WorldWideScience

Sample records for consanguineous pakistani families

  1. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  2. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  3. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  4. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  5. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  6. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  7. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  8. Addressing key issues in the consanguinity-related risk of autosomal recessive disorders in consanguineous communities: lessons from a qualitative study of British Pakistanis.

    Science.gov (United States)

    Darr, A; Small, N; Ahmad, W I U; Atkin, K; Corry, P; Modell, B

    2016-01-01

    Currently, there is no consensus regarding services required to help families with consanguineous marriages manage their increased genetic reproductive risk. Genetic services for communities with a preference for consanguineous marriage in the UK remain patchy, often poor. Receiving two disparate explanations of the cause of recessive disorders (cousin marriage and recessive inheritance) leads to confusion among families. Further, the realisation that couples in non-consanguineous relationships have affected children leads to mistrust of professional advice. British Pakistani families at-risk for recessive disorders lack an understanding of recessive disorders and their inheritance. Such an understanding is empowering and can be shared within the extended family to enable informed choice. In a three-site qualitative study of British Pakistanis, we explored family and health professional perspectives on recessively inherited conditions. Our findings suggest, firstly, that family networks hold strong potential for cascading genetic information, making the adoption of a family-centred approach an efficient strategy for this community. However, this is dependent on provision of high-quality and timely information from health care providers. Secondly, families' experience was of ill-coordinated and time-starved services, with few having access to specialist provision from Regional Genetics Services; these perspectives were consistent with health professionals' views of services. Thirdly, we confirm previous findings that genetic information is difficult to communicate and comprehend, further complicated by the need to communicate the relationship between cousin marriage and recessive disorders. A communication tool we developed and piloted is described and offered as a useful resource for communicating complex genetic information.

  9. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  10. Autozygosity mapping of a large consanguineous Pakistani family reveals a novel non-syndromic autosomal recessive mental retardation locus on 11p15-tel

    DEFF Research Database (Denmark)

    Rehman, Shoaib ur; Baig, Shahid Mahmood; Eiberg, Hans

    2011-01-01

    done in all sampled individuals in the family. The nuclear central loop in the five generation family showed homozygosity for a 6-Mb telomeric region on 11p15, whereas all other linkage regions were excluded by calculation of logarithm of odds (LOD) for the SNP microarray data. A maximum LOD score of Z......Autosomal recessive inherited mental retardation is an extremely heterogeneous disease and accounts for approximately 25% of all non-syndromic mental retardation cases. Autozygosity mapping of a large consanguineous Pakistani family revealed a novel locus for non-syndromic autosomal recessive...

  11. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  12. Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

    2017-10-26

    Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

  13. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  14. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  15. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  16. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  17. A novel HSF4 gene mutation (p.R405X causing autosomal recessive congenital cataracts in a large consanguineous family from Pakistan

    Directory of Open Access Journals (Sweden)

    Cheema Abdul

    2008-11-01

    Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.

  18. Potential social, economic and general health benefits of consanguineous marriage: results from the Born in Bradford cohort study.

    Science.gov (United States)

    Bhopal, Raj S; Petherick, Emily S; Wright, John; Small, Neil

    2014-10-01

    More than 1 billion people live in societies where consanguineous marriages are common. When children are born to consanguineous unions, there is an increased probability of the expression of single-gene disorders with a recessive mode of inheritance. There are presumptive social benefits of consanguineous marriages reported in the literature. The UK's Born in Bradford birth cohort study recruited 12 453 women at 26-28 weeks' gestation between 2007 and 2010. In all, 11 396 completed a questionnaire, including questions about their relationship to their baby's father. We compared Pakistani and Other ethnic groups in consanguineous relationships and Pakistani, Other and White British groups not in consanguineous relationships, calculating percentages and age-adjusted prevalence ratios (95% confidence intervals). In the Pakistani group, 59.3% of women (n = 3038) were blood relatives of their baby's father. Consanguinity was uncommon in the Other ethnic group (7.3%, n = 127) and rare (n = 5) in the White British group. Compared with non-consanguineous counterparts, mothers in consanguineous relationships were socially and economically disadvantaged (e.g. never employed, less likely to have higher education). The Pakistani consanguineous group's social, economic and health lifestyle circumstances were equivalent to, in some cases better than, women in non-consanguineous relationships (e.g. up-to-date in paying bills, or in disagreeing that they wished for more warmth in their marital relationship). The consanguineous relationship group had less separation/divorce. Rates of cigarette smoking during pregnancy were lower in mothers in consanguineous relationships. Debate about consanguinity should balance the potential protective effect of consanguineous relationships with established genetic risk of congenital anomaly in children. © The Author 2013. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

  19. Consanguinity and family clustering of male factor infertility in Lebanon.

    Science.gov (United States)

    Inhorn, Marcia C; Kobeissi, Loulou; Nassar, Zaher; Lakkis, Da'ad; Fakih, Michael H

    2009-04-01

    To investigate the influence of consanguineous marriage on male factor infertility in Lebanon, where rates of consanguineous marriage remain high (29.6% among Muslims, 16.5% among Christians). Clinic-based, case-control study, using reproductive history, risk factor interview, and laboratory-based semen analysis. Two IVF clinics in Beirut, Lebanon, during an 8-month period (January-August 2003). One hundred twenty infertile male patients and 100 fertile male controls, distinguished by semen analysis and reproductive history. None. Standard clinical semen analysis. The rates of consanguineous marriage were relatively high among the study sample. Patients (46%) were more likely than controls (37%) to report first-degree (parental) and second-degree (grandparental) consanguinity. The study demonstrated a clear pattern of family clustering of male factor infertility, with patients significantly more likely than controls to report infertility among close male relatives (odds ratio = 2.58). Men with azoospermia and severe oligospermia showed high rates of both consanguinity (50%) and family clustering (41%). Consanguineous marriage is a socially supported institution throughout the Muslim world, yet its relationship to infertility is poorly understood. This study demonstrated a significant association between consanguinity and family clustering of male factor infertility cases, suggesting a strong genetic component.

  20. Genetics of intellectual disability in consanguineous families.

    Science.gov (United States)

    Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Herwig, Ralf; Hosseini, Masoumeh; Oppitz, Cornelia; Abedini, Seyedeh Sedigheh; Suckow, Vanessa; Larti, Farzaneh; Beheshtian, Maryam; Lipkowitz, Bettina; Akhtarkhavari, Tara; Mehvari, Sepideh; Otto, Sabine; Mohseni, Marzieh; Arzhangi, Sanaz; Jamali, Payman; Mojahedi, Faezeh; Taghdiri, Maryam; Papari, Elaheh; Soltani Banavandi, Mohammad Javad; Akbari, Saeide; Tonekaboni, Seyed Hassan; Dehghani, Hossein; Ebrahimpour, Mohammad Reza; Bader, Ingrid; Davarnia, Behzad; Cohen, Monika; Khodaei, Hossein; Albrecht, Beate; Azimi, Sarah; Zirn, Birgit; Bastami, Milad; Wieczorek, Dagmar; Bahrami, Gholamreza; Keleman, Krystyna; Vahid, Leila Nouri; Tzschach, Andreas; Gärtner, Jutta; Gillessen-Kaesbach, Gabriele; Varaghchi, Jamileh Rezazadeh; Timmermann, Bernd; Pourfatemi, Fatemeh; Jankhah, Aria; Chen, Wei; Nikuei, Pooneh; Kalscheuer, Vera M; Oladnabi, Morteza; Wienker, Thomas F; Ropers, Hans-Hilger; Najmabadi, Hossein

    2018-01-04

    Autosomal recessive (AR) gene defects are the leading genetic cause of intellectual disability (ID) in countries with frequent parental consanguinity, which account for about 1/7th of the world population. Yet, compared to autosomal dominant de novo mutations, which are the predominant cause of ID in Western countries, the identification of AR-ID genes has lagged behind. Here, we report on whole exome and whole genome sequencing in 404 consanguineous predominantly Iranian families with two or more affected offspring. In 219 of these, we found likely causative variants, involving 77 known and 77 novel AR-ID (candidate) genes, 21 X-linked genes, as well as 9 genes previously implicated in diseases other than ID. This study, the largest of its kind published to date, illustrates that high-throughput DNA sequencing in consanguineous families is a superior strategy for elucidating the thousands of hitherto unknown gene defects underlying AR-ID, and it sheds light on their prevalence.

  1. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  2. Paternal asthma is a predictor for childhood asthma in the consanguineous families from the United Arab Emirates.

    Science.gov (United States)

    Joseph, Maries; Zoubeidi, Taoufik; Al-Dhaheri, Sherina M; Al-Dhaheri, Aysha Ahmed; Al-Dhaheri, Afra A; Al-Kaabi, Fatima M; Al-Muhairi, Shamma J; Joseph, Jose

    2009-03-01

    Consanguinity is known to increase the burden of genetic disorders among offspring. However, the effect of consanguinity on a complex disorder like childhood asthma has not been studied previously. Therefore, we explored this relationship by studying the asthma prevalence in children between 6 and 14 years of age among the local Arab families of the United Arab Emirates (UAE) where consanguinity is known to be highly prevalent. A total of 1136 children from 295 families met our inclusion criteria. The prevalence of childhood asthma was higher among children in consanguineous families (43.3%) compared to non-consanguineous (22.6%, p consanguinity and the number of asthmatic children per family (p = 0.0002). Girls from consanguineous families had proportionately more asthma (42.9%, p consanguineous families increased asthma risk for both boys and girls (p = 0.021 for boys, p consanguineous families. The significant asthma predictors for girls from the consanguineous families were the degree of consanguinity and paternal asthma. The only predictor for boys was paternal asthma. These interesting observations merit further studies on both larger samples and in other consanguineous communities for confirmation.

  3. Identification and in silico characterization of p.G380R substitution in FGFR3, associated with achondroplasia in a non-consanguineous Pakistani family.

    Science.gov (United States)

    Ajmal, Muhammad; Mir, Asif; Shoaib, Muhammad; Malik, Salman Akbar; Nasir, Muhammad

    2017-07-05

    The dimerization efficiency of FGFR3 transmembrane domain plays a critical role in the formation of a normal skeleton through the negative regulation of bone development. Recently, gain-of-function mutations in the transmembrane domain of FGFR3 has been described associated with an aberrant negative regulation, leading to the development of achondroplasia-group disorders, including achondroplasia (ACH), hypochondroplasia (HCH) and thanatophoric dysplasia (TD). Here, we describe a non-consanguineous Pakistani family with achondroplasia to explain hereditary basis of the disease. PCR-based linkage analysis using microsatellite markers was employed to localize the disease gene. Gene specific intronic primers were used to amplify the genomic DNA from all affected as well as phenotypically healthy individuals. Amplified PCR products were then subjected to Sanger sequencing and RFLP analysis to identify a potentially pathogenic mutation. The impact of identified mutation on FGFR3 protein's structure and stability was highlighted through different bioinformatics tools. Genetic screening of the family revealed a previously reported heterozygous c.1138 G > A (p.G380R) mutation in the coding exon 8 of FGFR3 gene. Identified genetic variation was confirmed in all affected individuals while healthy individuals and controls were found genotypically normal. The results were further validated by RFLP analysis as c.1138 G > A substitution generates a unique recognition site for SfcI endonuclease. Following SfcI digestion, the electrophoretic pattern of three bands/DNA fragments for each patient is indicative of heterozygous status of the disease allele. In silico studies of the mutant FGFR3 protein predicted to adversely affect the stability of FGFR3 protein. Mutation in the transmembrane domain may adversely affect the dimerization efficiency and overall stability of the FGFR3, leading to a constitutively active protein. As a result, an uncontrolled intracellular signaling

  4. Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

    OpenAIRE

    Shakari, Yasmine

    2013-01-01

    Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

  5. CLRN1 mutations cause nonsyndromic retinitis pigmentosa

    NARCIS (Netherlands)

    Khan, M.I.; Kersten, F.F.J.; Azam, M.; Collin, R.W.J.; Hussain, A.; Shah, S.T.; Keunen, J.E.E.; Kremer, J.M.J.; Cremers, F.P.M.; Qamar, R.; Hollander, A.I. den

    2011-01-01

    OBJECTIVE: To describe the mutations in the CLRN1 gene in patients from 2 consanguineous Pakistani families diagnosed with autosomal recessive retinitis pigmentosa (arRP). DESIGN: Case-series study. PARTICIPANTS: Affected and unaffected individuals of 2 consanguineous Pakistani families and 90

  6. Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

    Science.gov (United States)

    Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

    2016-01-01

    We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  7. A Family Study of Consanguinity in Children with Intellectual Disabilities in Barwani, India

    OpenAIRE

    Lakhan, Ram; Bipeta, Rajshekhar; Yerramilli, Srinivasa S. R. R.; Nahar, Vinayak K.

    2017-01-01

    Background: Intellectual disability (ID) can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. Objective: This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. Materials and Methods: This is a case series...

  8. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  9. Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

    Science.gov (United States)

    Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

    2015-05-01

    In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

  10. A Family Study of Consanguinity in Children with Intellectual Disabilities in Barwani, India.

    Science.gov (United States)

    Lakhan, Ram; Bipeta, Rajshekhar; Yerramilli, Srinivasa S R R; Nahar, Vinayak K

    2017-01-01

    Intellectual disability (ID) can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. This is a case series research design. Extreme or deviant case sampling was applied. Data were collected in homes, camps, and clinical settings in the Barwani district of Madhya Pradesh, India. The patterns of consanguineous marriages and the relationship between children with ID and their relatives with ID, epilepsy, and mental illness were analyzed and reported with pedigree charts. Multiple patterns of consanguineous marriages in tribal and nontribal populations were observed. ID was found to be associated in children with their relatives of the first, second, and third generations. ID may inherit in individuals from their relatives of the first, second, and third generations who have ID, epilepsy, or mental illness and married in the relationship. Appropriate knowledge, guidance, and counseling may be provided to potential couples before planning a consanguineous marriage.

  11. A Common Ancestral Mutation in CRYBB3 Identified in Multiple Consanguineous Families with Congenital Cataracts.

    Directory of Open Access Journals (Sweden)

    Xiaodong Jiao

    Full Text Available This study was performed to investigate the genetic determinants of autosomal recessive congenital cataracts in large consanguineous families.Affected individuals underwent a detailed ophthalmological examination and slit-lamp photographs of the cataractous lenses were obtained. An aliquot of blood was collected from all participating family members and genomic DNA was extracted from white blood cells. Initially, a genome-wide scan was performed with genomic DNAs of family PKCC025 followed by exclusion analysis of our familial cohort of congenital cataracts. Protein-coding exons of CRYBB1, CRYBB2, CRYBB3, and CRYBA4 were sequenced bidirectionally. A haplotype was constructed with SNPs flanking the causal mutation for affected individuals in all four families, while the probability that the four familial cases have a common founder was estimated using EM and CHM-based algorithms. The expression of Crybb3 in the developing murine lens was investigated using TaqMan assays.The clinical and ophthalmological examinations suggested that all affected individuals had nuclear cataracts. Genome-wide linkage analysis localized the causal phenotype in family PKCC025 to chromosome 22q with statistically significant two-point logarithm of odds (LOD scores. Subsequently, we localized three additional families, PKCC063, PKCC131, and PKCC168 to chromosome 22q. Bidirectional Sanger sequencing identified a missense variation: c.493G>C (p.Gly165Arg in CRYBB3 that segregated with the disease phenotype in all four familial cases. This variation was not found in ethnically matched control chromosomes, the NHLBI exome variant server, or the 1000 Genomes or dbSNP databases. Interestingly, all four families harbor a unique disease haplotype that strongly suggests a common founder of the causal mutation (p<1.64E-10. We observed expression of Crybb3 in the mouse lens as early as embryonic day 15 (E15, and expression remained relatively steady throughout development.Here, we

  12. A family study of consanguinity in children with intellectual disabilities in Barwani, India

    Directory of Open Access Journals (Sweden)

    Ram Lakhan

    2017-01-01

    Full Text Available Background: Intellectual disability (ID can be inherited in families through consanguineous marriage. The ID in an individual can be associated with the ID, epilepsy, and mental illness in their parents. Such connections can be seen more closely among consanguineous marriages in tribal and nontribal population in India. Objective: This study shows a few common patterns of the consanguineous relationship in the parents of children with ID in India. Materials and Methods: This is a case series research design. Extreme or deviant case sampling was applied. Data were collected in homes, camps, and clinical settings in the Barwani district of Madhya Pradesh, India. The patterns of consanguineous marriages and the relationship between children with ID and their relatives with ID, epilepsy, and mental illness were analyzed and reported with pedigree charts. Results: Multiple patterns of consanguineous marriages in tribal and nontribal populations were observed. ID was found to be associated in children with their relatives of the first, second, and third generations. Conclusion: ID may inherit in individuals from their relatives of the first, second, and third generations who have ID, epilepsy, or mental illness and married in the relationship. Appropriate knowledge, guidance, and counseling may be provided to potential couples before planning a consanguineous marriage.

  13. Homozygous missense mutation in the LMAN2L gene segregates with intellectual disability in a large consanguineous Pakistani family.

    Science.gov (United States)

    Rafiullah, Rafiullah; Aslamkhan, Muhammad; Paramasivam, Nagarajan; Thiel, Christian; Mustafa, Ghulam; Wiemann, Stefan; Schlesner, Matthias; Wade, Rebecca C; Rappold, Gudrun A; Berkel, Simone

    2016-02-01

    Intellectual disability (ID) is a neurodevelopmental disorder affecting 1%-3% of the population worldwide. It is characterised by high phenotypic and genetic heterogeneity and in most cases the underlying cause of the disorder is unknown. In our study we investigated a large consanguineous family from Baluchistan, Pakistan, comprising seven affected individuals with a severe form of autosomal recessive ID (ARID) and epilepsy, to elucidate a putative genetic cause. Whole exome sequencing (WES) of a trio, including a child with ID and epilepsy and its healthy parents that were part of this large family, revealed a homozygous missense variant p.R53Q in the lectin mannose-binding 2-like (LMAN2L) gene. This homozygous variant was co-segregating in the family with the phenotype of severe ID and infantile epilepsy; unaffected family members were heterozygous variant carriers. The variant was predicted to be pathogenic by five different in silico programmes and further three-dimensional structure modelling of the protein suggests that variant p.R53Q may impair protein-protein interaction. LMAN2L (OMIM: 609552) encodes for the lectin, mannose-binding 2-like protein which is a cargo receptor in the endoplasmic reticulum important for glycoprotein transport. Genome-wide association studies have identified an association of LMAN2L to different neuropsychiatric disorders. This is the first report linking LMAN2L to a phenotype of severe ARID and seizures, indicating that the deleterious homozygous p.R53Q variant very likely causes the disorder. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  14. Localization of A Novel Autosomal Recessive Non-Syndromic Hearing Impairment Locus (DFNB38) to 6q26–q27 in a Consanguineous Kindred from Pakistan

    OpenAIRE

    Ansar, Muhammad; Ramzan, Mohammad; Pham, Thanh L.; Yan, Kai; Jamal, Syed Muhammad; Haque, Sayedul; Ahmad, Wasim; Leal, Suzanne M.

    2003-01-01

    For autosomal recessive nonsyndromic hearing impairment over 30 loci have been mapped and 19 genes have been identified. DFNB38, a novel locus for autosomal recessive nonsyndromic hearing impairment, was localized in a consanguineous Pakistani kindred to 6q26–q27. The affected family members present with profound prelingual sensorineural hearing impairment and use sign language for communications. Linkage was established to microsatellite markers located on chromosome 6q26–q27 (Multipoint lod...

  15. Familial Recurrence of 3MC Syndrome in Consanguineous Families: A Clinical and Molecular Diagnostic Approach With Review of the Literature.

    Science.gov (United States)

    Gardner, Olivia K; Haynes, Karla; Schweitzer, Daniela; Johns, Alexis; Magee, William P; Urata, Mark M; Sanchez-Lara, Pedro A

    2017-11-01

    We report four individuals from two unrelated consanguineous families with 3MC syndrome. In the first family, chromosome microarray data revealed that the two affected sisters, born to first-cousin parents, shared a unique homozygous C-terminal deletion in the COLEC11 gene. Two affected brothers from a second family, also born to first-cousin parents, shared a region of homozygosity that included the second gene known to cause the 3MC syndrome, MASP1. We discuss the diagnostic approach of craniofacial disorders born to consanguineous parents and highlight a literature search and reference a helpful dysmorphology solution powered by FDNA (Facial Dysmorphology Novel Analysis) technology.

  16. CONSANGUINEOUS MARRIAGE IN JORDAN: AN UPDATE.

    Science.gov (United States)

    Islam, M Mazharul; Ababneh, Faisal M; Khan, Md Hasinur Rahaman

    2017-08-10

    This study examined the recent level, trends and determinants of consanguineous marriage in Jordan using time-series data from the Jordan Population and Family Health Surveys (JPFHSs). According to the 2012 JPFHS, 35% of all marriages were consanguineous in Jordan in 2012. There has been a declining trend in consanguinity in the country, with the rate decreasing from a level of 57% in 1990. Most consanguineous marriage in 2012 were first cousin marriages, constituting 23% of all marriages and 66% of all consanguineous marriages. The data show that women with a lower age at marriage, older marriage cohort, larger family size, less than secondary level of education, rural place of residence, no employment, no exposure to mass media, a monogamous marriage, a husband with less than higher level of education and lower economic status, and those from the Badia region, were more likely to have a consanguineous marriage. Increasing age at marriage, level of education, urbanization and knowledge about the health consequences of consanguinity, and the ongoing socioeconomic and demographic transition in the country, will be the driving forces for further decline in consanguinity in Jordan.

  17. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    Science.gov (United States)

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

  18. Molecular and clinical studies of X-linked deafness among Pakistani families.

    Science.gov (United States)

    Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

    2011-07-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

  19. A consanguineous family with Hirschsprung disease, microcephaly, and mental retardation (Goldberg-Shprintzen syndrome)

    NARCIS (Netherlands)

    Brooks, AS; Breuning, MH; Osinga, J; Van der Smagt, JJ; Catsman, CE; Buys, CHCM; Meijers, C; Hofstra, RMW

    Hirschsprung disease, mental retardation, microcephaly, and specific craniofacial dysmorphism were observed in three children from a large, consanguineous, Moroccan family. A fourth child showed similar clinical features, with the exception of Hirschsprung disease. The association of these

  20. Novel VPS13B Mutations in Three Large Pakistani Cohen Syndrome Families Suggests a Baloch Variant with Autistic-Like Features.

    Science.gov (United States)

    Rafiq, Muhammad Arshad; Leblond, Claire S; Saqib, Muhammad Arif Nadeem; Vincent, Akshita K; Ambalavanan, Amirthagowri; Khan, Falak Sher; Ayaz, Muhammad; Shaheen, Naseema; Spiegelman, Dan; Ali, Ghazanfar; Amin-ud-Din, Muhammad; Laurent, Sandra; Mahmood, Huda; Christian, Mehtab; Ali, Nadir; Fennell, Alanna; Nanjiani, Zohair; Egger, Gerald; Caron, Chantal; Waqas, Ahmed; Ayub, Muhammad; Rasheed, Saima; Forgeot d'Arc, Baudouin; Johnson, Amelie; So, Joyce; Brohi, Muhammad Qasim; Mottron, Laurent; Ansar, Muhammad; Vincent, John B; Xiong, Lan

    2015-06-25

    Cohen Syndrome (COH1) is a rare autosomal recessive disorder, principally identified by ocular, neural and muscular deficits. We identified three large consanguineous Pakistani families with intellectual disability and in some cases with autistic traits. Clinical assessments were performed in order to allow comparison of clinical features with other VPS13B mutations. Homozygosity mapping followed by whole exome sequencing and Sanger sequencing strategies were used to identify disease-related mutations. We identified two novel homozygous deletion mutations in VPS13B, firstly a 1 bp deletion, NM_017890.4:c.6879delT; p.Phe2293Leufs*24, and secondly a deletion of exons 37-40, which co-segregate with affected status. In addition to COH1-related traits, autistic features were reported in a number of family members, contrasting with the "friendly" demeanour often associated with COH1. The c.6879delT mutation is present in two families from different regions of the country, but both from the Baloch sub-ethnic group, and with a shared haplotype, indicating a founder effect among the Baloch population. We suspect that the c.6879delT mutation may be a common cause of COH1 and similar phenotypes among the Baloch population. Additionally, most of the individuals with the c.6879delT mutation in these two families also present with autistic like traits, and suggests that this variant may lead to a distinct autistic-like COH1 subgroup.

  1. MED23-associated Intellectual Disability in a Non-consanguineous Family

    OpenAIRE

    Trehan, Aditi; Brady, Jacqueline M.; Maduro, Valerie; Bone, William; Huang, Yan; Golas, Gretchen A.; Kane, Megan; Lee, Paul R.; Thurm, Audrey; Gropman, Andrea L.; Paul, Scott M.; Vezina, Gilbert; Markello, Thomas C.; Gahl, William A.; Boerkoel, Cornelius F.

    2015-01-01

    Intellectual disability (ID) is a heterogeneous condition arising from a variety of environmental and genetic factors. Among these causes are defects in transcriptional regulators. Herein, we report two brothers in a non-consanguineous family with novel compound heterozygous, disease-segregating mutations (NM_015979.3: [3656A>G];[4006C>T], NP_057063.2: [H1219R];[R1336X]) in MED23. This gene encodes a subunit of the Mediator complex that modulates the expression of RNA polymerase II-dependent ...

  2. Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

    Science.gov (United States)

    Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

    2013-01-01

    Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

  3. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    OpenAIRE

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

  4. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  5. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  6. Consanguineous Marriage and Marital Adjustment in Turkey.

    Science.gov (United States)

    Fisiloglu, Hurol

    2001-01-01

    Investigates the relationship between consanguineous marriage and marital adjustment in Turkey. The results of the study show that the consanguineous marriage group had significantly lower marital adjustment and had more conflict with extended family than the nonconsanguineous marriage group. The finding is discussed in the context of research and…

  7. Loss of function mutations in RP1 are responsible for retinitis pigmentosa in consanguineous familial cases

    Science.gov (United States)

    Kabir, Firoz; Ullah, Inayat; Ali, Shahbaz; Gottsch, Alexander D.H.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose This study was undertaken to identify causal mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous families. Methods Large consanguineous families were ascertained from the Punjab province of Pakistan. An ophthalmic examination consisting of a fundus evaluation and electroretinography (ERG) was completed, and small aliquots of blood were collected from all participating individuals. Genomic DNA was extracted from white blood cells, and a genome-wide linkage or a locus-specific exclusion analysis was completed with polymorphic short tandem repeats (STRs). Two-point logarithm of odds (LOD) scores were calculated, and all coding exons and exon–intron boundaries of RP1 were sequenced to identify the causal mutation. Results The ophthalmic examination showed that affected individuals in all families manifest cardinal symptoms of RP. Genome-wide scans localized the disease phenotype to chromosome 8q, a region harboring RP1, a gene previously implicated in the pathogenesis of RP. Sanger sequencing identified a homozygous single base deletion in exon 4: c.3697delT (p.S1233Pfs22*), a single base substitution in intron 3: c.787+1G>A (p.I263Nfs8*), a 2 bp duplication in exon 2: c.551_552dupTA (p.Q185Yfs4*) and an 11,117 bp deletion that removes all three coding exons of RP1. These variations segregated with the disease phenotype within the respective families and were not present in ethnically matched control samples. Conclusions These results strongly suggest that these mutations in RP1 are responsible for the retinal phenotype in affected individuals of all four consanguineous families. PMID:27307693

  8. MED23-associated intellectual disability in a non-consanguineous family.

    Science.gov (United States)

    Trehan, Aditi; Brady, Jacqueline M; Maduro, Valerie; Bone, William P; Huang, Yan; Golas, Gretchen A; Kane, Megan S; Lee, Paul R; Thurm, Audrey; Gropman, Andrea L; Paul, Scott M; Vezina, Gilbert; Markello, Thomas C; Gahl, William A; Boerkoel, Cornelius F; Tifft, Cynthia J

    2015-06-01

    Intellectual disability (ID) is a heterogeneous condition arising from a variety of environmental and genetic factors. Among these causes are defects in transcriptional regulators. Herein, we report on two brothers in a nonconsanguineous family with novel compound heterozygous, disease-segregating mutations (NM_015979.3: [3656A > G];[4006C > T], NP_057063.2: [H1219R];[R1336X]) in MED23. This gene encodes a subunit of the Mediator complex that modulates the expression of RNA polymerase II-dependent genes. These brothers, who had profound ID, spasticity, congenital heart disease, brain abnormalities, and atypical electroencephalography, represent the first case of MED23-associated ID in a non-consanguineous family. They also expand upon the clinical features previously reported for mutations in this gene. © 2015 Wiley Periodicals, Inc.

  9. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  10. Thalassemia major and consanguinity in Shiraz city, Iran.

    Science.gov (United States)

    Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

    2004-09-05

    Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

  11. In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

    Science.gov (United States)

    Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

    2013-09-24

    Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

  12. New MCM8 mutation associated with premature ovarian insufficiency and chromosomal instability in a highly consanguineous Tunisian family.

    Science.gov (United States)

    Bouali, Nouha; Francou, Bruno; Bouligand, Jérôme; Imanci, Dilek; Dimassi, Sarra; Tosca, Lucie; Zaouali, Monia; Mougou, Soumaya; Young, Jacques; Saad, Ali; Guiochon-Mantel, Anne

    2017-10-01

    To identify the gene(s) involved in the etiology of premature ovarian insufficiency in a highly consanguineous Tunisian family. Genetic analysis of a large consanguineous family with several affected siblings. University hospital-based cytogenetics and molecular genetics laboratories. A highly consanguineous Tunisian family with several affected siblings born to healthy second-degree cousins. None. Targeted exome sequencing was performed by next-generation sequencing for affected family members. Mutations were validated by Sanger sequencing. Functional experiments were performed to explore the deleterious effects of the identified mutation. DNA damage was induced by increasing mitomycin C (MMC) concentrations on cultured peripheral lymphocytes. Analysis of the next-generation sequencing data revealed a new homozygous missense mutation in the minichromosome maintenance 8 gene (MCM8).This homozygous mutation (c. 482A>C; p.His161Pro) was predicted to be deleterious and segregated with the disease in the family. MCM8 participates in homologous recombination during meiosis and DNA double-stranded break repair by dimerizing with MCM9. Mcm8 knock out results in an early block in follicle development and small gonads. Given this, we tested the chromosomal breakage repair capacity of homozygous and heterozygous MCM8 p.His161Pro mutation on cultured peripheral lymphocytes exposed to increasing MMC concentrations. We found that chromosomal breakage after MMC exposure was significantly higher in cells from homozygously affected individuals than in those from a healthy control. Our findings provide additional support to the view that MCM8 mutations are involved in the primary ovarian insufficiency phenotype. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Consanguinity and genetic disorders: Profile from Jordan

    International Nuclear Information System (INIS)

    Hamamy, Hanan A.; Ajlouni, Kamel M.; Masri, Amira T.; Al-Hadidy, Azmy M.

    2007-01-01

    With 20-30% of all marriages occurring between first cousins, increasing attention in Jordan is now given to role of consanguinity in the occurrence of genetic diseases. The objective of this study is to define the specific categories of genetic disorders associated with consanguineous marriages. Etiological categories and consanguinity rates were studied among 623 families with genetic syndromes, congenital anomalies or mental retardation, or both, seen at the National Center for Diabetes, Endocrinology and Genetics for the period August 2002 to August 2006. Comparisons were made for first cousin marriage rates in the study group and that for the general population. First cousin marriages constituted 69%, 22% and 41.7% of marriages among families with autosomal recessive conditions (group 1), dominant, X-linked and chromosomal conditions (group 2) and sporadic undiagnosed conditions (group 3) respectively. The differences in the rates of the first cousin matings were highly significant when comparing known figures in the general population with group 1 and 3, but not significant with group 2. Two messages to the public and health care personnel regarding consanguinity can be derived from this study. The first message is that among genetic disorders, only autosomal recessive disorders are strongly associated with consanguinity. The second message is that approximately 30% of sporadic undiagnosed cases of mental retardation, congenital anomalies and dimorphism may have an autosomal recessive etiology with risks of recurrence in future pregnancies. (author)

  14. Changing profile of couples seeking genetic counseling for consanguinity in Australia.

    Science.gov (United States)

    Port, Katrina E; Mountain, Helen; Nelson, John; Bittles, Alan H

    2005-01-15

    Consanguineous marriage is rare in most Western countries and, for example, in the USA it may be subject to regulation by both civil legislation and religious prescription. This is not the case in many regions of Asia and Africa where marriage within the family is strongly favored. Since the 1970s there has been widespread migration to North America, Western Europe, and Australasia from communities which encourage consanguineous marriage. To assess the effect of this trend on a genetic counseling program, the records of 302 couples referred to Genetic Services of Western Australia for consanguinity counseling were abstracted for the period 1975-2001. Overall, a family history of genetic disease or a previously affected child was reported in 28.8% of cases. Premarital or prepregnancy counseling on grounds of consanguinity was sought by 41.0% of couples, and a further 18.2% of consanguineous couples had been referred because of a consanguineous pregnancy. In 7.6% of cases a relationship closer than first cousin was involved. Through time there was a significant increase in the numbers of consanguineous consultants, and their patterns of religious affiliation and ethnic origin widened markedly. Although effectively excluded from entry to Australia prior to 1975, couples of Asian origin accounted for 25.5% of all consanguineous consultants. With ongoing migration, changes in the ethnic profiles and the specific counseling requirements of consanguineous couples can be expected to continue and probably accelerate.

  15. Localization of A Novel Autosomal Recessive Non-Syndromic Hearing Impairment Locus (DFNB38) to 6q26–q27 in a Consanguineous Kindred from Pakistan

    Science.gov (United States)

    Ansar, Muhammad; Ramzan, Mohammad; Pham, Thanh L.; Yan, Kai; Jamal, Syed Muhammad; Haque, Sayedul; Ahmad, Wasim; Leal, Suzanne M.

    2010-01-01

    For autosomal recessive nonsyndromic hearing impairment over 30 loci have been mapped and 19 genes have been identified. DFNB38, a novel locus for autosomal recessive nonsyndromic hearing impairment, was localized in a consanguineous Pakistani kindred to 6q26–q27. The affected family members present with profound prelingual sensorineural hearing impairment and use sign language for communications. Linkage was established to microsatellite markers located on chromosome 6q26–q27 (Multipoint lod score 3.6). The genetic region for DFNB38 spans 10.1 cM according to the Marshfield genetic map and is bounded by markers D6S980 and D6S1719. This genetic region corresponds to 3.4 MB on the sequence-based physical map. PMID:12890929

  16. RESEARCH NOTE Molecular genetic analysis of consanguineous ...

    Indian Academy of Sciences (India)

    Navya

    Molecular genetic analysis of consanguineous families with primary microcephaly ... Translational Research Institute, Academic Health System, Hamad Medical ..... bridging the gap between homozygosity mapping and deep sequencing.

  17. Congenital abnormalities in newborns of consanguineous and nonconsanguineous parents.

    Science.gov (United States)

    Naderi, S

    1979-02-01

    The aim of this study was to determine the types, patterns, and frequencies of congenital anomalies among newborns of both consanguineous and nonconsanguineous parents in southern Iran. From 9526 consecutive pregnancies observed, 9623 newborns resulted (9431 singleton and 95 sets of multiple gestation). There were 7261 newborns from nonconsanguineous parents and 2362 (24.5%) babies from consanguineous marriages. Of the total pregnancies, 1.54% resulted in malformed children (1.53% of singleton and 2.1% of multiple gestations). The incidence of congenital abnormalities in newborns of nonconsanguineous parents was 1.66% as compared to 4.02% for newborns of the consanguineous group. Major and multiple malformations were found to be slightly more common in the consanguinous group. Prematurity, prenatal mortality rate, and congenital abnormalities were more common in the consanguineous group. Probably the closer the familial relationship of the parents, the greater the chances of congenital abnormalities.

  18. The changing pattern and determinants of declining consanguinity in Jordan during 1990-2012.

    Science.gov (United States)

    Islam, M Mazharul

    2018-03-01

    Consanguinity is a deep rooted cultural trait in Jordan. To examine the patterns and determinants of declining rates of consanguineous marriage in Jordan during 1990-2012 in the context of the changing pattern of socio-economic and demographic conditions. The data come from the 1990 and 2012 Jordan Population and Family Health Surveys (JPFHSs). A total of 6461 women in 1990 and 11,352 women in 2012 were successfully interviewed. Descriptive and multivariate statistical techniques were used for data analysis. Consanguinity was found to be widely practiced (35% in 2012) until recent times in Jordan. However, there has been a secular declining trend over the last few decades as the practice of consanguinity has declined from 56% in 1990 to 35% in 2012. Increasing age at marriage and female education, higher level of education of husbands, declining family size, increasing rate of urbanisation and female employment, exposure to mass media and higher economic status appeared as significant predictors of declining consanguinity in Jordan. The findings of this study support Goode's hypothesis of a decrease of consanguinity with modernisation. Although consanguinity is a deeply rooted cultural trend in Jordan, it is gradually losing ground due to modernisation and socio-demographic transition of the country.

  19. Epilepsy and consanguinity in Shiraz, Iran.

    Science.gov (United States)

    Asadi-Pooya, Ali Akbar

    2005-01-01

    The importance of consanguinity and its association with epilepsy has been suggested in some studies, but in one study the risk contributed to consanguinity for childhood epilepsy was not significanta. In the present study, there was an attempt to determine if consanguinity has any important association with epilepsy. All the epileptic children and adolescents up to the age of 18 years, who had been referred to Motahary Clinic in Shiraz, Iran, during a six-month period, were included in this cross-sectional study. The percentage of consanguinity in parents of the epileptic patients was compared to a sample of the general population in the same geographical area. In total, 181 unrelated epileptic children were included in this study. The mean age of these children was 7+/-4.6 years. The male/female ratio in these patients was 1.29. Overall, 61(33.7%) of the parents were first cousins (OR=2.264, 95%-CI: 1.618-3.169 in comparison to the general population), 37 (20.4%) were second cousins (OR=3.557, 95%-CI: 2.389-5.296), and 83 (45.9%) were not related. The percentage of consanguinity in parents of the epileptic patients was significantly higher in comparison to a sample of the general population (OR=2.612, 95%-CI: 1.929-3.536, Pmarriages (at least by 2.2 folds), as well as pre-marriage counseling for couples who have a family history of epilepsy are necessary as an effective preventive program.

  20. The frequency of consanguineous marriage in eastern Turkey.

    Science.gov (United States)

    Akbayram, S; Sari, N; Akgün, C; Doğan, M; Tuncer, O; Caksen, H; Oner, A F

    2009-01-01

    The frequency of consanguineous marriage in Eastern Turkey: The rate of consanguineous marriage (CM) varies depended on different factors such as race, characteristics of population, and religion and moral features in different countries. Gene frequency and genetic structure are changed by CMs. The aim of the present study is to assess the prevalence of CM and its effects on miscarriage, stillbirth, congenital malformation and ratio of newborn death. This study was performed in Van region, Eastern Turkey, between September 2005 and April 2006. A total of 650 families from 24 districts chosen in accordance with the number of inhabitants were included in this study. First cousin marriages were accepted as a first degree CMs, sesquialter and second cousin marriages as second degree and marriages between distant relatives were accepted as a third degree CM. Monthly income of the families was classified in accordance with minimum wage determined by government. Of all families, 224 (34.4%) had CM, and 168 (75%) had first-degree consanguinity. A lower CM rate was found in mothers who graduated from secondary school or upgrading (p relationship was found between CM and fathers' education level. While a low CM rate was found in families who had two or less children (p < 0.01), high rate was observed in families who had five or more children. In addition, a high rate of miscarriage, stillbirth and mental-motor retardation was found in families with CM (p < 0.05). The rate of child mortality between the aged 0-2 years was found to be higher in families with CM (p < 0.01). The higher CM rate was observed in families who married due to pressure or insistence of their families than married voluntarily (p < 0.05). Our study showed that CM rate was very high, 34.4%, in our region Eastern Turkey.

  1. Search for consanguinity within and among families of patients with trichothiodystrophy associated with xeroderma pigmentosum.

    Science.gov (United States)

    Nuzzo, F; Zei, G; Stefanini, M; Colognola, R; Santachiara, A S; Lagomarsini, P; Marinoni, S; Salvaneschi, L

    1990-01-01

    The association of two rare hereditary disorders, trichothiodystrophy (TTD) and xeroderma pigmentosum (XP), was found in four patients from three families, apparently unrelated but living in the same geographical area. In order to test the hypothesis of a common ancestor, consanguinity within and among the families was checked using three different approaches: reconstruction of genealogical trees, typing of blood markers, and surname analysis. The results of the three types of analyses strengthen the hypothesis that, in at least two out of the three families, the genetic defect determining the TTD/XP phenotype is identical by descent, as a consequence of remote inbreeding. This implies that if two mutations are responsible for the two diseases they are at linked loci or affect the same gene. PMID:2308151

  2. A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

    NARCIS (Netherlands)

    Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

    2014-01-01

    With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

  3. [Spectrum of congenital malformations observed in neonates of consanguineous parents].

    Science.gov (United States)

    Pinto Escalante, D; Castillo Zapata, I; Ruiz Allec, D; Ceballos Quintal, J M

    2006-01-01

    Consanguineous unions occur in all populations around the world. Couples related as second cousins or closer have been observed with deleterious effect. Among the clinical effects of parental consanguinity, the incidence of offspring with congenital malformations (CM) increases approximately two-fold. A hospital database of neonates with CM was searched to select neonates with parental consanguinity and two control groups. One control group consisted of healthy neonates and the other control group consisted of neonates with CM but without parental consanguinity. Both control groups consisted of the first neonate of the same sex to be born after a consanguineous neonate with CM. Family, sociodemographic and anthropometric variables, as well as the severity of the malformations, were compared between the two groups with CM. Neonates with CM were grouped into five categories: Major multiple CM, minor multiple CM, isolated major CM, isolated minor CM, and specific diseases. The indigenous Mayan subpopulation was also analyzed. Among 1117 neonates with CM, parental consanguinity was found in 21. Parental consanguinity was also found in 8 neonates in the group of healthy controls (OR 2.4 [1.05-5.95]). The most common form of consanguinity was between second cousins and was more frequent in the Mayan subpopulation. Major multiple CM were more frequent among consanguineous than among nonconsanguineous couples. No association was found between the severity of CM and the degree of relationship. The prevalence of consanguinity found in neonates with CM and healthy controls (1.9 % and 0.8 %) was similar to that found in other Latin populations. A higher prevalence was found in the Mayan population. Mayor multiple CM were more frequent among the neonates of consanguineous than among nonconsanguineous couples.

  4. Prevalence and Pattern of Consanguineous Marriages Among Different Communities in Mangalore

    Directory of Open Access Journals (Sweden)

    Bhagya Bhaskar

    2013-01-01

    Full Text Available Introduction: Consanguineous marriages are a common practice in the Middle East, Asian and African populations. Many studies have stated an association between first cousin marriages and the incidence of autosomal recessive diseases and congenital malformations. High frequency of consanguinity is reported by researchers among South India. The objectives of this study were to determine the prevalence and type of consanguineous marriages among the different communities of Mangalore. Methods: This study was conducted on 1164 married women in Mangalore to investigate the prevalence and type of consanguineous marriages. All the women were interviewed personally using a structured questionnaire. Family pedigree was constructed to study the type of consanguineous marriages. Data analysis was done by SPSS Win 13.0. Results: A low percentage of consanguinity (6.53% was observed with a mean inbreeding coefficient of 0.0339. Frequency of consanguinity between religions was highly significant. Of these the most frequent were first cousin marriages (43.42%. Within Hindu religion the highest rate of consanguinity was among the Billavas (47.62% of which the most frequent were distant relative marriages (75% followed by second cousin marriages (57.14%. There was no significant difference in the frequency distribution of the types of consanguinity between the religions and also between the different groups among Hindus. Conclusion: The frequency of consanguinity was found to be low in Mangalore. The findings contradict with the earlier reports of high prevalence of consanguineous marriages in South India. Increased female education, increased socio-economic status and decrease in parental decisions in marriages may be the reasons.

  5. [Analysis of clinical phenotype and mode of inheritance in retinitis pigmentosa patients with consanguineous marriage].

    Science.gov (United States)

    Rong, Wei-ning; Sheng, Xun-lun; Liu, Ya-ni

    2012-10-01

    To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal

  6. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    Science.gov (United States)

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  7. Consanguinity and primary immunodeficiencies.

    Science.gov (United States)

    Al-Herz, Waleed; Aldhekri, Hasan; Barbouche, Mohamed-Ridha; Rezaei, Nima

    2014-01-01

    Primary immunodeficiencies (PIDs) are a heterogeneous group of genetic disorders caused by defects in the immune system that predispose patients to infections, autoimmune diseases, lymphoproliferation and malignancies. Most PIDs are inherited in an autosomal recessive pattern; therefore, they are more common in areas with high rates of consanguineous marriage. Reports about PIDs from these areas have demonstrated a peculiar prevalence of more severe forms of diseases compared to other regions, and patients born to consanguineous parents have increased rates of morbidity and mortality compared to other patients. Individuals at high risk of having a child with a PID who wish to have a healthy child have limited options, these include prenatal diagnosis and pre-implantation genetic diagnosis. However, these options require a collaborative team of specialists and may not always be implemented due to geographic, religious, financial or social factors. The recent introduction of newborn-screening programs for a number of T and B lymphocyte deficiencies will facilitate early diagnosis and therapeutic interventions, which may include hematopoietic stem cell transplantation and intravenous immunoglobulin treatment. There is a need for the implementation of strategies to increase public awareness of the health risks associated with consanguineous marriage. It should be stressed that genetic counseling should be an important component of the care of patients with PIDs as well as their families. © 2014 S. Karger AG, Basel.

  8. THE CAUSAL RELATIONSHIP BETWEEN CONSANGUINEOUS MARRIAGES AND INFANT MORTALITY IN TURKEY.

    Science.gov (United States)

    Koç, İsmet; Eryurt, Mehmet Alİ

    2017-07-01

    Turkey has high levels of infant mortality and consanguineous marriages. It has had a high level of infant mortality for its economic level for many years. Over recent decades, although adult mortality rates have not been very different from those of other countries with similar socioeconomic structures, its life expectancy at birth has remained low due to its high infant mortality rate. This has been called the Turkish Puzzle. According to the Turkey Family Structure and Population Issues Survey, 27% of women had a consanguineous marriage in 1968. Subsequent Turkish Demographic and Health Surveys (TDHSs) found the rate of consanguineous marriages to be stagnated at 22-24%, with a resistance to reduction. According to the TDHS-2008, 24% of women had a consanguineous marriage. Numerous studies in various countries of the world have indicated that consanguineous marriages, particularly of first-degree, have the effect of increasing infant mortality. The main aim of this study was to assess the causal impact of consanguineous, particularly first-degree consanguineous, marriages on infant mortality, controlling for individual, cultural, bio-demographic and environmental factors. Data were merged from four Turkish DHS data sets (1993, 1998, 2003 and 2008). Multivariate analysis revealed that first-degree consanguineous marriages have increased infant mortality by 45% in Turkey: 57% in urban areas and 39% in rural areas. The results indicate that there is a causal relationship between consanguineous marriages and infant mortality. This finding should be taken into account when planning policies to reduce infant mortality in Turkey, and in other countries with high rates of consanguineous marriage and infant mortality.

  9. Prevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran

    Directory of Open Access Journals (Sweden)

    Shahrooz Nemati

    2012-06-01

    Full Text Available Background and Aim: Having healthy non-handicapped children plays a major role in mental health of the family and decreases family and society's costs. While consanguineous marriage could lead to expression of recessive genes and a variety of handicaps including deafness, the aim of present study was to scrutinize the prevalence of consanguineous marriage among parents of deaf and normal children as well as its relationship with deafness.Methods: In this study, 467 couples parenting normal children were selected by cluster sampling from elementary, guidance and high schools of Ardabil city and 423 couples parenting disabled children were selected non-randomly among which 130 had deaf children. Descriptive statistics was used to determine the prevalence of consanguineous marriage and chi-square test to compare prevalence of consanguineous marriage among parents of normal and deaf children.Results: Descriptive analyses showed that 80 out of 130 (61.54% parents who had deaf children have had consanguineous marriage. Furthermore data analysis demonstrated that prevalence of consanguineous marriage was significantly higher among parents of deaf children (p<0.001.Conclusion: Consanguineous marriage plays a major role in expression of recessive genes and could lead to development of various handicaps including deafness. Increasing couples' awareness about consequences of consanguineous marriage and conducting genetic counseling are indispensable.

  10. Consanguineous marriage in Oman: understanding the community awareness about congenital effects of and attitude towards consanguineous marriage.

    Science.gov (United States)

    Mazharul Islam, M

    2017-05-01

    Although consanguinity is widely practiced in Oman, the attitude of community towards consanguinity and the awareness of its health consequences to offspring remain largely unexplored. To analyse the levels and trends of consanguineous marriage and examine community awareness about congenital anomaly associated with consanguinity and attitude towards consanguinity in Oman. The data come from a nationally representative survey on Omani adults of age 18 years and above, irrespective of their marital status. Data were analysed using both descriptive and multivariate statistical techniques. The survey results indicate a very high rate (49%) of consanguineous marriage in Oman. There is a declining trend in consanguinity which may be attributed to decline in first cousin marriage. Omani adults have moderately high knowledge (69%) about health consequences of consanguineous marriage. There is a high positive attitude towards consanguineous marriage (75%) which appeared as a significant predictor of current practice of consanguineous marriage in Oman. The positive attitude of the Omani community towards consanguinity outweighs the negative health consequences of consanguinity, and the practice is likely to remain high in the near future. Strong educational and motivational programmes are needed to bring further changes in attitude towards consanguinity and, thus, reduce the burden of congenital anomalies associated with consanguinity in Oman.

  11. Consanguineous Marriage Among the Parents of Hearing Impaired Students in Baghcheban Primary Schools

    Directory of Open Access Journals (Sweden)

    Mansoureh Nikbakht

    2005-06-01

    Full Text Available Objective: Genetic studies show that consanguineous marriage can increase the probability of incidence of genetic impairments such as hearing impairments. The target of this study is to identify the prevalence of consanguinity among the parents of hearing impaired students in primary schools. Materials and Methods: We selected all of deaf students of Tehran (614 students. Their mothers answered to questionnaires. The questions were about Risk Factors of deafness in mother pregnancy or in neonatal period. Results: from 614 students, 389 parents of them (64% had consanguineous marriage and 223 person (36% didn’t have this factor. 2 person did not answer to this question. In this study we observed that there is 32.3% family history of hearing loss, 29.2%deaf sister and brother, 17% ear infection history. Other risk factors were studied too. Also there is significant correlation between consanguinity and more than one deaf children in the family (p<0.005. Conclusion: According to high incidence of consanguinity (64%that was observed in this study it may be one of most important causes of sensory neural hearing loss in children, so we should give enough information about this problem to the people.

  12. Mutations in ALDH1A3 represent a frequent cause of microphthalmia/anophthalmia in consanguineous families.

    Science.gov (United States)

    Abouzeid, Hana; Favez, Tatiana; Schmid, Angélique; Agosti, Céline; Youssef, Mohammed; Marzouk, Iman; El Shakankiry, Nihal; Bayoumi, Nader; Munier, Francis L; Schorderet, Daniel F

    2014-08-01

    Anophthalmia or microphthalmia (A/M), characterized by absent or small eye, can be unilateral or bilateral and represent developmental anomalies due to the mutations in several genes. Recently, mutations in aldehyde dehydrogenase family 1, member A3 (ALDH1A3) also known as retinaldehyde dehydrogenase 3, have been reported to cause A/M. Here, we screened a cohort of 75 patients with A/M and showed that mutations in ALDH1A3 occurred in six families. Based on this series, we estimate that mutations in ALDH1A3 represent a major cause of A/M in consanguineous families, and may be responsible for approximately 10% of the cases. Screening of this gene should be performed in a first line of investigation, together with SOX2. © 2014 WILEY PERIODICALS, INC.

  13. Consanguinity and isolated atrial septal defect in North East of Iran.

    Science.gov (United States)

    Moghaddam, Hasan Mottaghi; Esfehani, Reza Jafarzadeh; Panah, Nader Yazdan; Esfehani, Ali Jafarzadeh

    2014-01-01

    The rate of consanguineous marriage is high in Middle Eastern countries such as Iran. The relationship between consanguineous marriage and congenital heart disease is discussed in some studies, but there is not much data for relationship between atrial septal defect (ASD) and consanguineous marriage. The aim of this study was to evaluate the relationship between consanguineous marriage and ASD echocardiographic characteristics. This was a cross-sectional study approved by Mashhad University of Medical Sciences ethics committee and took place in Mashhad, Iran, for a period of 3 years from August 2008 till September 2011. In this cross-sectional study, 113 ASD patients participated and they were categorized into 3 groups on the basis of family relationship between their parents: first group-"no relationship," second group- "third degree relationship," and third group- "far relationship." Among the 54 male and 59 female ASD patients, the most prevalent type of ASD was ASD secundum (85.0%) followed by sinus venosus (8.8%). A total of 56% patients were present in the first group and 15% and 29% in the second group and the third group, respectively." The relationship between consanguinity and type of ASD (P relationship between the age of onset of disease and consanguinity (P=.003) was also observed. Considering the fact that there is a high prevalence of ASD and consanguineous marriage in Iran and bearing in mind the results of the present study, we recommend educating couples about the outcomes of consanguineous marriage in pre-marriage counseling.

  14. APOA5 Q97X Mutation Identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family

    Directory of Open Access Journals (Sweden)

    Dussaillant Catalina

    2012-11-01

    Full Text Available Abstract Background Severe hypertriglyceridemia (HTG has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. Methods We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel. Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. Results A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. Conclusion The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family.

  15. APOA5 Q97X mutation identified through homozygosity mapping causes severe hypertriglyceridemia in a Chilean consanguineous family.

    Science.gov (United States)

    Dussaillant, Catalina; Serrano, Valentina; Maiz, Alberto; Eyheramendy, Susana; Cataldo, Luis Rodrigo; Chavez, Matías; Smalley, Susan V; Fuentes, Marcela; Rigotti, Attilio; Rubio, Lorena; Lagos, Carlos F; Martinez, José Alfredo; Santos, José Luis

    2012-11-15

    Severe hypertriglyceridemia (HTG) has been linked to defects in LPL, APOC2, APOA5, LMF1 and GBIHBP1 genes. However, a number of severe HTG cases are probably caused by as yet unidentified mutations. Very high triglyceride plasma levels (>112 mmol/L at diagnosis) were found in two sisters of a Chilean consanguineous family, which is strongly suggestive of a recessive highly penetrant mutation. The aim of this study was to determine the genetic locus responsible for the severe HTG in this family. We carried out a genome-wide linkage study with nearly 300,000 biallelic markers (Illumina Human CytoSNP-12 panel). Using the homozygosity mapping strategy, we searched for chromosome regions with excess of homozygous genotypes in the affected cases compared to non-affected relatives. A large homozygous segment was found in the long arm of chromosome 11, with more than 2,500 consecutive homozygous SNP shared by the proband with her affected sister, and containing the APOA5/A4/C3/A1 cluster. Direct sequencing of the APOA5 gene revealed a known homozygous nonsense Q97X mutation (p.Gln97Ter) found in both affected sisters but not in non-affected relatives nor in a sample of unrelated controls. The Q97X mutation of the APOA5 gene in homozygous status is responsible for the severe hypertriglyceridemia in this family. We have shown that homozygosity mapping correctly pinpointed the genomic region containing the gene responsible for severe hypertriglyceridemia in this consanguineous Chilean family.

  16. Junctional epidermolysis bullosa in the Middle East: clinical and genetic studies in a series of consanguineous families.

    Science.gov (United States)

    Nakano, Aoi; Lestringant, Gilles G; Paperna, Tamar; Bergman, Reuven; Gershoni, Ruth; Frossard, Philippe; Kanaan, Moien; Meneguzzi, Guerrino; Richard, Gabriele; Pfendner, Ellen; Uitto, Jouni; Pulkkinen, Leena; Sprecher, Eli

    2002-04-01

    Junctional epidermolysis bullosa (JEB) is a group of inherited blistering diseases characterized by epidermal-dermal separation resulting from mutations that affect the function of critical components of the basement membrane zone. This group of autosomal recessive diseases is especially prevalent in regions where consanguinity is common, such as the Middle East. However, the clinical and genetic epidemiology of JEB in this region remains largely unexplored. The aim of the present study was to assess a series of consanguineous JEB families originating from the Middle East. We identified 7 families referred to us between 1998 and 1999 and originating from the United Arab Emirates, Saudi Arabia, Sudan, Yemen, and Israel. Histologic, immunofluorescence, and electron microscopy studies were performed to direct the subsequent molecular analysis. DNA obtained from all family members was amplified by means of polymerase chain reaction and analyzed by conformation-sensitive gel electrophoresis with subsequent direct sequencing. In 6 families presenting with the clinical and histologic features distinctive for JEB, mutations in genes encoding 1 of the 3 subunit polypeptides of laminin-5 were identified. Two families each had mutations in LAMB3, 2 in LAMA3, and 2 in LAMC2. Out of 7 distinct mutations, 5 were novel and 2 were recurrent. No relationship was found between the presence of nonsense/frameshift mutations in laminin-5 genes and perinatal mortality, contradicting a major genotype-phenotype correlation previously reported in the European and US literature. Similarly, none of the recurrent LAMB3 hot spot mutations previously described in other populations was found in our series. Finally, in a family with the clinical diagnosis of generalized atrophic benign epidermolysis bullosa, a homozygous non-sense mutation in Col17A1 gene (encoding the BPAG2 antigen) was identified. The present report suggests (1) the existence of a unique spectrum of mutations in the Middle East

  17. Consanguinity, endogamy and inborn errors of metabolism in Oman: a cross-sectional study.

    Science.gov (United States)

    Al-Thihli, Khalid; Al-Murshedi, Fathiya; Al-Hashmi, Nadia; Al-Mamari, Watfa; Islam, M Mazharul; Al-Yahyaee, Said A

    2014-01-01

    The Sultanate of Oman, like many other Arab countries, has relatively high rates of consanguinity. Reports suggest that the incidence of inborn errors of metabolism (IEM) is also high in Oman. This retrospective cross-sectional study was designed to evaluate the number of patients with IEM being followed at the only two tertiary centers in Oman treating such patients, and to calculate the consanguinity rates among these families. The electronic medical records of all patients were reviewed for demographic and clinical characteristics. A total of 285 patients with IEM were being followed at the 2 centers involved; 162 (56.8%) were male and 123 (43.2%) were female. The history of consanguinity was documented or available for 241 patients: 229 patients (95%) were born to consanguineous parents related as second cousins or closer. First-cousin marriages were reported in 191 families (79.3%), while 31 patients (12.9%) were born to second cousins. The parents of 5 patients (2%) were related as double first cousins, and 2 patients (1%) were born to first cousins once removed. The average coefficient of inbreeding (F) in our study was 0.081. Seventeen patients (6%) had associated comorbid conditions other than IEM. Our study highlights the clinical burden of IEM in Oman and emphasizes the high consanguinity rates among the parents of affected patients. © 2014 S. Karger AG, Basel

  18. Social structure and consanguinity in a French mountain Population (1550-1849).

    Science.gov (United States)

    Rabino-Massa, Emma; Prost, Michel; Boëtsch, Gilles

    2005-04-01

    Sociocultural factors play a crucial role in the variation of consanguinity in a population. The choice of specific matrimonial strategies can favor the closure or opening of the group to the outside, whereas differential fertility affects the gene flow from one generation to another. In the present study we analyzed the role of socioprofessional groups in the maintenance of endogamy and consanguinity in a French Alpine valley: Vallouise in the Briançon area. In mountain environments, where the reproductive space is limited and quickly saturated, the autochthonous families adopt diversified matrimonial strategies. These marriage practices tend to prevent fragmentation of agricultural property. We analyzed the matrimonial behavior in the two main social groups of this population (décideurs and farmers) from 1550 to 1849. To better understand the behavior of the two social groups, we considered the two components of consanguinity, close and distant. Our study showed that the two groups had similar behavior regarding consanguinity. The way to prevent fragmentation of the patrimony was to choose a consanguineous spouse. This type of strategy inevitably leads to a high percentage of endogamy, which in this region of the Alps exceeded 90% through many centuries.

  19. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Genetic analysis of a consanguineous Pakistani family with Leber congenital amaurosis identifies a novel mutation in GUCY2D gene. Muzammil Ahmad Khan Verena Rupp Muhammad Ayaz Khan Muhammad Pervaiz Khan Muhammad Ansar Christian Windpassinger. Research Note Volume 93 Issue 2 August 2014 pp ...

  20. Consanguinity and reproductive health among Arabs

    Directory of Open Access Journals (Sweden)

    Al Ali Mahmoud T

    2009-10-01

    Full Text Available Abstract Consanguineous marriages have been practiced since the early existence of modern humans. Until now consanguinity is widely practiced in several global communities with variable rates depending on religion, culture, and geography. Arab populations have a long tradition of consanguinity due to socio-cultural factors. Many Arab countries display some of the highest rates of consanguineous marriages in the world, and specifically first cousin marriages which may reach 25-30% of all marriages. In some countries like Qatar, Yemen, and UAE, consanguinity rates are increasing in the current generation. Research among Arabs and worldwide has indicated that consanguinity could have an effect on some reproductive health parameters such as postnatal mortality and rates of congenital malformations. The association of consanguinity with other reproductive health parameters, such as fertility and fetal wastage, is controversial. The main impact of consanguinity, however, is an increase in the rate of homozygotes for autosomal recessive genetic disorders. Worldwide, known dominant disorders are more numerous than known recessive disorders. However, data on genetic disorders in Arab populations as extracted from the Catalogue of Transmission Genetics in Arabs (CTGA database indicate a relative abundance of recessive disorders in the region that is clearly associated with the practice of consanguinity.

  1. Prevalence of consanguineous marriage among parents of deaf and normal children in Ardabil, North Western Iran

    OpenAIRE

    Shahrooz Nemati; Gholam Ali Afrooz; Ali Asgari; Bagher Ghobari Bonab

    2012-01-01

    Background and Aim: Having healthy non-handicapped children plays a major role in mental health of the family and decreases family and society's costs. While consanguineous marriage could lead to expression of recessive genes and a variety of handicaps including deafness, the aim of present study was to scrutinize the prevalence of consanguineous marriage among parents of deaf and normal children as well as its relationship with deafness.Methods: In this study, 467 couples parenting normal ch...

  2. Consanguinity in Lebanon: prevalence, distribution and determinants.

    Science.gov (United States)

    Barbour, Bernadette; Salameh, Pascale

    2009-07-01

    The union of individuals with a common ancestor may lead to serious health consequences in their offspring. Consanguinity is high in Middle Eastern communities; it was around 26% in 1988. The objective of this study was to determine the prevalence of consanguinity in Beirut and other Lebanese regions, and its associated factors in different subgroups. The cross-sectional study was performed on a convenience sample of married women in Lebanon. The women were administered a standardized questionnaire in a face-to-face interview by independent enquirers. Among 1556 women, the overall prevalence of consanguineous marriages was 35.5%, and the consanguinity coefficient was 0.020; 968 marriages (62.2%) were not consanguineous, 492 (31.6%) were first cousin, 61 (3.9%) were second cousin and 36 (2.3%) had lower degrees of consanguinity. Beirut suburb dwelling, low education subgroups, women working in the home and non-Christian religion presented the highest rates of consanguinity (pwomen thinking that consanguinity would not lead to serious diseases. Consanguinity is therefore still a prevailing problem in Lebanon. Specific health education, and genetic counselling in particular, are suggested to explain the consequences of consanguinity to the general population and to help couples make informed choices.

  3. British-Pakistani women's perspectives of diabetes self-management: the role of identity.

    Science.gov (United States)

    Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

    2015-09-01

    To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

  4. A missense mutation in the CRBN gene that segregates with intellectual disability and self-mutilating behaviour in a consanguineous Saudi family.

    Science.gov (United States)

    Sheereen, Atia; Alaamery, Manal; Bawazeer, Shahad; Al Yafee, Yusra; Massadeh, Salam; Eyaid, Wafaa

    2017-04-01

    Autosomal-recessive non-syndromic intellectual disability (ARNS-ID) is an aetiologically heterogeneous disorder. Although little is known about the function of human cereblon (CRBN), its relationship to mild cognitive deficits suggests that it is involved in the basic processes of human memory and learning. We aim to identify the genetic cause of intellectual disability and self-mutilation in a consanguineous Saudi family with five affected members. Clinical whole-exome sequencing was performed on the proband patient, and Sanger sequencing was done to validate and confirm segregation in other family members. A missense variant (c. 1171T>C) in the CRBN gene was identified in five individuals with severe intellectual disability (ID) in a consanguineous Saudi family. The homozygous variant was co-segregating in the family with the phenotype of severe ID, seizures and self-mutilating behaviour. The missense mutation (p.C391R) reported here results in the replacement of a conserved cysteine residue by an arginine in the CULT (cereblon domain of unknown activity, binding cellular ligands and thalidomide) domain of CRBN, which contains a zinc-binding site. These findings thus contribute to a growing list of ID disorders caused by CRBN mutations, broaden the spectrum of phenotypes attributable to ARNS-ID and provide new insight into genotype-phenotype correlations between CRBN mutations and the aetiology of ARNS-ID. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  5. Pathogenic mutations in TULP1 responsible for retinitis pigmentosa identified in consanguineous familial cases

    Science.gov (United States)

    Ullah, Inayat; Kabir, Firoz; Iqbal, Muhammad; Gottsch, Clare Brooks S.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose To identify pathogenic mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous familial cases. Methods Seven large familial cases with multiple individuals diagnosed with retinitis pigmentosa were included in the study. Affected individuals in these families underwent ophthalmic examinations to document the symptoms and confirm the initial diagnosis. Blood samples were collected from all participating members, and genomic DNA was extracted. An exclusion analysis with microsatellite markers spanning the TULP1 locus on chromosome 6p was performed, and two-point logarithm of odds (LOD) scores were calculated. All coding exons along with the exon–intron boundaries of TULP1 were sequenced bidirectionally. We constructed a single nucleotide polymorphism (SNP) haplotype for the four familial cases harboring the K489R allele and estimated the likelihood of a founder effect. Results The ophthalmic examinations of the affected individuals in these familial cases were suggestive of RP. Exclusion analyses confirmed linkage to chromosome 6p harboring TULP1 with positive two-point LOD scores. Subsequent Sanger sequencing identified the single base pair substitution in exon14, c.1466A>G (p.K489R), in four families. Additionally, we identified a two-base deletion in exon 4, c.286_287delGA (p.E96Gfs77*); a homozygous splice site variant in intron 14, c.1495+4A>C; and a novel missense variation in exon 15, c.1561C>T (p.P521S). All mutations segregated with the disease phenotype in the respective families and were absent in ethnically matched control chromosomes. Haplotype analysis suggested (p<10−6) that affected individuals inherited the causal mutation from a common ancestor. Conclusions Pathogenic mutations in TULP1 are responsible for the RP phenotype in seven familial cases with a common ancestral mutation responsible for the disease phenotype in four of the seven families. PMID:27440997

  6. Prevalence of consanguineous marriages among Iranian Georgians.

    Science.gov (United States)

    Rafiee, Laleh; Saadat, Mostafa

    2011-01-01

    Consanguineous marriage--marriage between relatives--has received a great deal of attention as a potential risk factor for many adverse health outcomes. The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among Iranian Georgians living in Frydoonshahr (Isfahan province, central Iran). Data on consanguineous marriages were collected using a simple questionnaire. The total number of couples in this study was 646. Consanguineous marriage was classified by the degree of relationship between couples. First cousin marriages (14.2%) were the most common type of consanguineous marriages, followed by second cousin (7.0%), beyond second cousin (1.5%) and first cousin once removed (0.6%). The mean inbreeding coefficient (α) was calculated as 0.0104 for the population. The present study shows that the study population, as other Iranian populations, has a high level of consanguinity.

  7. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen.

    Science.gov (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes

    2017-01-20

    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  8. Relationship between birth order of spouses with different degrees of consanguineous relationship.

    Science.gov (United States)

    Reddy, B M; Malhotra, K C

    1991-08-01

    The relationship between birth order of spouses with different degrees of consanguinity is examined in a sample of 1826 couples belonging to the endogamous Vadde Fisherfolk of Kolleru Lake, Andhra Pradesh, India. We attempt to explain the wide variation in the frequency of different kinds of consanguineous marriages through the age-sex structure of the population in general and especially of the related families. This structure may also be manifested in the association between the birth orders of spouses. A highly significant and large correlation between the birth orders of spouses in uncle-niece marriages and a gradual decrease in the correlation with increase in remoteness of the relationship between the spouses were observed. Given the distribution of age differences between the spouses and assuming a standard age-sex structure, it seems possible to estimate the optimum frequency with which at least close consanguineous marriages occur in any particular population.

  9. Impact of 226C>T MSH2 gene mutation on cancer phenotypes in two HNPCC-associated highly-consanguineous families from Kuwait: emphasis on premarital genetic testing.

    Science.gov (United States)

    Marafie, Makia J; Al-Awadi, Sadiqa; Al-Mosawi, Fatemah; Elshafey, Alaa; Al-Ali, Waleed; Al-Mulla, Fahd

    2009-01-01

    Lynch syndrome or hereditary nonpolyposis colorectal cancer (HNPCC) is one of the commonest cancer susceptibility syndromes. It is characterized by early onset colon cancer and a variety of extracolonic tumours. Germline mutations in the DNA mismatch repair genes (MLH1, MSH2, MSH6, PMS1, and PMS2) are responsible for this disorder. Identifying an affected individual depends on the tumour histopathology, family history that fulfils the Amsterdam and/or Bethesda criteria, tumour immunohistochemistry, microsatellite instability, and finally molecular analysis of an affected member. It is a laborious, time consuming and expensive procedure, which needs the effort of a multi-disciplinary team. However, once the diagnosis is established and germline defect is identified, other high risk pre-symptomatic carriers could be offered intensive surveillance and management as a preventive measure against cancer development. Here, we present two large highly consanguineous HNPCC-families from Kuwait in whom a founder MSH2 mutation was identified. The relationship between this mutation and cancer expressivity in two large consanguineous families harbouring other genetic defects is discussed. Moreover, we shed light on the challenges pertaining to diagnosis, screening, premarital counselling of couples and prenatal diagnosis of offspring with biallelic MSH2 gene mutation.

  10. Prevalence of consanguineous marriages in Syria.

    Science.gov (United States)

    Othman, Hasan; Saadat, Mostafa

    2009-09-01

    Consanguineous marriage is the union of individuals having at least one common ancestor. The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages in the Syrian Arab Republic. Data on consanguineous marriages were collected using a simple questionnaire. The total number of couples in this study was 67,958 (urban areas: 36,574 couples; rural areas: 31,384 couples) from the following provinces: Damascus, Hamah, Tartous, Latakia, Al Raqa, Homs, Edlep and Aleppo. In each province urban and rural areas were surveyed. Consanguineous marriage was classified by the degree of relationship between couples: double first cousins (F=1/8), first cousins (F=1/16), second cousins (F=1/64) and beyond second cousins (Fconsanguinity was 30.3% in urban and 39.8% in rural areas. Total rate of consanguinity was found to be 35.4%. The equivalent mean inbreeding coefficient (alpha) was 0.0203 and 0.0265 in urban and rural areas, respectively. The mean proportion of consanguineous marriages ranged from 67.5% in Al Raqa province to 22.1% in Latakia province. The alpha-value ranged from 0.0358 to 0.0127 in these two provinces, respectively. The western and north-western provinces (including Tartous, Lattakia and Edlep) recorded lower levels of inbreeding than the central, northern and southern provinces. The overall alpha-value was estimated to be about 0.0236 for the studied populations. First cousin marriages (with 20.9%) were the most common type of consanguineous marriages, followed by double first cousin (with 7.8%) and second cousin marriages (with 3.3%), and beyond second cousin was the least common type.

  11. Impact of consanguineous marriages and degrees of inbreeding on fertility, child mortality, secondary sex ratio, selection intensity, and genetic load: a cross-sectional study from Northern India.

    Science.gov (United States)

    Fareed, Mohd; Kaisar Ahmad, Mir; Azeem Anwar, Malik; Afzal, Mohammad

    2017-01-01

    The aim of our study was to understand the relationship between consanguineous marriages and reproductive outcomes. A total of 999 families were recruited from five Muslim populations of Jammu region. Family pedigrees were drawn to access the family history and inbreeding status in terms of coefficient of inbreeding (F). Fertility, mortality, secondary sex ratio, selection intensity, and lethal equivalents were measured using standard methods. The significant differences for gross fertility was found to be higher among inbred groups as compared to the unrelated families (P consanguineous families of all populations in comparison with the non-consanguineous family groups. Moreover, the prenatal and postnatal child mortality rates (i.e., U5MR and U18MR) have presented a persuasive increase with an upsurge in the homozygosity level. The mortality rate was found to be maximum among families with the highest value of coefficient of inbreeding (F). The selection intensity (SI) also showed inflations among families with respect to their increasing inbreeding coefficients. The greater values of lethal equivalents per gamete (LEs/gamete) were observed for autosomal inheritance in comparison with sex-linked inheritance. Our conclusive assessment brings out the deleterious consequence of consanguineous marriages on reproductive outcomes.

  12. A novel DFNB31 mutation associated with Usher type 2 syndrome showing variable degrees of auditory loss in a consanguineous Portuguese family.

    Science.gov (United States)

    Audo, Isabelle; Bujakowska, Kinga; Mohand-Saïd, Saddek; Tronche, Sophie; Lancelot, Marie-Elise; Antonio, Aline; Germain, Aurore; Lonjou, Christine; Carpentier, Wassila; Sahel, José-Alain; Bhattacharya, Shomi; Zeitz, Christina

    2011-01-01

    To identify the genetic defect of a consanguineous Portuguese family with rod-cone dystrophy and varying degrees of decreased audition. A detailed ophthalmic and auditory examination was performed on a Portuguese patient with severe autosomal recessive rod-cone dystrophy. Known genetic defects were excluded by performing autosomal recessive retinitis pigmentosa (arRP) genotyping microarray analysis and by Sanger sequencing of the coding exons and flanking intronic regions of eyes shut homolog-drosophila (EYS) and chromosome 2 open reading frame 71 (C2orf71). Subsequently, genome-wide homozygosity mapping was performed in DNA samples from available family members using a 700K single nucleotide polymorphism (SNP) microarray. Candidate genes present in the significantly large homozygous regions were screened for mutations using Sanger sequencing. The largest homozygous region (~11 Mb) in the affected family members was mapped to chromosome 9, which harbors deafness, autosomal recessive 31 (DFNB31; a gene previously associated with Usher syndrome). Mutation analysis of DFNB31 in the index patient identified a novel one-base-pair deletion (c.737delC), which is predicted to lead to a truncated protein (p.Pro246HisfsX13) and co-segregated with the disease in the family. Ophthalmic examination of the index patient and the affected siblings showed severe rod-cone dystrophy. Pure tone audiometry revealed a moderate hearing loss in the index patient, whereas the affected siblings were reported with more profound and early onset hearing impairment. We report a novel truncating mutation in DFNB31 associated with severe rod-cone dystrophy and varying degrees of hearing impairment in a consanguineous family of Portuguese origin. This is the second report of DFNB31 implication in Usher type 2.

  13. A homozygous mutation in a consanguineous family consolidates the role of ALDH1A3 in autosomal recessive microphthalmia

    DEFF Research Database (Denmark)

    Roos, L; Fang, M; Dali, C

    2013-01-01

    to the identification of new genes. Very recently, homozygous variations within ALDH1A3 have been associated with autosomal recessive microphthalmia with or without cysts or coloboma, and with variable subphenotypes of developmental delay/autism spectrum disorder in eight families. In a consanguineous family where...... three of the five siblings were affected with microphthalmia/coloboma, we identified a novel homozygous missense mutation in ALDH1A3 using exome sequencing. Of the three affected siblings, one had intellectual disability and one had intellectual disability and autism, while the last one presented...... with normal development. This study contributes further to the description of the clinical spectrum associated with ALDH1A3 mutations, and illustrates the interfamilial clinical variation observed in individuals with ALDH1A3 mutations....

  14. Variable pathogenicity of exon 43del (FAA) in four Fanconi anaemia patients within a consanguineous family.

    Science.gov (United States)

    Koc, A; Pronk, J C; Alikasifoglu, M; Joenje, H; Altay, C

    1999-01-01

    Four Fanconi anaemia group A (FAA) patients within two related consanguineous families are presented: the propositus (male, 13 years, transplanted at age 10), and his three cousins (one male, 8 years, and two female newborns). Assignment of the patients to FAA was based on the functional complementation analysis by somatic cell hybridization and confirmed by mutation screening showing a homozygous deletion of exon 43 (4267-4404del) in the FAA gene to be present in all four patients. The newborn patients had been diagnosed prenatally by DNA analysis. In spite of identical molecular pathology and close familial relationship the clinical phenotypes of the four patients were not concordant. Discordant symptoms included birthweight, pigmentation abnormalities, skeletal, renal and genital abnormalities, whereas microcephaly and possibly the haematological course were concordant. Differences in environmental conditions and/or genetic make-up along with chance effects during development may explain discordant phenotypes despite identical molecular pathology in these patients. However, our results do not rule out the possibility that the exon 43del mutation may have prognostic value for the haematological course of the disease.

  15. Constitutional Mismatch Repair Deficiency in Israel: High Proportion of Founder Mutations in MMR Genes and Consanguinity.

    Science.gov (United States)

    Baris, Hagit N; Barnes-Kedar, Inbal; Toledano, Helen; Halpern, Marisa; Hershkovitz, Dov; Lossos, Alexander; Lerer, Israela; Peretz, Tamar; Kariv, Revital; Cohen, Shlomi; Half, Elizabeth E; Magal, Nurit; Drasinover, Valerie; Wimmer, Katharina; Goldberg, Yael; Bercovich, Dani; Levi, Zohar

    2016-03-01

    Heterozygous germline mutations in any of the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2, cause Lynch syndrome (LS), an autosomal dominant cancer predisposition syndrome conferring a high risk of colorectal, endometrial, and other cancers in adulthood. Offspring of couples where both spouses have LS have a 1:4 risk of inheriting biallelic MMR gene mutations. These cause constitutional MMR deficiency (CMMRD) syndrome, a severe recessively inherited cancer syndrome with a broad tumor spectrum including mainly hematological malignancies, brain tumors, and colon cancer in childhood and adolescence. Many CMMRD children also present with café au lait spots and axillary freckling mimicking neurofibromatosis type 1. We describe our experience in seven CMMRD families demonstrating the role and importance of founder mutations and consanguinity on its prevalence. Clinical presentations included brain tumors, colon cancer, lymphoma, and small bowel cancer. In children from two nonconsanguineous Ashkenazi Jewish (AJ) families, the common Ashkenazi founder mutations were detected; these were homozygous in one family and compound heterozygous in the other. In four consanguineous families of various ancestries, different homozygous mutations were identified. In a nonconsanguineous Caucasus/AJ family, lack of PMS2 was demonstrated in tumor and normal tissues; however, mutations were not identified. CMMRD is rare, but, especially in areas where founder mutations for LS and consanguinity are common, pediatricians should be aware of it since they are the first to encounter these children. Early diagnosis will enable tailored cancer surveillance in the entire family and a discussion regarding prenatal genetic diagnosis. © 2015 Wiley Periodicals, Inc.

  16. Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families.

    Directory of Open Access Journals (Sweden)

    Sobia Shafique

    Full Text Available The frequency of inherited bilateral autosomal recessive non-syndromic hearing loss (ARNSHL in Pakistan is 1.6/1000 individuals. More than 50% of the families carry mutations in GJB2 while mutations in MYO15A account for about 5% of recessive deafness. In the present study a cohort of 30 ARNSHL families was initially screened for mutations in GJB2 and MYO15A. Homozygosity mapping was performed by employing whole genome single nucleotide polymorphism (SNP genotyping in the families that did not carry mutations in GJB2 or MYO15A. Mutation analysis was performed for the known ARNSHL genes present in the homozygous regions to determine the causative mutations. This allowed the identification of a causative mutation in all the 30 families including 9 novel mutations, which were identified in 9 different families (GJB2 (c.598G>A, p.Gly200Arg; MYO15A (c.9948G>A, p.Gln3316Gln; c.3866+1G>A; c.8767C>T, p.Arg2923* and c.8222T>C, p.Phe2741Ser, TMC1 (c.362+18A>G, BSND (c.97G>C, p.Val33Leu, TMPRSS3 (c.726C>G, p.Cys242Trp and MSRB3 (c.20T>G, p.Leu7Arg. Furthermore, 12 recurrent mutations were detected in 21 other families. The 21 identified mutations included 10 (48% missense changes, 4 (19% nonsense mutations, 3 (14% intronic mutations, 2 (9% splice site mutations and 2 (9% frameshift mutations. GJB2 accounted for 53% of the families, while mutations in MYO15A were the second most frequent (13% cause of ARNSHL in these 30 families. The identification of novel as well as recurrent mutations in the present study increases the spectrum of mutations in known deafness genes which could lead to the identification of novel founder mutations and population specific mutated deafness genes causative of ARNSHL. These results provide detailed genetic information that has potential diagnostic implication in the establishment of cost-efficient allele-specific analysis of frequently occurring variants in combination with other reported mutations in Pakistani populations.

  17. Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

    Directory of Open Access Journals (Sweden)

    Jaworek Thomas J

    2012-06-01

    Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

  18. Consanguineous marriages in the genetic counseling centers of Isfahan and the ethical issues of clinical consultations.

    Science.gov (United States)

    Nouri, Narges; Nouri, Nayereh; Tirgar, Samane; Soleimani, Elham; Yazdani, Vida; Zahedi, Farzaneh; Larijani, Bagher

    2017-01-01

    Consanguineous marriage, which is common in many regions in the world, has absorbed much attention as a causative factor in raising the incidence of genetic diseases. The adverse effects may be attributed to the expression of the genes received from common ancestors and mortality and morbidity of the offspring. Iran has a high rate of consanguineous marriages. In recent years genetic counseling has come to be considered in health care services. This cross-sectional study was conducted in order to determine the prevalence and types of consanguineous marriages in the genetic clinics in Isfahan. We aimed to define the different types of marriages, specific categories of genetic disorders associated with consanguineous marriages, and mode of inheritance in the family tree. We also narratively reviewed the ethical aspects of the issue. The data were collected using a simple questionnaire. A total number of 1535 couples from urban and rural areas formed the study population. The marriages were classified according to the degree of the relationship between couples, including: double cousin, first cousin, first cousin once removed, second cousin and beyond second cousin. The SPSS software version 16 was used for data analysis. Data obtained through genetic counseling offered during a 5-year period revealed that 74.3% had consanguineous relationships, 62.3% were first cousins, 1% were double cousins and 7.8% were second cousins. In addition, 76% of the couples had at least one genetic disease in their family tree. Related ethical issues were also considered in this study, including autonomy and informed decision making, benefit and harm assessment, confidentiality, ethics in research, justice in access to counseling services, financial problems ethics, and the intellectual property of scientific success.

  19. Expansion of the spectrum of ITGB6-related disorders to adolescent alopecia, dentogingival abnormalities and intellectual disability

    OpenAIRE

    Ansar, Muhammad; Jan, Abid; Santos-Cortez, Regie Lyn P; Wang, Xin; Suliman, Muhammad; Acharya, Anushree; Habib, Rabia; Abbe, Izoduwa; Ali, Ghazanfar; Lee, Kwanghyuk; Smith, Joshua D; Nickerson, Deborah A; Shendure, Jay; Bamshad, Michael J; Ahmad, Wasim

    2015-01-01

    Alopecia with mental retardation (APMR) is a very rare disorder. In this study, we report on a consanguineous Pakistani family (AP91) with mild-to-moderate intellectual disability, adolescent alopecia and dentogingival abnormalities. Using homozygosity mapping, linkage analysis and exome sequencing, we identified a novel rare missense variant c.898G>A (p.(Glu300Lys)) in ITGB6, which co-segregates with the phenotype within the family and is predicted to be deleterious. Structural modeling show...

  20. Consanguinity, prematurity, birth weight and pregnancy loss: a prospective cohort study at four primary health center areas of Karnataka, India.

    Science.gov (United States)

    Bellad, M B; Goudar, S S; Edlavitch, S A; Mahantshetti, N S; Naik, V; Hemingway-Foday, J J; Gupta, M; Nalina, H R; Derman, R; Moss, N; Kodkany, B S

    2012-06-01

    To determine whether consanguinity adversely influences pregnancy outcome in South India, where consanguinity is a common means of family property retention. Data were collected from a prospective cohort of 647 consenting women, consecutively registered for antenatal care between 14 and 18 weeks gestation, in Belgaum district, Karnataka in 2005. Three-generation pedigree charts were drawn for consanguineous participants. χ (2)-Test and Student's t-test were used to assess categorical and continuous data, respectively, using SPSS version 14. Multivariate logistic regression adjusted for confounding variables. Overall, 24.1% of 601 women with singleton births and outcome data were consanguineous. Demographic characteristics between study groups were similar. Non-consanguineous couples had fewer stillbirths (2.6 vs 6.9% P=0.017; adjusted P=0.050), miscarriages (1.8 vs 4.1%, P=0.097; adjusted P=0.052) and lower incidence of birth weight birth (P=0.013), whereas smoking (P=0.015) and poverty (P=0.003) were associated with higher rates of low birth weight. Consanguinity significantly increases pregnancy loss and birth weight <2500 g.

  1. Consanguinity and spousal concordance in Kuwait.

    Science.gov (United States)

    al-Kandari, Y; Crews, D E; Poirier, F E

    2002-12-01

    Consanguineous marriage is favored in Kuwait. This research focuses on the relationship of physical and cultural traits to marriage types in Kuwait and examines concordance as a function of consanguinity and marriage duration. In a nonrandom opportunistic sample of 242 couples anthropometric and blood pressure data have been collected as well as data on acculturation, religiosity, Farsi proficiency, level of education, occupation, and attitudes regarding fertility. Significant concordances occur in cultural characteristics among couples in all three types of marriages with respect to the degree of religiosity, acculturation, language similarity, education, and occupation. Non-consanguineous spouses have the highest concordance in educational level, occupation, and degree of acculturation, but the lowest for religiosity and Farsi proficiency. Nonkin marriages seem to be based on personal preferences. In the wider potential nonkin marriage pool spouses show more concordance in stature and education indicating the positive assortative mating for those traits. Non-consanguineous spouses show a significant association for triceps and subscapular skinfold thicknesses hip and waist circumferences, and body fat distribution. Unrelated spouses exhibit more concordance for physical traits than do related spouses. There is a significant correlation between spouses in first and double cousin marriages as well as in spouses in second and less than second cousin unions for systolic and diastolic blood pressure, while non-consanguineous spouses show a significant association in diastolic blood pressure only.

  2. Modernization and Consanguineous Marriage in Iran.

    Science.gov (United States)

    Givens, Benjamin P.; Hirschman, Charles

    1994-01-01

    Used data on 4,667 women from the Iran Fertility Survey to examine trends and social correlates of consanguineous marriage. Found modest increase in proportion of marriages between cousins in Iran from 1940s to 1970s. Results suggest that modernization may be eroding social bases on consanguinity, whereas increased availability of cousins may lead…

  3. Consanguinity Among Parents of Iranian Deaf Children.

    Science.gov (United States)

    Ajallouyan, Mohammad; Radfar, Shokofeh; Nouhi, Sima; Tavallaie, Seid Abbas; Amirsalari, Susan; Yousefi, Jaleh; Hasanali Fard, Mahdieh

    2016-11-01

    It seems that there is a relationship between consanguinity and profound hearing loss but there is little data about the association of consanguinity and hearing loss in Iran. The aim of this study is to demonstrate the causes of profound bilateral sensorineural hearing loss among Iranian samples who are candidates for cochlear implantation. This study was retrospective, analytical, and designed to collect information about profound hearing impaired cases referred to the Baqiyatallah Cochlear implantation center using enumeration. A total of 310 children with profound hearing impairments participated in this study. They were aged from 6 months to 4 years old. The study was done between January 2007 and April 2009. Chi-square tests were used to show whether there was any statistical difference between the incidence of marital consanguinity of their parents and the normal population. Sixty-five percent of those 310 children had parents who had married with their relatives. Of the 203 (65%) parents that had consanguineous marriages, 132 were first cousins, which includes the children of two brothers (37 [11.8%] patrilateral parallel cousins), the children of two sisters (38 [12.2%] multi-lateral parallel cousins), or the children of a brother and a sister (57 [18.3%] cross cousins). Fifty-four (17.4%) of the parents were second cousins and 17 (5.2%) were beyond second cousins. Also, hearing loss etiology was obvious in 237 (76.3%) of the patients with profound hearing loss but was unknown in 73 (23.7%). Hereditary was identified as the most common cause in 33% of the cases. Our data demonstrated a 65% occurrence of consanguineous marriage among the parents of deaf children, which is statistically different from the percentage of consanguineous marriage among Iranian population (38%). This indicates an obvious relationship between severe hearing loss and consanguineous marriage.

  4. The Use of High-Density SNP Array to Map Homozygosity in Consanguineous Families to Efficiently Identify Candidate Genes: Application to Woodhouse-Sakati Syndrome

    Directory of Open Access Journals (Sweden)

    Molly B. Sheridan

    2015-01-01

    Full Text Available Two consanguineous Qatari siblings presented for evaluation: a 17-4/12-year-old male with hypogonadotropic hypogonadism, alopecia, intellectual disability, and microcephaly and his 19-year-old sister with primary amenorrhea, alopecia, and normal cognition. Both required hormone treatment to produce secondary sex characteristics and pubertal development beyond Tanner 1. SNP array analysis of both probands was performed to detect shared regions of homozygosity which may harbor homozygous mutations in a gene causing their common features of abnormal pubertal development, alopecia, and variable cognitive delay. Our patients shared multiple homozygous genomic regions; ten shared regions were >1 Mb in length and constituted 0.99% of the genome. DCAF17, encoding a transmembrane nuclear protein of uncertain function, was the only gene identified in a homozygous region known to cause hypogonadotropic hypogonadism. DCAF17 mutations are associated with Woodhouse-Sakati syndrome, a rare disorder characterized by alopecia, hypogonadotropic hypogonadism, sensorineural hearing loss, diabetes mellitus, and extrapyramidal movements. Sequencing of the coding exons and flanking intronic regions of DCAF17 in the proband revealed homozygosity for a previously described founder mutation (c.436delC. Targeted DCAF17 sequencing of his affected sibling revealed the same homozygous mutation. This family illustrates the utility of SNP array testing in consanguineous families to efficiently and inexpensively identify regions of genomic homozygosity in which genetic candidates for recessive conditions can be identified.

  5. Consanguinity and Disorders of Sexual Developments in the Sudan ...

    African Journals Online (AJOL)

    Background: Consanguinity is very common in the Sudanese society. There is a lack of studies on consanguinity and its impact on genetic diseases in Sudan. In this study we correlated Disorders of Sexual developments (DSDs), as an example of genetic conditions, in relation with consanguinity. Material and Methods: A ...

  6. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  7. Suicidal ideation in Pakistani college students.

    Science.gov (United States)

    Khokher, Sehar; Khan, Murad M

    2005-01-01

    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  8. Consanguineous marriage and reproduction in Beirut, Lebanon.

    Science.gov (United States)

    Khlat, M

    1988-08-01

    Effects of consanguineous marriages on couples' fertility and on offspring mortality were investigated in Beirut through a population-based health survey of 2,752 households. A multistage random sampling procedure was used, and information was obtained from all ever-married women in the household about their reproductive performance and genealogical relationship with spouse; demographic and socioeconomic information was also recorded. Twenty-five percent of all marriages were between relatives, and the spouses were first cousins in approximately 57% of all consanguineous marriages. Total pregnancies, live births, and living children were significantly higher among consanguineous couples than among nonconsanguineous ones, as was the proportion dead among children ever born. However, no difference remained in either fertility or mortality, when allowance was made for socioeconomic status, religious affiliation, and marriage duration. The issue of confounding is discussed, and the lack of significant pattern in the final analysis is interpreted as resulting from a long-term practice of consanguineous marriages.

  9. Effect of Consanguinity on Low Birth Weight: A Meta-Analysis.

    Science.gov (United States)

    Poorolajal, Jalal; Ameri, Pegah; Soltanian, Alireza; Bahrami, Masoud

    2017-03-01

    Consanguinity (when couples share at least one common ancestor) is a public health issue with a variety of distributions and incidence rates worldwide. Several epidemiological studies have explored the association between consanguinity and low birth weight (LBW). However, the results are inconsistent. This meta-analysis aimed to explore the overall association between consanguineous marriage and LBW. We searched PubMed, Web of Science, Scopus, ScienceDirect, and reference lists of articles up to May 2015. We included cohort, case-control, and cross-sectional studies addressing the association between consanguinity and LBW. We assessed heterogeneity using Q-test and I2 statistic. We explored publication bias using the Egger's and Begg's tests and the funnel plot. We meta-analyzed the data and reported the overall odds ratio (OR) and mean difference with 95% confidence intervals (CI) using the random-effects model. We included 24 out of 3941 retrieved studies, with 44,131 participants. We indicated that LBW was associated significantly with first-cousin marriages (OR = 1.36; 95% CI: 1.03, 1.69) and non-significantly with second-cousin marriages (OR = 1.20; 95% CI: 0.49, 1.91). Furthermore, first-cousin marriages can reduce the birth weight of siblings of consanguineous couples 144 g more compared to non-consanguineous marriages. This meta-analysis measured the association between consanguinity and LBW. Based on the current evidence, consanguineous marriage can increase the risk for LBW. However, further evidence based on large cohort studies conducted in different settings is required to make a robust conclusion regarding the effect of consanguinity on LBW.

  10. Prevalence of consanguineous marriages and associated factors among Israeli Bedouins.

    Science.gov (United States)

    Na'amnih, Wasef; Romano-Zelekha, Orly; Kabaha, Ahmed; Rubin, Liza Pollack; Bilenko, Natalya; Jaber, Lutfi; Honovich, Mira; Shohat, Tamy

    2014-10-01

    The Bedouin population in Israel is a semi-nomadic traditional patriarchal society. Consanguineous marriages are very common, contributing to high rates of congenital malformations and genetic diseases, resulting in high infant mortality. Data on consanguineous marriages among Bedouins in Israel are limited. This study examined the current prevalence of consanguineous marriages and their determinants among Israeli Bedouins. One thousand two hundred ninety Bedouin women who delivered in the maternity wards of the only hospital serving the Bedouin population were interviewed between November 2009 and January 2010. The prevalence of consanguineous marriages was 44.8 %. The most common type of spousal relationship was first cousins (65.7 % of all consanguineous marriages). The mean inbreeding coefficient was 0.0238. Factors significantly associated with consanguinity were less years of schooling (OR 0.94, 95 % CI (0.88-0.99), p = 0.02) and younger age at marriage of the wife (OR 0.90, 95 % CI (0.80-0.96), p = 0.0002). In conclusion, the rate of consanguineous marriages among Bedouins is very high, making this population at risk for congenital malformations and genetic diseases. Efforts should be directed at better education and provision of premarital and prenatal counseling on the health consequences of consanguineous marriages and the possibilities to lower those risks.

  11. A novel AP4M1 mutation in autosomal recessive cerebral palsy syndrome and clinical expansion of AP-4 deficiency

    OpenAIRE

    Jameel, Muhammad; Klar, Joakim; Tariq, Muhammad; Moawia, Abubakar; Altaf Malik, Naveed; Seema Waseem, Syeda; Abdullah, Uzma; Naeem Khan, Tahir; Raininko, Raili; Baig, Shahid Mahmood; Dahl, Niklas

    2014-01-01

    BACKGROUND: Cerebral palsy (CP) is a heterogeneous neurodevelopmental disorder associated with intellectual disability in one-third of cases. Recent findings support Mendelian inheritance in subgroups of patients with the disease. The purpose of this study was to identify a novel genetic cause of paraplegic CP with intellectual disability in a consanguineous Pakistani family. METHODS: We performed whole-exome sequencing (WES) in two brothers with CP and intellectual disability. Analysis of AP...

  12. Consanguineous marriages in Afghanistan.

    Science.gov (United States)

    Saify, Khyber; Saadat, Mostafa

    2012-01-01

    The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among Afghanistan populations. Data on types of marriages were collected using a simple questionnaire. The total number of couples in the study was 7140 from the following provinces: Badakhshan, Baghlan, Balkh, Bamyan, Kabul, Kunduz, Samangan and Takhar. Consanguineous marriages were classified by the degree of relationship between couples: double first cousins, first cousins, first cousins once removed, second cousins and beyond second cousins. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for each population. The proportion of consanguineous marriages in the country was 46.2%, ranging from 38.2% in Kabul province to 51.2% in Bamyan province. The equivalent mean inbreeding coefficient (α) was 0.0277, and ranged from 0.0221 to 0.0293 in these two regions. There were significant differences between provinces for frequencies of different types of marriages (pconsanguineous marriages, followed by double first cousin (6.9%), second cousin (5.8%), beyond second cousin (3.9%) and first cousin once removed (1.8%). There were significant differences between ethnic groups for the types of marriages (χ2=177.6, df=25, pconsanguinity.

  13. The Implications of Parental Consanguinity on the Care of Neonates.

    Science.gov (United States)

    Ng, Diana

    2016-08-01

    Approximately 6% of births worldwide, 7.9 million children, are born with a serious genetic congenital abnormality each year. A factor thought to increase the prevalence of birth defects is parental consanguinity, which is a social custom practiced in at least 20% of the world's population. The purpose of this article is to explore the relationship between consanguinity and congenital defects. This article also aims to enhance neonatal healthcare practitioners' comprehension of its implications for practice and research. A review of literature was compiled from a search of the online databases Cumulative Index of Nursing and Allied Health (CINAHL), PubMed, EBSCO MegaFILE, and Google Scholar. Literature pertinent to this topic primarily consists of research studies that examine the inbreeding depression phenomenon through comparison of the prevalence of birth defects among the offspring of consanguineous and nonconsanguineous couples. Current studies indicate that the progeny of consanguineous couples are at an increased risk of congenital defects compared with those of nonconsanguineous couples. Consanguinity is one risk factor among many that can lead to a major birth defect. Relationships between consanguineous populations and neonatal healthcare practitioners such as registered nurses, advanced practice nurses, and physicians could significantly alter neonatal health outcomes. Specific recommendations such as genetic counseling and therapeutic communication are discussed. Further studies need to investigate the connection between consanguinity and birth defects while controlling for nongenetic variables. Moreover, a focus on consanguineous communities in the United States would prove beneficial.

  14. Socioeconomic, demographic, and geographic variables affecting the diverse degrees of consanguineous marriages in Spain.

    Science.gov (United States)

    Fuster, V; Colantonio, S E

    2004-02-01

    In a population the inbreeding coefficient alpha is determined by the relative incidence of the various degrees of consanguineous marriages--uncle-niece or aunt-nephew (C12), first cousin (C22), first cousin once removed (C23), second cousin (C33)--which may be related to temporal, geographic, demographic, and economic factors. Using published information from Spain corresponding to urban and rural areas, in this article we seek to establish how each specific relationship behaves with respect to geographic, demographic, and socioeconomic factors, to determine differential urban-rural patterns, and to study whether the diverse types of consanguineous matings relate homogeneously to these factors. For this purpose we performed multiple regressions in which the dependent variables were the different degrees of consanguinity previously selected and the independent variables were geographic, demographic, and economic factors. Our results indicate that the various types of consanguineous marriages in Spain are more conditioned by geographic, demographic, and economic variables than by the inbreeding level alpha (the coefficient of determination was between 0.22 and 0.72; the maximum for alpha was 0.35). A regional pattern exists in Spain and corresponds to close and to remote kinship, which may be mainly related to economic and family factors. Close relationships appear to be more associated with economic variables, whereas second-cousin marriages correspond largely to rural areas of the Spanish Central Plateau.

  15. Consanguinity studies and genome research in Mediterranean developing countries

    OpenAIRE

    Romeo, G.; Gialluisi, A.; Pippucci, T.

    2012-01-01

    Purpose: Classical studies of consanguinity have taken advantage of the relationship between the gene frequency for a rare autosomal recessive disorder (q) and the proportion of offspring of consanguineous couples who are affected with the same disorder. The Swedish geneticist Gunnar Dahlberg provided the first theoretical formulation of the inverse correlation between q and the increase in frequency of consanguineous marriages among parents of affected children with respect to marriages of t...

  16. Consanguinity pattern and heritability of Vitiligo in Arar, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Dhaifallah A Alenizi

    2014-01-01

    Full Text Available Context: Epidemiological studies have shown that vitiligo is a complex trait, involving combinations of pathogenic effects of multiple susceptibility genes as well as environmental risk factors. Aim: To observe whether consanguinity increased the incidence of vitiligo in Saudi patients from Arar. Patients and Methods: This study included 69 Saudi patients with vitiligo and their families. These patients, selected from the experience specialist dermatology center in Arar, from April 2011 to 2012, were interviewed by a dermatologist to confirm the diagnosis and complete a questionnaire. Results: A total of 69 patients, 40 males and 29 females were selected. Their mean age was 34.5 ± 11.8 years with the median age of 23 years. The mean age at onset of disease was 27.9 ± 12.9 years. The mean duration of the disease was 9.7 ± 5.3 years. The frequency of focal, vulgaris, universal, and acrofacial subtypes was 22 (31.9%, 21 (30.4%, 8 (11.6%, and 18 (26.1%, respectively. A positive family history of vitiligo was obtained in 45 (65.2% cases. A comparison of the frequency of vitiligo among siblings in relation to the general population was more in accord with the multifactorial model. Conclusion: Consanguinity in marriage increases the incidence of the disease. Therefore, genetic counseling and premarital examination would be important contributions to lower the prevalence of vitiligo.

  17. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. WDR73 missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in a consanguineous family.

    Science.gov (United States)

    Jiang, Chen; Gai, Nan; Zou, Yongyi; Zheng, Yu; Ma, Ruiyu; Wei, Xianda; Liang, Desheng; Wu, Lingqian

    2017-01-01

    Galloway-Mowat syndrome (GMS) is a very rare autosomal-recessive disorder characterized by nephrotic syndrome associated with microcephaly, and various central nervous system abnormalities, mostly cerebral hypoplasia or cerebellar atrophy, intellectual disability and neural-migration defects. WDR73 is the only gene known to cause GMS, and has never been implicated in other disease. Here we present a Chinese consanguineous family with infantile onset intellectual disability and cerebellar hypoplasia but no microcephaly. Whole exome sequencing identified a WDR73 p.W371G missense mutation. The mutation is confirmed to be segregated in this family by Sanger sequencing according to a recessive inheritance pattern. It is predicted to be deleterious by multiple algorithms and affect highly conserved site. Structural modeling revealed conformational differences between the wild type protein and the p.W371G protein. Real-time PCR and Western blotting revealed altered mRNA and protein levels in mutated samples. Our study indicates the novel WDR73 p.W371G missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in recessive mode of inheritance. Our findings imply that microcephaly is a variable phenotype in WDR73-related disease, suggest WDR73 to be a candidate gene of severe intellectual disability and cerebellar hypoplasia, and expand the molecular spectrum of WDR73-related disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Social and cultural construction of obesity among Pakistani Muslim women in North West England.

    Science.gov (United States)

    Ludwig, Alison F; Cox, Peter; Ellahi, Basma

    2011-10-01

    The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

  20. Parental consanguinity and associated factors in congenital talipes equinovarus.

    Science.gov (United States)

    Sreenivas, T; Nataraj, A R

    2012-03-01

    The cause of congenital talipes equinovarus (CTEV) is multifactorial and, consanguinity could be one of the causative factors in its development. The purpose of this study was, to determine the prevalence of parental consanguinity in CTEV and other factors like associated, congenital anomalies, maternal and fetal factors and also the severity of CTEV in these patients. The above factors were studied in 54 patients of less than 1 month of age with parental, consanguinity and 91 feet were evaluated for its severity using Dimeglio classification at the time of presentation. Out of 174 children presented to our department with CTEV, 54 (31%) children were born out, of consanguineous marriage. Thirty seven (68.5%) patients had bilateral CTEV. Twenty five (46.3%), patients had associated congenital anomalies and myelomeningocele being the commonest anomaly, associated. Out of 91 feet 61 (67%) were of grade 4 severity. High grade of severity observed in both idiopathic and non idiopathic CTEV suggests the, probable role of consanguinity as an etiological factor in the development of CTEV especially in our, part of the world. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Genotype and phenotype relationships in 10 Pakistani unrelated patients with inherited factor VII deficiency.

    Science.gov (United States)

    Borhany, M; Boijout, H; Pellequer, J-L; Shamsi, T; Moulis, G; Aguilar-Martinez, P; Schved, J-F; Giansily-Blaizot, M

    2013-11-01

    Inherited factor VII (FVII) deficiency is one of the commonest rare bleeding disorders. It is characterized by a wide molecular and clinical heterogeneity and an autosomal recessive pattern of inheritance. Factor VII-deficient patients are still scarcely explored in Pakistan although rare bleeding disorders became quite common as a result of traditional consanguineous marriages. The aim of the study was to give a first insight of F7 gene mutations in Pakistani population. Ten unrelated FVII-deficient patients living in Pakistan were investigated (median FVII:C = 2%; range = 2-37%). A clinical questionnaire was filled out for each patient and direct sequencing was performed on the coding regions, intron/exon boundaries and 5' and 3' untranslated regions of the F7 gene. Nine different mutations (eight missense mutations and one located within the F7 promoter) were identified on the F7 gene. Five of them were novel (p.Cys82Tyr, p.Cys322Ser, p.Leu357Phe, p.Thr410Ala, c-57C>T, the last being predicted to alter the binding site of transcription factor HNF-4). Half of the patients had single mutations in Cys residues involved in disulfide bridges. The p.Cys82Arg mutation was the most frequent in our series. Six of seven patients with FVII:C levels below 10% were homozygous in connection with the high percentage of consanguinity in our series. In addition, we graded the 10 patients according to three previously published classifications for rare bleeding disorders. The use of the bleeding score proposed by Tosetto and co-workers in 2006 appears to well qualify the bleeding tendency in our series. © 2013 John Wiley & Sons Ltd.

  2. Prevalence of consanguineous marriages and associated factors among Israeli Bedouins

    OpenAIRE

    Na’amnih, Wasef; Romano-Zelekha, Orly; Kabaha, Ahmed; Rubin, Liza Pollack; Bilenko, Natalya; Jaber, Lutfi; Honovich, Mira; Shohat, Tamy

    2014-01-01

    The Bedouin population in Israel is a semi-nomadic traditional patriarchal society. Consanguineous marriages are very common, contributing to high rates of congenital malformations and genetic diseases, resulting in high infant mortality. Data on consanguineous marriages among Bedouins in Israel are limited. This study examined the current prevalence of consanguineous marriages and their determinants among Israeli Bedouins. One thousand two hundred ninety Bedouin women who delivered in the ma...

  3. The Genetics of Asymmetry: Whole Exome Sequencing in a Consanguineous Turkish Family with an Overrepresentation of Left-Handedness

    Directory of Open Access Journals (Sweden)

    Sebastian Ocklenburg

    2017-05-01

    Full Text Available Handedness is the most pronounced behavioral asymmetry in humans. Genome-wide association studies have largely failed to identify genetic loci associated with phenotypic variance in handedness, supporting the idea that the trait is determined by a multitude of small, possibly interacting genetic and non-genetic influences. However, these studies typically are not capable of detecting influences of rare mutations on handedness. Here, we used whole exome sequencing in a Turkish family with history of consanguinity and overrepresentation of left-handedness and performed quantitative trait analysis with handedness lateralization quotient as a phenotype. While rare variants on different loci showed significant association with the phenotype, none was functionally relevant for handedness. This finding was further confirmed by gene ontology group analysis. Taken together, our results add further evidence to the suggestion that there is no major gene or mutation that causes left-handedness.

  4. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  5. TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

    Science.gov (United States)

    Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

    2015-01-01

    A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

  6. The relationship between consanguineous marriage and death in fetus and infants

    Directory of Open Access Journals (Sweden)

    Majid Mehr Mohammadi

    2012-01-01

    Full Text Available Background: Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. Materials ans Methods : This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more than one exceptional child questionnaire. The validity and reliability of this questionnaire was acceptable. Hierarchical log-linear method was used for statistical analysis. Results: Consanguineous marriage significantly increased the number of births of exceptional children. Moreover, there was a significant relation between the history of fetal/infant death and belonging to the group. There was a significant relation between consanguineous marriage and the history of fetal/infant death which means consanguineous marriage increased the prevalence of fetal/infant death in parents with exceptional children rather than in parents with normal children. Conclusions: The rate of fetal/infant death in exceptional births of consanguineous marriages was higher than that of non-consanguineous marriages.

  7. The relationship between consanguineous marriage and death in fetus and infants.

    Science.gov (United States)

    Mohammadi, Majid Mehr; Hooman, Heidar Ali; Afrooz, Gholam Ali; Daramadi, Parviz Sharifi

    2012-05-01

    Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled) or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more than one exceptional child questionnaire. The validity and reliability of this questionnaire was acceptable. Hierarchical log-linear method was used for statistical analysis. Consanguineous marriage significantly increased the number of births of exceptional children. Moreover, there was a significant relation between the history of fetal/infant death and belonging to the group. There was a significant relation between consanguineous marriage and the history of fetal/infant death which means consanguineous marriage increased the prevalence of fetal/infant death in parents with exceptional children rather than in parents with normal children. The rate of fetal/infant death in exceptional births of consanguineous marriages was higher than that of non-consanguineous marriages.

  8. Novel compound heterozygous mutations of ALDH1A3 contribute to anophthalmia in a non-consanguineous Chinese family

    Directory of Open Access Journals (Sweden)

    Yunqiang Liu

    2017-06-01

    Full Text Available Abstract Anophthalmia is a rare eye development anomaly resulting in absent ocular globes or tissue in the orbit since birth. Here, we investigated a newborn with bilateral anophthalmia in a Chinese family. Exome sequencing revealed that compound heterozygous mutations c.287G > A (p.(Arg96His and c.709G > A (p.(Gly237Arg of the ALDH1A3 gene were present in the affected newborn. Both mutations were absent in all of the searched databases, including 10,000 in-house Chinese exome sequences, and these mutations were confirmed as having been transmitted from the parents. Comparative amino acid sequence analysis across distantly related species revealed that the residues at positions 96 and 234 were evolutionarily highly conserved. In silico analysis predicted these changes to be damaging, and in vitro expression analysis revealed that the mutated alleles were associated with decreased protein production and impaired tetrameric protein formation. This study firstly reported that compound heterozygous mutations of the ALDH1A3 gene can result in anophthalmia in humans, thus highlighting those heterozygous mutations in ALDH1A3 should be considered for molecular screening in anophthalmia, particularly in cases from families without consanguineous relationships.

  9. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  10. Homozygosity mapping and targeted sanger sequencing reveal genetic defects underlying inherited retinal disease in families from pakistan.

    Directory of Open Access Journals (Sweden)

    Maleeha Maria

    Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.

  11. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  12. PECUNIA EX MACHINA: PAKISTANI ENTREPRENEURS IN THE CITY OF BARCELONA

    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García

    2010-12-01

    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  13. Hurler disease (mucopolysaccharidosis type IH: clinical features and consanguinity in Tunisian population

    Directory of Open Access Journals (Sweden)

    Chkioua Latifa

    2011-11-01

    Full Text Available Abstract Mucopolysaccharidosis type I (MPS I was a group of rare autosomal recessive disorder caused by the deficiency of the lysosomal enzyme, alpha -L -iduronidase, and the resulting accumulation of undergraded dematan sulfate and heparan sulfate. MPS I patients have a wide range of clinical presentations, that makes it difficult to predict patient phenotype which is needed for genetic counseling and also impedes the selection and evaluation of patients undergoing therapy bone marrow transplantation. Aim of the study consanguinity rates have been determined among 14 families with mucopolysaccharidosis type I, seen in the pediatric departments of different geographic areas of Tunisia (Central and Southern areas for the period August 2004 - August 2011 in order to investigate the relation between consanguinity and this disorder. Patients and methods Clinical and molecular analyses confirmed the diagnosis for MPS type I in the studied families. Results Most of the Tunisian MPS I patients have been identified at the homozygous status: p.P533R mutation (7 homozygous and one double heterozygous p.L578Q/p.P533R patients; 41.66% of all the investigated MPSI patients, p.F177S (1 homozygous patient; 5.55%, p.L530fs (1 patient; 5.55%, p.Y581X (2 patients; 11.11%, p.F602X (3 patients; 16.66%, p.R628X (1 patient; 5.55%. Another mutation: p.L578Q has been identified at the heterozygous status in the only double heterozygous p.L578Q/p.P533R case. Part of the mutations was the result of a founder effect. These described points are the consequences of the high rate of consanguinity. Conclusion The high frequency of p.P533R mutation could be explained by the high degree of inbreeding. This is due to the richness of the genetic background of the studied population. A multidisciplinary approach is essential to develop adequate preventive program adapted to the social, cultural, and economic context.

  14. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia.

    Science.gov (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali

    2008-06-30

    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  15. Consanguineous marriage in PR China: a study in rural Man (Manchu) communities.

    Science.gov (United States)

    Wang, W; Qian, Cong; Bittles, A H

    2002-01-01

    Although there is a long history of consanguineous marriage in China, information on its prevalence is very limited. The Man (Qing) dynasty ruled China for over 250 years, but no consanguinity studies have been reported on this important population. The objective of the present investigation was to determine the present-day level of consanguineous marriage in the Man community, and to compare the data with existing consanguinity information on other Chinese populations. The study was conducted in a group of 11 rural Man communities in the north-eastern Chinese province of Liaoning. Household-based interviews were conducted by local staff on 513 couples, 418 of whom were Man with another 95 Man-Han inter-ethnic marriages. Basic pedigrees were constructed to determine the biological relationship between each set of spouses. Thirty of the 418 couples were in a consanguineous union, with a mean coefficient of inbreeding alpha = 0.0012. The small population sizes of the study may have contributed to the spatial variation in the patterns of inbreeding. Across generations there was a reduction in consanguineous marriages and an increase in inter-ethnic unions, which paralleled changes in civil marriage regulations.

  16. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  17. CONSANGUINEOUS MARRIAGES AMONG IRANIAN MANDAEANS LIVING IN SOUTH-WEST IRAN.

    Science.gov (United States)

    Saadat, Mostafa; Zarghami, Mahdis

    2018-07-01

    SummarySeveral studies have indicated that consanguineous marriages (unions between biologically related persons) are associated with increased risk of autosomal recessive diseases and several multifactorial traits. Mandaeans are a closed ethno-religious community living in areas of southern Iraq and Iran (Khuzestan Province). There are currently no data on the prevalence of consanguineous marriages among Mandaeans. The present study was carried out in 2016 to determine the prevalence of consanguinity among Iranian Mandaeans living in Khuzestan Province, south-west Iran. A total of 137 couples (urban areas: 79 couples; rural areas: 58 couples) were included in the study. Information on the consanguineous marriages of the subjects was collected through direct interviews. Marriages were classified by the degree of relationship between couples as double first cousins, first cousins, first cousin once removed, second cousins and unrelated marriages. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for the population, stratified by rural and urban areas. The overall frequency of consanguinity was found to be 50.7% in urban and 86.2% in rural areas. There was a significant difference between rural and urban areas in types of marriages (χ 2=24.8, df=4, p<0.001) and first cousin marriages (51.8%) were the most common type. The overall α-value was estimated to be 0.0363 for the Iranian Mandaean population.

  18. Endogamy, consanguinity and community genetics

    Indian Academy of Sciences (India)

    Unknown

    Centre for Human Genetics, Edith Cowan University, 100 Joondalup Drive, Perth, WA 6027, Australia ... vidual mutation profiles, but to date the clinical con- .... rity of clinical studies only the effects of consanguinity ..... invest in the training of specialist medical, scientific, ... tions in a prospective study at a teaching hospital.

  19. Consanguinity and major genetic disorders in Saudi children: Acommunity-based cross-sectional study

    International Nuclear Information System (INIS)

    El-Mouzan, Mohammad I.; Al-Salloum, Abdullah A.; Al-Herbish, Abdullah S.; Qurachi, Mansour M.; Al-Omar, Ahmad A.

    2008-01-01

    There is a high rate of consanguinity in Saudi Arabia; however,information on its relationship with genetic disorders is limited. Theobjective of this cross-sectional study was to explore the role ofconsanguinity in genetic disorders. The study sample was determined by amultistage probability random sampling procedure. Primary care physiciansperformed a history and physical examination of all children and adolescentsyounger than 19 years and all cases of genetic diseases were recorded. Thechi-square test was used to compare proportions. During the two-year studyperiod (2004-2005), 11554 of 11874 (97%) mothers answered the question onconsanguinity and 6470 of 11554 (56%) were consanguineous. There was nosignificant association between first-cousin consanguinity and Down syndrome(P=0.55). Similarly, there was no significant association with either sicklecell disease (P=0.97) or glucose-6-phosphate dehydrogenase deficiency(P=0.67) for-cousin in consanguinity. A borderline statistical significancewas found for major congenital malformations (P=0.05). However, the mostsignificant association with first-cousin consanguinity was congenital heartdisease (CHD) (P=0.01). Finally, no significant association was found fortype 1 diabetes mellitus (P=0.92). For all types of consanguinity, similartrends of association were found, with a definite statistically significantassociation only with CHD (P=0.003). The data suggest a significant role ofparental consanguinity in CHD. However, a relationship between consanguinityand other genetic diseases could not be established. The effect ofconsanguinity on genetic diseases is not uniform and this should be takeninto consideration in genetic counseling. (author)

  20. Parental consanguinity and susceptibility to drug abuse among offspring, a case-control study.

    Science.gov (United States)

    Saadat, Mostafa; Vakili-Ghartavol, Roghayyeh

    2010-11-30

    Consanguineous marriage is the union of individuals having at least one common ancestor. It is well established that consanguinity is a potential risk factor for many adverse health outcome of offspring. In the present case-control study we tested the hypothesis of an association between parental consanguinity marriages and risk of offspring substance abuse. The study was performed in Shiraz (Fars province, Iran). Here 156 male drug abusers (case group) and 264 randomly selected healthy blood donors, matched for age and gender as control group, were included in the study. The prevalence of parental consanguineous marriages in the studied sample was 39.1 and 28.0% among cases and controls, respectively. The difference was statistically significant. The substance abusers were more smokers and drinkers compared with the control group. There was significant negative linear trend between drug abuse and level of education. The participants stratified using drinking habits and then the analysis was carried out separately for drinker and non-drinker subjects. Among drinkers, neither before nor after adjusting for smoking status and educational level, parental consanguinity did not show association with risk of substance abuse. Among non-drinkers, after adjusting for smoking status and educational level, parental consanguineous marriage was significantly associated with increased risk of substance abuse. Our study supports a significant relationship between parental consanguinity and drug abuse among non-drinker subjects. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. Modernization or cultural maintenance: the practice of consanguineous marriage in Iran.

    Science.gov (United States)

    Jalal Abbasi-Shavazi, Mohammad; McDonald, Peter; Hosseini-Chavoshi, Meimanat

    2008-11-01

    Consanguineous marriage has been the culturally preferred form of marriage in Iran. This paper examines the extent to which education, urbanization and changes in modes of economic production have affected the incidence of consanguineous marriage and attitudes towards consanguineous marriages. The 2002 Iran Fertility Transition Survey conducted in the four provinces of Gilan, Sistan and Baluchistan, Yazd and West Azarbaijan provides information on the degree of relationship of marriage partners from around 6550 ever-married women aged 15-49. Attitudinal data were also obtained. Overall, the level of marriage to biological relatives ranged from 23% in Gilan to 78% in Sistan and Baluchistan. The paper finds that the practice of marriage to biological relatives has remained surprisingly resilient in the face of modernizing influences and that ethnicity, province and area of residence remain important determinants. On the other hand, attitudes have shifted towards marriage with a non-relative. Anthropological research would illuminate the processes of consanguineous marriage in Iran.

  2. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  3. Inactivation of IL11 signaling causes craniosynostosis, delayed tooth eruption, and supernumerary teeth

    DEFF Research Database (Denmark)

    Nieminen, Pekka; Morgan, Neil V; Fenwick, Aimée L

    2011-01-01

    Craniosynostosis and supernumerary teeth most often occur as isolated developmental anomalies, but they are also separately manifested in several malformation syndromes. Here, we describe a human syndrome featuring craniosynostosis, maxillary hypoplasia, delayed tooth eruption, and supernumerary...... teeth. We performed homozygosity mapping in three unrelated consanguineous Pakistani families and localized the syndrome to a region in chromosome 9. Mutational analysis of candidate genes in the region revealed that all affected children harbored homozygous missense mutations (c.662C>G [p.Pro221Arg], c...... for the treatment of craniosynostosis....

  4. Prevalence of consanguineous marriages among shi'a populations of Lebanon.

    Science.gov (United States)

    El-Kheshen, Ghadir; Saadat, Mostafa

    2013-09-01

    In genetics, a consanguineous marriage means union between couples who are related as second cousins or closer. The present cross-sectional study was carried out in order to illustrate the prevalence and types of consanguineous marriages in the Shi'a population living in widespread territories in Lebanon including the Bekaa Valley, the south of Lebanon and the southern suburb of Beirut. Data on types of marriages were collected using a simple questionnaire. The total number of couples in the study was 1203. Consanguineous marriage was classified by the degree of relationship between couples. The overall frequency of consanguinity was found to be 28.4%, with first cousin marriages (21.3%) being the most common type followed by first cousins once removed (5.5%), then double first cousins (0.8%). The frequencies of second cousin and beyond second cousin marriages were the same at 0.4% of all the marriages. The mean inbreeding coefficient (α) was estimated at about 0.0161 for the population. There were no significant differences between the three studied territories for frequencies of different types of marriages (p>0.1), nor were there significant differences between the rural and urban areas (p>0.1).

  5. Consanguineous marriages and matrimonial distance: a study among three South Indian caste groups.

    Science.gov (United States)

    Reddy, P G

    1988-12-01

    Reddy studies consanguineous marriages and matrimonial distance in 3 castes of Nellore district, Andhra Pradesh, South India. The castes include the well-to-do agricultural caste, the Desuri Kapu; the 2nd, artisan caste in the middle of the hierarchy, the Devanga; and the third caste at the bottom of the social ladder, the Mala. During field work conducted in 1978-1979, prominent elders of the villages were approached; information on the consanguinity of marriage and matrimonial distance was gathered through intensive interviews of both men and women from all the households of the 3 castes. Among the total of 979 marriages, 28.9% occurred within the village, the proportion of intra-village marriages being significantly higher in Nellore taluk than in Sullurpet. The 3 castes overall show little difference in the incidence of intra-village marriages, but there is some within caste regional variation in the incidence of intra-village marriages, the Devanga showing a significantly higher incidence in Nellore than in Sullurpet. Intra-village marriages are more common among consanguineous couples (41.5%) than among non-consanguineous (18.3%), a highly significant excess in each of the caste groups. In short, Reddy concludes that intra-village marriages are more common among consanguineous couples than non-consanguineous, and mean matrimonial distance is also lower.

  6. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  7. Genome-wide linkage in a highly consanguineous pedigree reveals two novel loci on chromosome 7 for non-syndromic familial Premature Ovarian Failure.

    Directory of Open Access Journals (Sweden)

    Sandrine Caburet

    Full Text Available BACKGROUND: The human condition known as Premature Ovarian Failure (POF is characterized by loss of ovarian function before the age of 40. A majority of POF cases are sporadic, but 10-15% are familial, suggesting a genetic origin of the disease. Although several causal mutations have been identified, the etiology of POF is still unknown for about 90% of the patients. METHODOLOGY/PRINCIPAL FINDINGS: We report a genome-wide linkage and homozygosity analysis in one large consanguineous Middle-Eastern POF-affected family presenting an autosomal recessive pattern of inheritance. We identified two regions with a LOD(max of 3.26 on chromosome 7p21.1-15.3 and 7q21.3-22.2, which are supported as candidate regions by homozygosity mapping. Sequencing of the coding exons and known regulatory sequences of three candidate genes (DLX5, DLX6 and DSS1 included within the largest region did not reveal any causal mutations. CONCLUSIONS/SIGNIFICANCE: We detect two novel POF-associated loci on human chromosome 7, opening the way to the identification of new genes involved in the control of ovarian development and function.

  8. Inbreeding coefficients and degree of consanguineous marriages in Spain: a review.

    Science.gov (United States)

    Fuster, Vicente; Colantonio, Sonia Edith

    2003-01-01

    The contribution of consanguineous marriages corresponding to uncle-niece or aunt-nephew (C12), first cousin (C22), first cousin once removed (C23), and second cousin (C33) to the inbreeding coefficient (alpha) was analyzed from a sample of Spanish areas and periods. Multiple regressions were performed taking as independent variables the different degrees of consanguinity previously selected (C12, C22, C23, and C33) and as dependent variable the inbreeding coefficient (alpha). According to the results obtained for any degree and period, rural frequencies always surpass urban. However, the pattern is similar in both areas. In the period where consanguinity was more elevated (1890-1929) the C22/C33 ratio increased. Its variation is not due to C22 and C33 changes in the same way. In rural areas, this ratio surpasses the expected value by a factor of 2-3, but in urban areas it was 7-10 times larger, in some cases due to migration. While in rural Spain the C33 frequency was approximately 1.5 times C22, in cities C22 was 1.5 times C33. The best fit among the various types of consanguineous matings and alpha involves a lineal relationship. Regardless of the number of variables contributing significantly to alpha, C22 matings are always present. Moreover, their standardized (beta) coefficients are the highest. The above indicates that this consanguineous relationship conditions the inbreeding coefficient the most. In the period of greater consanguinity, close relationships, uncle-niece C12, and first cousin once removed (C23) make a significant contribution to alpha. In rural Spain second cousins (C33) always significantly determined alpha; however, in cities the inbreeding variation was mainly due to C12 and C23. Copyright 2003 Wiley-Liss, Inc.

  9. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements

    Science.gov (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim

    2015-01-01

    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  10. Phenotypic Progression of Stargardt Disease in a Large Consanguineous Tunisian Family Harboring New ABCA4 Mutations

    Directory of Open Access Journals (Sweden)

    Yousra Falfoul

    2018-01-01

    Full Text Available To assess the progression of Stargardt (STGD disease over nine years in two branches of a large consanguineous Tunisian family. Initially, different phenotypes were observed with clinical intra- and interfamilial variations. At presentation, four different retinal phenotypes were observed. In phenotype 1, bull’s eye maculopathy and slight alteration of photopic responses in full-field electroretinography were observed in the youngest child. In phenotype 2, macular atrophy and yellow white were observed in two brothers. In phenotype 3, diffuse macular, peripapillary, and peripheral RPE atrophy and hyperfluorescent dots were observed in two sisters. In phenotype 4, Stargardt disease-fundus flavimaculatus phenotype was observed in two cousins with later age of onset. After a progression of 9 years, all seven patients displayed the same phenotype 3 with advanced stage STGD and diffuse atrophy. WES and MLPA identified two ABCA4 mutations M1: c.[(?_4635_(5714+?dup; (?_6148_(6479_+? del] and M2: c.[2041C>T], p.[R681∗]. In one branch, the three affected patients had M1/M1 causal mutations and in the other branch the two affected patients had M1/M2 causal mutations. After 9-year follow-up, all patients showed the same phenotypic evolution, confirming the progressive nature of the disease. Genetic variations in the two branches made no difference to similar end-stage disease.

  11. The prevalence of isolated growth hormone deficiency among children of short stature in Jordan and its relationship with consanguinity.

    Science.gov (United States)

    Zayed, Ayman A; Mustafa Ali, Moaath K; Al-Ani, Mohammad A; Momani, Munther S; Yousef, Al-Motassem F

    2014-12-01

    The prevalence of isolated growth hormone deficiency (IGHD) among short-statured children in Jordan, where consanguineous marriage (CM) is common, is unknown. No studies have investigated the relationship between degrees of consanguinity and IGHD. This study aimed to determine the prevalence of IGHD among short-statured children referred to a university hospital in Jordan and its relationship with different degrees of consanguinity. We conducted a 24-month cross-sectional observational trial at an outpatient tertiary care center in Amman, Jordan. We obtained detailed family histories, medical evaluations and laboratory tests for 94 short-statured children (50 boys and 44 girls aged 6-16 years). Complete and partial GHD were defined as peak GH responses of 5 and 7 μg/l (15 and 21 mIU/l) [IRMA/DiaSorin®], respectively, in both exercise and insulin tolerance tests. GHD was diagnosed in 69·1% of the short children, including 86% (43/50) of the children of consanguineous parents (83·3%, 93·8% and 81·8% of children of first cousins, first cousins once removed and second cousins, respectively) and 50% (20/44) of the children of nonconsanguineous parents (P = 0·039, 0·002 and 0·013, respectively). However, there was no statistically significant difference in the prevalence of small pituitary MRI between GH-deficient children of consanguineous parents and those of nonconsanguineous parents (28·6% vs 13·6%, P = 0·3). The prevalence of IGHD among referred short children in Jordan was exceptionally high and significantly higher in the children of CM. In countries where CM is common, preconception counselling and rigorous surveillance for GHD in short children may be indicated. © 2014 John Wiley & Sons Ltd.

  12. Inbreeding in Gredos mountain range (Spain): contribution of multiple consanguinity and intervalley variation.

    Science.gov (United States)

    Fuster, V; Jiménez, A M; Colantonio, S E

    2001-04-01

    The present paper examines consanguineous marriages occurring between 1874 and 1975 in three valleys (Tormes, Alberche, and Tiétar) in the Sierra de Gredos mountain range, Avila province, Spain. Information was obtained from parish registers of 42 localities, corresponding to a total of 41,696 weddings. Consanguineous marriages were defined as those up to the third degree of consanguinity (second cousins). From 1874 to 1975 the percentage of related mates was 4.45% and the inbreeding coefficient was 0.0011868 (for 1874 to 1917 corresponding figures up to the fourth degree were 16.44% and 0.00 19085, respectively). In order to ascertain the characteristics and evolution of mating patterns in Gredos, the contribution of each degree of kinship was analyzed as a whole and then for each valley separately. Regarding total consanguineous marriages in Gredos, there is a low frequency of uncle-niece matings (0.21%) and a first-second cousin mating ratio (C22/C33) of 0.23 (up to the third degree of consanguinity). Before 1918 multiple matings (i.e., those involving more than a single relationship) accounted for 19.16% of consanguineous marriages (up to the fourth degree). The observed frequencies of multiple consanguineous marriages was, on average, about twice that expected at random, and the proportion of such marriages to total inbreeding was 34.65%. The temporal change of the Gredos inbreeding pattern was characterized by a recent decrease; the highest inbreeding levels correspond to the period from 1915 to 1944. Finally, intervalley differences (maximum inbreeding coefficient in the Tormes, minimum in the Tiétar) are interpreted considering the geography, population size, and population mobility for each valley

  13. Cerebro-costo-mandibular syndrome with consanguinity

    International Nuclear Information System (INIS)

    Clarke, E.A.; Nguyen, V.D.

    1985-01-01

    The cerebro-costo-mandibular syndrome is a rare disorder characterized by unique posterior rib defectes, micrognathia, and mental deficiency. The mode of transmission is undetermined. This report describes the first case with documented parental consanguinity as well as hitherto undescribed CT and skeletal findings. (orig.)

  14. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.

    2018-01-01

    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  15. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah

    2005-01-01

    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  16. Effect of consanguinity on birth defects in Saudi women; results from a nested case-control study

    DEFF Research Database (Denmark)

    Majeed-Saidan, Muhammad Ali; Ammari, Amer N; AlHashem, Amal M

    2015-01-01

    BACKGROUND: The role of consanguinity in the etiology of structural birth defects outside of chromosomal and inherited disorders has always been debated. We studied the independent role of consanguinity on birth defects in Saudi women with a high prevalence of consanguineous marriages. METHODS: T...

  17. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  18. A novel homozygous variant in the SMOC1 gene underlying Waardenburg anophthalmia syndrome.

    Science.gov (United States)

    Ullah, Asmat; Umair, Muhammad; Ahmad, Farooq; Muhammad, Dost; Basit, Sulman; Ahmad, Wasim

    2017-01-01

    Waardenburg anophthalmia syndrome (WAS), also known as ophthalmo-acromelic syndrome or anophthalmia-syndactyly, is a rare congenital disorder that segregates in an autosomal recessive pattern. Clinical features of the syndrome include malformation of the eyes and the skeleton. Mostly, WAS is caused by mutations in the SMOC-1 gene. The present report describes a large consanguineous family of Pakistani origin segregating Waardenburg anophthalmia syndrome in an autosomal recessive pattern. Genotyping followed by Sanger sequencing was performed to search for a candidate gene. SNP genotyping using AffymetrixGeneChip Human Mapping 250K Nsp array established a single homozygous region among affected members on chromosome 14q23.1-q24.3 harboring the SMOC1 gene. Sequencing of the gene revealed a novel homozygous missense mutation (c.812G>A; p.Cys271Tyr) in the family. This is the first report of Waardenburg anophthalmia syndrome caused by a SMOC1 variant in a Pakistani population. The mutation identified in the present investigation extends the body of evidence implicating the gene SMOC-1 in causing WAS.

  19. Prevalence of consanguineous marriages in west and south of Afghanistan.

    Science.gov (United States)

    Saadat, Mostafa; Tajbakhsh, Khadijeh

    2013-11-01

    The prevalence of consanguinity in eight provinces of Afghanistan has recently been reported by Saify & Saadat (2012). The present cross-sectional study was done in order to illustrate the prevalence and types of consanguineous marriages among other populations of Afghanistan. Data on types of marriages were collected using a simple questionnaire. The total number of couples in this study was 5200 from the following provinces: Farah, Ghazni, Herat, Hilmand, Kabul, Kandahar, Logar, Parwan and Wardak. Consanguineous marriages were classified by the degree of relationship between couples: double first cousins, first cousins, first cousins once removed, second cousins and beyond second cousins. The coefficient of inbreeding (F) was calculated for each couple and the mean coefficient of inbreeding (α) estimated for each population. The α in the country was 0.0226, ranging from 0.0203 in Farah province to 0.0246 in Herat province. There were significant differences between provinces for frequencies of different types of marriages (pconsanguineous marriages, followed by second cousins (16.0%), first cousins once removed (14.0%), beyond second cousins (6.9%) and double first cousins (1.6%). There was significant difference between ethnic groups for the types of marriages (pconsanguinity among ethnic groups in Afghanistan, respectively. The present study shows that the Afghani populations, the same as other Islamic populations, have high levels of consanguinity.

  20. Comparative Analysis of the Indian and Pakistani Nuclear Energy Development Programmes

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2015-01-01

    Full Text Available Due to the traditional competition between India and Pakistan, their strategic fields developing are interdependent. Nuclear power development programs are concerned as well. Pakistan falls behind India in this branch, however the specifics of the nuclear infrastructure let the potential of the states be relatively balanced. After Nuclear Suppliers Group granted a waiver to India in 2008 and Russia, France and USA, the new participants, broke into the market, India obtained an opportunity to make a breakthrough in the national nuclear program development, thus violating a status quo in fuel cycle technologies. Such chances stimulated China to violate the NSG guidelines and non-proliferations principles to get involved in Pakistani nuclear program development. The nuclear power Indian-Pakistani competition prospects largely depend on the Chinese position. Despite the international community suspects the Pakistani officials in nuclear black market dealing and the NSG guidelines China obviously supports the Pakistani nuclear field. This may result in preventing of escalation of tensions in the region. 

  1. Survey of familial glaucoma shows a high incidence of cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in non-consanguineous congenital forms in a Spanish population

    Science.gov (United States)

    Millá, Elena; Mañé, Begoña; Duch, Susana; Hernan, Imma; Borràs, Emma; Planas, Ester; Dias, Miguel de Sousa; Carballo, Miguel

    2013-01-01

    Purpose To identify myocilin (MYOC) and cytochrome P450, family 1, subfamily B, polypeptide 1 (CYP1B1) mutations in a Spanish population with different clinical forms of familial glaucoma or ocular hypertension (OHT). Methods Index patients from 226 families participated in this study. Patients were diagnosed with familial glaucoma or OHT by complete ophthalmologic examination. Screening for MYOC mutations was performed in 207 index patients: 96 with adult-onset primary open-angle glaucoma (POAG), 21 with primary congenital glaucoma (PCG), 18 with juvenile-onset open-angle glaucoma (JOAG), five with Axenfeld-Rieger syndrome (ARS), and 67 with other types of glaucoma. One hundred two of the families (including all those in whom a MYOC mutation was detected) were also screened for CYP1B1 mutations: 45 POAG, 25 PCG, 21 JOAG, four ARS, and seven others. Results We examined 292 individuals (patients and relatives) with a positive family history of glaucoma or OHT. We identified two novel MYOC variants, p.Lys39Arg and p.Glu218Lys, in two families with POAG, and six previously reported MYOC mutations in seven families with POAG (four), JOAG (one), PCG (one), and normotensive glaucoma (one). CYP1B1 mutations were found in 16 index patients with PCG (nine), POAG (three), JOAG (two), and ARS (two). Conclusions The high percentage (9/25=36%) of mutations in CYP1B1 found in non-consanguineous patients with congenital glaucoma mandates genetic testing. However, the percentage of mutations (9/207=4.4%) in MYOC associated with glaucoma is relatively low in our population. The variable phenotype expression of glaucoma, even in families, cannot be explained with a digenic mechanism between MYOC and CYP1B1. PMID:23922489

  2. Consanguineous marriage in an urban area of Saudi Arabia: rates and adverse health effects on the offspring.

    Science.gov (United States)

    al-Abdulkareem, A A; Ballal, S G

    1998-02-01

    The objective of this cross-sectional study was to determine the pattern and time trend of consanguineous marriage and its adverse health effects on the offspring in Dammam city, Eastern Province, in the Kingdom of Saudi Arabia. This city is known to attract Saudis from different parts of the country because it is in the heart of this industrial region. Five primary health care centers were randomly selected from different sectors of the city in addition to the city's only Maternity and Children's Hospital. For inclusion in the study a wife must have at least one pregnancy that terminated in either full term liveborn baby, still birth, or abortion. A total of 1307 ever-married Saudis completed a pre-structured questionnaire during an interview. The rate of consanguineous marriage was 52.0% with an average inbreeding coefficient of 0.0312. First-cousin marriages were the commonest (39.3%) of all matings. The consanguineous groups had a significantly higher number of pregnancies. The mean birth weight of the offspring of consanguineous couples was not statistically significant being less than that of the non-consanguineous. However, within the consanguineous groups the more closely related couples had smaller babies on average. No significant differences were noted for the rates of inherited diseases and reproductive wastage. The rate of consanguineous marriage in this city was high and so was the inbreeding coefficient. These figures place this nation among the countries with a high rate of consanguineous marriages. A nationwide study to determine accurately the relationship between consanguinity and inherited diseases has much to commend it.

  3. Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2010-11-01

    To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

  4. Association of food security status with overweight and dietary intake: exploration of White British and Pakistani-origin families in the Born in Bradford cohort.

    Science.gov (United States)

    Yang, T C; Sahota, P; Pickett, K E; Bryant, M

    2018-04-24

    Food insecurity has been associated with dietary intake and weight status in UK adults and children although results have been mixed and ethnicity has not been explored. We aimed to compare prevalence and trajectories of weight and dietary intakes among food secure and insecure White British and Pakistani-origin families. At 12 months postpartum, mothers in the Born in Bradford cohort completed a questionnaire on food security status and a food frequency questionnaire (FFQ) assessing their child's intake in the previous month; at 18 months postpartum, mothers completed a short-form FFQ assessing dietary intake in the previous 12 months. Weights and heights of mothers and infants were assessed at 12-, 24-, and 36-months postpartum, with an additional measurement of children taken at 4-5 years. Associations between food security status and dietary intakes were assessed using Wilcoxon-Mann-Whitney for continuous variables and χ 2 or Fisher's exact tests for categorical variables. Quantile and logistic regression were used to determine dietary intakes adjusting for mother's age. Linear mixed effects models were used to assess longitudinal changes in body mass index (BMI) in mothers and BMI z-scores in children. At 12 months postpartum, White British mothers reported more food insecurity than Pakistani-origin mothers (11% vs 7%; p secure (β = 0.44 units, 95% CI: 0.33, 0.55). This was also found in Pakistani-origin children (BMI z-score: food insecure β = 0.40 units, 95% CI: 0.22, 0.59; food secure β = 0.25 units, 95% CI: 0.20, 0.29). No significant increases in BMI were observed for food secure or insecure White British mothers while BMI z-score increased by 0.17 (95% CI: 0.13, 0.21) for food secure White British children. Food insecure mothers and children had dietary intakes of poorer quality, with fewer vegetables and higher consumption of sugar-sweetened drinks. Food security status is associated with body weight and dietary intakes

  5. Consanguinity in Qatar: knowledge, attitude and practice in a population born between 1946 and 1991.

    Science.gov (United States)

    Sandridge, A L; Takeddin, J; Al-Kaabi, E; Frances, Y

    2010-01-01

    From March 2007 to March 2008 a cross-sectional study was conducted in Qatar to estimate the prevalence of consanguinity among Qataris and to assess their knowledge of the risks and their attitudes towards the practice. A secondary objective was to test the acceptability of sixteen Likert-style questions within the Qatari population. Face-to-face interviews using a 70-item structured questionnaire were conducted by three native Arabic-speaking medical students with 362 Qatari employees. Where consanguinity existed between the employee's parents, a diagram of the consanguinal relationship (phylogram) was completed. The response rate was 93%. By phylogram, 22% of participants reported a cousin relationship between their parents (consanguinal relationship) and another 15% reported that their parents were from the same tribe (affinal relationship). With respect to their own marital decision, 68% of the respondents had been married at least once. By phylogram, 35% of these reported a consanguineous relationship (first marriage), 9% reported only an affinal relationship and 56% reported that they were not married to a blood relative. Results on the sixteen Likert-style attitude questions were stratified by consanguinity status of parents and of self. In the stratification by consanguinity status of parents the top five attitudes differed by group but there appeared to be more similarity between the consanguinal and only tribal groups. Attitudinal results were stratified by sex. Results showed that the males had a stronger belief in several of the attitudes than females with the exception of causation of genetic abnormalities and health problems. The phylogram was shown to collect more detailed and explicit data than hard-coding. With respect to knowledge, the results showed that knowledge was imperfect with high proportions of participants not knowing that consanguinity has been implicated in autosomal recessive diseases such as thalassaemia, inborn errors of metabolism

  6. Stories of pain and health by elderly Pakistani women in Norway.

    Science.gov (United States)

    Sverre, Beate Lie; Solbrække, Kari Nyheim; Eilertsen, Grethe

    2014-11-01

    This ethnographic study investigates the stories of elderly Pakistani women living in Norway. Migration studies indicate that elderly migrant women are passive, ill victims caught in a marginalized position due to age, ethnicity and gender, and thus have little access to opposition and agency. To broaden the picture it is necessary to develop an innovative approach to understand what is implicated in the process of migration. The importance of considering life conditions that surrounds potential health promotion behaviors of immigrants is stressed by several researchers. However, up to now limited research guided by this perspective has been done in Norway. Therefore, this study explored how elderly Pakistani women in Norway promote their health and well-being through some distinct social interactions. The intention is to bring awareness to how health, even by so-called disadvantaged social groups, may take place. These practices are important to take into consideration when developing health-promoting policies for elderly immigrants. An ethnographic study of 15 Pakistani women, aged 53-75, was carried out in a multisided fieldwork in Oslo using participant observation and ethnographic interviews. The analytical approach was inspired by the constructivist theoretical framework of narrative ethnography. The elderly Pakistani women in Norway construct stories of living in-between cultures and experiences of acculturative stress caused by being elderly, immigrants and women. However, this analysis also suggests that through distinct social relationships, primarily in the context of a voluntary organization, elderly Pakistani women do health by the way they interact and construct a repertoire of social identities. The healing practices taking place among elderly Pakistani women may counteract the negative health outcomes associated with age, migration and gender implications for immigrant health-promoting policy in Norway may be to increase the establishment and

  7. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K

    2017-01-01

    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  8. The decline in consanguineous marriage among Muslims in Israel: The role of education

    Directory of Open Access Journals (Sweden)

    Jona Schellekens

    2017-12-01

    Full Text Available Background: There are two explanations for the inverse relationship between consanguinity and women's education. The female empowerment hypothesis posits that better-educated women will demand more freedom in choosing a marriage partner, whereas the role incompatibility hypothesis posits that school enrollment may prevent women from fulfilling spousal obligations. Objective: This article presents estimates of the relative contributions of school enrolment and educational attainment to the decline in consanguineous marriage. Methods: Our data comes from three rounds of the Palestinians in Israel Socio-Economic Survey. Using multinomial logistic regression analysis, we estimated discrete-time event history models to assess the effects of education on the probability of a consanguineous marriage. To test the two hypotheses we constructed two distinct education vectors for each woman from information on the number of years of schooling. The first charts yearly enrolment in education, whereas the second vector reflects actual attainment in each year. Results: Between 1975‒1979 and 2005‒2010, consanguineous marriage declined by almost 60Š. The rise in the age of leaving school explains about a third of the decline. Educational attainment did not contribute to the decline. Contribution: To the best of our knowledge, this is the first study to present estimates of the relative contributions of school enrolment and educational attainment to the decline in consanguineous marriage.

  9. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    OpenAIRE

    Summaira Naz

    2015-01-01

    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  10. Genealogical and molecular analysis of a family-based cohort of congenital heart disease patients from the São Miguel Island (Azores, Portugal).

    Science.gov (United States)

    Cabral, Rita; Pires, Renato; Anjos, Rui; Branco, Claudia C; Maciel, Paula; Mota-Vieira, Luisa

    2016-11-01

    Congenital heart disease (CHD) is one common birth malformation, accounting for ∼30% of total congenital abnormalities. Considering the unknown role of consanguinity in causing CHD, this study hypothesised that consanguineous unions and/or familial aggregation may be frequent in the Azorean Island of São Miguel (Portugal). To that end, a retrospective observational study was performed based on genealogical and molecular analyses. The study enrolled 112 CHD patients from São Miguel Island, which allowed the assessment of type of family (simplex or multiplex), parental consanguinity and grandparental endogamy. Based on 15 STR markers, inbreeding coefficients (F IS ) in the CHD cohort and healthy control group (n = 114) were estimated. Multiplex families were 37.6% (n = 41/109), a rate considerably higher than previously described in the literature (genealogical and genetic features related with CHD, revealing the presence of parental consanguinity and extensive familial aggregation in the CHD patients from São Miguel Island.

  11. Association between consanguinity and survival of marriages ...

    African Journals Online (AJOL)

    Background and purpose: The present study was performed to investigate the association between consanguineous marriages and divorce risk. Materials and methods: A total of 496 couples at divorce time and 800 couples from general population who have no plan for divorce (as control group) were included in the study.

  12. Consanguinity and its relevance to clinical genetics

    African Journals Online (AJOL)

    Rabah M. Shawky

    2013-01-29

    Jan 29, 2013 ... Autosomal dominant e.g. Marfan's syndrome and achondroplasia. ... In X-linked diseases consanguineous marriage was de- tected in all cases of ..... government should put strict laws for premarital tests. Conflict of interest .... V. Genetic contribution to high neonatally lethal malformation rate in the United ...

  13. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2006-01-01

    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  14. Prevalence and risk factors of helicobacter pylori infection among Pakistani population

    International Nuclear Information System (INIS)

    Rasheed, F.; Ahmad, T.; Bilal, B.

    2012-01-01

    Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

  15. Semi-legal family life

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    In 2002, the Danish government introduced new legislation on family reunification to restrict the transnational arranged marriages that were occurring among some immigrant groups. Since then, thousands of people have emigrated from Denmark to Sweden where, as citizens of the European Union, they ...... patterns and family life among Pakistani immigrants but also have long- lasting effects on the relationship between minorities and majorities in Denmark....

  16. Mutation Analysis of Consanguineous Moroccan Patients with Parkinson’s Disease Combining Microarray and Gene Panel

    Directory of Open Access Journals (Sweden)

    Ahmed Bouhouche

    2017-10-01

    Full Text Available During the last two decades, 15 different genes have been reported to be responsible for the monogenic form of Parkinson’s disease (PD, representing a worldwide frequency of 5–10%. Among them, 10 genes have been associated with autosomal recessive PD, with PRKN and PINK1 being the most frequent. In a cohort of 145 unrelated Moroccan PD patients enrolled since 2013, 19 patients were born from a consanguineous marriage, of which 15 were isolated cases and 4 familial. One patient was homozygous for the common LRRK2 G2019S mutation and the 18 others who did not carry this mutation were screened for exon rearrangements in the PRKN gene using Affymetrix Cytoscan HD microarray. Two patients were determined homozygous for PRKN exon-deletions, while another patient presented with compound heterozygous inheritance (3/18, 17%. Two other patients showed a region of homozygosity covering the 1p36.12 locus and were sequenced for the candidate PINK1 gene, which revealed two homozygous point mutations: the known Q456X mutation in exon 7 and a novel L539F variation in exon 8. The 13 remaining patients were subjected to next-generation sequencing (NGS that targeted a panel of 22 PD-causing genes and overlapping phenotypes. NGS data showed that two unrelated consanguineous patients with juvenile-onset PD (12 and 13 years carried the same homozygous stop mutation W258X in the ATP13A2 gene, possibly resulting from a founder effect; and one patient with late onset (76 years carried a novel heterozygous frameshift mutation in SYNJ1. Clinical analysis showed that patients with the ATP13A2 mutation developed juvenile-onset PD with a severe phenotype, whereas patients having either PRKN or PINK1 mutations displayed early-onset PD with a relatively mild phenotype. By identifying pathogenic mutations in 45% (8/18 of our consanguineous Moroccan PD series, we demonstrate that the combination of chromosomal microarray analysis and NGS is a powerful approach to

  17. Do consanguineous parents of a child affected by an autosomal recessive disease have more DNA identical-by-descent than similarly-related parents with healthy offspring? Design of a case-control study

    Directory of Open Access Journals (Sweden)

    Cornel Martina C

    2010-07-01

    Full Text Available Abstract Background The offspring of consanguineous relations have an increased risk of congenital/genetic disorders and early mortality. Consanguineous couples and their offspring account for approximately 10% of the global population. The increased risk for congenital/genetic disorders is most marked for autosomal recessive disorders and depends on the degree of relatedness of the parents. For children of first cousins the increased risk is 2-4%. For individual couples, however, the extra risk can vary from zero to 25% or higher, with only a minority of these couples having an increased risk of at least 25%. It is currently not possible to differentiate between high-and low-risk couples. The quantity of DNA identical-by-descent between couples with the same degree of relatedness shows a remarkable variation. Here we hypothesize that consanguineous partners with children affected by an autosomal recessive disease have more DNA identical-by-descent than similarly-related partners who have only healthy children. The aim of the study is thus to establish whether the amount of DNA identical-by-descent in consanguineous parents of children with an autosomal recessive disease is indeed different from its proportion in consanguineous parents who have healthy children only. Methods/Design This project is designed as a case-control study. Cases are defined as consanguineous couples with one or more children with an autosomal recessive disorder and controls as consanguineous couples with at least three healthy children and no affected child. We aim to include 100 case couples and 100 control couples. Control couples are matched by restricting the search to the same family, clan or ethnic origin as the case couple. Genome-wide SNP arrays will be used to test our hypothesis. Discussion This study contains a new approach to risk assessment in consanguineous couples. There is no previous study on the amount of DNA identical-by-descent in consanguineous

  18. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2007-01-01

    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  19. Early detection of leprosy by examination of household contacts, determination of serum anti-PGL-1 antibodies and consanguinity

    Directory of Open Access Journals (Sweden)

    Renata Bazan-Furini

    2011-08-01

    Full Text Available A cross-sectional clinical trial in which the serum anti-phenolic glycolipid (anti-PGL-1 antibodies were analysed in household contacts (HHC of patients with leprosy as an adjunct early leprosy diagnostic marker was conducted. The families of 83 patients underwent clinical examination and serum anti-PGL1 measurement using enzyme-linked immunosorbent assay. Of 320 HHC, 98 were contacts of lepromatous leprosy (LL, 80 were contacts of borderline lepromatous (BL, 28 were contacts of borderline (BB leprosy, 54 were contacts of borderline tuberculoid (BT, 40 were contacts of tuberculoid (TT and 20 were contacts of indeterminate (I leprosy. Consanguinity with the patients was determined for 232 (72.5% HHC. Of those 232 contacts, 183 had linear consanguinity. Forty-nine HHC had collateral consanguinity. Fifty-eight contacts (18.1% tested positive for anti-PGL1 antibodies. The number of seropositive contacts based on the clinical forms of the index case was 17 (29.3% for LL, 15 (25.9% for BL, one (1.7% for BB, 14 (24.1% for BT, three (5.2% for TT and eight (13.7% for I. At the one year follow-up, two (3.4% of these seropositive contacts had developed BT leprosy. The results of the present study indicate that the serum anti-PGL-1 IgM antibody may be useful for evaluating antigen exposure and as a tool for an early leprosy diagnosis in HHC.

  20. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

    Science.gov (United States)

    Ali, Zarqa S.

    2014-01-01

    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  1. Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

    International Nuclear Information System (INIS)

    Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.

    2015-01-01

    Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

  2. Pre-marital genetic counselling to consanguineous couples: attitudes, beliefs and decisions among counselled, noncounselled and unrelated couples in Israel.

    Science.gov (United States)

    Shiloh, S; Reznik, H; Bat-Miriam-Katznelson, M; Goldman, B

    1995-11-01

    Semi-structured interviews were conducted with 65 Israeli subjects who received genetic counselling while considering marriage to a close relative, 40 subjects married to a close relative who did not receive pre-marital genetic counselling, and 125 controls married to a nonrelative and never having considered marrying a relative. It was found that 72% of the consanguineous couples who received pre-marital genetic counselling proceeded with their plans and married their relative; 86% of them reported that the counselling influenced their final decision to some degree. Counsellees' appraisals of genetic counselling revealed unfulfilled expectations to obtain more definitive answers, and mixed reactions to the nondirective approach applied by the counsellors. Comparisons between consanguineous and control couples revealed different views about consanguinity in general, and genetic risks in particular. Consanguineous couples, unlike controls, perceived consanguinity as an ordinary form of marriage, and had more favorable attitudes towards it. Compared to the noncounselled consanguineous group, consanguineous couples who received pre-marital genetic counselling had fewer children, estimated their genetic risk as lower but its subjective significance as higher, and perceived genetic disorders as more severe. The implications of these results are discussed from both theoretical and practical standpoints.

  3. Work-family conflict in South Asia : The case of Pakistan

    NARCIS (Netherlands)

    Syed, S.; Memon, S.B.; Goraya, N.A.; Schalk, R.; Freese, C.

    2016-01-01

    This study gives a picture of work-family conflict in South Asia, specifically the views of Pakistani Bank employees on antecedents and outcomes of work -family conflicts. We use the framework of the psychological contract to understand work-to family conflict for both employees and managers, to see

  4. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-

    2006-01-01

    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  5. Assessing the influence of consanguinity on congenital heart disease

    Directory of Open Access Journals (Sweden)

    Alan H Bittles

    2011-01-01

    Full Text Available Numerous articles have been published linking consanguineous marriage to an elevated prevalence of congenital heart disease, with ventricular septal defects and atrial septal defects the most commonly cited disorders. While initially persuasive, on closer examination many of these studies have fundamental shortcomings in their design and in the recruitment of study subjects and controls. Improved matching of cases and controls, to include recognition of the long-established community boundaries within which most marriages are contracted, and the assessment of consanguinity within specific levels and types of marital union would improve and help to focus the study outcomes. At the same time, major discrepancies between studies in their reported prevalence and types of congenital heart disease suggest an urgent need for greater standardization in the classification and reporting of these disorders.

  6. Assessing the influence of consanguinity on congenital heart disease

    International Nuclear Information System (INIS)

    Bittles, Alan H.

    2011-01-01

    Numerous articles have been published linking consanguineous marriage to an elevated prevalence of congenital heart disease, with ventricular septal defects and atrial septal defects the most commonly cited disorders. While initially persuasive, on closer examination many of these studies have fundamental shortcomings in their design and in the recruitment of study subjects and controls. Improved matching of cases and controls, to include recognition of the long-established community boundaries within which most marriages are contracted, and the assessment of consanguinity within specific levels and types of marital union would improve and help to focus the study outcomes. At the same time, major discrepancies between studies in their reported prevalence and types of congenital heart disease suggest an urgent need for greater standardization in the classification and reporting of these disorders

  7. Challenges in the care for consanguineous couples: an exploratory interview study among general practitioners and midwives

    Directory of Open Access Journals (Sweden)

    Teeuw Marieke E

    2012-10-01

    Full Text Available Abstract Background It is often suggested that an effort must be made to increase awareness among consanguineous couples of their reproductive risk, and to refer them for genetic counseling if needed. Primary care professionals are considered most appropriate for addressing the subject and identifying couples at risk during consultations in their practice. This Dutch study aims to explore the experiences, attitudes and beliefs of such professionals regarding their care for consanguineous couples. Methods Sixteen semi-structured interviews were conducted with midwives and general practitioners. Results Although most primary care professionals considered it their task to inform couples about the risks of consanguinity, during consultations the topic was generally only briefly touched upon and quickly abandoned. Important reasons for this were professionals’ beliefs about religious and social values of couples, their low perception of the couples’ reproductive risk and expected limited feasibility of referral. Feelings of embarrassment regarding addressing consanguinity did not seem to play a significant role. Conclusions Primary care professional beliefs about their clients’ religious and social values, their attitudes toward the risk, and perceived limited options for referral seem to conflict with the professional norm to address the topic of consanguinity.

  8. An empirical analysis of the effects of consanguineous marriages on economic development.

    Science.gov (United States)

    Bildirici, Melike; Kökdener, Meltem; Ersin, Oezgür ömer

    2010-01-01

    In this study, development experiences toward economic development are investigated to provide an alternative analysis of economic development, human capital, and genetic inheritance in the light of consanguineous marriages. The countries analyzed in the study are discussed in accordance with consanguineous marriage practices and classified by their per capita gross domestic product (GDP) growth. A broad range of countries are analyzed in the study. Arab countries that experienced high rates of growth in their gross national income during the twentieth century but failed to fulfill adequate development measures as reflected in the growth in national income, countries undergoing transition from tight government regulation to free market democracy, and African nations that have experienced complications in the process of development show important differences in the process of economic development. It is shown that the countries that have reached high average development within the context of per capita GDP have overcome problems integral to consanguineous marriage.

  9. Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

    Directory of Open Access Journals (Sweden)

    Barton Pelham M

    2011-06-01

    Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

  10. LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

    Directory of Open Access Journals (Sweden)

    Muhammad Usman

    2014-12-01

    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  11. Prevalence and characteristics of non-syndromic orofacial clefts and the influence of consanguinity.

    Science.gov (United States)

    Alamoudi, N M; Sabbagh, H J; Innes, N P T; El Derwi, D; Hanno, A Z; Al-Aama, J Y; Habiballah, A H; Mossey, P A

    2014-01-01

    The Objective of this study was to identify the prevalence and describe the characteristics of non-syndromic orofacial cleft (NSOFC) in Jeddah, Saudi Arabia and examine the influence of consanguinity. Six hospitals were selected to represent Jeddah's five municipal districts. New born infants with NSOFC born between 1st of January 2010 to 31st of December 2011 were clinically examined and their number compared to the total number of infants born in these hospitals to calculate the prevalence of NSOFC types and sub-phenotypes. Referred Infants were included for the purpose of studying NSOFC characteristics and their relationship to consanguinity. Information on NSOFC infants was gathered through parents' interviews, infants 'files and patient examinations. Prospective surveillance of births resulted in identifying 37 NSOFC infants born between 1st of January 2010 to 31st of December 2011 giving a birth prevalence of 0.80/1000 living births. The total infants seen, including referred cases, were 79 children. Consanguinity among parents of cleft palate (CP) cases was statistically higher than that among cleft lip with or without cleft palate (CL/P) patients (P = 0.039). Although there appears to be a trend in the relationship between consanguinity and severity of CL/P sub-phenotype, it was not statistically significant (P = 0.248). Birth prevalence of NSOFC in Jeddah City was 0.8/1000 live births with CL/P: 0.68/1000 and CP: 0.13/1000. Both figures were low compared to the global birth prevalence (NSOFC: 1.25/1000, CL/P: 0.94/1000 and CP: 0.31/1000 live births). Consanguineous parents were statistically higher among CP cases than among other NSOFC phenotypes.

  12. DETERMINATION OF THE PREVALENCE AND THE AFFECTING FACTORS OF CONSANGUINOUS MARRIAGES AMONG YOUNG ADULT MEN

    Directory of Open Access Journals (Sweden)

    Omer Faruk TEKBAS

    2005-06-01

    Full Text Available In order to examine the prevalence and the affecting factors of consanguinous marriage which is common especially in around of our country and leads to very important health problems, a questionnaire was applied to all 402 married soldiers among 4300 soldiers of Etimesgut Armor School and Training Division Command. At the end of the study, it has been found that the overall prevalence of consanguinous marriage was 18.7%. Contrary to general expectations, ?love and marriage by loving? other than ?economical concerns? was determined as the basic reason of the consanguinous marriage. [TAF Prev Med Bull 2005; 4(3.000: 120-128

  13. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    Directory of Open Access Journals (Sweden)

    Summaira Naz

    2015-03-01

    Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

  14. Access to Power: Governance and Development in the Pakistani Electrical Power Sector

    Science.gov (United States)

    Naqvi, Ijlal

    This dissertation explores governance in Pakistan through a study of the state-run electrical power sector. At both the micro and macro level, the Pakistani power sector provides a lens into the heart of the Pakistani state and its governance institutions. This ethnographic and historical study offers an in-depth look at state operations in a developing country, situates the current Pakistani power crisis in a larger context of continuity through periods of dictatorship and democracy, and suggests how efforts to make state service delivery more responsive to citizens might be reconceived. A historical review of the Pakistani power sector establishes first and foremost that the current crisis is the product of longer-term processes for which the policy solutions currently being proposed (with the support of international donors and multilateral lenders) are inadequate. Depoliticized attempts at power sector reform have little to offer in light of the pervasively informal and negotiated nature of the fragmented Pakistani state. The institutions of power sector governance are mutually constituted by the formal rules and the informal---personal relationships, language, violence, money, and power. These rules of the game are as relevant to relations within and between public sector organizations as they are to the engagement of citizens with their state. The same rules apply at the margins of the state---informal squatter settlements---as at the core, though the resources brought to bear and the resultant outcomes are different. The internal incoherence of this state underscores the limitations of formal rules in determining outcomes, and the poor prospects for reform efforts that focus exclusively on the formal aspects of governance. To proactively engage with the question of political will leads away from top-down policy perspectives and counter to the depoliticizing tendencies that currently shape policy reforms. Instead, an energized and informed local participation

  15. Familial hemophagocytic lymphohistiocytosis in two Saudi siblings

    OpenAIRE

    Abbaker, Abdelakarim Ibrahim; Dammas, Ali Saeed

    2015-01-01

    Primary familial hemophagocytic lymphohistiocytosis (HLH; or familial erythrophagocytic lymphohistiocytosis [FEL]) is a heterogeneous autosomal recessive disorder more prevalent with parental consanguinity. There is aggressive proliferation of activated macrophages and histiocytes, which phagocytose red blood cells (RBCs), white blood cells (WBCs), and platelets, leading to anemia, neutropenia and thrombocytopenia. The exaggerated response of immune system in familial HLH can occur in the abs...

  16. Application of a high-throughput genotyping method for loci exclusion in non-consanguineous Australian pedigrees with autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Paterson, Rachel L; De Roach, John N; McLaren, Terri L; Hewitt, Alex W; Hoffmann, Ling; Lamey, Tina M

    2012-01-01

    Retinitis pigmentosa (RP) is the most common form of inherited blindness, caused by progressive degeneration of photoreceptor cells in the retina, and affects approximately 1 in 3,000 people. Over the past decade, significant progress has been made in gene therapy for RP and related diseases, making genetic characterization increasingly important. Recently, high-throughput technologies have provided an option for reasonably fast, cost-effective genetic characterization of autosomal recessive RP (arRP). The current study used a single nucleotide polymorphism (SNP) genotyping method to exclude up to 28 possible disease-causing genes in 31 non-consanguineous Australian families affected by arRP. DNA samples were collected from 59 individuals affected with arRP and 74 unaffected family members from 31 Australian families. Five to six SNPs were genotyped for 28 genes known to cause arRP or the related disease Leber congenital amaurosis (LCA). Cosegregation analyses were used to exclude possible causative genes from each of the 31 families. Bidirectional sequencing was used to identify disease-causing mutations in prioritized genes that were not excluded with cosegregation analyses. Two families were excluded from analysis due to identification of false paternity. An average of 28.9% of genes were excluded per family when only one affected individual was available, in contrast to an average of 71.4% or 89.8% of genes when either two, or three or more affected individuals were analyzed, respectively. A statistically significant relationship between the proportion of genes excluded and the number of affected individuals analyzed was identified using a multivariate regression model (pA) and USH2A in two families (c.2276 G>T). This study has shown that SNP genotyping cosegregation analysis can be successfully used to refine and expedite the genetic characterization of arRP in a non-consanguineous population; however, this method is effective only when DNA samples are

  17. An exploration and comparison of food and drink availability in homes in a sample of families of White and Pakistani origin within the UK.

    Science.gov (United States)

    Bryant, Maria; Sahota, Pinki; Santorelli, Gillian; Hill, Andrew

    2015-05-01

    Knowledge of the types and quantities of foods and drinks available in family homes supports the development of targeted intervention programmes for obesity prevention or management, or for overall diet improvement. In the UK, contemporary data on foods that are available within family homes are lacking. The present study aimed to explore home food and drink availability in UK homes. An exploratory study using researcher-conducted home food availability inventories, measuring all foods and drinks within the categories of fruits, vegetables, snack foods and beverages. Bradford, a town in the north of the UK. Opportunistic sample of mixed ethnicity families with infants approximately 18 months old from the Born in Bradford birth cohort. All homes had at least one type of fruit, vegetable and snack available. Fresh fruits commonly available were oranges, bananas, apples, satsumas and grapes. Commonly available fresh vegetables included potatoes, cucumber, tomatoes and carrots. The single greatest non-fresh fruit available in homes was raisins. Non-fresh vegetables contributing the most were frozen mixed vegetables, tinned tomatoes and tinned peas. Ethnic differences were found for the availability of fresh fruits and sugar-sweetened beverages, which were both found in higher amounts in Pakistani homes compared with White homes. These data contribute to international data on availability and provide an insight into food availability within family homes in the UK. They have also supported a needs assessment of the development of a culturally specific obesity prevention intervention in which fruits and vegetables and sugar-sweetened beverages are targeted.

  18. A novel homozygous missense variant in NECTIN4 (PVRL4) causing ectodermal dysplasia cutaneous syndactyly syndrome.

    Science.gov (United States)

    Ahmad, Farooq; Nasir, Abdul; Thiele, Holger; Umair, Muhammad; Borck, Guntram; Ahmad, Wasim

    2018-02-12

    Ectodermal dysplasia syndactyly syndrome 1 (EDSS1) is a rare form of ectodermal dysplasia including anomalies of hair, nails, and teeth along with bilateral cutaneous syndactyly of hands and feet. In the present report, we performed a clinical and genetic characterization of a consanguineous Pakistani family with four individuals affected by EDSS1. We performed exome sequencing using DNA of one affected individual. Exome data analysis identified a novel homozygous missense variant (c.242T>C; p.(Leu81Pro)) in NECTIN4 (PVRL4). Sanger sequencing validated this variant and confirmed its cosegregation with the disease phenotype in the family members. Thus, our report adds a novel variant to the NECTIN4 mutation spectrum and contributes to the NECTIN4-related clinical characterization. © 2018 John Wiley & Sons Ltd/University College London.

  19. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  20. Consanguinity and its relationship to differential fertility and mortality in the Kotia: a tribal population of Andhra Pradesh, India.

    Science.gov (United States)

    Yasim; Naidu, J M; Mascie-Taylor, C G

    1997-04-01

    Data on patterns of marriage, differential fertility and mortality were collected from 211 Kotia women residing in Visakhapatnam district of Andhra Pradesh, India. Consanguineous marriages made up just over a quarter of the total, and of these, father's sister's daughter (FSD) were more common than mother's brother's daughter (MBD). The mean inbreeding coefficient for the sample (F) was 0.0172. Women in consanguineous marriages had a lower mean number of total conceptions, live births and living offspring (net fertility) than women in non-consanguineous marriages. Significant heterogeneity was found in the means of living offspring for FSD, MBD and non-consanguineous couples, but not for conceptions and live births.

  1. An insight into recent consanguinity within the Basque area in Spain. Effects of autochthony, industrialization and demographic changes.

    Science.gov (United States)

    Alfonso-Sanchez, M A; Peña, J A; Aresti, U; Calderón, R

    2001-01-01

    The importance of studying the genetic kinship of those human groups characterized by a deeply rooted ethnicity has traditionally been and still is an interesting goal of anthropological and population genetic studies. However, only a few surveys have aimed to learn about the impact of industrial development on the consanguinity of these populations and even those have concentrated on industrialized regions. This approach is worth analysing in Spain, where industrialization was late in relation to other western European countries. In this work we analyse the characteristics of inbreeding in Guipúzcoa from 1951 to 1995. This Basque province underwent industrial and tourist development earlier than other Spanish regions. It has the highest density of Basque speakers and has always occupied a central position within the map of distribution of the Basque language. Guipúzcoa is geographically placed in the core of the Basque area. SUDJECTS AND METHODS: Data on consanguineous marriages recorded in the province of Guipúzcoa between 1951 and 1995 were taken from Roman Catholic dispensations stored in the Diocesan Archives of San Sebastián, the province's capital city. Over the whole time period, a total of 1152 consanguineous marriages were registered. The high frequencies of first cousin (M22) (F = 1/16) and uncle-niece, aunt-nephew (M12) (F = 1/8) consanguineous marriages distinguish Guipúzcoa from the rest of Iberian populations. The M22/M33 ratio (with M33 being second cousins) has never dropped below 0.67, which represents a significant deviation from the expectation value of 0.25. When consanguineous marriages are classified according to marriage partner birthplaces interesting results emerge. Provincial endogamy shows the highest consanguinity rates (57%) and the proportion of M22/M33 is also rather high (0.63). However, a major contribution to the consanguinity levels and mean inbreeding coefficient recorded in Guipúzcoa over recent decades has been made by

  2. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  3. The Effect of Consanguineous Marriage on Mental Health among the Students of the Shahrekord University of Medical Sciences.

    Science.gov (United States)

    Hosseinpour, Maryam; Deris, Fatemeh; Solati-Dehkordi, Kamal; Heidari-Soreshjani, Sheida; Karimi, Negar; Teimori, Hossein

    2016-11-01

    In Iran, after unintentional accidents, mental health problems are the second leading burden of disease. Consanguineous marriage is very common in Iran and the association between parental consanguinity and mental health is an important issue that has not yet been studied sufficiently in Iran. To investigate the effect of consanguinity and the degree of relationship on different levels of mental health. In this cross-sectional study, conducted in the Shahrekord University of Medical Sciences, two groups of students were enrolled. The first group consisted of 156 students that had consanguineous parent (case group) and the second group was 156 students whose parents had non-blood relationship (control group). The students were evaluated using General Health Questionnaire (GHQ-28). Statistical analysis was conducted by Pearson's correlation coefficient, independent t-test and the one-way analysis of variance. Odd ratio was used to estimate the relative risk. Over 30% of the individuals were suffering from mental health problems. The most and least common mental health problems in both groups were social dysfunction (54.5% in the case group and the control group 50%) and depression (15.4% in the case group and 17.3% in the control group), respectively. No statistically significant difference was observed in the frequency of overall mental health and its subscales between student with non-consanguineous parent (control group) and the students that had consanguineous parent (case group) (p>0.05) and the status of mental health was not significantly different among student with different degree of kinship (p>0.05). The study revealed that social dysfunction was very common among the study students and also there were no relationship between parental consanguineous marriage and mental health. Parental consanguinity and genetic factors may not be the major causes of high prevalence of mental health problems in Iran and the effects of the environmental factors on these

  4. Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Claussen Bjorgulf

    2006-06-01

    Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

  5. Consanguineous marriage and reproduction in Beirut, Lebanon.

    OpenAIRE

    Khlat, M

    1988-01-01

    Effects of consanguineous marriages on couples' fertility and on offspring mortality were investigated in Beirut through a population-based health survey of 2,752 households. A multistage random sampling procedure was used, and information was obtained from all ever-married women in the household about their reproductive performance and genealogical relationship with spouse; demographic and socioeconomic information was also recorded. Twenty-five percent of all marriages were between relative...

  6. A novel loss-of-function mutation in GPR54/KISS1R leads to hypogonadotropic hypogonadism in a highly consanguineous family.

    Science.gov (United States)

    Nimri, Revital; Lebenthal, Yael; Lazar, Liora; Chevrier, Lucie; Phillip, Moshe; Bar, Meytal; Hernandez-Mora, Eva; de Roux, Nicolas; Gat-Yablonski, Galia

    2011-03-01

    The G protein-coupled receptor 54 (GPR54), the kisspeptin receptor, is essential for stimulation of GnRH secretion and induction of puberty. Recently loss-of-function mutations of the GPR54 have been implicated as a cause of isolated idiopathic hypogonadotropic hypogonadism (IHH). The objective of the study was to identify the genetic cause of IHH in a consanguineous pedigree and to characterize the phenotypic features from infancy through early adulthood. In six patients with normosmic IHH belonging to two families of Israeli Muslim-Arab origin highly related to one another, DNA was analyzed for mutations in the GnRHR and GPR54 genes, with functional analysis of the mutation found. The five males underwent comprehensive endocrine evaluation and were under longitudinal follow-up; the one female presented in early adulthood. A new homozygous mutation (c.T815C) in GPR54 leading to a phenylalanine substitution by serine (p.F272S) was detected in all patients. Functional analysis showed an almost complete inhibition of kisspeptin-induced GPR54 signaling and a dramatic decrease of the mutated receptor expression at the cell surface. The males exhibited the same clinical features from infancy to adulthood, characterized by cryptorchidism, a relatively short penis, and no spontaneous pubertal development. The female patient presented at 18 yr with impuberism and primary amenorrhea. Repeated stimulation tests demonstrated complete gonadotropin deficiency throughout follow-up. A novel loss-of-function mutation (p.F272S) in the GPR54 gene is associated with familial normosmic IHH. Underdeveloped external genitalia and impuberism point to the major role of GPR54 in the activation of the gonadotropic axis from intrauterine life to adulthood.

  7. Screening for homozygosity by descent in families with autosomal

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 81; Issue 2 ... Perspectives Volume 81 Issue 2 August 2002 pp 59-63 ... disease locus in families with the recessive form of the disease, we used the approach of screening for homozygosity by descent in offspring of consanguineous and nonconsanguineous families with RP.

  8. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

    Science.gov (United States)

    Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

    2017-09-01

    Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

  9. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  10. Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

    Science.gov (United States)

    Mac an Ghaill, Mairtin; Haywood, Chris

    2014-01-01

    This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

  11. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  12. A novel splice-site mutation in ALS2 establishes the diagnosis of juvenile amyotrophic lateral sclerosis in a family with early onset anarthria and generalized dystonias.

    Directory of Open Access Journals (Sweden)

    Saima Siddiqi

    Full Text Available The diagnosis of childhood neurological disorders remains challenging given the overlapping clinical presentation across subgroups and heterogeneous presentation within subgroups. To determine the underlying genetic cause of a severe neurological disorder in a large consanguineous Pakistani family presenting with severe scoliosis, anarthria and progressive neuromuscular degeneration, we performed genome-wide homozygosity mapping accompanied by whole-exome sequencing in two affected first cousins and their unaffected parents to find the causative mutation. We identified a novel homozygous splice-site mutation (c.3512+1G>A in the ALS2 gene (NM_020919.3 encoding alsin that segregated with the disease in this family. Homozygous loss-of-function mutations in ALS2 are known to cause juvenile-onset amyotrophic lateral sclerosis (ALS, one of the many neurological conditions having overlapping symptoms with many neurological phenotypes. RT-PCR validation revealed that the mutation resulted in exon-skipping as well as the use of an alternative donor splice, both of which are predicted to cause loss-of-function of the resulting proteins. By examining 216 known neurological disease genes in our exome sequencing data, we also identified 9 other rare nonsynonymous mutations in these genes, some of which lie in highly conserved regions. Sequencing of a single proband might have led to mis-identification of some of these as the causative variant. Our findings established a firm diagnosis of juvenile ALS in this family, thus demonstrating the use of whole exome sequencing combined with linkage analysis in families as a powerful tool for establishing a quick and precise genetic diagnosis of complex neurological phenotypes.

  13. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    MUZAMMIL AHMAD KHAN1

    4Department of Cell and Developmental Biology, School of Life Sciences, University of Science .... Sex. Male. Male. Male. Male. Head circumference (cm). 41. 46. 46. 39. Intellectual disability .... One family revealed a novel single-base dele-.

  14. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    MUZAMMIL AHMAD KHAN

    3Institute of Human Genetics, Medical University of Graz, Graz 8010, Austria. 4Department of Cell and ... Materials and methods. Family recruitment and sample collection ..... 2014 A Drosophila genetic resource of mutats to study mechanism ...

  15. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif

    2017-09-01

    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  16. USH1H, a novel locus for type I Usher syndrome, maps to chromosome 15q22-23.

    Science.gov (United States)

    Ahmed, Z M; Riazuddin, S; Khan, S N; Friedman, P L; Riazuddin, S; Friedman, T B

    2009-01-01

    Usher syndrome (USH) is a hereditary disorder associated with sensorineural hearing impairment, progressive loss of vision attributable to retinitis pigmentosa (RP) and variable vestibular function. Three clinical types have been described with type I (USH1) being the most severe. To date, six USH1 loci have been reported. We ascertained two large Pakistani consanguineous families segregating profound hearing loss, vestibular dysfunction, and RP, the defining features of USH1. In these families, we excluded linkage of USH to the 11 known USH loci and subsequently performed a genome-wide linkage screen. We found a novel USH1 locus designated USH1H that mapped to chromosome 15q22-23 in a 4.92-cM interval. This locus overlaps the non-syndromic deafness locus DFNB48 raising the possibility that the two disorders may be caused by allelic mutations.

  17. Is consanguinity prevalence decreasing in Saudis?: a study in two ...

    African Journals Online (AJOL)

    2014-06-02

    Jun 2, 2014 ... Consanguineous mating and inbreeding have been a subject of human biological inquiry since George. Darwin, himself the son of a marriage between Charles. Darwin and his cousin Emma Wedgewood [2], who. Corresponding author: Arjumand S. Warsy. Department of Biochemistry. College of Science.

  18. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

    OpenAIRE

    Saghir, Sheeba; Hyland, Lynda

    2017-01-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  19. ASSESSMENT OF KNOWLEDGE, ATTITUDE AND PRACTICE TOWARDS CONSANGUINEOUS MARRIAGES AMONG A COHORT OF MULTIETHNIC HEALTH CARE PROVIDERS IN SAUDI ARABIA.

    Science.gov (United States)

    Alnaqeb, Dhekra; Hamamy, Hanan; Youssef, Amira M; Al-Rubeaan, Khalid

    2018-01-01

    This study aimed to assess knowledge, attitude and practice related to consanguinity among multiethnic health care providers in the Kingdom of Saudi Arabia. Using a cross-sectional study design, a validated, self-administered close-ended questionnaire was randomly distributed to health care providers in different health institutions in the country between 1st August 2012 and 31st July 2013. A total of 1235 health care providers completed the study questionnaire. Of the 892 married participants (72.23% of total), 11.43% were married to a first cousin, and were predominantly Arabs, younger than 40 years and male. Only 17.80% of the patients seen by the health care providers requested consanguinity related counselling. A knowledge barrier was expressed by 27.49% of the participants, and 85.67% indicated their willingness to have more training in basic genetic counselling. A language barrier was expressed as a limiting factor to counselling for consanguinity among non-Arabs. The health care providers had a major dearth of knowledge that was reflected in their attitude and practice towards consanguinity counselling. This finding indicates the need for more undergraduate and postgraduate medical and nursing education and training in the counselling of consanguineous couples. It is recommended that consanguinity counselling is included in the current premarital screening and counselling programmes in the Kingdom.

  20. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan

    2014-08-01

    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  1. Compound heterozygous ASPM mutations in Pakistani MCPH families

    DEFF Research Database (Denmark)

    Muhammad, Farooq; Mahmood Baig, Shahid; Hansen, Lars

    2009-01-01

    Autosomal recessive primary microcephaly (MCPH) is characterized by reduced head circumference (50% of all reported families. In spite of the high frequency of MCPH in Pakistan only one case of compound heterozygosity for mutations in ASPM has been reported yet. In this large MCPH study we...... confirmed compound heterozygosity in two and homozygous mutations in 20 families, respectively, showing that up to 10% of families with MCPH caused by ASPM are compound heterozygous. In total we identified 16 different nonsense or frameshift mutations of which 12 were novel thereby increasing the number...... of mutations in ASPM significantly from 35 to 47. We found no correlation between the severity of the condition and the site of truncation. We suggest that the high frequency of compound heterozygosity observed in this study is taken into consideration as part of future genetic testing and counseling...

  2. Expansion of the spectrum of ITGB6-related disorders to adolescent alopecia, dentogingival abnormalities and intellectual disability.

    Science.gov (United States)

    Ansar, Muhammad; Jan, Abid; Santos-Cortez, Regie Lyn P; Wang, Xin; Suliman, Muhammad; Acharya, Anushree; Habib, Rabia; Abbe, Izoduwa; Ali, Ghazanfar; Lee, Kwanghyuk; Smith, Joshua D; Nickerson, Deborah A; Shendure, Jay; Bamshad, Michael J; Ahmad, Wasim; Leal, Suzanne M

    2016-08-01

    Alopecia with mental retardation (APMR) is a very rare disorder. In this study, we report on a consanguineous Pakistani family (AP91) with mild-to-moderate intellectual disability, adolescent alopecia and dentogingival abnormalities. Using homozygosity mapping, linkage analysis and exome sequencing, we identified a novel rare missense variant c.898G>A (p.(Glu300Lys)) in ITGB6, which co-segregates with the phenotype within the family and is predicted to be deleterious. Structural modeling shows that Glu300 lies in the β-propeller domain, and is surrounded by several residues that are important for heterodimerization with α integrin. Previous studies showed that ITGB6 variants can cause amelogenesis imperfecta in humans, but patients from family AP91 who are homozygous for the c.898G>A variant present with neurological and dermatological features, indicating a role for ITGB6 beyond enamel formation. Our study demonstrates that a rare deleterious variant within ITGB6 causes not only dentogingival anomalies but also intellectual disability and alopecia.

  3. WORK-FAMILY CONFLICT IN SOUTH ASIA: THE CASE OF PAKISTAN

    OpenAIRE

    Syed, Sumaiya; Memon, Salman; Goraya, Nasreen; Schalk, M.J.D.; Freese, C

    2016-01-01

    This study gives a picture of work-family conflict in South Asia, specifically the views of Pakistani Bank employees on antecedents and outcomes of work-family conflicts. We use the framework of the psychological contract to understand work-to family conflict for both employees and managers, to see how work-to family conflict might be resolved. Twenty bank employees, including three executives were selected from three privatized banks and two private Banks in Pakistan. Semi-structured intervi...

  4. PAKISTANIS IN ITALY: THE DISENCHANTMENTS OF “LIVING TRANSNATIONALLY”

    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad

    2010-12-01

    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  5. HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Naqi, N.; Ahmed, T.A.; Bashir, M.M.

    2011-01-01

    Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

  6. Associations of recurrent miscarriages with chromosomal abnormalities, thrombophilia allelic polymorphisms and/or consanguinity in Saudi Arabia.

    Science.gov (United States)

    Turki, Rola F; Assidi, Mourad; Banni, Huda A; Zahed, Hanan A; Karim, Sajjad; Schulten, Hans-Juergen; Abu-Elmagd, Muhammad; Rouzi, Abdulrahim A; Bajouh, Osama; Jamal, Hassan S; Al-Qahtani, Mohammed H; Abuzenadah, Adel M

    2016-10-10

    Recurrent pregnancy loss (RPL) or recurrent spontaneous abortion is an obstetric complication that affects couples at reproductive age. Previous reports documented a clear relationship between parents with chromosomal abnormalities and both recurrent miscarriages and infertility. However, limited data is available from the Arabian Peninsula which is known by higher rates of consanguineous marriages. The main goal of this study was to determine the prevalence of chromosomal abnormalities and thrombophilic polymorphisms, and to correlate them with RPL and consanguinity in Saudi Arabia. Cytogenetic analysis of 171 consent patients with RPL was performed by the standard method of 72-h lymphocyte culture and GTG banding. Allelic polymorphisms of three thrombophilic genes (Factor V Leiden, Prothrombin A20210G, MTHFR C677T) were performed using PCR-RFLP (restriction fragment length polymorphism) and gel electrophoresis. Data analysis revealed that 7.6 % of patients were carrier of numerical or structural chromosomal abnormalities. A high rate of translocations (46 %) was associated to increased incidence of RPL. A significant correlation between consanguineous RPL patients and chromosomal abnormalities (P consanguineous marriages in the Saudi population, these results underline the importance of systematic cytogenetic investigation and genetic counseling preferably at the premarital stage or at least during early pregnancy phase through preimplantation genetic diagnosis (PGD).

  7. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  8. Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

    Directory of Open Access Journals (Sweden)

    Abdul Haque

    2011-01-01

    Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

  9. Oral clefts, consanguinity, parental tobacco and alcohol use: a case-control study in Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Isabel Cristina Gonçalves Leite

    2009-03-01

    Full Text Available This hospital-based, case-control study investigated the possible associations between family history of malformations, parental consanguinity, smoking and alcohol drinking and nonsyndromic orofacial cleft (OC, subdivided in 2 main groups: CL/P - cleft lip with or without cleft palate and CP - cleft palate alone. 274 cases were matched (age, sex and place of residence to 548 controls. Odds ratios (OR and 95% confidence intervals (95% CI - adjusted for maternal age, schooling and smoking / alcohol use - were calculated by conditional logistic regression. The results demonstrated that the history of oral clefts either in the father's (CL/P: OR = 16.00, 5.64-69.23; CP: OR = 6.64, 1.48-33.75 or in the mother's family (CL/P: OR = 5.00, 2.31-10.99, CP: OR = 12.44, 1.33-294.87 was strongly associated with both types of clefts, but parental consanguinity was associated only with CL/P (OR = 3.8, 1.27-12.18. Prevalence of maternal smoking during the first trimester of pregnancy was higher among cases but the OR (1.13, 0.81-1.57 was not statistically significant. Maternal passive smoking (nonsmoking mothers during pregnancy was associated with CL/P (1.39, 1.01-1.98 but not with CP. Maternal alcohol use during the 1st trimester increased odds for CL/P (OR = 2.08, 1.27-3.41 and CP (OR = 2.89, 1.25-8.30, and odds for OC tended to increase with dose. Neither smoking nor alcohol use by fathers increased risks for OC. This study provides further evidence of a possible role of maternal exposure to tobacco smoke and alcohol in the etiology of nonsyndromic oral clefts.

  10. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

    Science.gov (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

    2010-01-01

    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  11. Different sex ratios of children born to Indian and Pakistani immigrants in Norway

    Directory of Open Access Journals (Sweden)

    Brekke Torkel

    2010-08-01

    Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

  12. Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

    Science.gov (United States)

    Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

    2017-07-01

    Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

  13. A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

    Science.gov (United States)

    Chaudhry, N; Husain, N; Tomenson, B; Creed, F

    2012-06-01

    The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

  14. Molecular investigation of mental retardation locus gene PRSS12 by linkage analysis.

    Science.gov (United States)

    Ali, Zafar; Babar, Masroor Ellahi; Ahmad, Jamil; Yousaf, Muhammad Zubair; Asif, Muhammad; Shah, Sajjad Ali

    2011-05-01

    The present study was carried out to determine the prevalence of families having mental retardation in Pakistani population. We enrolled seven mentally retarded (MR) families with two or more affected individuals. Family history was taken to minimize the chances of other abnormalities. Pedigrees were drawn using the Cyrillic software (version 2.1). The structure of pedigrees shows that all the marriages are consanguineous and the families have recessive mode of inheritance. All the families were studied by linkage analysis to mental retardation locus (MRT1)/gene PRSS12. Three STR markers (D4S191, D4S2392, and D4S3024) in vicinity of mental retardation (MR) locus (MRT1)/gene PRSS12 were amplified on all the sample of each family by PCR. The PCR products were then genotyped on non denaturing polyacrylamide gel electrophoresis (PAGE). The Haplotype were constructed to determine the pattern of inheritance and also to determine that a family was linked or unlinked to gene PRSS12. One out of the seven families was potentially linked to gene PRSS12, while the other six families remain unlinked.

  15. [The point-digital interpretation and the choice of the dermatoglyphic patterns on human fingers for diagnostics of consanguineous relationship].

    Science.gov (United States)

    Zvyagin, V N; Rakitin, V A; Fomina, E E

    The objective of the present study was the development of the point-digital model for the scaless interpretation of the dermatoglyphic papillary patterns on human fingers that would allow to comprehensively describe, in digital terms, the main characteristics of the traits and perform the quantitative assessment of the frequency of their inheritance. A specially developed computer program, D.glyphic. 7-14 was used to mark the dermatoglyphic patterns on the fingerprints obtained from 30 familial triplets (father + mother + child).The values of all the studied traits for kinship diagnostics were found by calculating the ratios of the sums of differences between the traits in the parent-parent pairs to those in the respective parent-child pairs. The algorithms for the point marking of the traits and reading out the digital information about them have been developed. The traditional dermatoglyphic patterns were selected and the novel ones applied for the use in the framework of the point-digital model for the interpretation of the for diagnostics of consanguineous relationship. The present experimental study has demonstrated the high level of inheritance of the selected traits and the possibility to develop the algorithms and computation techniques for the calculation of consanguineous relationship coefficients based on these traits.

  16. Consanguineous marriages in the genetic counseling centers of Isfahan and the ethical issues of clinical consultations

    OpenAIRE

    Nouri, Narges; Nouri, Nayereh; Tirgar, Samane; Soleimani, Elham; Yazdani, Vida; Zahedi, Farzaneh; Larijani, Bagher

    2017-01-01

    Consanguineous marriage, which is common in many regions in the world, has absorbed much attention as a causative factor in raising the incidence of genetic diseases. The adverse effects may be attributed to the expression of the genes received from common ancestors and mortality and morbidity of the offspring. Iran has a high rate of consanguineous marriages. In recent years genetic counseling has come to be considered in health care services. This cross-sectional study was conducted in orde...

  17. Whole exome sequencing of a consanguineous family identifies the possible modifying effect of a globally rare AK5 allelic variant in celiac disease development among Saudi patients.

    Directory of Open Access Journals (Sweden)

    Jumana Yousuf Al-Aama

    Full Text Available Celiac disease (CD, a multi-factorial auto-inflammatory disease of the small intestine, is known to occur in both sporadic and familial forms. Together HLA and Non-HLA genes can explain up to 50% of CD's heritability. In order to discover the missing heritability due to rare variants, we have exome sequenced a consanguineous Saudi family presenting CD in an autosomal recessive (AR pattern. We have identified a rare homozygous insertion c.1683_1684insATT, in the conserved coding region of AK5 gene that showed classical AR model segregation in this family. Sequence validation of 200 chromosomes each of sporadic CD cases and controls, revealed that this extremely rare (EXac MAF 0.000008 mutation is highly penetrant among general Saudi populations (MAF is 0.62. Genotype and allelic distribution analysis have indicated that this AK5 (c.1683_1684insATT mutation is negatively selected among patient groups and positively selected in the control group, in whom it may modify the risk against CD development [p<0.002]. Our observation gains additional support from computational analysis which predicted that Iso561 insertion shifts the existing H-bonds between 400th and 556th amino acid residues lying near the functional domain of adenylate kinase. This shuffling of amino acids and their H-bond interactions is likely to disturb the secondary structure orientation of the polypeptide and induces the gain-of-function in nucleoside phosphate kinase activity of AK5, which may eventually down-regulates the reactivity potential of CD4+ T-cells against gluten antigens. Our study underlines the need to have population-specific genome databases to avoid false leads and to identify true candidate causal genes for the familial form of celiac disease.

  18. The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

    Science.gov (United States)

    Goodwin, Laura; Hunter, Billie; Jones, Aled

    2018-02-01

    In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  19. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    OpenAIRE

    Syeda Bushra Zaidi

    2016-01-01

    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  20. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  1. Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2007-01-01

    Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

  2. Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

    Science.gov (United States)

    Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

    2007-01-01

    Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

  3. The risk ratio for development of hereditary sensorineural hearing loss in consanguineous marriage offspring.

    Science.gov (United States)

    Sanyelbhaa, Hossam; Kabel, Abdelmagied; Abo El-Naga, Heba Abd El-Rehem; Sanyelbhaa, Ahmed; Salem, Hatem

    2017-10-01

    This study aims to define the relative risk of development of hearing loss in offspring of consanguineous marriages. This is a retrospective case-control study conducted in a tertiary referral center in Jeddah, KSA. The study group included 1600 probands (848 males, 752 females), with age range 0.5-12 years (6.6 ± 3.6). The study group comprised of two equal, age and sex matched subgroups; Hearing Loss (HL) group and Normal Hearing (NH) group. The children included in the HL group should have idiopathic or non syndromic genetic sensorineural hearing loss. The HL Group comprised 800 children with variable degrees of sensorineural hearing loss. Profound and severe degrees of hearing loss were the most prevalent degrees (P marriage offspring in the NH group was 42.5%, while in the HL group it was 68.9% (P  0.05). The relative risk and 95% confidence interval (RR, 95% CI) for development of hearing loss in offspring of consanguineous marriage was 1.76 (95% CI 1.57-1.97, P marriage progeny to develop SNHL when compared to non consanguineous progeny. Copyright © 2017. Published by Elsevier B.V.

  4. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  5. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

    Science.gov (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

    2017-10-01

    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  6. Study of a large Anglo-Saxon family with beta-thalassaemia trait.

    Science.gov (United States)

    Raik, E; Powell, E; Gordon, S

    1976-01-01

    Study of a large Anglo-Saxon family with beta-thalassaemia trait revealed evidence of consanguinity, moreover both branches of the family shared a Spanish ancestor. The manifestations of the disorder were varied in severity and yet the degree of severity appeared to breed true within any individual part of the family. Our explanation for the inheritance pattern observed in the family was to postulate the existence of two non-allelic genes influencing the rate of beta-chain synthesis.

  7. Birth prevalence of non-syndromic orofacial clefts in Saudi Arabia and the effects of parental consanguinity

    Science.gov (United States)

    Sabbagh, Heba J.; Innes, Nicola P.; Sallout, Bahauddin I.; Alamoudi, Najlaa M.; Hamdan, Mustafa A.; Alhamlan, Nasir; Al-Khozami, Amaal I.; Abdulhameed, Fatma D.; Al-Aama, Jumana Y.; Mossey, Peter A.

    2015-01-01

    Objectives: To describe the characteristics and prevalence of non-syndromic orofacial clefting (NSOFC) and assess the effects of parental consanguinity on NSOFC phenotypes in the 3 main cities of Saudi Arabia. Methods: All infants (114,035) born at 3 referral centers in Riyadh, and 6 hospitals in Jeddah and Madinah between January 2010 and December 2011 were screened. The NSOFC cases (n=133) were identified and data was collected through clinical examination and records, and information on consanguinity through parent interviews. The diagnosis was confirmed by reviewing medical records and contacting the infants’ pediatricians. Control infants (n=233) matched for gender and born in the same hospitals during the same period, were selected. Results: The prevalence of NSOFC was 1.07/1000 births in Riyadh, and 1.17/1000 births overall; cleft lip (CL) was 0.47/1000 births, cleft lip and palate (CLP) was 0.42/1000 births, and cleft palate (CP) was 0.28/1000 births. Cleft palate was significantly associated with consanguinity (p=0.047, odds ratio: 2.5, 95% confidence interval: 1 to 6.46), particularly for first cousin marriages. Conclusion: The birth prevalence of NSOFC in Riyadh alone, and in the 3 main cities of Saudi Arabia were marginally lower than the mean global prevalence. While birth prevalence for CLP was comparable to global figures, the CL:CLP ratio was high, and only CP was significantly associated with consanguinity. PMID:26318465

  8. Birth prevalence of non-syndromic orofacial clefts in Saudi Arabia and the effects of parental consanguinity

    Directory of Open Access Journals (Sweden)

    Heba J. Sabbagh

    2015-09-01

    Full Text Available Objectives: To describe the characteristics and prevalence of non-syndromic orofacial clefting (NSOFC and assess the effects of parental consanguinity on NSOFC phenotypes in the 3 main cities of Saudi Arabia. Methods: All infants (114,035 born at 3 referral centers in Riyadh, and 6 hospitals in Jeddah and Madinah between January 2010 and December 2011 were screened. The NSOFC cases (n=133 were identified and data was collected through clinical examination and records, and information on consanguinity through parent interviews. The diagnosis was confirmed by reviewing medical records and contacting the infants’ pediatricians. Control infants (n=233 matched for gender and born in the same hospitals during the same period, were selected. Results: The prevalence of NSOFC was 1.07/1000 births in Riyadh, and 1.17/1000 births overall; cleft lip (CL was 0.47/1000 births, cleft lip and palate (CLP was 0.42/1000 births, and cleft palate (CP was 0.28/1000 births. Cleft palate was significantly associated with consanguinity (p=0.047, odds ratio: 2.5, 95% confidence interval: 1 to 6.46, particularly for first cousin marriages. Conclusion: The birth prevalence of NSOFC in Riyadh alone, and in the 3 main cities of Saudi Arabia were marginally lower than the mean global prevalence. While birth prevalence for CLP was comparable to global figures, the CL:CLP ratio was high, and only CP was significantly associated with consanguinity.

  9. Brand equity in the Pakistani hotel industry

    OpenAIRE

    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

    2014-01-01

    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  10. Mutation analysis in a family with oculocutaneous albinism manifesting in the same generation of three branches

    NARCIS (Netherlands)

    Preising, Markus N.; Forster, Hedwig; Tan, H.; Lorenz, Birgit; de Jong, Paulus T. V. M.; Plomp, Astrid S.

    2007-01-01

    To elucidate the molecular basis of oculocutaneous albinism with variable expressivity in a family from The Netherlands in which no consanguinity was reported. Three affected family members were screened for mutations in tyrosinase (TYR) and the pink-eye-dilution gene (P) by using SSCP. The

  11. Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

    Science.gov (United States)

    Mythen, Gabe

    2012-09-01

    Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

  12. Mal de Meleda: A Report of Two Cases In One Family

    Directory of Open Access Journals (Sweden)

    M.Kantor

    2006-08-01

    Full Text Available Mal de Meleda is a rare autosomal recessive skin disorder, characterized by transgressive palmoplantar keratoderma, lichenoid skin lesions, perioral erythema, brachydactyly and nail abnormalities. We are reporting two cases of a clinically typical disease in a family. No consanguineous relationship between the parents was known and cases could not be detected in three generations of the patient's family.

  13. Consanguineous marriage and increased risk of idiopathic congenital talipes equinovarus: a case-control study in a rural area.

    Science.gov (United States)

    Sahin, Orcun; Yildirim, Cengiz; Akgun, Rahmi C; Haberal, Bahtiyar; Yazici, Ayse C; Tuncay, Ismail C

    2013-01-01

    The purpose of this study is to evaluate if there is any relationship between consanguineous marriages and idiopathic congenital talipes equinovarus (CTEV). A case-control study on CTEV screening was conducted in a rural eastern city of Turkey between 2009 and 2011 and a total of 28 cases (infants with idiopathic CTEV) and 575 controls (healthy infants) were recruited. Sociodemographic status of the infants, including gestational age and birth weights, maternal characteristics and, if any, the degree of consanguinity, were recorded. As an inclusion criterion, only singleton, full-term, live births were accepted. A backward stepwise logistic regression model was used to evaluate the relationship between idiopathic CTEV and parental consanguinity. Unadjusted and adjusted odds ratios (OR) with 95% confidence interval (CI) were calculated. Among maternal and infant characteristics, significant risk factors for idiopathic CTEV in the regression analysis were work status (employed), consanguineous marriage, sex (male), and gestational age (>42 wk). Babies born to first-cousin parents had >4 times the risk of idiopathic CTEV [OR, 4.138, (95% CI, 1.484, 11.538)] and the risk for those born to distant relatives was 2.9 times higher [OR, 2.941, (95% CI, 1.070, 8.087)] than for children of unrelated parents. Consanguineous marriage was significantly associated with an increased risk of idiopathic CTEV. This association remained significant even after adjusting for potential confounding variables. To obtain more accurate results, a population-based screening study with an increased number of cases and controls should be performed in future studies. Case-control study investigating the effect of a patient characteristic on the outcome of disease (level-III).

  14. A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-04-11

    Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  15. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

    International Nuclear Information System (INIS)

    Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

    2010-01-01

    Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

  16. Adoptees and adoptive families :an exploration of the formation of the legal family, the stigma of adoption, and the decision to search

    OpenAIRE

    Kressierer, Dana Katherine

    1994-01-01

    In this thesis I utilize sociological theories on deviance, published research on adoption, and surveys of 41 adoptees and 15 adoptive parents in order to address four primary questions: 1.What factors have influenced adoption historically, and continue to influence current practices? 2.In what ways does the legal system treat the adoptive family differently than the consanguine family? 3.Is there a stigma associated with adoption? 4.What factors are associat...

  17. A novel recessive mutation in the gene ELOVL4 causes a neuro-ichthyotic disorder with variable expressivity

    Science.gov (United States)

    2014-01-01

    Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530

  18. Integration of sequence data from a Consanguineous family with genetic data from an outbred population identifies PLB1 as a candidate rheumatoid arthritis risk gene.

    Directory of Open Access Journals (Sweden)

    Yukinori Okada

    Full Text Available Integrating genetic data from families with highly penetrant forms of disease together with genetic data from outbred populations represents a promising strategy to uncover the complete frequency spectrum of risk alleles for complex traits such as rheumatoid arthritis (RA. Here, we demonstrate that rare, low-frequency and common alleles at one gene locus, phospholipase B1 (PLB1, might contribute to risk of RA in a 4-generation consanguineous pedigree (Middle Eastern ancestry and also in unrelated individuals from the general population (European ancestry. Through identity-by-descent (IBD mapping and whole-exome sequencing, we identified a non-synonymous c.2263G>C (p.G755R mutation at the PLB1 gene on 2q23, which significantly co-segregated with RA in family members with a dominant mode of inheritance (P = 0.009. We further evaluated PLB1 variants and risk of RA using a GWAS meta-analysis of 8,875 RA cases and 29,367 controls of European ancestry. We identified significant contributions of two independent non-coding variants near PLB1 with risk of RA (rs116018341 [MAF = 0.042] and rs116541814 [MAF = 0.021], combined P = 3.2 × 10(-6. Finally, we performed deep exon sequencing of PLB1 in 1,088 RA cases and 1,088 controls (European ancestry, and identified suggestive dispersion of rare protein-coding variant frequencies between cases and controls (P = 0.049 for C-alpha test and P = 0.055 for SKAT. Together, these data suggest that PLB1 is a candidate risk gene for RA. Future studies to characterize the full spectrum of genetic risk in the PLB1 genetic locus are warranted.

  19. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

    Science.gov (United States)

    Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

    2006-07-10

    In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

  20. Cleft lip and cleft palate relationship with familial marriage: a study in 136 cases

    Directory of Open Access Journals (Sweden)

    Azimi C

    2010-02-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Clefts of the lip and palate are one of the most common congenital birth anomalies. Genetic factors play a great role in the etiology of them and the high percentage of the consanguineous marriage of the parents of the affected persons is one of the reasons. These defects not only make abnormal changes on appearance of the neonate, but also make a lot of stress and psychological problems for the patients and their families. Study on the prevalence of clefts, their risk factors and also genetic counseling for affected persons and their families can be a guideline for general population and probably reduce these anomalies over the generations."n"nMethods: Patients referred to the Department of Genetics, Imam Khomeini Hospital, Tehran, Iran were studied. A total of 7374 pedigrees of all the patients admitted to the Department, were studied during 2002-2005 and 99 pedigrees with the patients with cleft lip± palate or isolated cleft palate were separated. The total number of cases among these 99 pedigrees was 136. The effects of consanguineous marriage, positive family history and sex were investigated among cases."n"nResults: 70.8% of patients with syndromic clefts and 58.7% of patients with nonsyndromic CL

  1. Dental findings and treatment in consanguinity associated congenital chronic familial neutropenia.

    Science.gov (United States)

    Buduneli, Nurcan; Cogulu, Dilsah; Kardesler, Levent; Kütükçüler, Necil

    2006-01-01

    The purpose of this report is to describe dental findings and treatment of an 11-year old male patient and a 5-year old female patient, children of first cousins, suffering from severe benign congenital chronic familial neutropenia. This case report emphazises the importance of differential diagnosis of immunodeficiencies including congenital chronic familial neutropenia in the background of severe periodontal diseases and/or diffuse carious lesions in children.

  2. When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

    OpenAIRE

    Marwah, Ane Frislid Sveinhaug

    2008-01-01

    This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

  3. Senior-Loken syndrome: A novel NPHP5 gene mutation in a family from Kuwait

    Directory of Open Access Journals (Sweden)

    Makia J Marafie

    2014-04-01

    Conclusion: Identification of this pathogenic mutation helped in confirmation of the clinical diagnosis and in providing a proper pre-marital genetic counselling and testing for a couple embarking on marriage from this highly consanguineous high-risk family.

  4. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.

    2015-01-01

    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  5. Perspectives of UK Pakistani women on their behaviour change to prevent type 2 diabetes: qualitative study using the theory domain framework.

    Science.gov (United States)

    Penn, Linda; Dombrowski, Stephan U; Sniehotta, Falko F; White, Martin

    2014-07-08

    Type 2 diabetes (T2D) is a debilitating disease, highly prevalent in UK South Asians, and preventable by lifestyle intervention. The 'New life, New you' (NLNY) physical activity (PA) and dietary intervention for T2D prevention was culturally adapted to better engage minority ethnic populations and tested for feasibility. To investigate Pakistani female participants' perspectives of their behaviour change and of salient intervention features. A community-based 8-week programme of group delivered PA sessions with behavioural counselling and dietary advice, culturally adapted for ethnic minority populations, in an area of socioeconomic deprivation. Participants to NLNY were recruited through screening events in community venues across the town. Interviews were conducted with 20 Pakistani female NLNY participants, aged 26-45 (mean 33.5) years, from different parts of town. Within the a priori Theoretical Domains Framework (intentions and goals, reinforcement, knowledge, nature of the activity, social role and identity, social influences, capabilities and skills, regulation and decision, emotion and environment), we identified the importance of social factors relating to participants' own PA and dietary behaviour change. We also identified cross-cutting themes as collateral benefits of the intervention including participants' 'psychological health'; 'responsibility' (for others' health, especially family members included in the new PA and diet regimes) and 'inclusion' (an ethos of accommodating differences). Our findings suggest that culturally adapted interventions for Pakistani women at risk of T2D, delivered via group PA sessions with counselling and dietary advice, may encourage their PA and dietary behaviour change, and have collateral health and social benefits. The NLNY intervention appeared to be acceptable. We plan to evaluate recruitment, retention and likely effect of the intervention on participant behaviour prior to definitive evaluation. Published by the

  6. Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

    International Nuclear Information System (INIS)

    Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

    2017-01-01

    Objective: To determine the frequency of organic acidurais (OA) and amino acidopathies (AA) in selected high-risk patients screened in two years. Study Design: Retrospective Observational study. Place and Duration of Study: The Aga Khan University Hospital (AKUH), Karachi, from January 2013 to December 2014. Methodology: Patients with OA and AA were included in the study and patients with IMDs other than OA and AA were excluded. Amino acids and organic acids were analyzed on high performance liquid chromatography and gas chromatography-mass spectrometry respectively. Clinical data and chromatograms of patients screened for IMDs were reviewed by chemical pathologist and metabolic physician. Results: Eighty-eight cases (4.7 percent) were diagnosed including 41 OA (46.5 percent), 28 AA (31.8 percent) and 19 others (21.5 percent) from 1,866 specimens analyzed. Median age of the patients was 1.1 years, with high consanguinity rate (64.8 percent). Among OA, methyl CoA mutase deficiency was diagnosed in 9 (10.2 percent) and was suspected in 2 (2.3 percent) cases. Five (5.7 percent) cases of MHBD (2-methyl-3-hydroxybutyryl-CoA), 4 (4.5 percent) each of PPA (propionic aciduria) and HMG-CoA lyase deficiency, 3 (3.4 percent) cases each of IVA (isovaleric aciduria), multiple carboxylase deficiency, fructose-1, 6-biphosphatase deficiency, fumarase deficiency, GA-1 (glutaric aciduria type 1) and 2 (2.3 percent) cases of EMA (ethyl-malonic aciduria). AA included 8 (9.1 percent) cases of MSUD (maple syrup urine disease), 6 (6.8 percent) cases of CBS (cystathionine beta-synthetase) and UCDs (urea cycle disorders) each, 5 (5.7 percent) cases of hyperphenylalaninemia and 3 (3.4 percent) cases of hyperprolinemia were reported. Other inherited metabolic disorders included: 9 (10.2 percent) cases of intracellular cobalamin defects, 2 (2.3 percent) cases each of alkaptonuria, Canavan's disease, SUCL (succinate CoA ligase) deficiency, and 1 (1.1 percent) case each of DPD

  7. A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

    Directory of Open Access Journals (Sweden)

    Rebecca Garcia

    2017-04-01

    Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  8. Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

    Science.gov (United States)

    Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

    2011-01-01

    This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

  9. Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

    2017-12-01

    South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

  10. The Effect of Bin Laden’s Death and Arab Spring on Al Qaeda’s Operational Center of Gravity

    Science.gov (United States)

    2012-05-04

    strongest links with its geographic allies in Pakistan’s FATA, to include the Pakistani Taliban and Haqqani Network; these relationships enable Core AQ to...this relationship with al-Awalaki, AQAP’s English-langauge jihadist. 15 These groups also provide a venue for training camps and facilitate the...point of consanguinity , the affinity between AQ’s ideology and the local insurgents and population, with the goal disconnecting the population from

  11. Familial hypercholesterolemia with multiple cutaneous xanthomas

    Directory of Open Access Journals (Sweden)

    Reddy BSN

    2006-01-01

    Full Text Available An interesting episode of homozygous familial hypercholesterolemia affecting four children born to a consanguinous parents belonging to two different families is reported for its rarity. The patients had multiple cutaneous xanthomas including the characteristic xanthoma tendinosum, xanthoma interosseum, xanthoma tuberosum, and xanthelasma palpebrarum. Prominent corneal arcus juvenalis has been noted in three children. Gross elevation of serum levels of low density lipoprotein cholesterol (LDLc with normal values of triglycerides have been found in all patients. They have been prescribed medication with oral tablets of simvastatin and advised fat restricted diet and regular follow up in the clinic at periodic intervals.

  12. Family relationship, water contact and occurrence of Buruli ulcer in Benin.

    Directory of Open Access Journals (Sweden)

    Ghislain Emmanuel Sopoh

    Full Text Available BACKGROUND: Mycobacterium ulcerans disease (Buruli ulcer is the most widespread mycobacterial disease in the world after leprosy and tuberculosis. How M. ulcerans is introduced into the skin of humans remains unclear, but it appears that individuals living in the same environment may have different susceptibilities. OBJECTIVES: This study aims to determine whether frequent contacts with natural water sources, family relationship or the practice of consanguineous marriages are associated with the occurrence of Buruli ulcer (BU. DESIGN: Case control study. SETTING: Department of Atlantique, Benin. SUBJECTS: BU-confirmed cases that were diagnosed and followed up at the BU detection and treatment center (CDTUB of Allada (Department of the Atlantique, Benin during the period from January 1st, 2006, to June 30th, 2008, with three matched controls (persons who had no signs or symptoms of active or inactive BU for age, gender and village of residence per case. MAIN OUTCOMES MEASURED: Contact with natural water sources, BU history in the family and the practice of consanguineous marriages. RESULTS: A total of 416 participants were included in this study, including 104 cases and 312 controls. BU history in the family (p<0.001, adjusted by daily contact with a natural water source (p = 0.007, was significantly associated with higher odds of having BU (OR; 95% CI = 5.5; 3.0-10.0. The practice of consanguineous marriage was not associated with the occurrence of BU (p = 0.40. Mendelian disorders could explain this finding, which may influence individual susceptibility by impairing immunity. CONCLUSION: This study suggests that a combination of genetic factors and behavioral risk factors may increase the susceptibility for developing BU.

  13. Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2014-01-01

    The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

  14. A mutation in the FOXE3 gene causes congenital primary aphakia in an autosomal recessive consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Anjum, Iram; Eiberg, Hans; Baig, Shahid Mahmood

    2010-01-01

    of the population in this region of Pakistan which has prevailed for many months. CONCLUSIONS: FOXE3 is responsible for the early developmental arrest of the lens placode, and the complete loss of a functional FOXE3 protein results in primary aphakia. It can also be deduced that this mutation is quite primitive...

  15. Meanings of family under the perspective of parents of adolescent students

    Directory of Open Access Journals (Sweden)

    Francisca Georgina Macedo de Sousa

    2014-09-01

    Full Text Available This study aimed to understand the meanings of family according to parents of adolescent students. A qualitative research conducted with nine parents of adolescents from a public school, Maranhão, Brazil. Data collection occurred through unstructured interview from February to April 2011, and were submitted to thematic content analysis. Eight themes emerged: Structure, values and meanings of family; Roles and functions of family members; Family and school; Family dynamics and the health-disease process in the family; Affective bonds and family relationships; Strategies for family functioning; Feelings and support network; Adolescence and the adolescent in the family. The meanings of family overtook consanguinity, extending to friendship, solidarity and affection in a dynamic relationship that involves dialogue, affection, love and responsibility.

  16. Senior-Loken syndrome: A novel NPHP5 gene mutation in a family from Kuwait

    OpenAIRE

    Marafie, Makia J; Al-Mulla, Fahd

    2014-01-01

    Background: Rare autosomal recessive disorders of variable severity are segregating in many highly consanguineous families from the Arab population. One of these deleterious diseases is Senior-Loken syndrome, a hereditary heterogeneous multiorgan disorder, which combines nephronophthisis with retinal dystrophy, leading to blindness and eventually end stage renal failure. This disorder has been reported in many cases worldwide, including two unrelated families from Arabian Gulf countries, whic...

  17. POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

    Science.gov (United States)

    Rafique, Rafia; Anjum, Afifa

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  18. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

  19. Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

    Science.gov (United States)

    Uphoff, Eleonora P; Pickett, Kate E; Wright, John

    2016-10-01

    This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

  20. Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta.

    Science.gov (United States)

    Kim, Youn Jung; Kang, Jenny; Seymen, Figen; Koruyucu, Mine; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Lee, Zang Hee; Hu, Jan C-C; Simmer, James P; Kim, Jung-Wook

    2017-01-01

    Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19) and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln) was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180 * and c.389C>T, p.Thr130Ile) were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

  1. Analyses of MMP20 Missense Mutations in Two Families with Hypomaturation Amelogenesis Imperfecta

    Directory of Open Access Journals (Sweden)

    Jung-Wook Kim

    2017-04-01

    Full Text Available Amelogenesis imperfecta is a group of rare inherited disorders that affect tooth enamel formation, quantitatively and/or qualitatively. The aim of this study was to identify the genetic etiologies of two families presenting with hypomaturation amelogenesis imperfecta. DNA was isolated from peripheral blood samples obtained from participating family members. Whole exome sequencing was performed using DNA samples from the two probands. Sequencing data was aligned to the NCBI human reference genome (NCBI build 37.2, hg19 and sequence variations were annotated with the dbSNP build 138. Mutations in MMP20 were identified in both probands. A homozygous missense mutation (c.678T>A; p.His226Gln was identified in the consanguineous Family 1. Compound heterozygous MMP20 mutations (c.540T>A, p.Tyr180* and c.389C>T, p.Thr130Ile were identified in the non-consanguineous Family 2. Affected persons in Family 1 showed hypomaturation AI with dark brown discoloration, which is similar to the clinical phenotype in a previous report with the same mutation. However, the dentition of the Family 2 proband exhibited slight yellowish discoloration with reduced transparency. Functional analysis showed that the p.Thr130Ile mutant protein had reduced activity of MMP20, while there was no functional MMP20 in the Family 1 proband. These results expand the mutational spectrum of the MMP20 and broaden our understanding of genotype-phenotype correlations in amelogenesis imperfecta.

  2. Clinical Polymorphism of Stargardt Disease in a Large Consanguineous Tunisian Family; Implications for Nosology

    Directory of Open Access Journals (Sweden)

    Leila El Matri

    2013-01-01

    Full Text Available Purpose: To describe the polymorphic expression of Stargardt disease in a large Tunisian family with clinical intra- and interfamilial variation of the condition. Methods: Twelve subjects from two related families with autosomal recessive Stargardt disease were enrolled. A detailed clinical examination including visual acuity and visual field measurement, fundus photography, fluorescein angiography, electroretinography (ERG and color vision testing was performed for all subjects. Results: The youngest child from family A manifested typical Stargardt disease while her two brothers presented with Stargardt disease-fundus flavimaculatus (STGD-FFM and her two sisters demonstrated a peculiar phenotype overlapping Stargardt disease and cone-rod dystrophy; their phenotypic manifestation corresponded well with ERG groups I, II and III, respectively. This uncommon occurrence of an age-related decline in ERG amplitude and worsening of fundus changes is suggestive of a grading pattern in Stargardt disease. Their two cousins in family B, displayed the STGD-FFM phenotype. Despite clinically similar STGD-FFM patterns in both families, age of onset and progression of the phenotype in family B differed from family A. Conclusion: This is the first report on phenotypic variation of Stargardt disease in a large Tunisian family. Regarding phenotype and severity of visual symptoms, family A demonstrated Stargardt disease at various stages of progression. In addition, STGDFFM appeared to be an independent clinical entity in family B. These findings imply that further parameters are required to classify Stargardt′s disease.

  3. The relationship between consanguineous marriage and death in fetus and infants

    OpenAIRE

    Mohammadi, Majid Mehr; Hooman, Heidar Ali; Afrooz, Gholam Ali; Daramadi, Parviz Sharifi

    2012-01-01

    Background: Given the high prevalence of consanguineous marriages in rural and urban areas of Iran, the aim of this study was to identify its role in increasing fetal and infant deaths. Materials ans Methods : This was a cross-sectional study in which 494 mothers with more than one exceptional child (mentally retarded and physically-dynamically disabled) or with normal children were selected based on multi-stage random sampling method. Data was gathered using the features of parents with more...

  4. USH1K, a novel locus for type I Usher syndrome, maps to chromosome 10p11.21-q21.1.

    Science.gov (United States)

    Jaworek, Thomas J; Bhatti, Rashid; Latief, Noreen; Khan, Shaheen N; Riazuddin, Saima; Ahmed, Zubair M

    2012-10-01

    We ascertained two large Pakistani consanguineous families (PKDF231 and PKDF608) segregating profound hearing loss, vestibular dysfunction, and retinitis pigmentosa; the defining features of Usher syndrome type 1 (USH1). To date, seven USH1 loci have been reported. Here, we map a novel locus, USH1K, on chromosome 10p11.21-q21.1. In family PKDF231, we performed a genome-wide linkage screen and found a region of homozygosity shared among the affected individuals at chromosome 10p11.21-q21.1. Meiotic recombination events in family PKDF231 define a critical interval of 11.74 cM (20.20 Mb) bounded by markers D10S1780 (63.83 cM) and D10S546 (75.57 cM). Affected individuals of family PKDF608 were also homozygous for chromosome 10p11.21-q21.1-linked STR markers. Of the 85 genes within the linkage interval, PCDH15, GJD4, FZD4, RET and LRRC18 were sequenced in both families, but no potential pathogenic mutation was identified. The USH1K locus overlaps the non-syndromic deafness locus DFNB33 raising the possibility that the two disorders may be caused by allelic mutations.

  5. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  6. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Hussain Akthar

    2006-07-01

    Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

  7. Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2016-01-01

    The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

  8. Understanding the Influence of the Pakistani Government in South Asia

    Science.gov (United States)

    2010-11-01

    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  9. Factors Affecting job satisfaction of employees in Pakistani banking sector

    OpenAIRE

    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

    2010-01-01

    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

  10. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  11. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

    Science.gov (United States)

    Saghir, Sheeba; Hyland, Lynda

    2017-07-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

  12. Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

    Science.gov (United States)

    Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

    2011-08-01

    The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

  13. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  14. Familial myasthenia gravis: report of four cases

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1976-09-01

    Full Text Available Two pairs of siblings with myasthenia gravis, belonging to two different families, are reported. This is the only record of familial myasthenia during the past twenty years, in a total of 145 patients seen at the Neurological Clinic of the São Paulo Medical School. In spite of the fact that myasthenia gravis does not show hereditary characteristics, the peculiar features of the four cases justify the present report. The two pairs of siblings were born from non myasthenic nor consanguineous parents. The disease started at birth showing bilateral partial eyelid ptosis in all patients. The course of the illness has been favorable. There was no thymoma.

  15. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

    2012-01-01

    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  16. Lethal/severe osteogenesis imperfecta in a large family: a novel homozygous LEPRE1 mutation and bone histological findings

    NARCIS (Netherlands)

    van Dijk, Fleur S.; Nikkels, Peter G. J.; den Hollander, Nicolette S.; Nesbitt, Isabel M.; van Rijn, Rick R.; Cobben, Jan M.; Pals, Gerard

    2011-01-01

    We report a large consanguineous Turkish family in which multiple individuals are affected with autosomal recessive lethal or severe osteogenesis imperfecta (OI) due to a novel homozygous LEPRE1 mutation. In one affected individual histological studies of bone tissue were performed, which may

  17. Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

    Directory of Open Access Journals (Sweden)

    Syed Muhammad Aamir Shah

    2012-09-01

    Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

  18. Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

    Science.gov (United States)

    Qureshi, Mustafa; Abbas, Zaigham

    2015-01-01

    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  19. Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

    Science.gov (United States)

    Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

    2018-02-02

    Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

  20. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

    2016-01-01

    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  1. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

    2013-01-01

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  2. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

    2013-11-29

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  3. Genetic heterogeneity and consanguinity lead to a "double hit": homozygous mutations of MYO7A and PDE6B in a patient with retinitis pigmentosa.

    Science.gov (United States)

    Goldenberg-Cohen, Nitza; Banin, Eyal; Zalzstein, Yael; Cohen, Ben; Rotenstreich, Ygal; Rizel, Leah; Basel-Vanagaite, Lina; Ben-Yosef, Tamar

    2013-01-01

    Retinitis pigmentosa (RP), the most genetically heterogeneous disorder in humans, actually represents a group of pigmentary retinopathies characterized by night blindness followed by visual-field loss. RP can appear as either syndromic or nonsyndromic. One of the most common forms of syndromic RP is Usher syndrome, characterized by the combination of RP, hearing loss, and vestibular dysfunction. The underlying cause of the appearance of syndromic and nonsyndromic RP in three siblings from a consanguineous Israeli Muslim Arab family was studied with whole-genome homozygosity mapping followed by whole exome sequencing. THE FAMILY WAS FOUND TO SEGREGATE NOVEL MUTATIONS OF TWO DIFFERENT GENES: myosin VIIA (MYO7A), which causes type 1 Usher syndrome, and phosphodiesterase 6B, cyclic guanosine monophosphate-specific, rod, beta (PDE6B), which causes nonsyndromic RP. One affected child was homozygous for both mutations. Since the retinal phenotype seen in this patient results from overlapping pathologies, one might expect to find severe retinal degeneration. Indeed, he was diagnosed with RP based on an abnormal electroretinogram (ERG) at a young age (9 months). However, this early diagnosis may be biased, as two of his older siblings had already been diagnosed, leading to increased awareness. At the age of 32 months, he had relatively good vision with normal visual fields. Further testing of visual function and structure at different ages in the three siblings is needed to determine whether the two RP-causing genes mutated in this youngest sibling confer increased disease severity. This report further supports the genetic heterogeneity of RP, and demonstrates how consanguinity could increase intrafamilial clustering of multiple hereditary diseases. Moreover, this report provides a unique opportunity to study the clinical implications of the coexistence of pathogenic mutations in two RP-causative genes in a human patient.

  4. The impact of consanguinity on the frequency of inborn errors of metabolism

    DEFF Research Database (Denmark)

    Afzal, Raja Majid; Lund, Allan Meldgaard; Skovby, Flemming

    2018-01-01

    for selected IEM with autosomal recessive mode of inheritance, a national screening program of newborns covering the period from 2002 until April 2017. Among the 838,675 newborns from Denmark, the Faroe Islands and Greenland, a total of 196 newborns had an IEM of whom 155 from Denmark were included...... children. The data indicate a strong association between consanguinity and IEM. These figures could be useful to health professionals providing antenatal, pediatric, and clinical genetic services....

  5. Family relationship, water contact and occurrence of Buruli ulcer in Benin.

    Science.gov (United States)

    Sopoh, Ghislain Emmanuel; Barogui, Yves Thierry; Johnson, Roch Christian; Dossou, Ange Dodji; Makoutodé, Michel; Anagonou, Sévérin Y; Kestens, Luc; Portaels, Françoise

    2010-07-13

    Mycobacterium ulcerans disease (Buruli ulcer) is the most widespread mycobacterial disease in the world after leprosy and tuberculosis. How M. ulcerans is introduced into the skin of humans remains unclear, but it appears that individuals living in the same environment may have different susceptibilities. This study aims to determine whether frequent contacts with natural water sources, family relationship or the practice of consanguineous marriages are associated with the occurrence of Buruli ulcer (BU). Case control study. Department of Atlantique, Benin. BU-confirmed cases that were diagnosed and followed up at the BU detection and treatment center (CDTUB) of Allada (Department of the Atlantique, Benin) during the period from January 1st, 2006, to June 30th, 2008, with three matched controls (persons who had no signs or symptoms of active or inactive BU) for age, gender and village of residence per case. Contact with natural water sources, BU history in the family and the practice of consanguineous marriages. A total of 416 participants were included in this study, including 104 cases and 312 controls. BU history in the family (pconsanguineous marriage was not associated with the occurrence of BU (p = 0.40). Mendelian disorders could explain this finding, which may influence individual susceptibility by impairing immunity. This study suggests that a combination of genetic factors and behavioral risk factors may increase the susceptibility for developing BU.

  6. Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

    Science.gov (United States)

    Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

    2015-01-01

    The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

  7. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

    Science.gov (United States)

    Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

    2016-12-09

    There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  8. Loss-of-function mutations in the thyrotropin receptor gene as a major determinant of hyperthyrotropinemia in a consanguineous community.

    Science.gov (United States)

    Tenenbaum-Rakover, Yardena; Grasberger, Helmut; Mamanasiri, Sunee; Ringkananont, Usanee; Montanelli, Lucia; Barkoff, Marla S; Dahood, Ahmad Mahameed-Hag; Refetoff, Samuel

    2009-05-01

    Resistance to TSH (RTSH) is a condition of impaired responsiveness of the thyroid gland to TSH, characterized by elevated serum TSH, low or normal thyroid hormone levels, and hypoplastic or normal-sized thyroid gland. The aim of the study was to evaluate the clinical course and the genotype-phenotype relationship of RTSH caused by two different TSH receptor (TSHR) gene mutations in a consanguineous population. We conducted a clinical and genetic investigation of 46 members of an extended family and 163 individuals living in the same town. In vitro functional studies of the mutant TSHRs were also performed. Two TSHR gene mutations (P68S and L653V) were identified in 33 subjects occurring as homozygous L653V (five subjects), heterozygous L653V (20 subjects), heterozygous P68S (four subjects), and compound heterozygous L653V/P68S (four subjects). With the exception of one individual with concomitant autoimmune thyroid disease, all homozygotes and compound heterozygotes presented with compensated RTSH (high TSH with free T(4) and T(3) in the normal range). Only nine of 24 heterozygotes had mild hyperthyrotropinemia. The L653V mutation resulted in a higher serum TSH concentration and showed a more severe in vitro abnormality than P68S. Haplotype analysis predicted a founder of the L653V six to seven generations earlier, whereas the P68S is older. Cross-sectional and prospective longitudinal studies indicate that TSH and T(4) concentrations remain stable over time. High frequency hyperthyrotropinemia in an Israeli Arab-Muslim consanguineous community is attributed to two inactivating TSHR gene mutations. Concordant genotype-phenotype was demonstrated clinically and by in vitro functional analysis. Retrospective and prospective studies indicate that in the absence of concomitant autoimmune thyroid disease, elevated TSH levels reflect stable compensated RTSH.

  9. Genetic heterogeneity and consanguinity lead to a “double hit”: Homozygous mutations of MYO7A and PDE6B in a patient with retinitis pigmentosa

    Science.gov (United States)

    Goldenberg-Cohen, Nitza; Banin, Eyal; Zalzstein, Yael; Cohen, Ben; Rotenstreich, Ygal; Rizel, Leah; Basel-Vanagaite, Lina

    2013-01-01

    Purpose Retinitis pigmentosa (RP), the most genetically heterogeneous disorder in humans, actually represents a group of pigmentary retinopathies characterized by night blindness followed by visual-field loss. RP can appear as either syndromic or nonsyndromic. One of the most common forms of syndromic RP is Usher syndrome, characterized by the combination of RP, hearing loss, and vestibular dysfunction. Methods The underlying cause of the appearance of syndromic and nonsyndromic RP in three siblings from a consanguineous Israeli Muslim Arab family was studied with whole-genome homozygosity mapping followed by whole exome sequencing. Results The family was found to segregate novel mutations of two different genes: myosin VIIA (MYO7A), which causes type 1 Usher syndrome, and phosphodiesterase 6B, cyclic guanosine monophosphate-specific, rod, beta (PDE6B), which causes nonsyndromic RP. One affected child was homozygous for both mutations. Since the retinal phenotype seen in this patient results from overlapping pathologies, one might expect to find severe retinal degeneration. Indeed, he was diagnosed with RP based on an abnormal electroretinogram (ERG) at a young age (9 months). However, this early diagnosis may be biased, as two of his older siblings had already been diagnosed, leading to increased awareness. At the age of 32 months, he had relatively good vision with normal visual fields. Further testing of visual function and structure at different ages in the three siblings is needed to determine whether the two RP-causing genes mutated in this youngest sibling confer increased disease severity. Conclusions This report further supports the genetic heterogeneity of RP, and demonstrates how consanguinity could increase intrafamilial clustering of multiple hereditary diseases. Moreover, this report provides a unique opportunity to study the clinical implications of the coexistence of pathogenic mutations in two RP-causative genes in a human patient. PMID:23882135

  10. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

    OpenAIRE

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-01-01

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  11. Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

    Directory of Open Access Journals (Sweden)

    Barton Pelham

    2011-08-01

    Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

  12. [Consanguineous marriage and morbi-mortality, short literature review based on an exceptional association: Usher syndrome and Von Recklinghausen neurofibromatosis].

    Science.gov (United States)

    Atipo-Tsiba, Pépin-Williams

    2016-01-01

    Usher syndrome is defined by the association of a progressive or non-progressive congenital sensorineural hearing loss with variable severity and a gradually blinding pigmentary retinopathy. Von Recklinghausen neurofibromatosis or Neurofibromatosis type 1 is the major clinically form of neurofibromatosis which occurs in approximately 90% of cases. Both types of disease are genetic in origin with very low prevalence. The probability of co-occurrence of these diseases in a single individual is exceptional. Inbreeding, as well as all genetic diseases, increases quite significantly the probability of their occurrence. Consanguineous marriages are still widespread in Maghreb and in some regions of the western African. This observation reports an exceptional case of this association in a 40-year-old man of Mauritanian origin born from a consanguineous union.

  13. The prevalence of attention deficit hyperactivity symptoms in schoolchildren in a highly consanguineous community.

    Science.gov (United States)

    Bener, Abdulbari; Al Qahtani, Razna; Teebi, Ahmad S; Bessisso, Mohammed

    2008-01-01

    The objective of the present study was to find the prevalence of attention deficit hyperactivity (ADH) symptoms in a sample of primary schoolchildren in Qatar and investigate the behaviour of the children with and without ADH symptoms in a highly consanguineous community. A total of 2,500 primary school students, aged 6-12 years, were randomly selected from the government primary schools, and 1,869 students (947 boys and 922 girls) gave consent to participate in this study. An Arabic questionnaire was used to collect the sociodemographic variables and a standardized Arabic version of the Conners' Teacher Rating Scale for ADH symptoms. Of the 947 boys, 158 (16.7%; 95% confidence interval, CI, 14.4-19.2) and of the 922 girls, 50 (5.4%; 95% CI 4.1-7.1) scored above the cut-off (>or=15) for ADH symptoms, thus giving an overall prevalence of 11.1% (95% CI 9.7-12.6). The children who had higher scores for ADH symptoms were in the age group of 6-9 years. Children who had higher scores for ADH symptoms had a poorer school performance than those with lower scores (p = 0.002). Two hundred (96.2%) children with ADH were disobedient, 126 (60.6%) noisy and hyperactive, 76 (36.5%) very cranky, 78 (37.5%) troublesome and 79 (37.9%) nervous. The logistic regression identified socio-economic condition, number of children, school performance and poor relationship between parents as the main contributors to ADH. Although the univariate analysis showed a significant relationship (p = 0.010) between ADH symptoms and consanguineous parents, logistic regression did not support this association (p = 0.075). This suggests that consanguinity has no impact on ADH children. The study revealed that ADH is a common problem among schoolchildren. The children with higher scores for ADH symptoms had a poorer school performance than those with lower scores. A significant difference exists between the behaviour of children with and without ADH. (c) 2008 S. Karger AG, Basel.

  14. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.

    1992-10-01

    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  15. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

    Directory of Open Access Journals (Sweden)

    Atta Abbas Naqvi

    2016-12-01

    Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  16. Bacteriological (fecal and total coliform) quality of Pakistani coastal water

    International Nuclear Information System (INIS)

    Mashiatullah, A.; Qureshi, R.M.; Javed, T.; Khan, M.S.; Chaudhary, M.Z.; Khalid, F.

    2010-01-01

    The coliform bacteria group consists of several genera of bacteria belonging to the family enterobacteriaceae. These are harmless bacteria, mostly live in soil, water, and digestive system of animals. Fecal coliform bacteria, which belongs to this group, are present in large numbers in feces and intestinal tract of human beings and other warm-blooded animals which can enter into water bodies from human and animal waste. Swimming in water having high levels of Fecal coliform bacteria increases the chance of developing illness (fever, nausea or stomach cramps) from pathogens entering the body through mouth, nose, ears or cuts in the skin. The objective of the present study was to characterize the bathing quality of Pakistani coastal water with respect to coliform bacteria. Total and Fecal coliform bacteria were determined at seven different locations along Pakistan coast using membrane filtration (MF) technique. 100 ml of water was passed through 0.45 micron (mu) filter paper. These filter papers were put on pads, soaked in Lauryle sulphate broth in petri-dishes and incubated at 44 deg. C for Fecal and 37 deg. for Total coliform for 24 hours. Significantly high population of Fecal and Total coliform bacteria was recorded at Karachi harbour area and Indus delta region. Results indicate that a large amount of domestically originated waste is being discharged into these locations without any pre-treatment (e.g., screening, activated sludge, by using filtration beds etc.) resulting in a poor seawater quality making it unfit for bathing. (author)

  17. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2012-12-01

    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  18. Ethnic differences in psychological well-being in adolescence in the context of time spent in family activities

    OpenAIRE

    Maynard, Maria J; Harding, Seeromanie

    2010-01-01

    BackgroundIn Britain and elsewhere there is ethnic variation in mental health in adulthood but less is known about adolescence. Few studies examining the role of family life in adolescent mental well-being have been based on a multi-ethnic UK sample. We explored whether family activities explain ethnic differences in mental health among adolescents in London, UK.MethodThese analyses are based on 4,349 Black Caribbean, Black African, Indian, Pakistani and Bangladeshi and White UK boys and girl...

  19. Familial short fifth metacarpals and insulin resistance

    International Nuclear Information System (INIS)

    Hyari, Muwafag; Hamamy, Hanan; Barham, Muries; Ajlouni, Kamel; Al-Hadidy, Azmy

    2006-01-01

    Very few reports on the phenotype of short fifth metacarpals have been published in the medical literature. We report a Jordanian family in which three sisters aged 15, 13 and 8 years revealed bilateral shortening of the fifth fingers and radiological shortening of the fifth metacarpals. The father had unilateral short fifth metacarpal. The elder two sisters, their father as well as their brother and another sister manifested insulin resistance. Spherocytosis was diagnosed in one of the girls and her father. The parents are non-consanguineous. This constellation of findings has not been previously reported and could point to the presence of two disorders segregating in the family or to a novel syndrome with autosomal dominant inheritance and variable expressivity. (orig.)

  20. Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

    Science.gov (United States)

    Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

    2015-01-01

    Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

  1. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad

    2014-06-01

    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  2. Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

    Science.gov (United States)

    Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

    2015-01-01

    Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

  3. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq

    2012-03-01

    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  4. Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.

    Science.gov (United States)

    Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar

    2011-01-01

    This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.

  5. Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

    Science.gov (United States)

    Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

    2011-01-01

    Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

  6. Cervical vertebral fusion (Klippel-Feil) syndrome with consanguineous parents.

    Science.gov (United States)

    Juberg, R C; Gershanik, J J

    1976-06-01

    We describe a female infant with the cervical vertebral fusion (Klippel-Feil) syndrome whom we recognized at birth because of her short neck, restriction of cervical movement, and low posterior hairline. X-ray examination showed anomalies of C1, and between C2-3 and C3-4; thus, we classified her as type II, with variable cervical fusion. At 24 months she was small and manifested hearing deficiency. The mother and father were consanguineous with five common ancestors four generations ago, which resulted in a coefficient of inbreeding equivalent to a second cousin relationship. The parents and grandparents were phenotypically normal, and the parents were radiologically normal. This form of the syndrome has previously been said to be autosomal dominant. Our conclusion of determination by a single autosomal recessive gene is evidence of genetic heterogeneity.

  7. The potential impact of family history of metabolic syndrome and risk of type 2 diabetes mellitus: In a highly endogamous population.

    Science.gov (United States)

    Bener, Abdulbari; Darwish, Sarah; Al-Hamaq, Abdulla O A; Yousafzai, Mohammad T; Nasralla, Eman A

    2014-03-01

    This study aims to determine the potential impact of positive family history of Metabolic Syndrome (MetS) among two generations, on developing Type 2 Diabetes Mellitus (T2DM) and the potential relation of consanguineous marriage among patients with MetS to the risk of developing T2DM among a sample of Qataris. A cross-sectional study. Primary healthcare (PHC) centers. The survey and measurement were conducted from April 2011 to December 2012 among Qatari nationals above 20 years of age. Of the 2,182 subjects, who were approached to participate in the study, 1,552 (71%) gave their consent. Face-to-face interviews were conducted using a structured questionnaire followed by anthropometric measurements and laboratory tests. Metabolic syndrome was defined using the National Cholesterol Education Program-Third Adult Treatment Panel (ATP III) as well as International Diabetes Federation (IDF). Overall, the prevalence of MetS was 26.2% according to ATP III and 36.9% according to IDF (P family history for MetS was significantly higher in MetS patients with T2DM as compared to those without T2DM (46.7% vs. 33.8%; P = 0.009). The proportion of positive family history of MetS among fathers (35% vs. 21.9%; P = 0.005), mothers (30.5% vs. 18.8%; P = 0.008), maternal aunt (18.3% vs. 11.2%; P = 0.055), and maternal grand father (19.5% vs. 10%; P = 0.010) were significantly higher in MetS patients with T2DM as compared to the counterpart. The proportion of consanguineous marriages was almost two times higher among MetS patients with T2DM as compared to those without T2DM (80.9% vs. 41.9%; P Family history of MetS among parents, maternal aunt, maternal grandfather, and consanguineous marriages among patients of MetS are significantly associated with the development of T2DM in Qatar. These results support the necessity of earlier screening for T2DM among MetS patients with positive family history of MetS.

  8. Analysis of toxic metals in branded Pakistani herbal products

    International Nuclear Information System (INIS)

    Saeed, M.; Muhammad, N.; Khan, H.

    2010-01-01

    The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

  9. 'They say Islam has a solution for everything, so why are there no guidelines for this?' Ethical dilemmas associated with the births and deaths of infants with fatal abnormalities from a small sample of Pakistani Muslim couples in Britain.

    Science.gov (United States)

    Shaw, Alison

    2012-11-01

    This paper presents ethical dilemmas concerning the termination of pregnancy, the management of childbirth, and the withdrawal of life-support from infants in special care, for a small sample of British Pakistani Muslim parents of babies diagnosed with fatal abnormalities. Case studies illustrating these dilemmas are taken from a qualitative study of 66 families of Pakistani origin referred to a genetics clinic in Southern England. The paper shows how parents negotiated between the authoritative knowledge of their doctors, religious experts, and senior family members in response to the ethical dilemmas they faced. There was little knowledge or open discussion of the view that Islam permits the termination of pregnancy for serious or fatal abnormality within 120 days and there was considerable disquiet over the idea of ending a pregnancy. For some parents, whether their newborn baby would draw breath was a main worry, with implications for the baby's Muslim identity and for the recognition of loss the parents would receive from family and community. This concern sometimes conflicted with doctors' concerns to minimize risk to future pregnancies by not performing a Caesarean delivery if a baby is sure to die. The paper also identifies parents' concerns and feelings of wrong-doing regarding the withdrawal of artificial life-support from infants with multiple abnormalities. The conclusion considers some of the implications of these observations for the counselling and support of Muslim parents following the pre- or neo-natal diagnosis of fatal abnormalities in their children. © 2011 Blackwell Publishing Ltd.

  10. A novel NDUFV1 gene mutation in complex I deficiency in consanguineous siblings with brainstem lesions and Leigh syndrome.

    Science.gov (United States)

    Vilain, C; Rens, C; Aeby, A; Balériaux, D; Van Bogaert, P; Remiche, G; Smet, J; Van Coster, R; Abramowicz, M; Pirson, I

    2012-09-01

    Although deficiency of complex I of the mitochondrial respiratory chain is a frequent cause of encephalopathy in children, only a few mutations have been reported in each of its subunits. In the absence of families large enough for conclusive segregation analysis and of robust functional testing, it is difficult to unequivocally show the causality of the observed mutations and to delineate genotype-phenotype correlations, making additional observations necessary. We observed two consanguineous siblings with an early-onset encephalopathy, medulla, brainstem and mesencephalon lesions on brain magnetic resonance imaging and death before 8 months of age, caused by a complex I deficiency. We used a homozygosity mapping approach and identified a missense mutation in the NDUFV1 gene. The mutation, p.Arg386His, affects a highly conserved residue, contiguous to a cysteine residue known to coordinate an Fe ion. This observation adds to our understanding of complex I deficiency disease. It validates the important role of Arg386 and therefore supports the current molecular model of iron-sulfur clusters in NDUFV1. © 2011 John Wiley & Sons A/S.

  11. Maternity services in multi-cultural Britain: using Q methodology to explore the views of first- and second-generation women of Pakistani origin.

    Science.gov (United States)

    Cross-Sudworth, Fiona; Williams, Amanda; Herron-Marx, Sandy

    2011-08-01

    to explore first- and second-generation Pakistani women's experiences of maternity services and the inter generational differences/comparisons. a retrospective Q methodology study of Pakistani women following childbirth. two Children's Centres in an inner city in the West Midlands. women self-identified following distribution of information leaflets at Children's Centres. Fifteen women took part in interviews (Stage one) using a semi-structured design and 16 women participated in the completion of the Q grid sorting (Stage four). a standard five-stage Q methodology process took place: (1) initial data were gathered using a combination of individual face-to-face and focus group semi-structured community-based interviews (developing the concourse); (2) transcribed interviews were analysed for 'themes'; (3) the themes were reduced to 'statements' that reflected the overall content of the concourse using an unstructured evolving approach (giving the Q set); (4) participants were asked to sort the statements (Q sorting) according to a pre-designed distribution grid providing individual participant response grids; and (5) the response grids were factor analysed using PQ Method (V2.11), which generates clusters of participants rather than clusters of variables. Factor loadings were calculated using factor analysis by principal components with varimax rotation. This produced a list of factors, each of which represents a 'story' of women's experiences of maternity services. Throughout the process, an Urdu interpreter was involved. six factors were identified: (1) confidence and empowerment of women who had attended higher education and had family support; (2) isolation of some women from both family and maternity services; (3) women who had poor experiences of maternity services but good family support, and wanted opportunities to be involved in service development; (4) women with positive experiences of maternity care and influenced by traditional cultural practices; (5

  12. Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

    NARCIS (Netherlands)

    Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

    Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

  13. Papillon-Lefevre syndrome: Reporting consanguinity as a risk factor.

    Science.gov (United States)

    Shah, Aasim Farooq; Tangade, Pradeep; Agarwal, Swatantra

    2014-07-01

    Papillon-Lefevre syndrome (PLS) is an autosomal recessive genetic disorder characterized by palmoplantar hyperkeratosis associated with severe early-onset periodontitis and premature loss of primary and permanent teeth. This report describes two cases of PLS in 28-year-old female and 16-year-old male siblings with consanguineously married parents. The patients presented to the Department of Public Health Dentistry of a dental education and research institute in India with thickening, flaking, and scaling of the skin on the palms and soles of the feet. On oral examination, the female patient presented completely resorbed maxillary and mandibular alveolar ridges with retention of only the third molars. The male patient retained only teeth 18, 13, 28, 38, and 45. Based on complete histories and clinical examination findings, a final diagnosis of PLS was made and treatment was initiated using an interdisciplinary dental approach in both cases.

  14. Papillon–Lefevre syndrome: Reporting consanguinity as a risk factor

    Directory of Open Access Journals (Sweden)

    Aasim Farooq Shah

    2014-07-01

    Full Text Available Papillon–Lefevre syndrome (PLS is an autosomal recessive genetic disorder characterized by palmoplantar hyperkeratosis associated with severe early-onset periodontitis and premature loss of primary and permanent teeth. This report describes two cases of PLS in 28-year-old female and 16-year-old male siblings with consanguineously married parents. The patients presented to the Department of Public Health Dentistry of a dental education and research institute in India with thickening, flaking, and scaling of the skin on the palms and soles of the feet. On oral examination, the female patient presented completely resorbed maxillary and mandibular alveolar ridges with retention of only the third molars. The male patient retained only teeth 18, 13, 28, 38, and 45. Based on complete histories and clinical examination findings, a final diagnosis of PLS was made and treatment was initiated using an interdisciplinary dental approach in both cases.

  15. Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

    Science.gov (United States)

    Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

    2010-06-01

    Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

  16. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    Directory of Open Access Journals (Sweden)

    Syeda Bushra Zaidi

    2016-05-01

    Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

  17. Acceptability of GM foods among Pakistani consumers

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-01-01

    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  18. Acceptability of GM foods among Pakistani consumers.

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-04-02

    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  19. Intergenerational patterns of family violence related to alcohol abuse: a genogram-based study

    Directory of Open Access Journals (Sweden)

    Cláudia Silveira Tondowski

    2014-12-01

    Full Text Available The objective of this study was to analyze intergenerational patterns of alcohol related violence (ARV. An intentional sample comprising 42 family members was selected according to a set of criteria, including history of ARV. A genogram based on anonymous semi-structured taped interviews was created. The Content Analysis pointed to different patterns of repetition of intergenerational ARV. The most recurrent ones were those of lineal consanguinity (father/son and through marriage. We observed similarities over the generations of each family as regards the pattern of alcohol consumption; the type of violence; the family reaction and the family life cycle in which ARV was intensified. Our results confirm the intergenerational reproduction of ARV. In conclusion, it is important to create intervention strategies to prevent intergenerational repetition of this association of behaviors.

  20. Ethnic differences in psychological well-being in adolescence in the context of time spent in family activities.

    Science.gov (United States)

    Maynard, Maria J; Harding, Seeromanie

    2010-01-01

    In Britain and elsewhere there is ethnic variation in mental health in adulthood but less is known about adolescence. Few studies examining the role of family life in adolescent mental well-being have been based on a multi-ethnic UK sample. We explored whether family activities explain ethnic differences in mental health among adolescents in London, UK. These analyses are based on 4,349 Black Caribbean, Black African, Indian, Pakistani and Bangladeshi and White UK boys and girls aged 11-13, in 51 schools. Psychological well-being was measured as the total difficulties score from Goodman's strengths and difficulties questionnaire (increasing score represents increasing difficulties). Participation in family activities varied by ethnicity. Compared with the White UK group, all minority groups were more likely to visit friends and relatives and go other places as a family. Black Caribbeans and Nigerian/Ghanaians were less likely and South Asian groups more likely to eat a meal together as a family. In multivariate analyses all minority groups had better well-being scores compared to Whites, independent of family type and socio-economic status (SES). Although adjusting for family activities slightly attenuated the association for South Asians, the minority ethnic advantage in psychological well-being remained [regression coefficients for Black Caribbeans = -0.66 (95% CI = -1.13, -0.20); Nigerian/Ghanaians = -1.27 (-1.81, -0.74); Other Africans = -1.43 (-2.00, -0.86); Indians = -1.15 (-1.73, -0.58); Pakistani/Bangladeshis = -0.66 (-1.20, -0.12)]. In analyses based on the whole group, all activity variables were independent correlates of psychological well-being. Multivariate models, stratified by ethnicity, showed that family meals was associated with poorer mental health for all groups, except Black Caribbeans, independent of family type and SES. Despite ethnic patterning of the frequency of family activities, adjusting for differences in these variables did not

  1. Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2013-01-01

    To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

  2. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA

    2017-07-01

    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  3. Sex linked versus autosomal inbreeding coefficient in close consanguineous marriages in the Basque country and Castile (Spain): genetic implications.

    Science.gov (United States)

    Calderón, R; Morales, B; Peña, J A; Delgado, J

    1995-10-01

    Pedigree structures of 161 uncle/niece-aunt/nephew and 4420 first cousin consanguineous marriages registered during the 19th and 20th centuries in two large and very different Spanish regions have been analysed and their genetic consequences evaluated. The frequencies of the different pedigree subtypes within each degree of relationship were quite similar in both populations despite significant heterogeneity in inbreeding patterns. The mean X-linked inbreeding coefficient (Fx) for each type of cousin mating was calculated and compared to that expected for autosomal genes (F). The effect of genealogical structure on the Fx/F ratio was compared to different cultural populations worldwide. Preferentiality and avoidance of close consanguinity along with specific types of pedigrees are discussed on the basis of premarital migration and sociocultural rules still deeply rooted in certain human groups. By admitting that the observed Fx coefficient is usually higher than F in most human populations some remarks have been made in terms of population genetic risk.

  4. Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-06-01

    To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

  5. Domestic violence and consanguineous marriages - perspective from Rawalpindi, Pakistan.

    Science.gov (United States)

    Shaikh, M Ali; Kayani, A; Shaikh, I Ali

    2014-01-09

    Domestic violence is globally endemic and adversely impacts the health and economic well-being of women and society. This study used the standardized and validated assessment instrument "Woman Abuse Screening Tool" to study the prevalence of various forms of domestic violence among married women. The relationship between domestic violence and consanguineous marriage was studied using the chi-squared test. Cumulatively, 1010 married women were interviewed. Emotional abuse was the most commonly reported abuse, reported by 721 (71.4%) women as either often or sometimes, followed by sexual abuse and physical abuse, reported by 527 (52.2%) and 511 (50.6%) respectively. Being married to one's cousin did not protect married women from being abused either emotionally or physically by their husbands; thsi was statistically significant. There is a need for better understanding of the magnitude and scale of domestic violence in Pakistan by using standardized assessment tools for meaningful comparisons across different parts of the country over time.

  6. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.

    2015-01-01

    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  7. Consanguinity among the risk factors for underweight in children under five: a study from rural Sindh

    International Nuclear Information System (INIS)

    Hasnain, S.F.; Hashmi, S.K.

    2009-01-01

    Malnutrition is a common problem, especially in developing countries. Of the 11 million children under 5 who die each year in the developing countries mainly from preventable causes, the death of about 54% are either directly or indirectly attributable to malnutrition. The objectives of this study were to assess the prevalence and associated factors for underweight in rural Sindh. Methods: A cross-sectional survey was conducted in Jhangara Town, located in District Dadu, Sindh. Eight hundred children under 5 years of age were enrolled. A questionnaire was used to elicit required information and anthropometric measurements were made. Results: The overall prevalence for underweight was 54.3% in the study population, which was higher than the prevalence reported by PDHS 1990 - 91. In multivariate analysis, various factors for underweight were consanguinity (OR=1.5, 95% CI=1.0 - 2.07), low birth weight (parents perspective) (OR=1.6, 95% CI=1.08 - 2.16) and lack of breast-feeding (OR=2.7, 95% CI=1.19 - 6.17). Conclusion: Effective strategies to discourage consanguineous marriages between first cousins are required. Promoting breast feeding is another factor that should be incorporated while designing control strategies to reduce morbidity and mortality due to malnutrition in children (<5 years). (author)

  8. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

    OpenAIRE

    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

    2013-01-01

    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  9. Influences of religion and culture on continuing bonds in a sample of British Muslims of Pakistani origin.

    Science.gov (United States)

    Hussein, Hanan; Oyebode, Jan R

    2009-11-01

    This study considered the nature of continuing bonds with deceased relatives in a sample of Pakistani Muslims living in the United Kingdom. Ten participants were interviewed following a cultural psychology approach and transcripts were analyzed using grounded theory methodology. Dreaming, talking with others about the deceased, following the deceased's example, keeping memories and mementos, and doing actions thought to help the deceased were forms of continued relationship found. These were intertwined with the process of grieving and were influenced by the family, culture, and religion. Religion was a strong influence on the prominence given by participants to finishing well and on the notion of doing actions thought to help the deceased. Cultural mores, such as the community, and collectivist ethos and the expectation that emotion would be expressed around the time of death, were found to be supportive for some but sources of tension for other participants. Expressing a continuing bond through following the deceased's example so as to make them proud or happy seemed to be reinforced by cultural roots in respect for elders. Participants gave instances of tensions in areas such as expression of emotion and communality versus individualism that arose as a result of their position between two cultural frameworks, some illustrating how assimilation into the host culture set up conflict with the expected norms of their family/ancestral culture. The study highlights how understanding different cultural and religious influences may enrich the concept of continuing bonds.

  10. "Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

    Science.gov (United States)

    Ghaffar-Kucher, Ameena

    2015-01-01

    Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

  11. A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

    Science.gov (United States)

    Khurshid, Ayesha

    2012-01-01

    Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

  12. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  13. Differences in the pregnancy gestation period and mean birth weights in infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK: a retrospective analysis of routinely collected data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-08-11

    To compare mean birth weights and gestational age at delivery of infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK. Retrospective analysis using routinely recorded secondary data in Ciconia Maternity information System, between 2008 and 2013. Luton, UK. Mothers whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian and living in Luton, aged over 16, who had a live singleton birth over 24 weeks of gestation were included in the analysis (n=14 871). Primary outcome measures were mean birth weight and gestational age at delivery. After controlling for maternal age, smoking, diabetes, gestation age, parity and maternal height and body mass index at booking, a significant difference in infants' mean birth weight was found between white British and Indian, Pakistani and Bangladeshi infants, F(3, 12 287)=300.32, pmothers, compared with Indian mothers (Wald=8.192, df 1, pmothers and preterm delivery, when compared with Pakistani, Bangladeshi and white British women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  15. [Maxillodental anomalies and consanguineous marriages].

    Science.gov (United States)

    Garaev, Z I

    1999-01-01

    Families of 549 probands and families of 123 probands with cleft lip and/or palate were examined in order to evaluate the relationship between marriages between close relatives and the incidence and structure of maxillodental diseases. Clinical and genealogical analysis of families of probands with maxillodental abnormalities and cleft lip and/or palate showed a significantly higher incidence of marriages between close relatives and an inbreeding coefficient in these families. Analysis of the population and familial incidence of maxillodental abnormalities and the inbreeding coefficient will help the physicians consulting such families more accurately evaluate the risk and improve the efficacy of prevention of such conditions.

  16. Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

    International Nuclear Information System (INIS)

    RIZK, M.A.

    2010-01-01

    This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

  17. Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

    Directory of Open Access Journals (Sweden)

    IRFAN UL HASAN

    Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

  18. Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

    International Nuclear Information System (INIS)

    Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

    2017-01-01

    To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

  19. Study of brachydactyly in gipsy population: Description of a familial case

    Directory of Open Access Journals (Sweden)

    Pérez-Lázaro, Antonia

    2016-04-01

    Full Text Available Brachydactyly is an inheritable autosomal genetic malformation, either dominant or recessive. This article describes a gypsy family presenting with congenital brachydactyly. The study was conducted at the Sanitary District of Guadix, in Granada, Spain. The study subjects were four siblings (two women and two men, members of the same family and belonging to the Roma community. Demographic and genetic data were collected. With some variability, they had the phenotypic manifestation of brachydactyly. Radiographic data revealed that it was type A4 brachydactyly, but one of them featured a blend of A4 with E, or perhaps it is a new unclassified variety. All cases showed similar abnormalities in the feet. Besides, they are obese, and have dyslipidemia and different degrees of consanguinity.

  20. Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-10-01

    To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

  1. Important TQM Implementation Contributors in Pakistani Petrochemical Sector

    Directory of Open Access Journals (Sweden)

    Yasir Latif

    2014-10-01

    Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

  2. Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

    Directory of Open Access Journals (Sweden)

    Dr. Abdul Muhaimin

    2017-02-01

    Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

  3. Relation between family history, obesity and risk for diabetes and heart disease in Pakistani children

    International Nuclear Information System (INIS)

    Basit, A.; Hakeem, R.; Hydrie, M.Z.; Ahmadani, M.Y.; Masood, Q.

    2004-01-01

    Objective: To assess the differences in relative risk of developing diabetes and CHD, obesity, fasting blood glucose, insulin and lipids of children having family history of diabetes or heart disease in first or second degree relatives as compared to control group. Design: Children were given a questionnaire to collect demographic data and to assess their dietary habits and family history. Anthropometric measurements and blood samples for fasting blood glucose, insulin and lipids of 8-10 years old children from 4 schools was taken. Subjects: Children having positive family history of diabetes (n=44) or heart disease (n=16) in first or second degree relatives were compared with a control group (n=39). Results: Children having positive family history for diabetes had slightly higher mean values for BMI, waist circumference, arm fat % as compared to the controls but the differences were not statistically significant. Overweight children (>85th Percentile of BMI for age) did not differ significantly in terms of various risk indicators however those who were in the uppermost tertile of arm fat % had significantly higher total Cholesterol, Triglycerides, LDL-C, LDL:HDL and Insulin levels (P<0.05 in each case). Conclusion: Diabetes and CVD risks from positive family history for the disease are probably mediated through increased body fat percentage. Thus even when information about family history of disease is lacking, arm-fat-percentage could be used as an important screening tool for determining the risk status of children. (author)

  4. [Juvenile myasthenia gravis in sub-Saharan Africa: a case study of two consanguine sisters born from consanguinity in Togo].

    Science.gov (United States)

    Maneh, Nidain; Apetse, Kossivi; Diatewa, Bénédicte Marèbe; Domingo, Sidik Abou-Bakr; Agba, Aidé Isabelle; Ayena, Koffi Didier; Balogou, Koffi Agnon; Balo, Komi Patrice

    2017-01-01

    Myasthenia gravis is a rare acquired autoimmune pathology causing neuromuscular transmission impairment. Juvenile onset of myasthenia gravis is often characterized by ocular involvement. We report two cases of ocular juvenile myasthenia gravis (JMG) in two siblings. They were two young girls, XA and XB, aged 11 and 9 years, of Malian origin, residing in Togo, born from first-degree of consanguinity presenting to Ophthalmology due to progressive decrease in visual acuity. XA showed visual acuity 8/10 on both eyes while XB showed improvement in visual acuity from 3/10 to 7/10 using a pinhole occluder, suggesting ametropia. XA had a 2-year history of bilateral ptosis lifting the upper eyelid of 7 mm, while XB had a 3-year history of bilateral ptosis with no lifting of the upper eyelid. Ice pack test was strongly positive in both patients. They had Cogan's lid twitch with paresis of the oculomotor nerve without diplopia. The dosage of acetylcholine receptor autoantibodies was normal. The diagnosis of JMG associated with ametropia was suspected. Ametropia was corrected by glasses and a specific treatment with pyridostigmine was initiated, but both patients were lost to follow-up. Autoimmune myasthenia gravis with inaugural ophthalmologic manifestation is rare but it can occur among children living in sub-Saharan Africa. Studies should be conducted to establish the features of this disease.

  5. Identification of Novel Variants in LTBP2 and PXDN Using Whole-Exome Sequencing in Developmental and Congenital Glaucoma.

    Directory of Open Access Journals (Sweden)

    Shazia Micheal

    Full Text Available Primary congenital glaucoma (PCG is the most common form of glaucoma in children. PCG occurs due to the developmental defects in the trabecular meshwork and anterior chamber of the eye. The purpose of this study is to identify the causative genetic variants in three families with developmental and primary congenital glaucoma (PCG with a recessive inheritance pattern.DNA samples were obtained from consanguineous families of Pakistani ancestry. The CYP1B1 gene was sequenced in the affected probands by conventional Sanger DNA sequencing. Whole exome sequencing (WES was performed in DNA samples of four individuals belonging to three different CYP1B1-negative families. Variants identified by WES were validated by Sanger sequencing.WES identified potentially causative novel mutations in the latent transforming growth factor beta binding protein 2 (LTBP2 gene in two PCG families. In the first family a novel missense mutation (c.4934G>A; p.Arg1645Glu co-segregates with the disease phenotype, and in the second family a novel frameshift mutation (c.4031_4032insA; p.Asp1345Glyfs*6 was identified. In a third family with developmental glaucoma a novel mutation (c.3496G>A; p.Gly1166Arg was identified in the PXDN gene, which segregates with the disease.We identified three novel mutations in glaucoma families using WES; two in the LTBP2 gene and one in the PXDN gene. The results will not only enhance our current understanding of the genetic basis of glaucoma, but may also contribute to a better understanding of the diverse phenotypic consequences caused by mutations in these genes.

  6. Molecular diagnostic in two families affected with Autosomic Recessive Pigmentary Retinitis

    International Nuclear Information System (INIS)

    Leal Esquivel, A.

    1996-01-01

    This study included two Costa Rican families with members affected by Recessive Pigmentary Autosomic Retinitis (RPAR). The first family (C1) from the province of San Jose, has 10 alive affected members, and 14 obligatory carriers. They present an Early Appearance Degeneration, RPAR tipe1 (cane-cone). The author used polymorphic markers (STRPs) to discard some related regions, with the RP in the literature. He also used the Linkage program, for the analysis of ligaments. The second family (P1), proceeding from Acosta (situated in the province of Alajuela), has 13 alive affected members and 23 obligatory carriers and they present numerous consanguineous unions. This case is a RPAR with Early Appearance (Night Blindness, fat ERG), but with a shower degeneration. The author concludes that, with studies such as this one, there will be a capacity to offer RP molecular diagnostic, and also advance in its knowledge and treatment. (S. Grainger)

  7. Intermittent chronic neutropenia in a patient with familial Mediterranean fever.

    Science.gov (United States)

    Ganiou Tidjani, K; Ailal, F; Najib, J; Bellanné-Chantelot, C; Donadieu, J; Bousfiha, A A

    2008-11-01

    A 12-year-old daughter of consanguineous Moroccan parents was diagnosed with cyclic neutropenia, based on a combination of recurrent gingivostomatitis, a fluctuating neutrophil count, and several episodes of severe neutropenia. No ELA2 gene mutations were found. At age 19 years she presented with edema of the limbs, proteinuria and renal failure. Renal amyloidosis AA was diagnosed by biopsy. Gene mutations associated with family Mediterranean fever (FMF) were sought, and a homozygous mutation (M694V) was found in the MFEV gene. This is the novel finding of FMF that masqueraded as cyclic neutropenia. (c) 2008 Wiley-Liss, Inc.

  8. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

    Science.gov (United States)

    Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

    2012-02-27

    A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

  9. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

    Science.gov (United States)

    Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

    2017-01-01

    Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

  10. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Mir Mohammed

    2012-02-01

    Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

  11. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  12. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  13. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    Energy Technology Data Exchange (ETDEWEB)

    Kamal, N.

    1999-01-01

    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  14. Money or Education?

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2011-01-01

    Tracing life stories and family histories back to rural Punjab, I explore the development and processes of upward social mobility of the Pakistani community in Denmark from the 1960s onwards. I suggest that social mobility among Pakistani immigrants and their descendants must be seen as the outcome...... of the Danish labour market during the late 1970s and 1980s pushed them into two different long-term strategies of money or education respectively. This created a split in the Pakistani community between educated and non-educated families and shaped the second generation’s way of life in terms of, for example...

  15. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    Energy Technology Data Exchange (ETDEWEB)

    Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

    2011-06-15

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  16. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    International Nuclear Information System (INIS)

    Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

    2011-01-01

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  17. Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

    Science.gov (United States)

    Nauman, Sarwat; Hussain, Nasreen

    2017-01-01

    Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

  18. Family genome browser: visualizing genomes with pedigree information.

    Science.gov (United States)

    Juan, Liran; Liu, Yongzhuang; Wang, Yongtian; Teng, Mingxiang; Zang, Tianyi; Wang, Yadong

    2015-07-15

    Families with inherited diseases are widely used in Mendelian/complex disease studies. Owing to the advances in high-throughput sequencing technologies, family genome sequencing becomes more and more prevalent. Visualizing family genomes can greatly facilitate human genetics studies and personalized medicine. However, due to the complex genetic relationships and high similarities among genomes of consanguineous family members, family genomes are difficult to be visualized in traditional genome visualization framework. How to visualize the family genome variants and their functions with integrated pedigree information remains a critical challenge. We developed the Family Genome Browser (FGB) to provide comprehensive analysis and visualization for family genomes. The FGB can visualize family genomes in both individual level and variant level effectively, through integrating genome data with pedigree information. Family genome analysis, including determination of parental origin of the variants, detection of de novo mutations, identification of potential recombination events and identical-by-decent segments, etc., can be performed flexibly. Diverse annotations for the family genome variants, such as dbSNP memberships, linkage disequilibriums, genes, variant effects, potential phenotypes, etc., are illustrated as well. Moreover, the FGB can automatically search de novo mutations and compound heterozygous variants for a selected individual, and guide investigators to find high-risk genes with flexible navigation options. These features enable users to investigate and understand family genomes intuitively and systematically. The FGB is available at http://mlg.hit.edu.cn/FGB/. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

  20. Genetic characterization of different pakistani date palm varieties

    International Nuclear Information System (INIS)

    Akhtar, W.; Rashid, A.; Mahmood, T.

    2014-01-01

    Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

  1. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  2. Statistical Analysis of Pakistani Currency Regime before and after Floatation

    Directory of Open Access Journals (Sweden)

    Shahid ALI

    2011-05-01

    Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

  3. Familial epilepsy in Algeria: Clinical features and inheritance profiles.

    Science.gov (United States)

    Chentouf, Amina; Dahdouh, Aïcha; Guipponi, Michel; Oubaiche, Mohand Laïd; Chaouch, Malika; Hamamy, Hanan; Antonarakis, Stylianos E

    2015-09-01

    To document the clinical characteristics and inheritance pattern of epilepsy in multigeneration Algerian families. Affected members from extended families with familial epilepsy were assessed at the University Hospital of Oran in Algeria. Available medical records, neurological examination, electroencephalography and imaging data were reviewed. The epilepsy type was classified according to the criteria of the International League Against Epilepsy and modes of inheritance were deduced from pedigree analysis. The study population included 40 probands; 23 male (57.5%) and 17 female subjects (42.5%). The mean age of seizure onset was 9.5 ± 6.1 years. According to seizure onset, 16 patients (40%) had focal seizures and 20 (50%) had generalized seizures. Seizure control was achieved for two patients (5%) for 10 years, while 28 (70%) were seizure-free for 3 months. Eleven patients (27.5%) had prior febrile seizures, 12 were diagnosed with psychiatric disorders and four families had syndromic epilepsy. The consanguinity rate among parents of affected was 50% with phenotypic concordance observed in 25 families (62.5%). Pedigree analysis suggested autosomal dominant (AD) inheritance with or without reduced penetrance in 18 families (45%), probable autosomal recessive (AR) inheritance in 14 families (35%), and an X-linked recessive inheritance in one family. This study reveals large Algerian families with multigenerational inheritance of epilepsy. Molecular testing such as exome sequencing would clarify the genetic basis of epilepsy in some of our families. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  4. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

    Science.gov (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

    2014-01-01

    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  5. Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

    Science.gov (United States)

    Tahir, Khazima

    2017-01-01

    This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

  6. Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Eivind Andersen

    2011-08-01

    Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

  7. Disease severity in familial cases of IBD.

    Science.gov (United States)

    Andreu, M; Márquez, L; Domènech, E; Gisbert, J P; García, V; Marín-Jiménez, I; Peñalva, M; Gomollón, F; Calvet, X; Merino, O; Garcia-Planella, E; Vázquez-Romero, N; Esteve, M; Nos, P; Gutiérrez, A; Vera, I; Cabriada, J L; Martín, M D; Cañas-Ventura, A; Panés, J

    2014-03-01

    Phenotypic traits of familial IBD relative to sporadic cases are controversial, probably related to limited statistical power of published evidence. To know if there are phenotype differences between familial and sporadic IBD, evaluating the prospective Spanish registry (ENEIDA) with 11,983 cases. 5783 patients (48.3%) had ulcerative colitis (UC) and 6200 (51.7%) Crohn's disease (CD). Cases with one or more 1st, 2nd or 3rd degree relatives affected by UC/CD were defined as familial case. In UC and CD, familial cases compared with sporadic cases had an earlier disease onset (UC: 33 years [IQR 25-44] vs 37 years [IQR 27-49]; p<0.0001); (CD: 27 years [IQR 21-35] vs 29 years [IQR 22-40]; p<0.0001), higher prevalence of extraintestinal immune-related manifestations (EIMs) (UC: 17.2% vs 14%; p=0.04); (CD: 30.1% vs 23.6%; p<0.0001). Familial CD had higher percentage of ileocolic location (42.7% vs 51.8%; p=0.0001), penetrating behavior (21% vs 17.6%; p=0.01) and perianal disease (32% vs 27.1%; p=0.003). Differences are not influenced by degree of consanguinity. When a sufficiently powered cohort is evaluated, familial aggregation in IBD is associated to an earlier disease onset, more EIMs and more severe phenotype in CD. This feature should be taken into account at establishing predictors of disease course. © 2013.

  8. Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

    International Nuclear Information System (INIS)

    Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

    2017-01-01

    Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

  9. SPG20 mutation in three siblings with familial hereditary spastic paraplegia.

    Science.gov (United States)

    Dardour, Leila; Roelens, Filip; Race, Valerie; Souche, Erika; Holvoet, Maureen; Devriendt, Koen

    2017-07-01

    Troyer syndrome (MIM#275900) is an autosomal recessive form of complicated hereditary spastic paraplegia. It is characterized by progressive lower extremity spasticity and weakness, dysarthria, distal amyotrophy, developmental delay, short stature, and subtle skeletal abnormalities. It is caused by deleterious mutations in the SPG20 gene, encoding spartin, on Chromosome 13q13. Until now, six unrelated families with a genetically confirmed diagnosis have been reported. Here we report the clinical findings in three brothers of a consanguineous Moroccan family, aged 24, 17, and 7 yr old, with spastic paraplegia, short stature, motor and cognitive delay, and severe intellectual disability. Targeted exon capture and sequencing showed a homozygous nonsense mutation in the SPG20 gene, c.1369C>T (p.Arg457*), in the three affected boys. © 2017 Dardour et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Rigid Basement and the Evolution of the Pakistani Convergent Margin

    Science.gov (United States)

    Haq, S. S.; Davis, D. M.

    2007-12-01

    In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

  11. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

    Science.gov (United States)

    Islam, Kazi Md Mukitul; Asadullah, M Niaz

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

  12. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

    Science.gov (United States)

    Islam, Kazi Md. Mukitul

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

  13. Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Hempler NF

    2015-02-01

    Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

  14. Managing Heritage Language Development: Opportunities and Challenges for Chinese, Italian and Pakistani Urdu-Speaking Families in the UK

    Science.gov (United States)

    Curdt-Christiansen, Xiao Lan; La Morgia, Francesca

    2018-01-01

    Drawing on theories of family language policy and literacy environment, this inquiry explores and describes how family language policy is managed through literacy resources and literacy related activities in transnational families in the UK. A total of 66 families, each with at least one child between the age of 2 and 8, participated in this…

  15. Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

    2013-06-01

    breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

  16. Intra-Family Gamete Donation: A Solution to Concerns Regarding Gamete Donation in China?

    Science.gov (United States)

    Liao, Juhong; Devolder, Katrien

    2016-09-01

    Gamete donation from third parties is controversial in China as it severs blood ties, which are considered of utmost importance in Confucian tradition. In recent years, infertile couples are increasingly demonstrating a preference for the use of gametes donated by family members to conceive children-known as "intra-family gamete donation." The main advantage of intra-family gamete donation is that it maintains blood ties between children and both parents. To date there is no practice of intra-family gamete donation in China. In this paper, we investigate intra-family adoption in China in order to illustrate that intra-family gamete donation is consistent with Confucian tradition regarding the importance of maintaining blood ties within the family. There are several specific ethical issues raised by intra-family gamete donation. It may, for example, result in consanguinity and the semblance of incest, lead to confused family relationships, and raise concerns about possible coercion of familial donors. Confucian tradition provides a new approach to understand and deal with these ethical issues in a way that Western tradition does not. As a result, we suggest intra-family gamete donation could be an acceptable solution to the problem of infertility in China. However, further discussion and open debates on the ethical issues raised by intra-family gamete donation are needed in China.

  17. Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

    Directory of Open Access Journals (Sweden)

    Shahid Ubeera

    2011-09-01

    Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

  18. OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

    Directory of Open Access Journals (Sweden)

    Khan Shoaib

    2016-07-01

    Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

  19. A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

    Science.gov (United States)

    Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

    2013-03-01

    Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

  20. The ethnomedicinal profile of family Rosaceae; a study on Pakistani plants

    International Nuclear Information System (INIS)

    Khan, M. Q.; Shinwari, Z. K.

    2016-01-01

    Keeping in view the growing interest of people worldwide towards the medicinal plants; it is of critical importance to document and authenticate the indigenous knowledge regarding medicinal plant administration for the treatment of various ailments. This will also enable the forth coming generation to conduct scientific studies using high throughput technologies to investigate the potential of such medicinal plants. Ethnobotany and ethnomedicine have attracted many scientists because it involves the struggle for cheaper, novel and effective therapeutics from plants. Since the beginning of humanity, plants are used for medicinal purposes in various forms. In the last few years herbal practices have attained global relevance. Among the different plant families, Rosaceae is well known for its therapeutic potential. Plants belonging to Rosaceae are common in Pakistan and used by the different ethnic groups to treat their ailments. The present communication deals with the different ethnomedicinal uses reported in the peer reviewed articles of the various species present in Pakistan. (author)

  1. HVDC Transmission an Outlook and Significance for Pakistani Power Sector

    Science.gov (United States)

    Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

    2018-04-01

    Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

  2. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  3. Causes and prevalence of consanguineous marriage, child health, happiness in relationships and life satisfaction among the women in Hatay

    OpenAIRE

    İnandı, Tacettin; Savaş, Nazan; Arslan, Evrim; Yeniçeri, Arif; Erdem, Mehmet; Durmaz, Elif; Peker, Ersin; Alışkın, Ömer

    2016-01-01

    Objective: This study assessed the causes and prevalence of consanguineous marriages, their effects on the children's health, on life satisfaction and on relationship’s relation to the happiness of the women. Methods: In this cross-sectional study, the population consisted of married, divorced or widowed women in Hatay, Turkey. The study sample was 584 women selected by a multistage sampling method. The data were collected during April and May 2014 at the women’s homes with a face to fac...

  4. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.

    2016-01-01

    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  5. STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

    Directory of Open Access Journals (Sweden)

    Abdul RAZIQ

    2014-10-01

    Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

  6. Case Report: Senior-Loken syndrome: A novel NPHP5 gene ...

    African Journals Online (AJOL)

    Conclusion: Identification of this pathogenic mutation helped in confirmation of the clinical diagnosis and in providing a proper pre-marital genetic counselling and testing for a couple embarking on marriage from this highly consanguineous high-risk family. Keywords: Arab; Ciliopathy; Consanguinity; Nephronophthisis; ...

  7. Familial myasthenia gravis: report of four cases Miastenia grave familial: registro de quatro casos

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1976-09-01

    Full Text Available Two pairs of siblings with myasthenia gravis, belonging to two different families, are reported. This is the only record of familial myasthenia during the past twenty years, in a total of 145 patients seen at the Neurological Clinic of the São Paulo Medical School. In spite of the fact that myasthenia gravis does not show hereditary characteristics, the peculiar features of the four cases justify the present report. The two pairs of siblings were born from non myasthenic nor consanguineous parents. The disease started at birth showing bilateral partial eyelid ptosis in all patients. The course of the illness has been favorable. There was no thymoma.Os autores registram dois pares de gêmeos com miastenia grave, pertencentes a duas famílias diferentes. Este é o único registro de miastenia familial durante os últimos 20 anos, num total de 145 pacientes examinados na Clínica Neurológica da FMUSP. Apesar do fato de a miastenia grave não ter características hereditárias, os aspectos peculiares dos quatro pacientes justificam o presente registro. Os dois pares de gêmeos nasceram de pais não miastênicos e sem consanguinidade. A doença iniciou-se no nascimento, evoluindo com ptose bilateral parcial da pálpebra superior precocemente em todos os pacientes. O curso da moléstia tem sido favorável. Não havia timoma.

  8. Identification of two new mutations in the GPR98 and the PDE6B genes segregating in a Tunisian family.

    Science.gov (United States)

    Hmani-Aifa, Mounira; Benzina, Zeineb; Zulfiqar, Fareeha; Dhouib, Houria; Shahzadi, Amber; Ghorbel, Abdelmonem; Rebaï, Ahmed; Söderkvist, Peter; Riazuddin, Sheikh; Kimberling, William J; Ayadi, Hammadi

    2009-04-01

    Autosomal recessive retinitis pigmentosa (ARRP) is a genetically heterogeneous disorder. ARRP could be associated with extraocular manifestations that define specific syndromes such as Usher syndrome (USH) characterized by retinal degeneration and congenital hearing loss (HL). The USH type II (USH2) associates RP and mild-to-moderate HL with preserved vestibular function. At least three genes USH2A, the very large G-protein-coupled receptor, GPR98, and DFNB31 are responsible for USH2 syndrome. Here, we report on the segregation of non-syndromic ARRP and USH2 syndrome in a consanguineous Tunisian family, which was previously used to define USH2B locus. With regard to the co-occurrence of these two different pathologies, clinical and genetic reanalysis of the extended family showed (i) phenotypic heterogeneity within USH2 patients and (ii) excluded linkage to USH2B locus. Indeed, linkage analysis disclosed the cosegregation of the USH2 phenotype with the USH2C locus markers, D5S428 and D5S618, whereas the ARRP perfectly segregates with PDE6B flanking markers D4S3360 and D4S2930. Molecular analysis revealed two new missense mutations, p.Y6044C and p.W807R, occurring in GPR98 and PDE6B genes, respectively. In conclusion, our results show that the USH2B locus at chromosome 3p23-24.2 does not exist, and we therefore withdraw this locus designation. The combination of molecular findings for GPR98 and PDE6B genes enable us to explain the phenotypic heterogeneity and particularly the severe ocular affection first observed in one USH2 patient. This report presents an illustration of how consanguinity could increase familial clustering of multiple hereditary diseases within the same family.

  9. Promoting smoking cessation in Bangladeshi and Pakistani male adults: design of a pilot cluster randomised controlled trial of trained community smoking cessation workers

    Directory of Open Access Journals (Sweden)

    Gill Paramjit

    2009-08-01

    Full Text Available Abstract Background The prevalence of smoking is higher among Pakistani and Bangladeshi males than among the general population. Smokers who receive behavioural support and medication quadruple their chances of stopping smoking, but evidence suggests that these populations do not use National Health Service run stop smoking clinics as frequently as would be expected given their high prevalence of smoking. This study aims to tackle some of the main barriers to use of stop smoking services and adherence to treatment programmes by redesigning service delivery to be more acceptable to these adult male populations. The study compares the effectiveness of trained Pakistani and Bangladeshi smoking cessation workers operating in an outreach capacity ('clinic + outreach' with standard care ('clinic only' to improve access to and success of National Health Service smoking cessation services. Methods/design This is a pilot cluster randomised controlled trial based in Birmingham, UK. Super output areas of Birmingham will be identified in which more than 10% of the population are of Pakistani and/or Bangladeshi origin. From these areas, 'natural geographical communities' will be identified. Sixteen aggregated agglomerations of super output areas will be identified, separating areas from each other using buffer regions in order to reduce potential contamination. These natural communities will be randomised to 'clinic + outreach' (intervention or 'clinic only' (control arms. The use of stop smoking services and the numbers of people quitting smoking (defined as prolonged self-reported abstinence at four weeks, three months and six months will be assessed in each area. In addition, we will assess the impact of the intervention on adherence to smoking cessation treatments and patient satisfaction. Trial registration Current Controlled Trials ISRCTN 82127540.

  10. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2003-01-01

    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  11. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2014-12-01

    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  12. Affinal and Consanguineal Kin as a Social Support for the Rural Elderly. Paper of the Journal Series of the North Carolina Agricultural Research Service, Raleigh, NC.

    Science.gov (United States)

    Kivett, Vira R.

    Although the support network of elderly individuals has received increased attention recently, most research has focused on the parent child relationship without examining other levels of kin interrelations. To examine the help received by rural-transitional older adults from their consanguineous kin (adult children, grandchildren, siblings,…

  13. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    OpenAIRE

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2012-01-01

    Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

  14. An exploratory research on the role of family in youth's drug addiction.

    Science.gov (United States)

    Masood, Sobia; Us Sahar, Najam

    2014-01-01

    Most of the researches in Pakistan are concerned with the aetiological factors of drug addiction among the youth. However, few studies seek to explore the social aspects of this phenomenon. The present study aimed to explore the role of family, the influence of parental involvement, and communication styles in youth's drug addiction in a qualitative manner. Twenty drug addicts (age range 18-28 years) were taken as a sample from drug rehabilitation centres in Rawalpindi and Islamabad, Pakistan. A structured interview guide was administered comprising questions related to the individual's habits, relationship with family and friends, and modes of communication within the family. Case profiles of the participants were also taken. The rehabilitation centres offered family therapy and the researcher, as a non-participant, observed these sessions as part of the analysis. The demographic information revealed that majority of the participants were poly-substance abusers (80%) and the significant reasons for starting drugs were the company of peers and curiosity. The thematic analysis revealed parental involvement and emotional expressiveness as two major components in family communication. It was found that parents were concerned about their children, but were not assertive in the implementation of family rules. It was also found that the major life decisions of the participants were taken by their parents, which is a characteristic of collectivist Pakistani society.

  15. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi

    2012-09-01

    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  16. Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

    Directory of Open Access Journals (Sweden)

    Habib Hussain Khan

    2017-06-01

    Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

  17. Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

    International Nuclear Information System (INIS)

    Hafeez, M.

    2007-01-01

    To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

  18. Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

    Science.gov (United States)

    Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

    2013-01-01

    Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

  19. SNP Analysis and Whole Exome Sequencing: Their Application in the Analysis of a Consanguineous Pedigree Segregating Ataxia

    Directory of Open Access Journals (Sweden)

    Sarah L. Nickerson

    2015-10-01

    Full Text Available Autosomal recessive cerebellar ataxia encompasses a large and heterogeneous group of neurodegenerative disorders. We employed single nucleotide polymorphism (SNP analysis and whole exome sequencing to investigate a consanguineous Maori pedigree segregating ataxia. We identified a novel mutation in exon 10 of the SACS gene: c.7962T>G p.(Tyr2654*, establishing the diagnosis of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS. Our findings expand both the genetic and phenotypic spectrum of this rare disorder, and highlight the value of high-density SNP analysis and whole exome sequencing as powerful and cost-effective tools in the diagnosis of genetically heterogeneous disorders such as the hereditary ataxias.

  20. Visual representation of gender in flood coverage of Pakistani print media

    Directory of Open Access Journals (Sweden)

    Zarqa S. Ali

    2014-08-01

    Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

  1. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2011-06-01

    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  2. Risk factors predisposing to congenital heart defects

    International Nuclear Information System (INIS)

    Ul Haq, Faheem; Jalil, Fatima; Hashmi, Saman; Jumani, Maliha Iqbal; Imdad, Aamer; Jabeen, Mehnaz; Hashmi, Javad Tauseef; Irfan, Furqan Bin; Imran, Muhammad; Atiq, Mehnaz

    2011-01-01

    Congenital heart disease (CHD) is associated with multiple risk factors, consanguinity may be one such significant factor. The role of consanguinity in the etiology of CHD is supported by inbreeding studies, which demonstrate an autosomal recessive pattern of inheritance of some congenital heart defects. This study was done to find out the risk factors for CHD. A case-control study was done on pediatric patients at a tertiary care hospital, Aga Khan University Hospital, located in Karachi, Pakistan. A total of 500 patients, 250 cases and 250 controls were included in the study. Amongst the 250 cases (i.e. those diagnosed with CHD), 122 patients (48.8%) were born of consanguineous marriages while in the controls (i.e. non-CHD) only 72 patients (28.9%) showed a consanguinity amongst parents. On multivariate analysis, consanguinity emerged as an independent risk factor for CHD; adjusted odds ratio 2.59 (95% C. I. 1.73 - 3.87). Other risk factors included low birth weight, maternal co-morbidities, family history of CHD and first born child. On the other hand, medications used by the mother during the index pregnancy, maternal age and gender of the child did not significantly increase the risk of developing CHD. Analyses of our results show that parental consanguinity, family history of CHD, maternal co-morbidities, first born child and low birth weight are independent risk factors for CHD

  3. Exploring Asian Indian and Pakistani views about cancer and participation in cancer genetics research: toward the development of a community genetics intervention.

    Science.gov (United States)

    Leader, Amy E; Mohanty, Salini; Selvan, Preethi; Lum, Ray; Giri, Veda N

    2018-01-01

    Cancer is a leading cause of mortality among the three million Asian Indian/Pakistanis (AIPs) in the USA. AIPs have traditionally been underrepresented in cancer-related research, although reasons remain largely unexplored. We sought to understand AIP's awareness and perceptions of cancer to improve their participation in risk assessment and cancer genetics research. Four focus groups, stratified by gender and birthplace (US-born vs. foreign-born), were held at an AIP cultural center. Discussions focused on knowledge and awareness of cancer risk; how AIP culture influences cancer perceptions; access to health care services for cancer screening, diagnosis, or treatment; and willingness to or experiences with participating in cancer genetics research. Sessions were audio-recorded, transcribed verbatim, and content analyzed using NVivo ® 11 for dominant themes. Thirty-two AIP adults participated in a focus group. Information on family cancer history is challenging to obtain due to the desire for privacy, cancer stigma, and loss of medical records. Interest in genetic testing for cancer risk was mixed: some were in favor of knowing their personal risk, yet many noted that future generations in their family would benefit more by knowing their risk. Participants felt that the AIP community has largely been overlooked in recruitment efforts for research studies. Recommendations for improving recruitment efforts included partnering with community events and festivities, posting culturally and linguistically relevant recruitment materials, and focusing on population-wide health improvement. Understanding the culture and perceptions of AIPs, separate from Asian Americans at large, will allow for more tailored approaches for including this population in cancer genetics research.

  4. Unexpected Genetic Cause in Two Female Siblings with High Myopia and Reduced Visual Acuity

    Directory of Open Access Journals (Sweden)

    M. N. Preising

    2018-01-01

    Full Text Available In daily life, myopia is a frequent cause of reduced visual acuity (VA due to missing or incomplete optical correction. While the genetic cause of high myopia itself is not well understood, a significant number of cases are secondary to hereditary malfunctions or degenerations of the retina. The mechanism by which this occurs remains yet unclear. Two female siblings, 4 y and 2 y, respectively, from a consanguineous Pakistani family were referred to our department for reduced VA and strabismus. Both girls were highly myopic and hence were further examined using standard clinical tests and electroretinography (ERG. The latter confirmed confounded electrical coupling of photoreceptors and bipolar cells. Further inquiry and testing confirmed a similar condition for the father including impaired night vision, reduced VA, photophobia, and an equally characteristic ERG. Findings in the mother were unremarkable. Subsequent genetic analysis of autosomal recessive and X-linked genes for congenital stationary night blindness (CSNB revealed a novel homozygous splice site mutation in CACNA1F in the two girls transmitted from both the father and the mother. While in males the above clinical constellation is a frequent finding, this report, to the authors’ knowledge, is the first demonstrating biallelic mutations at the CACNA1F locus in females.

  5. Identification of Missense Mutation (I12T in the BSND Gene and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Hina Iqbal

    2011-01-01

    Full Text Available Nonsyndromic hearing loss is a paradigm of genetic heterogeneity with 85 loci and 39 nuclear disease genes reported so far. Mutations of BSND have been shown to cause Bartter syndrome type IV, characterized by significant renal abnormalities and deafness and nonsyndromic nearing loss. We studied a Pakistani consanguineous family. Clinical examinations of affected individuals did not reveal the presence of any associated signs, which are hallmarks of the Bartter syndrome type IV. Linkage analysis identified an area of 18.36 Mb shared by all affected individuals between markers D1S2706 and D1S1596. A maximum two-point LOD score of 2.55 with markers D1S2700 and multipoint LOD score of 3.42 with marker D1S1661 were obtained. BSND mutation, that is, p.I12T, cosegregated in all extant members of our pedigree. BSND mutations can cause nonsyndromic hearing loss, and it is a second report for this mutation. The respected protein, that is, BSND, was first modeled, and then, the identified mutation was further analyzed by using different bioinformatics tools; finally, this protein and its mutant was docked with CLCNKB and REN, interactions of BSND, respectively.

  6. Homozygous TREM2 mutation in a family with atypical frontotemporal dementia.

    Science.gov (United States)

    Le Ber, Isabelle; De Septenville, Anne; Guerreiro, Rita; Bras, José; Camuzat, Agnès; Caroppo, Paola; Lattante, Serena; Couarch, Philippe; Kabashi, Edor; Bouya-Ahmed, Kawtar; Dubois, Bruno; Brice, Alexis

    2014-10-01

    TREM2 mutations were first identified in Nasu-Hakola disease, a rare autosomal recessive disease characterized by recurrent fractures because of bone cysts and presenile dementia. Recently, homozygous and compound heterozygous TREM2 mutations were identified in rare families with frontotemporal lobar degeneration (FTLD) but without bone involvement. We identified a p.Thr66Met heterozygous mutation in a new consanguineous Italian family. Two sibs had early onset autosomal recessive FTLD without severe bone disorders. Atypical signs were present in this family: early parietal and hippocampus involvement, parkinsonism, epilepsy, and corpus callosum thickness on brain magnetic resonance imaging. This study further demonstrates the implication of TREM2 mutations in FTLD phenotypes. It illustrates the variability of bone phenotype and underlines the frequency of atypical signs in TREM2 carriers. This and previous studies evidence that TREM2 mutation screening should be limited to autosomal recessive FTLD with atypical phenotypes characterized by: (1) a very young age at onset (20-50 years); (2) early parietal and hippocampal deficits; (3) the presence of seizures and parkinsonism; (4) suggestive extensive white matter lesions and corpus callosum thickness on brain magnetic resonance imaging. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

    Science.gov (United States)

    Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

    2012-01-01

    The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

  8. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-04-01

    Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

  9. Domestic violence in consanguineous marriages - findings from Pakistan Demographic and Health Survey 2012-13.

    Science.gov (United States)

    Shaikh, Masood Ali

    2016-10-01

    Domestic violence is a pandemic and estimated to affect one in three women globally, in their lifetime. Marriages within blood relations in Pakistan are common. In this study a secondary analysis of Pakistan Demographic and Health Survey 2012-13 was done to study the prevalence and profile of domestic violence in the context of consanguineous marriages in Pakistan. Almost 65% of women had some kind of blood relationship with their husbands. Women having a blood relationship with husbands were more likely to report having ever been subjected to marital control behaviours, emotional and physical violence by their husbands, compared to ones without such relationship. However, these associations fail to reach statistical significance; underscoring the ubiquitous nature of marital control and violence. More effective public health education campaigns for just and equal treatment of wives by their husbands to speedily curb the scourge of domestic violence in the country are needed.

  10. Parental consanguineous marriages and clinical response to chemotherapy in locally advanced breast cancer patients.

    Science.gov (United States)

    Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam

    2011-03-28

    The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

    Science.gov (United States)

    Williams, Lisa; Ralphs, Rob; Gray, Paul

    2017-03-21

    The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

  12. Unusual association of turner syndrome and hypopituitarism in a Tunisian family.

    Science.gov (United States)

    Bougacha-Elleuch, N; Elleuch, M; Charfi, N; Mnif, F; Belghith, N; Abdelhedi, F; Kammoun, H; Hachicha, M; Mnif, M; Abid, M

    2016-01-01

    Familial occurrence of either Turner syndrome or hypopituitarism is very rare. Particularly, their association is an uncommon finding. In this context, we describe for the first time 4 sisters with Turner syndrome, hypopituitarism was reported in three among them. Our cohort consists of four Tunisian adult sisters belonging to a consanguineous family. Biochemical analysis, resonance magnetic imaging and cytogenetic analyses were performed. Turner syndrome was diagnosed at the ages of 14, 17, 31 and 43 years in cases 1, 2, 3 and 4 respectively. They suffered from short stature, dysmorphic syndrome and/or delayed puberty. Interestingly, 3 among them showed also hypopituitarism, hypogonadotrophic hypogonadism and central hypothyroidism. Somatotropic insufficiency was proven in one case. Pituitary MRI has shown an empty sella turcica with hypoplastic pituitary gland in three cases. Their karyotypes were compatible with 45X in one case, 45X/46XX in the second and 45X/46XX/47XXY with x label in two cases. Hence, the presence of these familial cases of TS must evoke new etiopathogenetic arguments. Coincidence of hypopituitarism in this family, might suggest common genetic background for the two diseases. This particular family would be a precious tool for an extensive molecular analysis. More attention should be given to other family's members mainly in the presence of delayed puberty and sterility in other members. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. Homozygosity mapping in autosomal recessive retinitis pigmentosa families detects novel mutations

    Science.gov (United States)

    Marzouka, Nour al Dain; Hebrard, Maxime; Manes, Gaël; Sénéchal, Audrey; Meunier, Isabelle; Hamel, Christian P.

    2013-01-01

    Purpose Autosomal recessive retinitis pigmentosa (arRP) is a genetically heterogeneous disease resulting in progressive loss of photoreceptors that leads to blindness. To date, 36 genes are known to cause arRP, rendering the molecular diagnosis a challenge. The aim of this study was to use homozygosity mapping to identify the causative mutation in a series of inbred families with arRP. Methods arRP patients underwent standard ophthalmic examination, Goldman perimetry, fundus examination, retinal OCT, autofluorescence measurement, and full-field electroretinogram. Fifteen consanguineous families with arRP excluded for USH2A and EYS were genotyped on 250 K SNP arrays. Homozygous regions were listed, and known genes within these regions were PCR sequenced. Familial segregation and mutation analyzes were performed. Results We found ten mutations, seven of which were novel mutations in eight known genes, including RP1, IMPG2, NR2E3, PDE6A, PDE6B, RLBP1, CNGB1, and C2ORF71, in ten out of 15 families. The patients carrying RP1, C2ORF71, and IMPG2 mutations presented with severe RP, while those with PDE6A, PDE6B, and CNGB1 mutations were less severely affected. The five families without mutations in known genes could be a source of identification of novel genes. Conclusions Homozygosity mapping combined with systematic screening of known genes results in a positive molecular diagnosis in 66.7% of families. PMID:24339724

  14. A case - control study of risk factors for coronary artery disease in Pakistani females

    International Nuclear Information System (INIS)

    Nazeer, M.; Naveed, T.; Ullah, A.

    2010-01-01

    Objectives: To establish the strength of association of conventional risk factors for coronary artery disease in native Pakistani females. Methods: We conducted a case - control hospital based study on 198 females (age 30 - 80 years) scheduled for their first coronary angiography at Punjab Institute of Cardiology, Lahore. Patients were divided into pre-menopausal group (age: 45.1 +- 6.3) and post-menopausal group (62.1 +- 9.1). For each risk factor, patients with significant CAD (= 50% luminal diameter stenosis) were regarded as cases an those without significant CAD were taken as controls. Odds Ratios (OR) and their 95% confidence intervals (CI) were calculated by univariate analysis. Results: In total study cohort, Diabetes mellitus (OR 3.65 95% CI 2.0 - 6.5), Family history of premature coronary artery disease (OR 2.3, 95% CI 1.2 - 4.4), and increased waist circumference (OR 2.11, 95% CI 1.2 - 3.8) were strongly associated with significant CAD. In post menopausal age group, diabetes mellitus (OR 2.66 CI 1.3 - 5.1), hyperlipidaemia (OR 2.25 CI 1.2 - 2.3) and increased waist circumference (OR 2.16 CI 1.1 - 4.2) reached statistical significance. In pre-menopausal females only diabetes was strongly associated with significant coronary artery disease (OR 10 CI 2.6 - 37.4). Association of hypertension was not significant in any of subgroups studied. Very few cases of smoking (6 / 198) were found in our study to merit any further statistical analysis. Conclusions: Diabetes mellitus was the only risk factor in pre-menopausal females associated with coronary artery disease While diabetes, hyperlipidaemia and increased waist circumference were significantly associated with CAD in post menopausal females. (author)

  15. Coronary anomalies in Pakistani children with tetralogy of fallot

    International Nuclear Information System (INIS)

    Hussain, I.; Patel, N.

    2010-01-01

    To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

  16. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  17. Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

    DEFF Research Database (Denmark)

    Andersen, Rikke; Brot, Christine; Mejborn, Heddie

    2009-01-01

    Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

  18. Cortical atrophy and hypofibrinogenemia due to FGG and TBCD mutations in a single family: a case report.

    Science.gov (United States)

    Stephen, Joshi; Nampoothiri, Sheela; Vinayan, K P; Yesodharan, Dhanya; Remesh, Preetha; Gahl, William A; Malicdan, May Christine V

    2018-05-16

    Blended phenotypes or co-occurrence of independent phenotypically distinct conditions are extremely rare and are due to coincidence of multiple pathogenic mutations, especially due to consanguinity. Hereditary fibrinogen deficiencies result from mutations in the genes FGA, FGB, and FGG, encoding the three different polypeptide chains that comprise fibrinogen. Neurodevelopmental abnormalities have not been associated with fibrinogen deficiencies. In this study, we report an unusual patient with a combination of two independently inherited genetic conditions; fibrinogen deficiency and early onset cortical atrophy. The study describes a male child from consanguineous family presented with hypofibrinogenemia, diffuse cortical atrophy, microcephaly, hypertonia and axonal motor neuropathy. Through a combination of homozygosity mapping and exome sequencing, we identified bi-allelic pathogenic mutations in two genes: a homozygous novel truncating mutation in FGG (c.554del; p.Lys185Argfs*14) and a homozygous missense mutation in TBCD (c.1423G > A;p.Ala475Thr). Loss of function mutations in FGG have been associated with fibrinogen deficiency, while the c.1423G > A mutation in TBCD causes a novel syndrome of neurodegeneration and early onset encephalopathy. Our study highlights the importance of homozygosity mapping and exome sequencing in molecular prenatal diagnosis, especially when multiple gene mutations are responsible for the phenotype.

  19. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

    Science.gov (United States)

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-04-23

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

  20. Cancerous leptomeningitis and familial congenital hypopituitarism.

    Science.gov (United States)

    Vujovic, S; Vujosevic, S; Kavaric, S; Sopta, J; Ivovic, M; Saveanu, A; Brue, T; Korbonits, M; Popovic, V

    2016-05-01

    People are at higher risk of cancer as they get older or have a strong family history of cancer. The potential influence of environmental and behavioral factors remains poorly understood. Earlier population and case control studies reported that upper quartile of circulating IGF-I is associated with a higher risk of developing cancer suggesting possible involvement of the growth hormone (GH)/IGF system in initiation or progression of cancer. Since GH therapy increases IGF-1 levels, there have been concerns that GH therapy in hypopituitarism might increase the risk of cancer. We report a 42-year-old female patient who presented with subacute onset of symptoms of meningitis and with the absence of fever which resulted in death 70 days after the onset of symptoms. The patient together with her younger brother was diagnosed at the age of 5 years with familial congenital hypopituitarism, due to homozygous mutation c.150delA in PROP1 gene. Due to evolving hypopituitarism, she was replaced with thyroxine (from age 5), hydrocortisone (from age 13), GH (from age 13 until 17), and sex steroids in adolescence and adulthood. Her consanguineous family has a prominent history of malignant diseases. Six close relatives had malignant disease including her late maternal aunt with breast cancer. BRCA 1 and BRCA 2 mutational analysis in the patient's mother was negative. Histology after autopsy disclosed advanced ovarian cancer with multiple metastases to the brain, leptomeninges, lungs, heart, and adrenals. Low circulating IGF-1 did not seem to protect this patient from cancer initiation and progression in the context of strong family history of malignancies.

  1. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  2. [Phenotypic and molecular characterization of a Colombian family with phenylketonuria].

    Science.gov (United States)

    Gélvez, Nancy; Acosta, Johana; López, Greizy; Castro, Derly; Prieto, Juan Carlos; Bermúdez, Martha; Tamayo, Marta L

    2016-09-01

    Phenylketonuria is a metabolic disorder characterized by severe neurological involvement and behavioral disorder, whose early diagnosis enables an effective treatment to avoid disease sequelae, thus changing the prognosis. Objective: To characterize a family with phenylketonuria in Colombia at clinical, biochemical and molecular levels. Materials and methods: The population consisted of seven individuals of a consanguineous family with four children with suggestive symptoms of phenylketonuria. After signing an informed consent, blood and urine samples were taken for colorimetric tests and high performance liquid and thin layer chromatographies. DNA extraction and sequencing of the 13 exons of the PAH gene were performed in all subjects. We designed primers for each exon with the Primer 3 software using automatic sequencing equipment Abiprism 3100 Avant. Sequences were analyzed using the SeqScape, v2.0, software. Results: We described the clinical and molecular characteristics of a Colombian family with phenylketonuria and confirmed the presence of the mutation c.398_401delATCA. We established a genotype-phenotype correlation, highlighting the interesting clinical variability found among the affected patients despite having the same mutation in all of them. Conclusions: Early recognition of this disease is very important to prevent its neurological and psychological sequelae, given that patients reach old age without diagnosis or proper management.

  3. Síndrome de Usher de tipo II: caracterización oftalmológica, auditiva y genética de una familia consanguínea Type II Usher syndrome: ophthalmological, auditory, and genetic characterization of a consanguineous family

    Directory of Open Access Journals (Sweden)

    Rásife Freyre Luque

    2011-09-01

    Full Text Available Se caracterizó a una familia consanguínea de 25 miembros, 3 de los cuales padecían el síndrome de Usher de tipo II, a través del estudio auditivo, oftalmológico y genético en el Centro de Retinosis Pigmentaria de Santiago de Cuba. Los pacientes (2 varones y 1 fémina tenían en común: aparición de la enfermedad en la etapa juvenil, mala visión nocturna, campos visuales reducidos, hipoacusia neurosensorial y resultados normales en las pruebas vestibulares; asimismo, en genética molecular, la electroforesis en gel de poliacrilamida reveló la presencia del marcador D1S237, estrechamente ligado al gen USH2 en el cromosoma 1. Esa caracterización permitirá aplicar la terapia génica y los implantes, tanto de células madre como cocleares, según corresponda.A consanguineous family of 25 members, 3 of whom suffered from type II Usher syndrome was characterized through the auditory, ophthalmologic, and genetic study in the Retinitis Pigmentosa Center from Santiago de Cuba. The patients (2 males and a female had in common: occurrence of the illness during youth, bad night vision, reduced visual fields, neurosensorial hypoakusia, and normal results in the vestibular tests; also, in molecular genetics, electrophoresis in polyacrilamide gel revealed the presence of the D1S237 marker, closely linked to the gene USH2 in chromosome 1. That characterization will allow to apply the genic therapy and both implants, mother cells and cochlear, as it corresponds.

  4. Assessment of dietary intake of trace elements through Pakistani integrated diets

    International Nuclear Information System (INIS)

    Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

    1994-01-01

    A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

  5. The challenges of managing coexistent disorders with phenylketonuria

    DEFF Research Database (Denmark)

    MacDonald, A; Ahring, K; Almeida, M F

    2015-01-01

    INTRODUCTION: The few published case reports of co-existent disease with phenylketonuria (PKU) are mainly genetic and familial conditions from consanguineous marriages. The clinical and demographic features of 30 subjects with PKU and co-existent conditions were described in this multi-centre, re......INTRODUCTION: The few published case reports of co-existent disease with phenylketonuria (PKU) are mainly genetic and familial conditions from consanguineous marriages. The clinical and demographic features of 30 subjects with PKU and co-existent conditions were described in this multi...

  6. Meaning of 9/11 for two Pakistani communities: from external intruders to the internalisation of a negative self-image.

    Science.gov (United States)

    Rousseau, Cécile; Jamil, Uzma

    2008-12-01

    Since September 11, the increase in international tensions and the subsequent wars in Afghanistan and Iraq have created turmoil and fears in immigrant communities, fanned by the media in the context of the war against terrorism. This paper aims to compare the meaning systems evoked around 9/11 within two Pakistani groups-an immigrant community in Montreal and a group in Karachi. It also intends to examine the representation of themselves and of the 'Other' within these two groups. Results suggest that both Karachi and Montreal Pakistani respondents favour a conspiracy scenario which protects the Muslim community from the responsibility of 9/11 events. They refer to an argumentation process based on 'proofs', thus mirroring the political rhetoric used by the US government and its allies to justify the military intervention in Iraq. In the Montreal group, the pervasive feeling of fear and the bleak image that the community has of itself support the hypothesis of an immigrant internalisation of the negative representations of Muslim and South Asian identities in the North American context. The negative self-image observed in these minority groups indicates that more effort than ever should be dedicated to understanding the impact of the present international context on minority-majority relations in multi-ethnic societies. It is as if America is sitting right here in the living room with us … We have to ask them permission to breathe. (Parveen, Karachi).

  7. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    International Nuclear Information System (INIS)

    Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

    2010-01-01

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  8. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

    2010-04-15

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  9. Familial megacalyces with autosomal recessive inheritance

    International Nuclear Information System (INIS)

    Lam, A.H.

    1988-01-01

    Three children with bilateral congenital megacalyces from a consanguinous marriage are reported. No renal abnormality was detected in the parents. Our observation supports the genetic nature of the disease. The ultrasonographic features of congenital megacalyces are described. (orig.)

  10. Primary hyperoxaluria type 1: clinical manifestations in infancy and prenatal diagnosis

    DEFF Research Database (Denmark)

    Illum, N; Lavard, L; Danpure, C J

    1992-01-01

    biopsy demonstrated complete absence of alanine: glyoxylate aminotransferase catalytic activity and immunoreactive protein compatible with a diagnosis of primary hyperoxaluria type 1. He died at the age of 11 months, just before liver transplantation was made possible. Fetal liver biopsy in the mother......A 9-month-old Pakistani boy of consanguineous parents presented with uraemia preceded by pyuria from 5 weeks of age. He had no history of renal calculi or macroscopic haematuria. Renal biopsy revealed severe calcium oxalate deposition in the tubuli and fibrosis of the interstitial tissue. Liver......'s subsequent pregnancy showed normal enzymatic activity. Early detection and early replacement of the missing enzyme by liver transplantation are considered to be crucial for the survival of severely affected infants with the acute neonatal form of primary hyperoxaluria type 1. Persistent pyuria could...

  11. Homozygosity mapping reveals new nonsense mutation in the FAM161A gene causing autosomal recessive retinitis pigmentosa in a Palestinian family.

    Science.gov (United States)

    Zobor, Ditta; Balousha, Ghassan; Baumann, Britta; Wissinger, Bernd

    2014-01-01

    Retinitis pigmentosa (RP) is a heterogenous group of inherited retinal degenerations caused by mutations in at least 45 genes. Recently, the FAM161A gene was identified as the causative gene for RP28, an autosomal recessive form of RP. We performed a clinical and molecular genetic study of a consanguineous Palestinian family with two three siblings affected with retinitis pigmentosa. DNA samples were collected from the index patient, his father, his affected sister, and two non-affected brothers. DNA sample from the index was subjected to high resolution genome-wide SNP array. Assuming identity-by-descent in this consanguineous family we applied homozygosity mapping to identify disease causing genes. The index patient reported night blindness since the age of 20 years, followed by moderate disease progression with decrease of peripheral vision, the development of photophobia and later on reduced central vision. At the age of 40 his visual acuity was counting fingers (CF) for both eyes, color discrimination was not possible and his visual fields were severely constricted. Funduscopic examination revealed a typical appearance of advanced RP with optic disc pallor, narrowed retinal vessels, bone-spicule like pigmentary changes in the mid-periphery and atrophic changes in the macula. His younger affected brother (37 years) was reported with overall milder symptoms, while the youngest sister (21 years) reported problems only with night vision. Applying high-density SNP arrays we identified several homozygous genomic regions one of which included the recently identified FAM161A gene mutated in RP28-linked autosomal recessive RP. Sequencing analysis revealed the presence of a novel homozygous nonsense mutation, c.1003C>T/p.R335X in the index patient and the affected sister. We identified an RP28-linked RP family in the Palestinian population caused by a novel nonsense mutation in FAM161A. RP in this family shows a typical disease onset with moderate to rapid progression

  12. The potential impact of family history of metabolic syndrome and risk of type 2 diabetes mellitus: In a highly endogamous population

    Directory of Open Access Journals (Sweden)

    Abdulbari Bener

    2014-01-01

    Full Text Available Aim: This study aims to determine the potential impact of positive family history of Metabolic Syndrome (MetS among two generations, on developing Type 2 Diabetes Mellitus (T2DM and the potential relation of consanguineous marriage among patients with MetS to the risk of developing T2DM among a sample of Qataris. Design: A cross-sectional study. Setting: Primary healthcare (PHC centers. Materials and Methods: The survey and measurement were conducted from April 2011 to December 2012 among Qatari nationals above 20 years of age. Of the 2,182 subjects, who were approached to participate in the study, 1,552 (71% gave their consent. Face-to-face interviews were conducted using a structured questionnaire followed by anthropometric measurements and laboratory tests. Metabolic syndrome was defined using the National Cholesterol Education Program-Third Adult Treatment Panel (ATP III as well as International Diabetes Federation (IDF. Results: Overall, the prevalence of MetS was 26.2% according to ATP III and 36.9% according to IDF (P < 0.0001. The mean age of MetS patients with T2DM was significantly higher than those without T2DM (Mean 48 ± 9.9 vs. 42.5 ± 9.2; P < 0.001. The proportion of females was higher among MetS patients with T2DM as compared to those without T2DM (61% vs. 51%; P = 0.053. In addition, there were significant differences between MetS patients with and without DM in terms of co-morbidities of hypertension, coronary heart disease, and high cholesterol. The proportion of MetS patients with positive family history for MetS was significantly higher in MetS patients with T2DM as compared to those without T2DM (46.7% vs. 33.8%; P = 0.009. The proportion of positive family history of MetS among fathers (35% vs. 21.9%; P = 0.005, mothers (30.5% vs. 18.8%; P = 0.008, maternal aunt (18.3% vs. 11.2%; P = 0.055, and maternal grand father (19.5% vs. 10%; P = 0.010 were significantly higher in MetS patients with T2DM as compared to the

  13. Young family as the basis of forming family potential in perspective

    Directory of Open Access Journals (Sweden)

    H. H. Mamadalieva

    2017-01-01

    Full Text Available The purpose of the article is to disclose the place and the role of a young family in formation in perspective of the family potential of the Republic of Uzbekistan. The family represents an association of people based on marriage or consanguinity, who have a common life and mutual responsibility, and is an essential component of the social structure of the society. It is the most important life value in many countries. These days, there is often a transition to new models of family formation. The family in Uzbekistan is quite stable, despite new and not always positive trends occurring in the world. It continues to be the most important value in life, the guardian of national traditions and customs, the basis of personality formation and healthy way of living. The scientific novelty of the article is that for the fi rst time the role and the place of a young family in formation in the perspective of family potential is disclosed using the example of Uzbekistan. According to the Law of the Republic of Uzbekistan «About the State Youth Policy» a young family is a family where the age of both spouses does not exceed thirty inclusive, or a family in where children (child are raised by one parent aged no more than thirty inclusive, including the divorced, and the widower (widow. Procreation of population is largely due to a young family (3/4 of the total number of children are born with the parents under 30 years of age. Uzbekistan is characterized by a high marriage rate. The population, entering into marriage, increases annually in the Republic. At the same time, the marriage rate grows. All this promotes formation of young families and increase of their share in the total number of families in the Republic. The measures provided by the state policy concerning families in general, refer, mostly and largely, to young families in the fi rst place. Methods of statistical analysis, methods of groups, and methods of

  14. Waardenburg syndrome type I: Dental phenotypes and genetic analysis of an extended family.

    Science.gov (United States)

    Sólia-Nasser, L; de Aquino, S-N; Paranaíba, L-M R; Gomes, A; Dos-Santos-Neto, P; Coletta, R-D; Cardoso, A-F; Frota, A-C; Martelli-Júnior, H

    2016-05-01

    The aim of this study was to describe the pattern of inheritance and the clinical features in a large family with Waardenburg syndrome type I (WS1), detailing the dental abnormalities and screening for PAX3 mutations. To characterize the pattern of inheritance and clinical features, 29 family members were evaluated by dermatologic, ophthalmologic, otorhinolaryngologic and orofacial examination. Molecular analysis of the PAX3 gene was performed. The pedigree of the family,including the last four generations, was constructed and revealed non-consanguineous marriages. Out of 29 descendants, 16 family members showed features of WS1, with 9 members showing two major criteria indicative of WS1. Five patients showed white forelock and iris hypopigmentation, and four showed dystopia canthorum and iris hypopigmentation. Two patients had hearing loss. Dental abnormalities were identified in three family members, including dental agenesis, conical teeth and taurodontism. Sequencing analysis failed to identify mutations in the PAX3 gene. These results confirm that WS1 was transmitted in this family in an autosomal dominant pattern with variable expressivity and high penetrance. The presence of dental manifestations, especially tooth agenesis and conical teeth which resulted in considerable aesthetic impact on affected individuals was a major clinical feature. This article reveals the presence of well-defined dental changes associated with WS1 and tries to establish a possible association between these two entities showing a new spectrum of WS1.

  15. Assessment of potential toxicity of a smokeless tobacco product (naswar) available on the Pakistani market.

    Science.gov (United States)

    Zakiullah; Saeed, Muhammad; Muhammad, Naveed; Khan, Saeed Ahmad; Gul, Farah; Khuda, Fazli; Humayun, Muhammad; Khan, Hamayun

    2012-07-01

    'Naswar' is a smokeless tobacco product (STP) widely used in Pakistan. It has been correlated with oral and oesophageal cancer in recent clinical studies. The toxic effects associated with STPs have been associated with trace level contaminants present in these products. The toxin levels of Pakistani naswar are reported for the first time in this study. A total of 30 Pakistani brands of naswar were tested for a variety of toxic constituents and carcinogens such as cadmium, arsenic, lead and other carcinogenic metals, nitrite and nitrate, and nicotine and pH. The average values of all the toxins studied were well above their allowable limits, making the product a health risk for consumers. Calculated lifetime cancer risk from cadmium and lead was 1 lac (100,000) to 10 lac (1,000,000) times higher than the minimum 10E-4 (0.00001) to 10E-6 (0.000001), which is the 'target range' for potentially hazardous substances, according to the US Environmental Protection Agency. Similarly, the level of arsenic was in the range of 0.15 to 14.04 μg/g, the average being 1.25 μg/g. The estimated average bioavailable concentration of arsenic is 0.125-0.25 μg/g, which is higher than the allowable standard of 0.01 μg/g. Similarly, the average minimum daily intake of chromium and nickel was 126.97 μg and 122.01 μg, as compared to allowable 30-35 μg and 35 μg, respectively; a 4-5 times higher exposure. However, beryllium was not detected in any of the brands studied. The pH was highly basic, averaging 8.56, which favours the formation of tobacco specific amines thus making the product potentially toxic. This study validates clinical studies correlating incidence of cancer with naswar use in Pakistan. This study shows that the production, packaging, sale and consumption of naswar should be regulated so as to protect the public from the health hazards associated with its consumption.

  16. The prevalence of Y chromosome microdeletions in Pakistani infertile men

    Directory of Open Access Journals (Sweden)

    Rubina Tabassum Siddiqui

    2013-01-01

    Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.

  17. Patient perspectives on type 2 diabetes and medicine use during Ramadan among Pakistanis in Denmark

    DEFF Research Database (Denmark)

    Mygind, Anna; Kristiansen, Maria; Wittrup, Inge

    2013-01-01

    of Ramadan without adequate counselling on how to adjust their medicines. Objective To explore patient perspectives on medicine use during Ramadan, reasons for fasting and experiences with counselling on medicine use during Ramadan among people of Pakistani background with type 2 diabetes and at least one...... (six interviewers). Results All interviewees pointed out that Islam allows ill people to refrain from fasting during Ramadan. However, all had fasted during Ramadan despite being diagnosed with type 2 diabetes. While fasting, they adapted their use of medicines in different ways, e.g. by changing...... the time of intake or by skipping morning medicines. Fasting during Ramadan meant a feeling of improvement in well-being for all interviewees. Reasons for this improvement included physiological, social and religious aspects. Healthcare professionals were rarely included in the decision-making process...

  18. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  19. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

    Science.gov (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

    2015-06-01

    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  20. Pakistani Immigrant Children and Adults in Denmark Have Severely Low Vitamin D Status

    DEFF Research Database (Denmark)

    Andersen, Rikke; Mølgaard, C.; Skovgaard, L. T.

    2008-01-01

    association with S-25OHD for men (P = 0.04) and women (P = 0.0008). Twenty-one per cent of the women and 34% of the men had osteopenia. Neither S-25OHD nor S-iPTH was associated with lumbar spine or whole body bone mineral content. Conclusions: Severely low vitamin D status and elevated S-iPTH is common among......, Copenhagen (55 degrees N), January- November. Serum 25-hydroxyvitamin D (S-25OHD), serum intact parathyroid hormone (S-iPTH), bone turnover markers and whole body and lumbar spine bone mineral density were measured. Sun, smoking and clothing habits, age, body mass index (BMI), and vitamin D and calcium from......Objective: To determine vitamin D and bone status in adolescent girls, pre-menopausal women and men of Pakistani origin, to single out determinants of vitamin D status and to determine the association between vitamin D status, bone metabolism and bone status. Subjects/Methods: Cross-sectional study...

  1. A Novel Role for CSRP1 in a Lebanese Family with Congenital Cardiac Defects

    Directory of Open Access Journals (Sweden)

    Amina Kamar

    2017-12-01

    Full Text Available Despite an obvious role for consanguinity in congenital heart disease (CHD, most studies fail to document a monogenic model of inheritance except for few cases. We hereby describe a first-degree cousins consanguineous Lebanese family with 7 conceived children: 2 died in utero of unknown causes, 3 have CHD, and 4 have polydactyly. The aim of the study is to unveil the genetic variant(s causing these phenotypes using next generation sequencing (NGS technology. Targeted exome sequencing identified a heterozygous duplication in CSRP1 which leads to a potential frameshift mutation at position 154 of the protein. This mutation is inherited from the father, and segregates only with the CHD phenotype. The in vitro characterization demonstrates that the mutation dramatically abrogates its transcriptional activity over cardiac promoters like NPPA. In addition, it differentially inhibits the physical association of CSRP1 with SRF, GATA4, and with the newly described partner herein TBX5. Whole exome sequencing failed to show any potential variant linked to polydactyly, but revealed a novel missense mutation in TRPS1. This mutation is inherited from the healthy mother, and segregating only with the cardiac phenotype. Both TRPS1 and CSRP1 physically interact, and the mutations in each abrogate their partnership. Our findings add fundamental knowledge into the molecular basis of CHD, and propose the di-genic model of inheritance as responsible for such malformations.

  2. A study on the effective factors of mortalities with unknown causes among one month old infants of Tehran and Central provinces

    Directory of Open Access Journals (Sweden)

    Moshkani Z

    1998-07-01

    Full Text Available In this work, the net effect of birth type (one or more children, the number of previous dead children, the mother tongue, mother's age at infant birth, number of deliveries, consanguineous marriages, and the father's education on the mortality of one-month-old infants in families of residents of Tehran and the Central Province is studied. The data referred to in this study was taken from a survey conducted by the Department of Vital Statistics in 1991. Applying multiple logistic regreession to analyze the data I removed the effect of a number of variables to conclude that the consanguineous marriage is significantly effective by itself and in interaction with the number of previous dead children. The odds ratio among consanguine parents for those who had one previous dead child to those without a previous dead child is 5.45. This ratio for non-consanguineous parents is 4.96. Thus the significant effect of consanguinity is proven.

  3. Phenotypic concordance in familial inflammatory bowel disease (IBD). Results of a nationwide IBD Spanish database.

    Science.gov (United States)

    Cabré, Eduard; Mañosa, Míriam; García-Sánchez, Valle; Gutiérrez, Ana; Ricart, Elena; Esteve, Maria; Guardiola, Jordi; Aguas, Mariam; Merino, Olga; Ponferrada, Angel; Gisbert, Javier P; Garcia-Planella, Esther; Ceña, Gloria; Cabriada, José L; Montoro, Miguel; Domènech, Eugeni

    2014-07-01

    Disease outcome has been found to be poorer in familial inflammatory bowel disease (IBD) than in sporadic forms, but assessment of phenotypic concordance in familial IBD provided controversial results. We assessed the concordance for disease type and phenotypic features in IBD families. Patients with familial IBD were identified from the IBD Spanish database ENEIDA. Families in whom at least two members were in the database were selected for concordance analysis (κ index). Concordance for type of IBD [Crohn's disease (CD) vs. ulcerative colitis (UC)], as well as for disease extent, localization and behaviour, perianal disease, extraintestinal manifestations, and indicators of severe disease (i.e., need for immunosuppressors, biological agents, and surgery) for those pairs concordant for IBD type, were analyzed. 798 out of 11,905 IBD patients (7%) in ENEIDA had familial history of IBD. Complete data of 107 families (231 patients and 144 consanguineous pairs) were available for concordance analyses. The youngest members of the pairs were diagnosed with IBD at a significantly younger age (p<0.001) than the oldest ones. Seventy-six percent of pairs matched up for the IBD type (κ=0.58; 95%CI: 0.42-0.73, moderate concordance). There was no relevant concordance for any of the phenotypic items assessed in both diseases. Familial IBD is associated with diagnostic anticipation in younger individuals. Familial history does not allow predicting any phenotypic feature other than IBD type. Copyright © 2013 European Crohn's and Colitis Organisation. Published by Elsevier B.V. All rights reserved.

  4. LGMD2D syndrome: the importance of clinical and molecular genetics in patient and family management. Case Report.

    Science.gov (United States)

    Al-Harbi, Khalid M; Abdallah, Atiyeh M

    2016-09-01

    We report the case of a seven-year-old female from a consanguineous Saudi family with autosomal recessive limb girdle muscular dystrophy type 2D (LGMD2D) most likely caused by a rare SGCA mutation. Histopathological and molecular investigations resulted in the discovery of a homozygous mutation (c.226 C>T (p.L76 F)) in exon 3 of SGCA in the patient. The parents and one sibling were heterozygous carriers, but the mutation was not otherwise detected in 80 ethnic controls from the same geographic area. In silico analysis revealed that the mutation resulted in a functional leucine to phenylalanine alteration that was deleterious to the protein structure. This is only the second reported case of the p.L76F mutation in LGMD, and highlights that molecular genetics analysis is essential to deliver the most appropriate management to the patient and offer the family genetic counseling.

  5. Evaluation of Inheritance Pattern in Mentally Retarded Children

    Directory of Open Access Journals (Sweden)

    F Behnaz

    2011-07-01

    Full Text Available Introduction: Mental retardation is one of the most important problems of general health. The purpose of this study was to evaluate inheritance pattern of mentally retarded patients in Yazd city. Methods: In a descriptive cross- sectional study, all medical records and pedigrees of 320 mentally retarded children whose parents had referred for genetic consultation to the Welfare center of Yazd city were reviewed. Results: Of the total, 62.8% of the parents had consanguineous marriage. Mean inbreeding coefficient of offsprings was 0.0713 in third degree related parents versus 0.0156 in non-related parents. Mental retardation was seen in 43.4% of first– degree relatives of children (6.6% of parents and 36.8% of siblings, respectively. Frequency of mental retardation did not differ significantly in both sexes. Pedigree showed inheritance pattern in 43.4% of patients (autosomal recessive, autosomal dominant and x-linked inheritance pattern were seen in 33.75%, 6.9% and 2.8%, respectively, while 37% of patients had no definite inheritance pattern. Abnormal karyotype were seen in 19.4% of patients, 28 of whom(8.75% of all patients had Down syndrome. The prevalence of autosomal recessive inheritance in patients with consanguineous marriages and non family marriages was 62.8 % and 10%, respectively (P=0. 002. Conclusion: Since multiple cases of mental retardation were seen in families and rate of consanguineous marriage was more in parents of mentally retarded children, genetic counseling in consanguinity marriages and families of mentally retarded children can prevent incidence of mental retardation in these families.

  6. Religion, male violence, and the control of women: Pakistani Muslim men in Bradford, UK.

    Science.gov (United States)

    Macey, M

    1999-03-01

    This paper examines Pakistani Muslim male violence in the public and private spheres in Bradford, UK. The article also explores the relationship between male violence and ideas of culture and religion. The material used was collected over a 4-year period from students and staff in further and higher education institutions; working women (prostitutes); survivors of domestic violence; police personnel who work with Asian women fleeing domestic violence or forced marriages; and staff of a children's society working with teenage prostitutes. Methodologies included lectures, seminars, focus groups, and interviews. Findings reveal that there is a difference between male and female attitudes towards Islam. Some men are using it to justify violence against women, while women of all ages and backgrounds are using it as a source of strength and to negotiate (with ingenuity and humor) the cultural and religious requirements which men try to impose upon them.

  7. Study findings on evaluation of integrated family planning programme performance.

    Science.gov (United States)

    1980-01-01

    In 1976 the United Nations's Economic and Social Commission for Asia and the Pacific launched a comparative study on integrated family planning programs in a number of countries in the region. In November 1979 the study directors from the participating countries meet in Bangkok to discuss the current status of the studies in their countries. The Korean and Malaysian studies were completed, the Bangladesh study was in the data collecting phase, and the Pakistani research design phase was completed. The meeting participants focused their attention on the findings and policy implications of the 2 completed studies and also discussed a number of theorectical and methodological issues which grew out of their research experience. The Malaysian study indicated that group structure, financial resources, and the frequency and quality of worker-client contact were the most significant variables determining program effectiveness. In the Korean Study, leadership, financial resources, and the frequency and quality of contact between agencies were the key variables in determining program effectiveness. In the Malaysian study there was a positive correlation between maternal and child health service performance measures and family planning service performance measures. This finding supported the contention that these 2 types of service provision are not in conflict with each other but instead serve to reinforce each other. Policy implications of the Korean study were 1) family planning should be an integral part of all community activities; 2) family planning workers should be adequately supported by financial and supply allocations; and 3) adequate record keeping and information exchange procedures should be incorporated in the programs.

  8. [Serological Characteristics and Family Survey of 3 Cases of H-deficient Blood Group].

    Science.gov (United States)

    Geng, Wei; Gao, Huan-Huan; Zhang, Lin-Wei

    2016-06-01

    To investigate the serological characteristics and the genetic status of the family of H-deficient blood group in Jining area of Shandong province in China. ABO, H, and Lewis blood groups in 3 probands were screened out by the serological method, and saliva testing was performed on all the individuals. The presence of weak A or B on the RBC was confirmed by using the adsorption-elution procedure. Three cases of H-deficient blood group were identified to be para-Bombay blood group (secretor), out of 3 cases, 2 cases were Bh, 1 case was Ah, and anti-H or anti-HI antibody was detected in their serum. Three cases of H-deficerent blood group are para-Bombay phenotype, among them one proband's parents have been confirmed to be consanguineous relationship.

  9. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  10. Molecular genetic analysis of consanguineous families with primary ...

    Indian Academy of Sciences (India)

    RESEARCH NOTE Volume 96 Issue 2 June 2017 pp 383-387 ... Autosomal recessive primary microcephaly is a rare genetic disorder that is ... Department of Cell and Developmental Biology, School of Life Sciences, University of Science and ...

  11. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  12. A new family programme in Zhejiang province.

    Science.gov (United States)

    Xu, B

    1994-04-01

    Zhejiang Province in China has promoted a new family planning program since April 1993. The program stresses delayed marriage and childbearing, fewer and healthier births, modernization of family life, and prosperity through hard work. The people are receptive to the new program out of a desire for an improved standard of living. The objective is to build small, modern families who 1) practice deferred marriage and childbearing; 2) voluntarily practice family planning and have no unplanned births; 3) practice avoidance of consanguineous marriage, become sterilized if a carrier of a hereditary disease of chromosomal abnormality, and use premarital education and counseling and proper prenatal care; 4) uphold the laws and maintain discipline in action to avoid criminal behavior; 5) establish families that respect the old, care for children, and help their neighbors; 6) complete 9 years of compulsory education; and 7) create well being through hard work. The program is compatible with the strategy of the "three stresses" and an integrated approach. IEC and service provision are important components in program implementation. The target population are the masses and grassroots cadres, particularly those in the childbearing ages. IEC will be directed in different ways to different groups. Those aged 18-35 years will receive education. Face to face interaction with family planning workers and lectures will be directed to grassroots cadres. The mass media will be employed to reach the masses. The messages will include information and persuasion to adopt new families, accept family planning regulations, and learn about contraceptive use, healthy births and childrearing, education, health care, sex education, and income generation skills. Classes will be conducted for groups, such as teenagers, unmarried youth, pregnant women, and lactating women. Priority will be given to couples that accept the certificates for one child; favoritism will be granted for allocation of

  13. Variable clinical features in patients with CDH23 mutations (USH1D-DFNB12).

    NARCIS (Netherlands)

    Pennings, R.J.E.; Topsakal, V.; Astuto, L.M.; Brouwer, A.P.M. de; Wagenaar, M.; Huygen, P.L.M.; Kimberling, W.J.; Deutman, A.F.; Kremer, J.M.J.; Cremers, C.W.R.J.

    2004-01-01

    OBJECTIVE: To describe the findings of audiovestibular and ophthalmologic examinations in four families with mutations in the CDH23 gene. STUDY DESIGN: Family study. SETTING: Tertiary referral center. PATIENTS: Four DFNB12 patients from a large consanguineous Dutch family and six patients from three

  14. Restrictive Dermopathy: Molecular diagnosis of restrictive dermopathy in a stillborn fetus from a consanguineous Iranian family

    International Nuclear Information System (INIS)

    Karaminejad, A.; Goodarzi, P.; Huong, Le Thi Thanh; Wehnert, Manfred S.

    2009-01-01

    Restrictive dermopathy (RD) is an autosomal recessive lethal human genetic disorder. It is characterized by intrauterine growth retardation, tight and rigid skin with erosions, multiple joint contractures, lung hypoplasia, prominent superficial vasculature and epidermal hyperkeratosis. In the present report, we describe the first case of restrictive dermopathy in a stillborn fetus of Iranian origin, confirmed by molecular genetic diagnosis. In the index case (G-30159), a homozygous one base insertion in ZMPSTE24exon 9 (c.1085-1086insT) was identified. We believe that by increasing awareness of this disease in clinicians, gynecologists and pathologists, we may be able to help families who have had suspected cases of restrictive dermopathy be diagnosed and offer molecular testing in carriers and prenatal diagnosis to prevent the occurrence of further affected cases. (author)

  15. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  16. Pakistani medical students' specialty preference and the influencing factors.

    Science.gov (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

    2011-07-01

    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  17. Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan.

    Science.gov (United States)

    Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar

    2016-02-01

    There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation

    NARCIS (Netherlands)

    Pasutto, Francesca; Sticht, Heinrich; Hammersen, Gerhard; Gillessen-Kaesbach, Gabriele; Fitzpatrick, David R.; Nuernberg, Gudrun; Brasch, Frank; Schirmer-Zimmermann, Heidemarie; Tolmie, John L.; Chitayat, David; Houge, Gunnar; Fernandez-Martinez, Lorena; Keating, Sarah; Mortier, Geert; Hennekam, Raoul C. M.; von der Wense, Axel; Slavotinek, Anne; Meinecke, Peter; Bitoun, Pierre; Becker, Christian; Nuernberg, Peter; Reis, Andre; Rauch, Anita

    2007-01-01

    We observed two unrelated consanguineous families with malformation syndromes sharing anophthalmia and distinct eyebrows as common signs, but differing for alveolar capillary dysplasia or complex congenital heart defect in one and diaphragmatic hernia in the other family. Homozygosity mapping

  19. Mineralization and volatilization of 14C-ring labelled 2,4-dichlorophenoxy acetic acid in Pakistani soils

    International Nuclear Information System (INIS)

    Hussain, Altaf; Iqbal, Zafar; Asi, Muhammad Rafique; Chaudhry, Jamil Anwar

    2001-01-01

    The mineralization and volatilization of [U-ring 14 C] 2,4-D in three Pakistani soils was investigated under laboratory conditions using 50 g of soil and uniform distribution of 1.345 μg/g of 2,4-D. Maximum losses of 14 CO 2 and volatile organic compounds occurred at day 7 and losses gradually slowed down after 21 days of incubation. The relative distribution of 14 C losses differed with soil type. Volatilization was higher in control soil as compared to test and treated soil in both the study seasons. The contribution of volatile material to the total loss in 1997 was highest in test soil (24.4%), and lowest in farm soil (19.8%) but in 1998 was highest in control soil (26%) and lowest in test and farm soils (7%) during 1998. (author)

  20. Isolation, identification, screening of toxicity and oligopeptides of some marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the search for bioactive natural compounds

    OpenAIRE

    Hameed, Shaista

    2009-01-01

    Cyanobacteria produce a number of bioactive compounds, most of them are oligopeptides. Almost all are known from freshwater species. The aim of this study was to search for marine and brackish water species producing bioactive compounds. To reach this goal, new strains were isolated from Norwegian and Pakistani coastal waters. These and additional strains from NIVA, UiO and UiB culture collections (24 in total), belonging to Chroococcales and Oscillatoriales, were identified based on morpholo...

  1. Familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are different manifestations of the same disease: novel missense mutations in GALNT3

    International Nuclear Information System (INIS)

    Joseph, Leo; Joseph, Selvanayagam; Hing, Sandra N.; Idowu, Bernadine D.; Delaney, David; Presneau, Nadege; O'Donnell, Paul; Diss, Tim; Flanagan, Adrienne Margaret

    2010-01-01

    To report on the biochemistry and clinical and genetic findings of two siblings, the younger sister presenting with recurrent bone pain of the radius and ulna, and medullary sclerosis, and the older brother with soft tissue calcific deposits (tumoral calcinosis) but who later developed bone pain. Both were found to be hyperphosphaturic. The index family comprised four individuals (father, mother, brother, sister). The affected siblings were the offspring of a non-consanguineous Indian family of Tamil origin. Bidirectional sequencing was performed on the DNA from the index family and on 160 alleles from a population of 80 unrelated unaffected control individuals of Tamil extraction and 72 alleles from individuals of non-Tamil origin. Two symptomatic siblings were found to harbour previously unreported compound heterozygous missense UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-transferase; GALNT3) mutations in exon 4 c.842A>G and exon 5 c.1097T>G. This sequence variation was not detected in the control DNA. This is the first report of siblings exhibiting stigmata of familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome with documented evidence of autosomal recessive missense GALNT3 mutations. The findings from this family add further evidence to the literature that familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are manifestations of the same disease and highlight the importance of appropriate metabolic and genetic investigations. (orig.)

  2. Familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are different manifestations of the same disease: novel missense mutations in GALNT3

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, Leo; Joseph, Selvanayagam [Vinodhagan Memorial Hospital and Dr. Joseph' s Ortho Clinic, Department of Orthopaedic Surgery, Thanjavur (India); Hing, Sandra N.; Idowu, Bernadine D.; Delaney, David [Royal National Orthopaedic Hospital NHS Trust, Department of Histopathology, Stanmore, Middlesex (United Kingdom); Presneau, Nadege [University College London (UCL), Cancer Institute, London (United Kingdom); O' Donnell, Paul [Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom); University College London (UCL), Institute of Orthopaedics and Musculoskeletal Science, Stanmore (United Kingdom); University College London (UCL), The Institute of Orthopaedics and Musculoskeletal Science, London (United Kingdom); Diss, Tim [University College London Hospital (UCLH) NHS Trust, Rockefeller Building, Department of Histopathology, London (United Kingdom); Flanagan, Adrienne Margaret [Royal National Orthopaedic Hospital NHS Trust, Department of Histopathology, Stanmore, Middlesex (United Kingdom); University College London (UCL), Cancer Institute, London (United Kingdom); University College London Hospital (UCLH) NHS Trust, Rockefeller Building, Department of Histopathology, London (United Kingdom); University College London (UCL), Institute of Orthopaedics and Musculoskeletal Science, Stanmore (United Kingdom); Institute of Orthopaedics and Musculoskeletal Science, Stanmore, Middlesex (United Kingdom)

    2010-01-15

    To report on the biochemistry and clinical and genetic findings of two siblings, the younger sister presenting with recurrent bone pain of the radius and ulna, and medullary sclerosis, and the older brother with soft tissue calcific deposits (tumoral calcinosis) but who later developed bone pain. Both were found to be hyperphosphaturic. The index family comprised four individuals (father, mother, brother, sister). The affected siblings were the offspring of a non-consanguineous Indian family of Tamil origin. Bidirectional sequencing was performed on the DNA from the index family and on 160 alleles from a population of 80 unrelated unaffected control individuals of Tamil extraction and 72 alleles from individuals of non-Tamil origin. Two symptomatic siblings were found to harbour previously unreported compound heterozygous missense UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-transferase; GALNT3) mutations in exon 4 c.842A>G and exon 5 c.1097T>G. This sequence variation was not detected in the control DNA. This is the first report of siblings exhibiting stigmata of familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome with documented evidence of autosomal recessive missense GALNT3 mutations. The findings from this family add further evidence to the literature that familial tumoral calcinosis and hyperostosis-hyperphosphataemia syndrome are manifestations of the same disease and highlight the importance of appropriate metabolic and genetic investigations. (orig.)

  3. Chemical composition of particles from traditional burning of Pakistani wood species

    Science.gov (United States)

    Shahid, Imran; Kistler, Magdalena; Mukhtar, Azam; Ramirez-Santa Cruz, Carlos; Bauer, Heidi; Puxbaum, Hans

    2015-11-01

    Total particulate matter (TPM) emitted during burning of three types of Pakistani wood (eucalyptus camaldulensis, local name Safeeda; acacia nilotica, local name Kikar, Babul; dalbergia sissoo, Shisham, Tali) in a traditional brick stove were collected and analyzed for anhydrosugars, sugar alcohols, trace metals, soluble ions and carbonaceous species. This is a first study reporting anhydrosugars in wood smoke particles emitted during traditional burning of common wood types in Pakistan. Carbonaceous species showed the highest contribution to the particulate matter. Although the total carbon (TC) contribution was similar for all burnings (64.8-70.2%), the EC/OC ratio varied significantly, from 0.2 to 0.3 for Accacia and Dalbergia to 0.7-0.8 for Eucalyptus and Wood-mix. Among inorganic constituents potassium chloride and silicon were found at levels higher than 1%. The levoglucosan concentrations ranged from 3.0 to 6.6% (average 5.6%) with the highest value for Accacia and lowest value for the wood-mix. The high levoglucosan/mannosan ratios of 20-28 were typical for hardwood. The ratio between levoglucosan and galactosan varied stronger and was found to be around 13-20 for Accacia, Eucalyptus and Wood mix, and 43 for Dalbergia. The determined levoglucosan concentrations allowed assessing the conversion factor for calculation of biomass smoke contribution to ambient particulate matter levels in Pakistan.

  4. Impact on indoor air quality during burning of Pakistani coal briquettes

    International Nuclear Information System (INIS)

    Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.

    1993-01-01

    A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside

  5. Attitudes towards euthanasia and physician-assisted suicide among Pakistani and Indian doctors: A survey

    Directory of Open Access Journals (Sweden)

    Syed Qamar Abbas

    2008-01-01

    Full Text Available Aim: This study attempts to assess the attitude of Pakistani and Indian doctors to euthanasia and physician-assisted suicide. Methods: We used a questionnaire survey that included one case history of a patient with cancer and another of one suffering from motor neurone disease (MND. Results: Fifty-two of 100 doctors from Pakistan returned the completed questionnaires. Eight of the 52 (15.3% doctors agreed with the concept of euthanasia being an acceptable option for the patient with MND. Six of the 52 (11.5% supported a similar approach for the cancer patient. From India, 60/100 doctors returned the completed questionnaires. Sixteen of the 60 (26.6% doctors supported euthanasia as an option for the patient with MND whereas 15 (25% supported a similar option for the cancer patient. Conclusion: We conclude that only a minority of the doctors support euthanasia. This group belongs to a younger age group. In Pakistan, they were more likely to be males. The religion of the doctors did not appear to be a determining factor.

  6. Novel mutation in TSPAN12 leads to autosomal recessive inheritance of congenital vitreoretinal disease with intra-familial phenotypic variability.

    Science.gov (United States)

    Gal, Moran; Levanon, Erez Y; Hujeirat, Yasir; Khayat, Morad; Pe'er, Jacob; Shalev, Stavit

    2014-12-01

    Developmental malformations of the vitreoretinal vasculature are a heterogeneous group of conditions with various modes of inheritance, and include familial exudative vitreoretinopathy (FEVR), persistent fetal vasculature (PFV), and Norrie disease. We investigated a large consanguineous kindred with multiple affected individuals exhibiting variable phenotypes of abnormal vitreoretinal vasculature, consistent with the three above-mentioned conditions and compatible with autosomal recessive inheritance. Exome sequencing identified a novel c.542G > T (p.C181F) apparently mutation in the TSPAN12 gene that segregated with the ocular disease in the family. The TSPAN12 gene was previously reported to cause dominant and recessive FEVR, but has not yet been associated with other vitreoretinal manifestations. The intra-familial clinical variability caused by a single mutation in the TSPAN12 gene underscores the complicated phenotype-genotype correlation of mutations in this gene, and suggests that there are additional genetic and environmental factors involved in the complex process of ocular vascularization during embryonic development. Our study supports considering PFV, FEVR, and Norrie disease a spectrum of disorders, with clinical and genetic overlap, caused by mutations in distinct genes acting in the Norrin/β-catenin signaling pathway. © 2014 Wiley Periodicals, Inc.

  7. Characterizing bread wheat genotypes of Pakistani origin for grain zinc biofortification potential.

    Science.gov (United States)

    Rehman, Abdul; Farooq, Muhammad; Nawaz, Ahmad; Al-Sadi, Abdullah M; Al-Hashmi, Khalid S; Nadeem, Faisal; Ullah, Aman

    2018-03-15

    Zinc (Zn) is essential for all life forms and its deficiency is a major issue of malnutrition in humans. This study was carried out to characterize 28 wheat genotypes of Pakistani origin for grain zinc biofortification potential, genetic diversity and relatedness. There was low genetic differentiation among the tested genotypes. However, they differed greatly in yield-related traits, grain mineral (Zn, calcium (Ca) and protein) concentrations and Zn bioavailability. Zinc application increased the concentration of Zn in wheat grain (32.1%), embryo (19.8%), aleurone (47%) and endosperm (23.7%), with an increase in bioavailable Zn (22.2%) and a reduction in phytate concentration (6.8%). Application of Zn also enhanced grain protein and Ca concentrations. Among wheat genotypes, Blue Silver had the highest concentration of Zn in grain, embryo, aleurone and endosperm, with high bioavailable Zn, while Kohinoor-83 had low phytate concentration. Wheat genotypes of Pakistan are genetically less diverse owing to continuous focus on the development of high-yielding varieties only. Therefore genetically diverse wheat genotypes with high endospermic Zn concentration and better grain yield should be used in breeding programs approaches, aiming at improving Zn bioavailability. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  8. Construct validation of emotional labor scale for a sample of Pakistani corporate employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-02-01

    To translate, adapt and validate emotional labour scale for Pakistani corporate employees. This study was conducted in locale of Rawalpindi and Islamabad from October 2014 to December 2015, and comprised customer service employees of commercial banks and telecommunication companies. It comprised of two independent parts. Part one had two steps. Step one involved translation and adaptation of the instrument. In the second step psychometric properties of the translated scale were established by administering it to customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of emotional labour. Part two comprised the main study. Commercial bank employees were included in the sample by using convenient sampling technique. SPSS 20 was used for data analysis. There were 145 participants in the first study and 495 in the second study . Exploratory factor analysis initially generated three-factor model of emotional labour which was further confirmed by confirmatory factor analysis suggesting that emotional labour had three distinct dimensions, i.e. surface acting, deep acting and genuine expressions of emotions. The emotional labour scale was found to be a valid and reliable measure.

  9. 48XXYY Syndrome in an Adult with Type 2 Diabetes Mellitus, Unilateral Renal Aplasia, and Pigmentary Retinitis.

    Science.gov (United States)

    Zantour, Baha; Sfar, Mohamed Habib; Younes, Samia; Alaya, Wafa; Kamoun, Mahdi; Mkaouar, Emna; Jerbi, Saida

    2010-01-01

    A 45-year-old male was referred for diabetes mellitus. Clinical examination found a family history of multiple precocious deaths, strong consanguinity, personal history of seizures during childhood, small testicles, small penis, sparse body hair, long arms and legs, dysmorphic features, mental retardation, dysarthria, tremor, and mild gait ataxia. Investigations found pigmentary retinitis, metabolic syndrome, unilateral renal aplasia, and hypergonadotropic hypogonadism, and ruled out mitochondrial cytopathy and leucodystrophy. Karyotype study showed a 48XXYY chromosomal type. Renal aplasia and pigmentary retinitis have not been described in 48XXYY patients. They may be related to the chromosomal sex aneuploidy, or caused by other genetic aberrations in light of the high consanguinity rate in the patient's family.

  10. 48XXYY Syndrome in an Adult with Type 2 Diabetes Mellitus, Unilateral Renal Aplasia, and Pigmentary Retinitis

    Directory of Open Access Journals (Sweden)

    Baha Zantour

    2010-01-01

    Full Text Available A 45-year-old male was referred for diabetes mellitus. Clinical examination found a family history of multiple precocious deaths, strong consanguinity, personal history of seizures during childhood, small testicles, small penis, sparse body hair, long arms and legs, dysmorphic features, mental retardation, dysarthria, tremor, and mild gait ataxia. Investigations found pigmentary retinitis, metabolic syndrome, unilateral renal aplasia, and hypergonadotropic hypogonadism, and ruled out mitochondrial cytopathy and leucodystrophy. Karyotype study showed a 48XXYY chromosomal type. Renal aplasia and pigmentary retinitis have not been described in 48XXYY patients. They may be related to the chromosomal sex aneuploidy, or caused by other genetic aberrations in light of the high consanguinity rate in the patient's family.

  11. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  12. A homozygous FITM2 mutation causes a deafness-dystonia syndrome with motor regression and signs of ichthyosis and sensory neuropathy

    DEFF Research Database (Denmark)

    Zazo Seco, Celia; Castells-Nobau, Anna; Joo, Seol-Hee

    2017-01-01

    A consanguineous family from Pakistan was ascertained to have a novel deafness-dystonia syndrome with motor regression, ichthyosis-like features and signs of sensory neuropathy. By applying a combined strategy of linkage analysis and whole-exome sequencing in the presented family, a homozygous no...

  13. The relationship between periodontal status and peripheral levels of neutrophils in two consanguineous siblings with severe congenital neutropenia: case reports.

    Science.gov (United States)

    Tözüm, Tolga Fikret; Berker, Ezel; Ersoy, Fügen; Tezcan, Iihan; Sanal, Ozden

    2003-03-01

    Congenital neutropenia is characterized by a severe reduction in absolute neutrophil counts, resulting in an almost total absence of neutrophils. It is well known that severe neutropenia affects periodontal status. Oral manifestations include ulcerations, gingival desquamation, gingival inflammation, attachment loss, and alveolar bone loss which may result in tooth loss. Treatment with granulocyte-colony stimulating factor (G-CSF) may improve this periodontal condition. This article reports the relationship between periodontal disease status and peripheral neutrophil levels in two consanguineous siblings with severe congenital neutropenia who did not receive routine G-CSF for 2 years prior to examination. Both siblings were given scaling, root planing, and periodontal prophylaxis in regular follow-up visits. This report demonstrates that periodontal therapy supported by adequate oral hygiene may result in restoration of neutrophil counts in siblings with congenital neutropenia.

  14. Risk factors for breast cancer for women in Punjab, Pakistan:Results from a case-control study

    Directory of Open Access Journals (Sweden)

    Ghausia Masood Gilani

    2006-01-01

    Full Text Available Over the last three decades an increase in the incidence of breast cancer has been observed in the previously low-risk Asian countries. This study is designed to determine the risk factors of breast cancer for Pakistani women as little information exists in this regard. A case-control study of 564 female breast cancer cases diagnosed at the two cancer hospitals at Lahore (INMOL and SKMCH during the time period Jan 1, 1998 to Dec 31, 1998 was carried out. Four hundred and forty eight women aged 24-80 years out of 564 cases were complete with respect to defined criteria and were eligible for the study. Population-based controls were selected to match for age of cases in the ratio 1:2. The data were analyzed considering ‘all women’ and then separate analyses were done for ‘premenopausal’ and ‘postmenopausal women’. Women with family history of breast cancer, history of consanguineous marriage, smoking and high BMI (≥28 are at increased risk of breast cancer for all three groups. Early menarche (45 years was a strong determinant of breast cancer. Higher number of full-term pregnancies (>3 was protective for ‘all women’ and ‘premenopausal women’ but in case of ‘postmenopausal women’ the poor with higher number of pregnancies were significantly protected. Late age at first FTP (>25 years is a significant risk factor for postmenopausal women.

  15. Perceptions about the cause of schizophrenia and the subsequent help seeking behavior in a Pakistani population – results of a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Yousaf Wajeeha

    2008-07-01

    Full Text Available Abstract Background There is a cultural variability around the perception of what causes the syndrome of schizophrenia. Generally patients with schizophrenia are considered dangerous. They are isolated and treatment is delayed. Studies have shown favorable prognosis with good family and social support, early diagnosis and management. Duration of untreated psychosis is a bad prognostic indicator. We aimed to determine the perceptions regarding the etiology of schizophrenia and the subsequent help seeking behavior. Methods This cross-sectional study was carried out on a sample of 404 people at the out patient departments of Aga Khan University Hospital Karachi. Data was collected via a self-administered questionnaire. Questions were related to a vignette of a young man displaying schizophrenic behavior. Data was analyzed on SPSS v 14. Results The mean age of the participants was 31.4 years (range = 18–72 and 77% of them were males. The majorities were graduates (61.9% and employed (50%. Only 30% of the participants attributed 'mental illness' as the main cause of psychotic symptoms while a large number thought of 'God's will' (32.3%, 'superstitious ideas' (33.1%, 'loneliness' (24.8% and 'unemployment' (19.3% as the main cause. Mental illness as the single most important cause was reported by only 22%. As far as management is concerned, only 40% reported psychiatric consultation to be the single most important management step. Other responses included spiritual healing (19.5% and Sociachanges (10.6 while 14.8% of respondents said that they would do nothing. Gender, age, family system and education level were significantly associated with the beliefs about the cause of schizophrenia (p Conclusion Despite majority of the study population being well educated, only a few recognized schizophrenia as a mental illness and many held superstitious beliefs. A vast majority of Pakistanis have non-biomedical beliefs about the cause of schizophrenia. Their

  16. In-laws and outlaws

    DEFF Research Database (Denmark)

    Nielsen, Mikkel Rytter

    2010-01-01

    This article explores how suspicions of kala jaddu (black magic) restructure local and transnational family networks among Pakistani immigrants in Denmark. The notions of ‘working’ and ‘stealing’ are analysed as two idioms that sum up what it means to ‘be’ and ‘do’ family. ‘Working’ refers to the...

  17. Parent Training among Ethnic Minorities: Parenting Practices as Mediators of Change in Child Conduct Problems

    Science.gov (United States)

    Bjorknes, Ragnhild; Kjobli, John; Manger, Terje; Jakobsen, Reidar

    2012-01-01

    In this study, we examined parenting practices as mediators of changes in child conduct problems in ethnic minority families participating in Parent Management Training-Oregon Model (PMTO). The participants included 96 Somali and Pakistani immigrant mothers and their children living in Norway. The families were randomized to PMTO or a waiting-list…

  18. To integrate family planning into the building up of mental civilization by offering comprehensive services.

    Science.gov (United States)

    1988-03-01

    The government of Nangong City, a newly instituted city with a relatively large proportion of agricultural workers has integrated family planning into the building up of mental civilization. As a result, in 1986, the family planning practice rate was 98.4%. One way the government accomplished this was by developing production to eliminate poverty, to show that population development has a significant impact on socioeconomic development. To help change people's attitudes about family planning, the government 1) used publicity, such as speechmaking, mass media, and courses in population theory; 2) awarded those who made contributions; 3) carried out publicity and education in accordance with characteristics of different groups of people; and 4) encouraged bridegrooms to live with their wives' families if the wives' parents had had no son. Another technique the government used as the popularization of scientific knowledge about population theory, physiology and hygiene, birth control, and eugenics and health in births. A 4th method was to popularize knowledge of laws and regulations, such as of early marriage and consanguineous marriage. 5th, the government developed social security undertakings: 1) giving priority to single-child families and 2) taking care of the elderly. Finally, the government improved maternal and child care by 1) providing premarital health care; 2) creating a project for healthier births and better upbringing; 3) family planning workers showing warm concern for reproductive women; and 4) controlling women's diseases and providing health care knowledge, as well as family planning services. These 6 activities have resulted in 1) the decreasing momentum of per capita arable land being controlled, 2) 1-child couples having more time to learn, 3) the development of educational undertakings, 4) a change in people's traditional practices, and 5) improvement in the understanding of patriotism.

  19. Mutation analysis for DJ-1 in sporadic and familial parkinsonism: screening strategy in parkinsonism.

    Science.gov (United States)

    Tomiyama, Hiroyuki; Li, Yuanzhe; Yoshino, Hiroyo; Mizuno, Yoshikuni; Kubo, Shin-Ichiro; Toda, Tatsushi; Hattori, Nobutaka

    2009-05-22

    DJ-1 mutations cause autosomal recessive parkinsonism (ARP). Although some reports of DJ-1 mutations have been published, there is lack of information on the prevalence of these mutations in large-scale studies of both familial and sporadic parkinsonism. In this genetic screening study, we analyzed the distribution and frequency of DJ-1 mutations by direct nucleotide sequencing of coding exons and exon-intron boundaries of DJ-1, in 386 parkin-negative parkinsonism patients (371 index cases: 67 probands of autosomal recessive parkinsonism families, 90 probands of autosomal dominant parkinsonism families, 201 patients with sporadic parkinsonism, and 13 with unknown family histories) from 12 countries (Japan 283, China 27, Taiwan 22, Korea 22, Israel 16, Turkey 5, Philippines 2, Bulgaria 2, Greece 2, Tunisia 1, USA 2, Ukraine 1, unknown 1). None had causative mutation in DJ-1, suggesting DJ-1 mutation is very rare among patients with familial and sporadic parkinsonism from Asian countries and those with other ethnic background. This is in contrast to the higher frequencies and worldwide distribution of parkin- and PINK1-related parkinsonism in ARP and sporadic parkinsonism. Thus, after obtaining clinical information, screening for mutations in (1) parkin, (2) PINK1, (3) DJ-1, (4) ATP13A2 should be conducted in that order, in ARP and sporadic parkinsonism, based on their reported frequencies. In addition, haplotype analysis should be employed to check for homozygosity of 1p36, which harbors a cluster of causative genes for ARP such as DJ-1, PINK1 and ATP13A2 in ARP and sporadic parkinsonism, especially in parkinsonism with consanguinity.

  20. Famiglia e geno-poiesi nel Nazionalsocialismo - Family and genos-poiesis in National Socialism

    Directory of Open Access Journals (Sweden)

    Alberto Castaldini

    2014-12-01

    Full Text Available The Nazi regime (1933-45 wanted to protect and promote through the creation of a new family structure the conservation of the biological heredity of the German nation, in order to preserve and refine obsessively the identity and the purity of the so-called Blutsgemeinschaft, the “community of blood” in which to identify the political and the cultural entity of the Volk, one of the pillars of Hitler’s biocracy. In the first half of the 20th century the value of memory, the nature of the family and the meaning of the relationship between the generations were manipulated and debased. This view, with its tragic ethical and juridical consequences, was scientifically warranted by German academic world, whose leading exponents took controversial positions. For instance the human biologist and eugenicist Otmar von Verschuer (1896-1969 theorized a biological unity between present and past, stating that the “German people is a large community of ancestors, namely a consanguineous solidarity”. In this way the Nazis deeply redefined the bonds of kinship and the genos assumed the nature of a “fictitious symbol” (C. Tullio-Altan in the service of a regime that in the name of an imaginary ancestral vitalism pursued a systematic policy of death.