The Impact of Immunosenescence on Pulmonary Disease.

LENUS (Irish Health Repository)

Murray, Michelle A

2015-08-01

The global population is aging with significant gains in life expectancy particularly in the developed world. Consequently, greater focus on understanding the processes that underlie physiological aging has occurred. Key facets of advancing age include genomic instability, telomere shortening, epigenetic changes, and declines in immune function termed immunosenescence. Immunosenescence and its associated chronic low grade systemic "inflamm-aging" contribute to the development and progression of pulmonary disease in older individuals. These physiological processes predispose to pulmonary infection and confer specific and unique clinical phenotypes observed in chronic respiratory disease including late-onset asthma, chronic obstructive pulmonary disease, and pulmonary fibrosis. Emerging concepts of the gut and airway microbiome further complicate the interrelationship between host and microorganism particularly from an immunological perspective and especially so in the setting of immunosenescence. This review focuses on our current understanding of the aging process, immunosenescence, and how it can potentially impact on various pulmonary diseases and the human microbiome.

The restriction-modification genes of Escherichia coli K-12 may not be selfish: they do not resist loss and are readily replaced by alleles conferring different specificities.

Science.gov (United States)

O'Neill, M; Chen, A; Murray, N E

1997-12-23

Type II restriction and modification (R-M) genes have been described as selfish because they have been shown to impose selection for the maintenance of the plasmid that encodes them. In our experiments, the type I R-M system EcoKI does not behave in the same way. The genes specifying EcoKI are, however, normally residents of the chromosome and therefore our analyses were extended to monitor the deletion of chromosomal genes rather than loss of plasmid vector. If EcoKI were to behave in the same way as the plasmid-encoded type II R-M systems, the loss of the relevant chromosomal genes by mutation or recombination should lead to cell death because the cell would become deficient in modification enzyme and the bacterial chromosome would be vulnerable to the restriction endonuclease. Our data contradict this prediction; they reveal that functional type I R-M genes in the chromosome are readily replaced by mutant alleles and by alleles encoding a type I R-M system of different specificity. The acquisition of allelic genes conferring a new sequence specificity, but not the loss of the resident genes, is dependent on the product of an unlinked gene, one predicted [Prakash-Cheng, A., Chung, S. S. & Ryu, J. (1993) Mol. Gen. Genet. 241, 491-496] to be relevant to control of expression of the genes that encode EcoKI. Our evidence suggests that not all R-M systems are evolving as "selfish" units; rather, the diversity and distribution of the family of type I enzymes we have investigated require an alternative selective pressure.

Specific echocardiographic findings useful for the diagnosis of common pulmonary vein atresia

Directory of Open Access Journals (Sweden)

Hiroyuki Nagasawa

2015-12-01

Full Text Available In this paper, we report a case of common pulmonary vein atresia, which is a very rare disease characterized by cyanosis, heart failure and pulmonary hypertension. Reverse flow in the pulmonary artery at end-diastole as well as in the isthmus of the aorta from early systole to end-diastole detected by echocardiography were found to be specific features useful in diagnosing the disease.

Gene Expression Networks in the Murine Pulmonary Myocardium Provide Insight into the Pathobiology of Atrial Fibrillation

Directory of Open Access Journals (Sweden)

Jordan K. Boutilier

2017-09-01

Full Text Available The pulmonary myocardium is a muscular coat surrounding the pulmonary and caval veins. Although its definitive physiological function is unknown, it may have a pathological role as the source of ectopic beats initiating atrial fibrillation. How the pulmonary myocardium gains pacemaker function is not clearly defined, although recent evidence indicates that changed transcriptional gene expression networks are at fault. The gene expression profile of this distinct cell type in situ was examined to investigate underlying molecular events that might contribute to atrial fibrillation. Via systems genetics, a whole-lung transcriptome data set from the BXD recombinant inbred mouse resource was analyzed, uncovering a pulmonary cardiomyocyte gene network of 24 transcripts, coordinately regulated by chromosome 1 and 2 loci. Promoter enrichment analysis and interrogation of publicly available ChIP-seq data suggested that transcription of this gene network may be regulated by the concerted activity of NKX2-5, serum response factor, myocyte enhancer factor 2, and also, at a post-transcriptional level, by RNA binding protein motif 20. Gene ontology terms indicate that this gene network overlaps with molecular markers of the stressed heart. Therefore, we propose that perturbed regulation of this gene network might lead to altered calcium handling, myocyte growth, and contractile force contributing to the aberrant electrophysiological properties observed in atrial fibrillation. We reveal novel molecular interactions and pathways representing possible therapeutic targets for atrial fibrillation. In addition, we highlight the utility of recombinant inbred mouse resources in detecting and characterizing gene expression networks of relatively small populations of cells that have a pathological significance.

Gene expression of cyclin-dependent kinase inhibitors and effect of heparin on their expression in mice with hypoxia-induced pulmonary hypertension

International Nuclear Information System (INIS)

Yu Lunyin; Quinn, Deborah A.; Garg, Hari G.; Hales, Charles A.

2006-01-01

The balance between cell proliferation and cell quiescence is regulated delicately by a variety of mediators, in which cyclin-dependent kinases (CDK) and CDK inhibitors (CDKI) play a very important role. Heparin which inhibits pulmonary artery smooth muscle cell (PASMC) proliferation increases the levels of two CDKIs, p21 and p27, although only p27 is important in inhibition of PASMC growth in vitro and in vivo. In the present study we investigated the expression profile of all the cell cycle regulating genes, including all seven CDKIs (p21, p27, p57, p15, p16, p18, and p19), in the lungs of mice with hypoxia-induced pulmonary hypertension. A cell cycle pathway specific gene microarray was used to profile the 96 genes involved in cell cycle regulation. We also observed the effect of heparin on gene expression. We found that (a) hypoxic exposure for two weeks significantly inhibited p27 expression and stimulated p18 activity, showing a 98% decrease in p27 and 81% increase in p18; (b) other CDKIs, p21, p57, p15, p16, and p19 were not affected significantly in response to hypoxia; (c) heparin treatment restored p27 expression, but did not influence p18; (d) ERK1/2 and p38 were mediators in heparin upregulation of p27. This study provides an expression profile of cell cycle regulating genes under hypoxia in mice with hypoxia-induced pulmonary hypertension and strengthens the previous finding that p27 is the only CDKI involved in heparin regulation of PASMC proliferation and hypoxia-induced pulmonary hypertension

A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

Science.gov (United States)

Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

2018-05-15

, because probiotic bacteria are used for human and animal consumption, one of the safety concerns over these bacteria is the presence of antibiotic resistance genes, since the human gut is a densely populated habitat that could favor the transfer of genetic material to potential pathogens. In this study, we analyzed the genetic basis responsible for the erythromycin and clindamycin resistance phenotype of B. breve CECT7263. We were able to identify and characterize a novel gene homologous to rRNA methylase genes which confers erythromycin and clindamycin resistance. This gene seems to be very uncommon in other bifidobacteria and in the gut microbiomes of both adults and infants. Even though conjugation experiments showed the absence of transferability under in vitro conditions, it has been predicted to be located in a putative genomic island recently acquired by specific bifidobacterial strains. Copyright © 2018 American Society for Microbiology.

Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

Science.gov (United States)

Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

2012-12-01

Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

Deleterious genetic variants in ciliopathy genes increase risk of ritodrine-induced cardiac and pulmonary side effects.

Science.gov (United States)

Seo, Heewon; Kwon, Eun Jin; You, Young-Ah; Park, Yoomi; Min, Byung Joo; Yoo, Kyunghun; Hwang, Han-Sung; Kim, Ju Han; Kim, Young Ju

2018-01-24

Ritodrine is a commonly used tocolytic to prevent preterm labour. However, it can cause unexpected serious adverse reactions, such as pulmonary oedema, pulmonary congestion, and tachycardia. It is unknown whether such adverse reactions are associated with pharmacogenomic variants in patients. Whole-exome sequencing of 13 subjects with serious ritodrine-induced cardiac and pulmonary side-effects was performed to identify causal genes and variants. The deleterious impact of nonsynonymous substitutions for all genes was computed and compared between cases (n = 13) and controls (n = 30). The significant genes were annotated with Gene Ontology (GO), and the associated disease terms were categorised into four functional classes for functional enrichment tests. To assess the impact of distributed rare variants in cases with side effects, we carried out rare variant association tests with a minor allele frequency ≤ 1% using the burden test, the sequence Kernel association test (SKAT), and optimised SKAT. We identified 28 genes that showed significantly lower gene-wise deleteriousness scores in cases than in controls. Three of the identified genes-CYP1A1, CYP8B1, and SERPINA7-are pharmacokinetic genes. The significantly identified genes were categorized into four functional classes: ion binding, ATP binding, Ca 2+ -related, and ciliopathies-related. These four classes were significantly enriched with ciliary genes according to SYSCILIA Gold Standard genes (P side effects may be associated with deleterious genetic variants in ciliary and pharmacokinetic genes.

Identification of distinct specificity determinants in resistance protein Cf-4 allows construction of a Cf-9 mutant that confers recognition of avirulence protein AVR4

NARCIS (Netherlands)

Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.

2001-01-01

The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,

Lung-specific loss of α3 laminin worsens bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Morales-Nebreda, Luisa I; Rogel, Micah R; Eisenberg, Jessica L; Hamill, Kevin J; Soberanes, Saul; Nigdelioglu, Recep; Chi, Monica; Cho, Takugo; Radigan, Kathryn A; Ridge, Karen M; Misharin, Alexander V; Woychek, Alex; Hopkinson, Susan; Perlman, Harris; Mutlu, Gokhan M; Pardo, Annie; Selman, Moises; Jones, Jonathan C R; Budinger, G R Scott

2015-04-01

Laminins are heterotrimeric proteins that are secreted by the alveolar epithelium into the basement membrane, and their expression is altered in extracellular matrices from patients with pulmonary fibrosis. In a small number of patients with pulmonary fibrosis, we found that the normal basement membrane distribution of the α3 laminin subunit was lost in fibrotic regions of the lung. To determine if these changes play a causal role in the development of fibrosis, we generated mice lacking the α3 laminin subunit specifically in the lung epithelium by crossing mice expressing Cre recombinase driven by the surfactant protein C promoter (SPC-Cre) with mice expressing floxed alleles encoding the α3 laminin gene (Lama3(fl/fl)). These mice exhibited no developmental abnormalities in the lungs up to 6 months of age, but, compared with control mice, had worsened mortality, increased inflammation, and increased fibrosis after the intratracheal administration of bleomycin. Similarly, the severity of fibrosis induced by an adenovirus encoding an active form of transforming growth factor-β was worse in mice deficient in α3 laminin in the lung. Taken together, our results suggest that the loss of α3 laminin in the lung epithelium does not affect lung development, but plays a causal role in the development of fibrosis in response to bleomycin or adenovirally delivered transforming growth factor-β. Thus, we speculate that the loss of the normal basement membrane organization of α3 laminin that we observe in fibrotic regions from the lungs of patients with pulmonary fibrosis contributes to their disease progression.

A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

Science.gov (United States)

Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

2018-02-07

Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

Energy Technology Data Exchange (ETDEWEB)

Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

2007-07-01

As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

The Transcriptional Signature of Active Tuberculosis Reflects Symptom Status in Extra-Pulmonary and Pulmonary Tuberculosis.

Directory of Open Access Journals (Sweden)

Simon Blankley

Full Text Available Mycobacterium tuberculosis infection is a leading cause of infectious death worldwide. Gene-expression microarray studies profiling the blood transcriptional response of tuberculosis (TB patients have been undertaken in order to better understand the host immune response as well as to identify potential biomarkers of disease. To date most of these studies have focused on pulmonary TB patients with gene-expression profiles of extra-pulmonary TB patients yet to be compared to those of patients with pulmonary TB or sarcoidosis.A novel cohort of patients with extra-pulmonary TB and sarcoidosis was recruited and the transcriptional response of these patients compared to those with pulmonary TB using a variety of transcriptomic approaches including testing a previously defined 380 gene meta-signature of active TB.The 380 meta-signature broadly differentiated active TB from healthy controls in this new dataset consisting of pulmonary and extra-pulmonary TB. The top 15 genes from this meta-signature had a lower sensitivity for differentiating extra-pulmonary TB from healthy controls as compared to pulmonary TB. We found the blood transcriptional responses in pulmonary and extra-pulmonary TB to be heterogeneous and to reflect the extent of symptoms of disease.The transcriptional signature in extra-pulmonary TB demonstrated heterogeneity of gene expression reflective of symptom status, while the signature of pulmonary TB was distinct, based on a higher proportion of symptomatic individuals. These findings are of importance for the rational design and implementation of mRNA based TB diagnostics.

Pulmonary arterial hypertension

Science.gov (United States)

2013-01-01

Pulmonary arterial hypertension (PAH) is a chronic and progressive disease leading to right heart failure and ultimately death if untreated. The first classification of PH was proposed in 1973. In 2008, the fourth World Symposium on PH held in Dana Point (California, USA) revised previous classifications. Currently, PH is devided into five subgroups. Group 1 includes patients suffering from idiopathic or familial PAH with or without germline mutations. Patients with a diagnosis of PAH should systematically been screened regarding to underlying mutations of BMPR2 gene (bone morphogenetic protein receptor type 2) or more rarely of ACVRL1 (activine receptor-like kinase type 1), ENG (endogline) or Smad8 genes. Pulmonary veno occusive disease and pulmonary capillary hemagiomatosis are individualized and designated as clinical group 1'. Group 2 'Pulmonary hypertension due to left heart diseases' is divided into three sub-groups: systolic dysfonction, diastolic dysfonction and valvular dysfonction. Group 3 'Pulmonary hypertension due to respiratory diseases' includes a heterogenous subgroup of respiratory diseases like PH due to pulmonary fibrosis, COPD, lung emphysema or interstitial lung disease for exemple. Group 4 includes chronic thromboembolic pulmonary hypertension without any distinction of proximal or distal forms. Group 5 regroup PH patients with unclear multifactorial mechanisms. Invasive hemodynamic assessment with right heart catheterization is requested to confirm the definite diagnosis of PH showing a resting mean pulmonary artery pressure (mPAP) of ≥ 25 mmHg and a normal pulmonary capillary wedge pressure (PCWP) of ≤ 15 mmHg. The assessment of PCWP may allow the distinction between pre-capillary and post-capillary PH (PCWP > 15 mmHg). Echocardiography is an important tool in the management of patients with underlying suspicion of PH. The European Society of Cardiology and the European Respiratory Society (ESC-ERS) guidelines specify its role

[The effect of calcitonin gene-related peptide on collagen accumulation in pulmonary arteries of rats with hypoxic pulmonary arterial hypertension].

Science.gov (United States)

Li, Xian-Wei; Du, Jie; Li, Yuan-Jian

2013-03-01

To observe the effect of calcitonin gene-related peptide (CGRP) on pulmonary vascular collagen accumulation in hypoxia rats in order to study the effect of CGRP on hypoxic pulmonary vascular structural remodeling and its possible mechanism. Rats were acclimated for 1 week, and then were randomly divided into three groups: normoxia group, hypoxia group, and hypoxia plus capsaicin group. Pulmonary arterial hypertension was induced by hypoxia in rats. Hypoxia plus capsaicin group, rats were given capsaicin (50 mg/(kg x d), s.c) 4 days before hypoxia to deplete endogenous CGRP. Hypoxia (3% O2) stimulated proliferation of pulmonary arterial smooth muscle cells (PASMCs) and proliferation was measured by BrdU marking. The expression levels of CGRP, phosphorylated ERK1/2 (p-ERK1/ 2), collagen I and collagen III were detected by real-time PCR or Western blot. Right ventricle systolic pressure (RVSP) and mean pulmonary arterial pressure (mPAP) of pulmonary arterial hypertension (PAH) rats induced by hypoxia were higher than those of normoxia rats. By HE and Masson staining, it was demonstrated that hypoxia also significantly induced hypertrophy of pulmonary arteries and increased level of collagen accumulation. Hypoxia dramatically decreased the CGRP level and increased the expression of p-ERK1/2, collagen I, collagen III in pulmonary arteries. All these effects of hypoxia were further aggravated by pre-treatment of rats with capsaicin. CGRP concentration-dependently inhibited hypoxia-induced proliferation of PASMCs, markedly decreased the expression of p-ERK1/2, collagen I and collagen III. All these effects of CGRP were abolished in the presence of CGRP8-37. These results suggest that CGRP might inhibit hypoxia-induced PAH and pulmonary vascular remodeling, through inhibiting phosphorylation of ERK1/2 and alleviating the collagen accumulation of pulmonary arteries.

Pulmonary instillation of low doses of titanium dioxide nanoparticles in mice leads to particle retention and gene expression changes in the absence of inflammation

DEFF Research Database (Denmark)

Husain, Mainul; Saber, Anne Thoustrup; Guo, Charles

2013-01-01

We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO2). Female C57BL/6 mice were exposed to rutile nano-TiO2 via single intratracheal instillations of 18, 54, and 162......μg/mouse. Mice were sampled 1, 3, and 28days post-exposure. The deposition of nano-TiO2 in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific q...

Effect of prepro-calcitonin gene-related peptide-expressing endothelial progenitor cells on pulmonary hypertension.

Science.gov (United States)

Zhao, Qiang; Liu, Zixiong; Wang, Zhe; Yang, Cheng; Liu, Jun; Lu, Jun

2007-08-01

Calcitonin gene-related peptide (CGRP) is a potent smooth muscle cell proliferation inhibitor and vasodilator. It is now believed that CGRP plays an important role in maintaining a low pulmonary vascular resistance. We evaluated the therapeutic effect of intravenously administered CGRP-expressing endothelial progenitor cells (EPCs) on left-to-right shunt-induced pulmonary hypertension in rats. Endothelial progenitor cells were obtained from cultured human peripheral blood mononuclear cells. The genetic sequence for CGRP was subcloned into cultured EPCs by human expression plasmid. Pulmonary hypertension was established in immunodeficient rats with an abdominal aorta to inferior vena cava shunt operation. The transfected EPCs were injected through the left jugular vein at 10 weeks after the shunt operation. Mean pulmonary artery pressure and total pulmonary vascular resistance were detected with right cardiac catheterization at 4 weeks. The distribution of EPCs in the lung tissue was examined with immunofluorescence technique. Histopathologic changes in the structure of the pulmonary arteries was observed with electron microscopy and subjected to computerized image analysis. The lungs of rats transplanted with CGRP-expressing EPCs demonstrated a decrease in both mean pulmonary artery pressure (17.64 +/- 0.79 versus 22.08 +/- 0.95 mm Hg; p = 0.018) and total pulmonary vascular resistance (1.26 +/- 0.07 versus 2.45 +/- 0.18 mm Hg x min/mL; p = 0.037) at 4 weeks. Immunofluorescence revealed that intravenously administered cells were incorporated into the pulmonary vasculature. Pulmonary vascular remodeling was remarkably attenuated with the administration of CGRP-expressing EPCs. The transplantation of CGRP-expressing EPCs may effectively attenuate established pulmonary hypertension and exert reversal effects on pulmonary vascular remodeling. Our findings suggest that the therapy based on the combination of both CGRP transfection and EPCs may be a potentially useful

Cerebral Venous Thrombosis and Pulmonary Embolism with Prothrombin G20210A Gene Mutation.

Science.gov (United States)

Dagli, Canan Eren; Koksal, Nurhan; Guler, Selma; Gelen, Mehmet Emin; Atilla, Nurhan; Tuncel, Deniz

2010-04-01

A 25-year-old man presented with symptoms of syncope, cough, headache and hemoptysis. Cranial MR and venography showed thrombus formation in the right transverse sinus and superior sagittal sinus. Computed tomographic pulmonary angiography (CTPA) showed an embolic thrombus in the right pulmonary truncus and lung abscess. The patient was young, and there were no signs of lower extremity deep venous thrombosis or other major risk factors for pulmonary embolism (PE) including cardiac anomaly. The only risk factor we were able to identify was the presence of the prothrombin G20210A gene mutation. Anticoagulant treatment with oral warfarin (10 mg daily) and imipenem (4X500 mg) was started. The patient was hospitalized for antibiotic and anticoagulation therapies for three weeks and was discharged on lifelong treatment with warfarin (5 mg daily).

Chronic obstructive pulmonary disease candidate gene prioritization based on metabolic networks and functional information.

Directory of Open Access Journals (Sweden)

Xinyan Wang

Full Text Available Chronic obstructive pulmonary disease (COPD is a multi-factor disease, in which metabolic disturbances played important roles. In this paper, functional information was integrated into a COPD-related metabolic network to assess similarity between genes. Then a gene prioritization method was applied to the COPD-related metabolic network to prioritize COPD candidate genes. The gene prioritization method was superior to ToppGene and ToppNet in both literature validation and functional enrichment analysis. Top-ranked genes prioritized from the metabolic perspective with functional information could promote the better understanding about the molecular mechanism of this disease. Top 100 genes might be potential markers for diagnostic and effective therapies.

Comprehensive analysis of gene-expression profile in chronic obstructive pulmonary disease

Directory of Open Access Journals (Sweden)

Wei L

2015-06-01

Full Text Available Lei Wei,1,* Dong Xu,2,* Yechang Qian,1 Guoyi Huang,1 Wei Ma,1 Fangying Liu,1 Yanhua Shen,1 Zhongfu Wang,1 Li Li,1 Shanfang Zhang,1 Yafang Chen1 1Department of Respiratory Disease, Baoshan District Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai, 2Medical College of Soochow University, Suzhou, People's Republic of China *These authors contributed equally to this work Objective: To investigate the gene-expression profile of chronic obstructive pulmonary disease (COPD patients and explore the possible therapeutic targets. Methods: The microarray raw dataset GSE29133, including three COPD samples and three normal samples, was obtained from Gene Expression Omnibus. After data preprocessing with the Affy package, Student’s t-test was employed to identify the differentially expressed genes (DEGs. The up- and downregulated DEGs were then pooled for gene-ontology and pathway-enrichment analyses using the Database for Annotation, Visualization and Integrated Discovery (DAVID. The upstream regulatory elements of these DEGs were also explored by using Whole-Genome rVISTA. Furthermore, we constructed a protein–protein interaction (PPI network for DEGs. The surfactant protein D (SP-D serum level and HLA-A gene frequency in COPD patients and healthy controls were also measured by enzyme-linked immunosorbent assay (ELISA and real-time polymerase chain reaction, respectively. Results: A total of 39 up- and 15 downregulated DEGs were screened. Most of the upregulated genes were involved in the immune response process, while the downregulated genes were involved in the steroid metabolic process. Moreover, we also found that HLA-A has the highest degree in the PPI network. The SP-D serum level and HLA-A gene frequency in COPD patients were significantly higher than those in healthy controls (13.62±2.09 ng/mL vs 10.28±2.86 ng/mL; 62.5% vs 12.5%; P<0.05. Conclusion: Our results may help further the understanding of the mechanisms of

Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL.

Science.gov (United States)

Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W

2015-09-01

Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.

Francisella tularensis subsp. tularensis induces a unique pulmonary inflammatory response: role of bacterial gene expression in temporal regulation of host defense responses.

Directory of Open Access Journals (Sweden)

Kathie-Anne Walters

Full Text Available Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4. Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways.

Pulmonary artery hypertension in childhood: The transforming growth factor-β superfamily-related genes

Directory of Open Access Journals (Sweden)

Shi-Min Yuan

2018-04-01

Full Text Available Pulmonary artery hypertension (PAH is very rare in childhood, and it can be divided into heritable, idiopathic drug- and toxin-induced and other disease (connective tissue disease, human immunodeficiency virus infection, portal hypertension, congenital heart disease, or schistosomiasis-associated types. PAH could not be interpreted solely by pathophysiological theories. The impact of the transforming growth factor-β superfamily-related genes on the development of PAH in children remains to be clarified. Pertinent literature on the transforming growth factor-β superfamily-related genes in relation to PAH in children published after the year 2000 was reviewed and analyzed. Bone morphogenetic protein receptor type II gene mutation promotes cell division or prevents cell death, resulting in an overgrowth of cells in small arteries throughout the lungs. About 20% of individuals with a bone morphogenetic protein receptor type II gene mutation develop symptomatic PAH. In heritable PAH, bone morphogenetic protein receptor type II mutations may be absent; while mutations of other genes, such as type I receptor activin receptor-like kinase 1 and the type III receptor endoglin (both associated with hereditary hemorrhagic telangiectasia, caveolin-1 and KCNK3, the gene encoding potassium channel subfamily K, member 3, can be detected, instead. Gene mutations, environmental changes and acquired adjustment, etc. may explain the development of PAH. The researches on PAH rat model and familial PAH members may facilitate the elucidations of the mechanisms and further provide theories for prophylaxis and treatment of PAH. Key Words: bone morphogenetic proteins, mutation, pulmonary hypertension

Genetics of pulmonary hypertension in the clinic.

Science.gov (United States)

Girerd, Barbara; Lau, Edmund; Montani, David; Humbert, Marc

2017-09-01

Heritable pulmonary arterial hypertension (PAH) is an autosomal dominant disease with incomplete penetrance because of mutations in bone morphogenetic protein receptor-II (BMPR2), activin A receptor type II-like kinase 1, endoglin, caveolin-1, potassium channel subfamily K, member 3, and T-box gene 4 genes. Heritable pulmonary veno-occlusive disease and/or pulmonary capillary hemangiomatosis (PVOD/PCH) is an autosomal recessive disease because of biallelic mutations in the eukaryotic translation initiation factor 2 alpha kinase 4 gene. The 2015 european society of cardiology (ESC) and european respiratory society (ERS) pulmonary hypertension guidelines recommend genetic counselling and testing to adults and children with PAH or PVOD/PCH as well as in adult relatives at risk of carrying a predisposing mutation. In France, genetic counseling and testing are offered to all patients displaying sporadic or familial form of PAH or PVOD/PCH and to their relatives at high risk of carrying a predisposing mutation. Patients with a heritable form of PAH are younger at diagnosis with a worse hemodynamic and a dismal prognosis. Patients with a heritable form of PVOD/PCH are younger at diagnosis with a worse response to specific PAH therapies. A program to detect PAH in an early phase was offered to all asymptomatic BMPR2 mutation carriers, according to the 2015 ESC/ERS guidelines. Finally, preimplantation genetic diagnosis has been performed in families with a history of BMPR2 mutations. Genetic counseling and testing has to be implemented in pulmonary hypertension centers.

Heterologous expression of pathogen-specific genes ligA and ligB in the saprophyte Leptospira biflexa confers enhanced adhesion to cultured cells and fibronectin.

Science.gov (United States)

Figueira, Cláudio Pereira; Croda, Julio; Choy, Henry A; Haake, David A; Reis, Mitermayer G; Ko, Albert I; Picardeau, Mathieu

2011-06-09

In comparison to other bacterial pathogens, our knowledge of the molecular basis of the pathogenesis of leptospirosis is extremely limited. An improved understanding of leptospiral pathogenetic mechanisms requires reliable tools for functional genetic analysis. Leptospiral immunoglobulin-like (Lig) proteins are surface proteins found in pathogenic Leptospira, but not in saprophytes. Here, we describe a system for heterologous expression of the Leptospira interrogans genes ligA and ligB in the saprophyte Leptospira biflexa serovar Patoc. The genes encoding LigA and LigB under the control of a constitutive spirochaetal promoter were inserted into the L. biflexa replicative plasmid. We were able to demonstrate expression and surface localization of LigA and LigB in L. biflexa. We found that the expression of the lig genes significantly enhanced the ability of transformed L. biflexa to adhere in vitro to extracellular matrix components and cultured cells, suggesting the involvement of Lig proteins in cell adhesion. This work reports a complete description of the system we have developed for heterologous expression of pathogen-specific proteins in the saprophytic L. biflexa. We show that expression of LigA and LigB proteins from the pathogen confers a virulence-associated phenotype on L. biflexa, namely adhesion to eukaryotic cells and fibronectin in vitro. This study indicates that L. biflexa can serve as a surrogate host to characterize the role of key virulence factors of the causative agent of leptospirosis.

Association of P2X7 gene common polymorphisms with pulmonary tuberculosis in Lur population of Iran

Directory of Open Access Journals (Sweden)

Ali Amiri

2018-07-01

Full Text Available Background: Different genetic and environmental factors are associated with susceptibility to pulmonary tuberculosis (TB in different individuals of different populations. Based on previous studies role of P2X7 gene common polymorphisms in susceptibility to pulmonary TB was associated with ethnicities. Aim: We intend to perform this study on genetic reservoir (gene pool of Lur population of western Iran. Methods: For the present case-control study, 100 unrelated pulmonary TB patients and 100 unrelated controls were enrolled through convenient sampling. TB confirmation was through smear and culture of sputum. Polymerase chain reaction with restriction fragment length polymorphism (PCR-RFLP was used for molecular assay. This study has been approved in the ethic committee of Lorestan University of Medical Sciences with registration number LUMS.REC.1396.253. Results: Among the genotypes of polymorphism 1513A/C, AA genotype was associated with susceptibility to pulmonary TB (P = .0001; OR = 4.750 whereas AC genotype was a protecting factor (P = .0001; OR = 0.192. Higher genetic reservoir of A allele was associated with more susceptibility to pulmonary TB (P = .0001; OR = 2.879 whereas C allele was a protecting factor (P = .0001; OR = 0.347. No significant result was found for −762T/C polymorphism. Conclusion: In Lur population of Iran, 1513A/C polymorphism of P2X7 is associated with susceptibility to pulmonary TB. It is suggested that bio-information banks should be established and developed in countries. Keywords: Pulmonary tuberculosis, Immunogenetics, P2X7, Population genetics

Screening and identification of six serum microRNAs as novel potential combination biomarkers for pulmonary tuberculosis diagnosis.

Science.gov (United States)

Zhang, Xing; Guo, Jing; Fan, Shufeng; Li, Yanyuan; Wei, Liliang; Yang, Xiuyun; Jiang, Tingting; Chen, Zhongliang; Wang, Chong; Liu, Jiyan; Ping, Zepeng; Xu, Dandan; Wang, Jiaxiong; Li, Zhongjie; Qiu, Yunqing; Li, Ji-Cheng

2013-01-01

It is very difficult to prevent pulmonary tuberculosis (TB) due to the lack of specific and diagnostic markers, which could lead to a high incidence of pulmonary TB. We screened the differentially expressed serum microRNAs (miRNAs) as potential biomarkers for the diagnosis of pulmonary TB. In this study, serum miRNAs were screened using the Solexa sequencing method as the potential biomarkers for the diagnosis of pulmonary TB. The stem-loop quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assay was used to verify differentially expressed serum miRNAs. The receiver operating characteristic (ROC) curve and logistic regression model were used to analyze the sensitivity and specificity of the single miRNA and a combination of miRNAs for diagnosis, respectively. Using the predicted target genes, we constructed the regulatory networks of miRNAs and genes that were related to pulmonary TB. The Solexa sequencing data showed that 91 serum miRNAs were differentially expressed in pulmonary TB patients, compared to healthy controls. Following qRT-PCR confirmation, six serum miRNAs (hsa-miR-378, hsa-miR-483-5p, hsa-miR-22, hsa-miR-29c, hsa-miR-101 and hsa-miR-320b) showed significant difference among pulmonary TB patients, healthy controls (P<0.001) and differential diagnosis groups (including patients with pneumonia, lung cancer and chronic obstructive pulmonary disease) (P<0.05). The logistic regression analysis of a combination of six serum miRNAs revealed that the sensitivity and the specificity of TB diagnosis were 95.0% and 91.8% respectively. The miRNAs-gene regulatory networks revealed that several miRNAs may regulate some target genes involved in immune pathways and participate in the pathogenesis of pulmonary TB. Our study suggests that a combination of six serum miRNAs have great potential to serve as non-invasive biomarkers of pulmonary TB.

Heterogeneous Pulmonary Phenotypes Associated With Mutations in the Thyroid Transcription Factor Gene NKX2-1

Science.gov (United States)

Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.

2013-01-01

Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038

Oxidant and enzymatic antioxidant status (gene expression and activity) in the brain of chickens with cold-induced pulmonary hypertension

Science.gov (United States)

Hassanpour, Hossein; Khalaji-Pirbalouty, Valiallah; Nasiri, Leila; Mohebbi, Abdonnaser; Bahadoran, Shahab

2015-11-01

To evaluate oxidant and antioxidant status of the brain (hindbrain, midbrain, and forebrain) in chickens with cold-induced pulmonary hypertension, the measurements of lipid peroxidation, protein oxidation, antioxidant capacity, enzymatic activity, and gene expression (for catalase, glutathione peroxidase, and superoxide dismutases) were done. There were high lipid peroxidation/protein oxidation and low antioxidant capacity in the hindbrain of cold-induced pulmonary hypertensive chickens compared to control ( P pulmonary hypertension.

Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis

International Nuclear Information System (INIS)

Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.

2004-01-01

Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)

Source-specific pollution exposure and associations with pulmonary response in the Atlanta Commuters Exposure Studies.

Science.gov (United States)

Krall, Jenna R; Ladva, Chandresh N; Russell, Armistead G; Golan, Rachel; Peng, Xing; Shi, Guoliang; Greenwald, Roby; Raysoni, Amit U; Waller, Lance A; Sarnat, Jeremy A

2018-01-03

Concentrations of traffic-related air pollutants are frequently higher within commuting vehicles than in ambient air. Pollutants found within vehicles may include those generated by tailpipe exhaust, brake wear, and road dust sources, as well as pollutants from in-cabin sources. Source-specific pollution, compared to total pollution, may represent regulation targets that can better protect human health. We estimated source-specific pollution exposures and corresponding pulmonary response in a panel study of commuters. We used constrained positive matrix factorization to estimate source-specific pollution factors and, subsequently, mixed effects models to estimate associations between source-specific pollution and pulmonary response. We identified four pollution factors that we named: crustal, primary tailpipe traffic, non-tailpipe traffic, and secondary. Among asthmatic subjects (N = 48), interquartile range increases in crustal and secondary pollution were associated with changes in lung function of -1.33% (95% confidence interval (CI): -2.45, -0.22) and -2.19% (95% CI: -3.46, -0.92) relative to baseline, respectively. Among non-asthmatic subjects (N = 51), non-tailpipe pollution was associated with pulmonary response only at 2.5 h post-commute. We found no significant associations between pulmonary response and primary tailpipe pollution. Health effects associated with traffic-related pollution may vary by source, and therefore some traffic pollution sources may require targeted interventions to protect health.

Pulmonary mucosa-associated lymphoid tissue lymphoma associated with pulmonary sarcoidosis: a case report and literature review.

Science.gov (United States)

Kokuho, Nariaki; Terasaki, Yasuhiro; Urushiyama, Hirokazu; Terasaki, Mika; Kunugi, Shinobu; Morimoto, Taisuke; Azuma, Arata; Usuda, Jitsuo; Gemma, Akihiko; Eishi, Yoshinobu; Shimizu, Akira

2016-05-01

Differentiating low-grade lymphoma from preexisting sarcoidosis is difficult because of their pathological similarity. This article describes a case of pulmonary mucosa-associated lymphoid tissue lymphoma associated with pulmonary sarcoidosis. The patient, a 45-year-old Japanese man, presented with a 10-year history of pulmonary sarcoidosis and 5-year history of ocular sarcoidosis with histologic findings. Because only the right S3 lung nodule had gradually enlarged, partial resection was performed. Pathological study revealed noncaseous epithelioid granulomas with lymphoplasmacytic proliferation but also marked lymphoid cell proliferation with lymphoepithelial lesion findings that differed from findings of typical sarcoid lesions. Our lymphoepithelial lesion evaluation via immunohistochemistry and analysis of Ig heavy-chain gene rearrangements with assessment of Propionibacterium acnes-specific antibody reactions allow us to report, for the first time, this case of pulmonary mucosa-associated lymphoid tissue lymphoma associated with pulmonary sarcoidosis in exactly the same location, which may be significant for differentiating these diseases and understanding their pathogenic association. Copyright © 2016 Elsevier Inc. All rights reserved.

Ankyrin-1 Gene Exhibits Allelic Heterogeneity in Conferring Protection Against Malaria

Directory of Open Access Journals (Sweden)

Hong Ming Huang

2017-09-01

Full Text Available Allelic heterogeneity is a common phenomenon where a gene exhibits a different phenotype depending on the nature of its genetic mutations. In the context of genes affecting malaria susceptibility, it allowed us to explore and understand the intricate host–parasite interactions during malaria infections. In this study, we described a gene encoding erythrocytic ankyrin-1 (Ank-1 which exhibits allelic-dependent heterogeneous phenotypes during malaria infections. We conducted an ENU mutagenesis screen on mice and identified two Ank-1 mutations, one resulting in an amino acid substitution (MRI95845, and the other a truncated Ank-1 protein (MRI96570. Both mutations caused hereditary spherocytosis-like phenotypes and confer differing protection against Plasmodium chabaudi infections. Upon further examination, the Ank-1(MRI96570 mutation was found to inhibit intraerythrocytic parasite maturation, whereas Ank-1(MRI95845 caused increased bystander erythrocyte clearance during infection. This is the first description of allelic heterogeneity in ankyrin-1 from the direct comparison between two Ank-1 mutations. Despite the lack of direct evidence from population studies, this data further supported the protective roles of ankyrin-1 mutations in conferring malaria protection. This study also emphasized the importance of such phenomena in achieving a better understanding of host–parasite interactions, which could be the basis of future studies.

An efficient parallel simulation of unsteady blood flows in patient-specific pulmonary artery.

Science.gov (United States)

Kong, Fande; Kheyfets, Vitaly; Finol, Ender; Cai, Xiao-Chuan

2018-04-01

Simulation of blood flows in the pulmonary artery provides some insight into certain diseases by examining the relationship between some continuum metrics, eg, the wall shear stress acting on the vascular endothelium, which responds to flow-induced mechanical forces by releasing vasodilators/constrictors. V. Kheyfets, in his previous work, studies numerically a patient-specific pulmonary circulation to show that decreasing wall shear stress is correlated with increasing pulmonary vascular impedance. In this paper, we develop a scalable parallel algorithm based on domain decomposition methods to investigate an unsteady model with patient-specific pulsatile waveforms as the inlet boundary condition. The unsteady model offers tremendously more information about the dynamic behavior of the flow field, but computationally speaking, the simulation is a lot more expensive since a problem which is similar to the steady-state problem has to be solved many times, and therefore, the traditional sequential approach is not suitable anymore. We show computationally that simulations using the proposed parallel approach with up to 10 000 processor cores can be obtained with much reduced compute time. This makes the technology potentially usable for the routine study of the dynamic behavior of blood flows in the pulmonary artery, in particular, the changes of the blood flows and the wall shear stress in the spatial and temporal dimensions. Copyright © 2017 John Wiley & Sons, Ltd.

Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks.

Science.gov (United States)

Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina

2017-11-28

Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD.

Inflammatory myofibroblastic tumors of the lung carrying a chimeric A2M-ALK gene: report of 2 infantile cases and review of the differential diagnosis of infantile pulmonary lesions.

Science.gov (United States)

Tanaka, Mio; Kohashi, Kenichi; Kushitani, Kei; Yoshida, Misa; Kurihara, Sho; Kawashima, Masumi; Ueda, Yuka; Souzaki, Ryota; Kinoshita, Yoshiaki; Oda, Yoshinao; Takeshima, Yukio; Hiyama, Eiso; Taguchi, Tomoaki; Tanaka, Yukichi

2017-08-01

We report 2 infantile cases of pulmonary tumor carrying a chimeric A2M-ALK gene. A2M-ALK is a newly identified anaplastic lymphoma kinase (ALK)-related chimeric gene from a tumor diagnosed as fetal lung interstitial tumor (FLIT). FLIT is a recently recognized infantile pulmonary lesion defined as a mass-like lesion that morphologically resembles the fetal lung. Grossly, FLIT characteristically appears as a well-circumscribed spongy mass, whereas the tumors in these patients were solid and firm. Histologically, the tumors showed intrapulmonary lesions composed of densely proliferating polygonal or spindle-shaped mesenchymal cells with diffuse and dense infiltrations of inflammatory cells forming microcystic or micropapillary structures lined by thyroid transcription factor 1-positive pneumocytes, favoring inflammatory myofibroblastic tumor rather than FLIT. The proliferating cells were immunoreactive for ALK, and A2M-ALK was identified in both tumors with reverse-transcription polymerase chain reaction. The dense infiltration of inflammatory cells, immunoreactivity for ALK, and identification of an ALK-related chimeric gene suggested a diagnosis of inflammatory myofibroblastic tumor. Histologically, most reported FLITs show sparse inflammatory infiltrates and a relatively low density of interstitial cells in the septa, although prominent infiltration of inflammatory cells and high cellularity of interstitial cells are seen in some FLITs. The present cases suggest that ALK rearrangements, including the chimeric A2M-ALK gene, may be present in these infantile pulmonary lesions, especially those with inflammatory cell infiltration. We propose that these infantile pulmonary lesions containing a chimeric A2M-ALK gene be categorized as a specific type of inflammatory myofibroblastic tumor that develops exclusively in neonates and infants. Copyright © 2017 Elsevier Inc. All rights reserved.

Targeted delivery of genes to endothelial cells and cell- and gene-based therapy in pulmonary vascular diseases.

Science.gov (United States)

Suen, Colin M; Mei, Shirley H J; Kugathasan, Lakshmi; Stewart, Duncan J

2013-10-01

Pulmonary arterial hypertension (PAH) is a devastating disease that, despite significant advances in medical therapies over the last several decades, continues to have an extremely poor prognosis. Gene therapy is a method to deliver therapeutic genes to replace defective or mutant genes or supplement existing cellular processes to modify disease. Over the last few decades, several viral and nonviral methods of gene therapy have been developed for preclinical PAH studies with varying degrees of efficacy. However, these gene delivery methods face challenges of immunogenicity, low transduction rates, and nonspecific targeting which have limited their translation to clinical studies. More recently, the emergence of regenerative approaches using stem and progenitor cells such as endothelial progenitor cells (EPCs) and mesenchymal stem cells (MSCs) have offered a new approach to gene therapy. Cell-based gene therapy is an approach that augments the therapeutic potential of EPCs and MSCs and may deliver on the promise of reversal of established PAH. These new regenerative approaches have shown tremendous potential in preclinical studies; however, large, rigorously designed clinical studies will be necessary to evaluate clinical efficacy and safety. © 2013 American Physiological Society. Compr Physiol 3:1749-1779, 2013.

Phloem-specific expression of the lectin gene from Allium sativum confers resistance to the sap-sucker Nilaparvata lugens.

Science.gov (United States)

Chandrasekhar, Kottakota; Vijayalakshmi, Muvva; Vani, Kalasamudramu; Kaul, Tanushri; Reddy, Malireddy K

2014-05-01

Rice production is severely hampered by insect pests. Garlic lectin gene (ASAL) holds great promise in conferring protection against chewing (lepidopteran) and sap-sucking (homopteran) insect pests. We have developed transgenic rice lines resistant to sap-sucking brown hopper (Nilaparvata lugens) by ectopic expression of ASAL in their phloem tissues. Molecular analyses of T0 lines confirmed stable integration of transgene. T1 lines (NP 1-2, 4-3, 11-6 & 17-7) showed active transcription and translation of ASAL transgene. ELISA revealed ASAL expression was as high as 0.95% of total soluble protein. Insect bioassays on T2 homozygous lines (NP 18 & 32) revealed significant reduction (~74-83%) in survival rate, development and fecundity of brown hoppers in comparison to wild type. Transgenics exhibited enhanced resistance (1-2 score) against brown hoppers, minimal plant damage and no growth penalty or phenotypic abnormalities.

SPDEF is required for mouse pulmonary goblet cell differentiation and regulates a network of genes associated with mucus production.

Science.gov (United States)

Chen, Gang; Korfhagen, Thomas R; Xu, Yan; Kitzmiller, Joseph; Wert, Susan E; Maeda, Yutaka; Gregorieff, Alexander; Clevers, Hans; Whitsett, Jeffrey A

2009-10-01

Various acute and chronic inflammatory stimuli increase the number and activity of pulmonary mucus-producing goblet cells, and goblet cell hyperplasia and excess mucus production are central to the pathogenesis of chronic pulmonary diseases. However, little is known about the transcriptional programs that regulate goblet cell differentiation. Here, we show that SAM-pointed domain-containing Ets-like factor (SPDEF) controls a transcriptional program critical for pulmonary goblet cell differentiation in mice. Initial cell-lineage-tracing analysis identified nonciliated secretory epithelial cells, known as Clara cells, as the progenitors of goblet cells induced by pulmonary allergen exposure in vivo. Furthermore, in vivo expression of SPDEF in Clara cells caused rapid and reversible goblet cell differentiation in the absence of cell proliferation. This was associated with enhanced expression of genes regulating goblet cell differentiation and protein glycosylation, including forkhead box A3 (Foxa3), anterior gradient 2 (Agr2), and glucosaminyl (N-acetyl) transferase 3, mucin type (Gcnt3). Consistent with these findings, levels of SPDEF and FOXA3 were increased in mouse goblet cells after sensitization with pulmonary allergen, and the proteins were colocalized in goblet cells lining the airways of patients with chronic lung diseases. Deletion of the mouse Spdef gene resulted in the absence of goblet cells in tracheal/laryngeal submucosal glands and in the conducting airway epithelium after pulmonary allergen exposure in vivo. These data show that SPDEF plays a critical role in regulating a transcriptional network mediating the goblet cell differentiation and mucus hyperproduction associated with chronic pulmonary disorders.

Pulmonary instillation of low doses of titanium dioxide nanoparticles in mice leads to particle retention and gene expression changes in the absence of inflammation

International Nuclear Information System (INIS)

Husain, Mainul; Saber, Anne T.; Guo, Charles; Jacobsen, Nicklas R.; Jensen, Keld A.; Yauk, Carole L.; Williams, Andrew; Vogel, Ulla; Wallin, Hakan; Halappanavar, Sabina

2013-01-01

We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO 2 ). Female C57BL/6 mice were exposed to rutile nano-TiO 2 via single intratracheal instillations of 18, 54, and 162 μg/mouse. Mice were sampled 1, 3, and 28 days post-exposure. The deposition of nano-TiO 2 in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific qPCR arrays, and tissue protein ELISA. Hyperspectral mapping showed dose-dependent retention of nano-TiO 2 in the lungs up to 28 days post-instillation. DNA microarray analysis revealed approximately 3000 genes that were altered across all treatment groups (± 1.3 fold; p 2 in the absence of inflammation over time may potentially perturb calcium and ion homeostasis, and affect smooth muscle activities. - Highlights: • Pulmonary effects following exposure to low doses of nano-TiO 2 were examined. • Particle retention in lungs was assessed using nanoscale hyperspectral microscopy. • Particles persisted up to 28 days in lungs in all dose groups. • Inflammation was the pathway affected in the high dose group at all time points. • Ion homeostasis and muscle activity pathways were affected in the low dose group

[Recurrent pulmonary infection and oral mucosal ulcer].

Science.gov (United States)

Kuang, Fei-Mei; Tang, Lan-Lan; Zhang, Hui; Xie, Min; Yang, Ming-Hua; Yang, Liang-Chun; Yu, Yan; Cao, Li-Zhi

2017-04-01

An 8-year-old girl who had experienced intermittent cough and fever over a 3 year period, was admitted after experiencing a recurrence for one month. One year ago the patient experienced a recurrent oral mucosal ulcer. Physical examination showed vitiligo in the skin of the upper right back. Routine blood tests and immune function tests performed in other hospitals had shown normal results. Multiple lung CT scans showed pulmonary infection. The patient had recurrent fever and cough and persistent presence of some lesions after anti-infective therapy. The antitubercular therapy was ineffective. Routine blood tests after admission showed agranulocytosis. Gene detection was performed and she was diagnosed with dyskeratosis congenita caused by homozygous mutation in RTEL1. Patients with dyskeratosis congenita with RTEL1 gene mutation tend to develop pulmonary complications. Since RTEL1 gene sequence is highly variable with many mutation sites and patterns and can be inherited via autosomal dominant or recessive inheritance, this disease often has various clinical manifestations, which may lead to missed diagnosis or misdiagnosis. For children with unexplained recurrent pulmonary infection, examinations of the oral cavity, skin, and nails and toes should be taken and routine blood tests should be performed to exclude dyskeratosis congenita. There are no specific therapies for dyskeratosis congenita at present, and when bone marrow failure and pulmonary failure occur, hematopoietic stem cell transplantation and lung transplantation are the only therapies. Androgen and its derivatives are effective in some patients. Drugs targeting the telomere may be promising for patients with dyskeratosis congenita.

Genetics of sputum gene expression in chronic obstructive pulmonary disease.

Directory of Open Access Journals (Sweden)

Weiliang Qiu

Full Text Available Previous expression quantitative trait loci (eQTL studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs. The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5, the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus.

Genetics of Sputum Gene Expression in Chronic Obstructive Pulmonary Disease

Science.gov (United States)

Qiu, Weiliang; Cho, Michael H.; Riley, John H.; Anderson, Wayne H.; Singh, Dave; Bakke, Per; Gulsvik, Amund; Litonjua, Augusto A.; Lomas, David A.; Crapo, James D.; Beaty, Terri H.; Celli, Bartolome R.; Rennard, Stephen; Tal-Singer, Ruth; Fox, Steven M.; Silverman, Edwin K.; Hersh, Craig P.

2011-01-01

Previous expression quantitative trait loci (eQTL) studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD) patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP) data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs). The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS) dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5), the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD) bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus. PMID:21949713

Multisociety task force recommendations of competencies in Pulmonary and Critical Care Medicine.

Science.gov (United States)

Buckley, John D; Addrizzo-Harris, Doreen J; Clay, Alison S; Curtis, J Randall; Kotloff, Robert M; Lorin, Scott M; Murin, Susan; Sessler, Curtis N; Rogers, Paul L; Rosen, Mark J; Spevetz, Antoinette; King, Talmadge E; Malhotra, Atul; Parsons, Polly E

2009-08-15

Numerous accrediting organizations are calling for competency-based medical education that would help define specific specialties and serve as a foundation for ongoing assessment throughout a practitioner's career. Pulmonary Medicine and Critical Care Medicine are two distinct subspecialties, yet many individual physicians have expertise in both because of overlapping content. Establishing specific competencies for these subspecialties identifies educational goals for trainees and guides practitioners through their lifelong learning. To define specific competencies for graduates of fellowships in Pulmonary Medicine and Internal Medicine-based Critical Care. A Task Force composed of representatives from key stakeholder societies convened to identify and define specific competencies for both disciplines. Beginning with a detailed list of existing competencies from diverse sources, the Task Force categorized each item into one of six core competency headings. Each individual item was reviewed by committee members individually, in group meetings, and conference calls. Nominal group methods were used for most items to retain the views and opinions of the minority perspective. Controversial items underwent additional whole group discussions with iterative modified-Delphi techniques. Consensus was ultimately determined by a simple majority vote. The Task Force identified and defined 327 specific competencies for Internal Medicine-based Critical Care and 276 for Pulmonary Medicine, each with a designation as either: (1) relevant, but competency is not essential or (2) competency essential to the specialty. Specific competencies in Pulmonary and Critical Care Medicine can be identified and defined using a multisociety collaborative approach. These recommendations serve as a starting point and set the stage for future modification to facilitate maximum quality of care as the specialties evolve.

Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana

Science.gov (United States)

2011-01-01

Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species

Loss-of-function of neuroplasticity-related genes confers risk for human neurodevelopmental disorders.

Science.gov (United States)

Smith, Milo R; Glicksberg, Benjamin S; Li, Li; Chen, Rong; Morishita, Hirofumi; Dudley, Joel T

2018-01-01

High and increasing prevalence of neurodevelopmental disorders place enormous personal and economic burdens on society. Given the growing realization that the roots of neurodevelopmental disorders often lie in early childhood, there is an urgent need to identify childhood risk factors. Neurodevelopment is marked by periods of heightened experience-dependent neuroplasticity wherein neural circuitry is optimized by the environment. If these critical periods are disrupted, development of normal brain function can be permanently altered, leading to neurodevelopmental disorders. Here, we aim to systematically identify human variants in neuroplasticity-related genes that confer risk for neurodevelopmental disorders. Historically, this knowledge has been limited by a lack of techniques to identify genes related to neurodevelopmental plasticity in a high-throughput manner and a lack of methods to systematically identify mutations in these genes that confer risk for neurodevelopmental disorders. Using an integrative genomics approach, we determined loss-of-function (LOF) variants in putative plasticity genes, identified from transcriptional profiles of brain from mice with elevated plasticity, that were associated with neurodevelopmental disorders. From five shared differentially expressed genes found in two mouse models of juvenile-like elevated plasticity (juvenile wild-type or adult Lynx1-/- relative to adult wild-type) that were also genotyped in the Mount Sinai BioMe Biobank we identified multiple associations between LOF genes and increased risk for neurodevelopmental disorders across 10,510 patients linked to the Mount Sinai Electronic Medical Records (EMR), including epilepsy and schizophrenia. This work demonstrates a novel approach to identify neurodevelopmental risk genes and points toward a promising avenue to discover new drug targets to address the unmet therapeutic needs of neurodevelopmental disease.

Pulmonary hypertension and vascular remodeling in mice exposed to crystalline silica.

Science.gov (United States)

Zelko, Igor N; Zhu, Jianxin; Ritzenthaler, Jeffrey D; Roman, Jesse

2016-11-28

Occupational and environmental exposure to crystalline silica may lead to the development of silicosis, which is characterized by inflammation and progressive fibrosis. A substantial number of patients diagnosed with silicosis develop pulmonary hypertension. Pulmonary hypertension associated with silicosis and with related restrictive lung diseases significantly reduces survival in affected subjects. An animal model of silicosis has been described previously however, the magnitude of vascular remodeling and hemodynamic effects of inhaled silica are largely unknown. Considering the importance of such information, this study investigated whether mice exposed to silica develop pulmonary hypertension and vascular remodeling. C57BL6 mice were intratracheally injected with either saline or crystalline silica at doses 0.2 g/kg, 0.3 g/kg and 0.4 g/kg and then studied at day 28 post-exposure. Pulmonary hypertension was characterized by changes in right ventricular systolic pressure and lung histopathology. Mice exposed to saline showed normal lung histology and hemodynamic parameters while mice exposed to silica showed increased right ventricular systolic pressure and marked lung pathology characterized by a granulomatous inflammatory reaction and increased collagen deposition. Silica-exposed mice also showed signs of vascular remodeling with pulmonary artery muscularization, vascular occlusion, and medial thickening. The expression of pro-inflammatory genes such as TNF-α and MCP-1 was significantly upregulated as well as the expression of the pro-remodeling genes collagen type I, fibronectin and the metalloproteinases MMP-2 and TIMP-1. On the other hand, the expression of several vasculature specific genes involved in the regulation of endothelial function was significantly attenuated. We characterized a new animal model of pulmonary hypertension secondary to pulmonary fibrosis induced by crystalline silica. Our data suggest that silica promotes the damage of the

High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

Science.gov (United States)

Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

2017-08-01

Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

Modulation of cGMP by human HO-1 retrovirus gene transfer in pulmonary microvessel endothelial cells.

Science.gov (United States)

Abraham, Nader G; Quan, Shuo; Mieyal, Paul A; Yang, Liming; Burke-Wolin, Theresa; Mingone, Christopher J; Goodman, Alvin I; Nasjletti, Alberto; Wolin, Michael S

2002-11-01

Carbon monoxide (CO) stimulates guanylate cyclase (GC) and increases guanosine 3',5'-cyclic monophosphate (cGMP) levels. We transfected rat-lung pulmonary endothelial cells with a retrovirus-mediated human heme oxygenase (hHO)-1 gene. Pulmonary cells that expressed hHO-1 exhibited a fourfold increase in HO activity associated with decreases in the steady-state levels of heme and cGMP without changes in soluble GC (sGC) and endothelial nitric oxide synthase (NOS) proteins or basal nitrite production. Heme elicited significant increases in CO production and intracellular cGMP levels in both pulmonary endothelial and pulmonary hHO-1-expressing cells. N(omega)-nitro-L-arginine methyl ester (L-NAME), an inhibitor of NOS, significantly decreased cGMP levels in heme-treated pulmonary endothelial cells but not heme-treated hHO-1-expressing cells. In the presence of exogenous heme, CO and cGMP levels in hHO-1-expressing cells exceeded the corresponding levels in pulmonary endothelial cells. Acute exposure of endothelial cells to SnCl2, which is an inducer of HO-1, increased cGMP levels, whereas chronic exposure decreased heme and cGMP levels. These results indicate that prolonged overexpression of HO-1 ultimately decreases sGC activity by limiting the availability of cellular heme. Heme activates sGC and enhances cGMP levels via a mechanism that is largely insensitive to NOS inhibition.

Proteome analysis of Radiation-induced pulmonary fibrosis

International Nuclear Information System (INIS)

Song, Jie Young; Lim, Hee Soon; Kim, Hyung Doo; Shim, Ji Young; Han, Young Soo; Son, Hyeog Jin Son; Yun, Yeon Sook

2005-01-01

Pulmonary fibrosis is perhaps the most universal late effect of organ damage after both chemical insult and irradiation in the treatment of lung cancer. The use chemotherapy and radiation therapy, alone or combined, can be associated with clinically significant pulmonary toxicity, which leads to pneumonia and pulmonary fibrosis. It is also reported that about 100,000 people in the United States are suffered from pulmonary fibrosis. Therefore, pulmonary fibrosis will be more focused by medicinal researchers. Because current therapies, aimed at inhibiting pulmonary inflammation that often precedes fibrosis, are effective only in a minority of suffered patients, novel therapeutic methods are highly needed. Some researchers have used bleomycininduced pulmonary fibrosis as a basis for looking at the molecular mechanisms of fibrosis, and total gene expression was monitored using genomics method. However, radiation-induced pulmonary fibrosis has not been fully focused and investigated. Here, we have analyzed changes in gene expression in response to γ- irradiation by using proteomic analysis

Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.)

Science.gov (United States)

Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia

2015-01-01

Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

Micro-computed tomography of pulmonary fibrosis in mice induced by adenoviral gene transfer of biologically active transforming growth factor-β1

Directory of Open Access Journals (Sweden)

Gauldie Jack

2010-12-01

Full Text Available Abstract Background Micro-computed tomography (micro-CT is a novel tool for monitoring acute and chronic disease states in small laboratory animals. Its value for assessing progressive lung fibrosis in mice has not been reported so far. Here we examined the importance of in vivo micro-CT as non-invasive tool to assess progression of pulmonary fibrosis in mice over time. Methods Pulmonary fibrosis was induced in mice by intratracheal delivery of an adenoviral gene vector encoding biologically active TGF-ß1 (AdTGF-ß1. Respiratory gated and ungated micro-CT scans were performed at 1, 2, 3, and 4 weeks post pulmonary adenoviral gene or control vector delivery, and were then correlated with respective histopathology-based Ashcroft scoring of pulmonary fibrosis in mice. Visual assessment of image quality and consolidation was performed by 3 observers and a semi-automated quantification algorithm was applied to quantify aerated pulmonary volume as an inverse surrogate marker for pulmonary fibrosis. Results We found a significant correlation between classical Ashcroft scoring and micro-CT assessment using both visual assessment and the semi-automated quantification algorithm. Pulmonary fibrosis could be clearly detected in micro-CT, image quality values were higher for respiratory gated exams, although differences were not significant. For assessment of fibrosis no significant difference between respiratory gated and ungated exams was observed. Conclusions Together, we show that micro-CT is a powerful tool to assess pulmonary fibrosis in mice, using both visual assessment and semi-automated quantification algorithms. These data may be important in view of pre-clinical pharmacologic interventions for the treatment of lung fibrosis in small laboratory animals.

Pulmonary instillation of low doses of titanium dioxide nanoparticles in mice leads to particle retention and gene expression changes in the absence of inflammation

Energy Technology Data Exchange (ETDEWEB)

Husain, Mainul, E-mail: mainul.husain@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Saber, Anne T., E-mail: ats@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Guo, Charles, E-mail: charles.guo@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Jacobsen, Nicklas R., E-mail: nrj@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Jensen, Keld A., E-mail: kaj@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Yauk, Carole L., E-mail: carole.yauk@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Williams, Andrew, E-mail: andrew.williams@hc-sc.gc.ca [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Vogel, Ulla, E-mail: ubv@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Department of Micro- and Nanotechnology, Technical University of Denmark, Kgs. Lyngby DK-2800 (Denmark); Wallin, Hakan, E-mail: hwa@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Institute of Public Health, University of Copenhagen, Copenhagen DK-1014 (Denmark); Halappanavar, Sabina, E-mail: sabina.halappanavar@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada)

2013-06-15

We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO{sub 2}). Female C57BL/6 mice were exposed to rutile nano-TiO{sub 2} via single intratracheal instillations of 18, 54, and 162 μg/mouse. Mice were sampled 1, 3, and 28 days post-exposure. The deposition of nano-TiO{sub 2} in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific qPCR arrays, and tissue protein ELISA. Hyperspectral mapping showed dose-dependent retention of nano-TiO{sub 2} in the lungs up to 28 days post-instillation. DNA microarray analysis revealed approximately 3000 genes that were altered across all treatment groups (± 1.3 fold; p < 0.1). Several inflammatory mediators changed in a dose- and time-dependent manner at both the mRNA and protein level. Although no influx of neutrophils was detected at the low dose, changes in the expression of several genes and proteins associated with inflammation were observed. Resolving inflammation at the medium dose, and lack of neutrophil influx in the lung fluid at the low dose, were associated with down-regulation of genes involved in ion homeostasis and muscle regulation. Our gene expression results imply that retention of nano-TiO{sub 2} in the absence of inflammation over time may potentially perturb calcium and ion homeostasis, and affect smooth muscle activities. - Highlights: • Pulmonary effects following exposure to low doses of nano-TiO{sub 2} were examined. • Particle retention in lungs was assessed using nanoscale hyperspectral microscopy. • Particles persisted up to 28 days in lungs in all dose groups. • Inflammation was the pathway affected in the high dose group at all time points. • Ion homeostasis and muscle activity pathways were affected in the low dose

An Uncommon Severe Case of Pulmonary Hypertension - From Genetic Testing to Benefits of Home Anticoagulation Monitoring

Directory of Open Access Journals (Sweden)

Varga Andreea

2016-12-01

Full Text Available A 62 year-old caucasian male was admitted in our pulmonary hypertension expert center with initial diagnosis of pulmonary veno-occlusive disease for validation and specific treatment approach. Routine examinations revealed no apparent cause of pulmonary hypertension. Patient was referred for a thorax contrast enhanced multi-slice computed tomography which revealed extensive bilateral thrombi in pulmonary lower lobe arteries, pleading for chronic post embolic lesions. A right heart catheterization and pulmonary angiography confirmed the diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH. Following the local regulations, the patient underwent thrombophilia screening including molecular genetic testing, with positive findings for heterozygous for VCORK1 -1639G>A gene single nucleotide polymorphism, PAI-1 4G/5G and factor II G20210A gene. With heterozygous genetic profile of 3 mutations he has a genetic predisposition for developing a thrombophilic disease which could be involved in the etiology of CTEPH. Familial screening was extended to descendants; the unique son was tested with positive results for the same three genes. Supportive pulmonary hypertension drug therapy was initiated together with patient self-monitoring management of oral anticoagulation therapy. For optimal control of targeted anticoagulation due to a very high risk of thrombotic state the patient used a point-of-care device (CoaguChek®XS System, Roche Diagnostics for coagulation self-monitoring.

Simian virus 40 vectors for pulmonary gene therapy

Directory of Open Access Journals (Sweden)

Oppenheim Ariella

2007-10-01

Full Text Available Abstract Background Sepsis remains the leading cause of death in critically ill patients. One of the primary organs affected by sepsis is the lung, presenting as the Acute Respiratory Distress Syndrome (ARDS. Organ damage in sepsis involves an alteration in gene expression, making gene transfer a potential therapeutic modality. This work examines the feasibility of applying simian virus 40 (SV40 vectors for pulmonary gene therapy. Methods Sepsis-induced ARDS was established by cecal ligation double puncture (2CLP. SV40 vectors carrying the luciferase reporter gene (SV/luc were administered intratracheally immediately after sepsis induction. Sham operated (SO as well as 2CLP rats given intratracheal PBS or adenovirus expressing luciferase served as controls. Luc transduction was evaluated by in vivo light detection, immunoassay and luciferase mRNA detection by RT-PCR in tissue harvested from septic rats. Vector abundance and distribution into alveolar cells was evaluated using immunostaining for the SV40 VP1 capsid protein as well as by double staining for VP1 and for the surfactant protein C (proSP-C. Immunostaining for T-lymphocytes was used to evaluate the cellular immune response induced by the vector. Results Luc expression measured by in vivo light detection correlated with immunoassay from lung tissue harvested from the same rats. Moreover, our results showed vector presence in type II alveolar cells. The vector did not induce significant cellular immune response. Conclusion In the present study we have demonstrated efficient uptake and expression of an SV40 vector in the lungs of animals with sepsis-induced ARDS. These vectors appear to be capable of in vivo transduction of alveolar type II cells and may thus become a future therapeutic tool.

Genetic variants in MARCO are associated with the susceptibility to pulmonary tuberculosis in Chinese Han population.

Directory of Open Access Journals (Sweden)

Mai-Juan Ma

Full Text Available BACKGROUND: Susceptibility to tuberculosis is not only determined by Mycobacterium tuberculosis infection, but also by the genetic component of the host. Macrophage receptor with a collagenous structure (MARCO is essential components required for toll like receptor-signaling in macrophage response to Mycobacterium tuberculosis, which may contribute to tuberculosis risk. PRINCIPAL FINDINGS: To specifically investigated whether single nucleotide polymorphisms (SNPs in MARCO gene are associated with pulmonary tuberculosis in Chinese Han population. By selecting tagging SNPs in MARCO gene, 17 tag SNPs were identified and genotyped in 923 pulmonary tuberculosis patients and 1033 healthy control subjects using a hospital based case-control association study. Single-point and haplotype analysis revealed an association in intron and exon region of MARCO gene. One SNP (rs17009726 was associated with susceptibility to pulmonary tuberculosis, where the carriers of the G allele had a 1.65 fold (95% CI = 1.32-2.05, p(corrected = 9.27E-5 increased risk of pulmonary tuberculosis. Haplotype analysis revealed that haplotype GC containing G allele of 17009726 and haplotype TGCC (rs17795618T/A, rs1371562G/T, rs6761637T/C, rs2011839C/T were also associated with susceptibility to pulmonary tuberculosis (p(corrected = 0.0001 and 0.029, respectively. CONCLUSIONS: Our study suggested that genetic variants in MARCO gene were associated with pulmonary tuberculosis susceptibility in Chinese Han population, and the findings emphasize the importance of MARCO mediated immune responses in the pathogenesis of tuberculosis.

Pulmonary gene and microRNA expression changes in mice exposed to benzo(a)pyrene by oral gavage

International Nuclear Information System (INIS)

Halappanavar, Sabina; Wu, Dongmei; Williams, Andrew; Kuo, Byron; Godschalk, Roger W.; Van Schooten, Frederik J.; Yauk, Carole Lyn

2011-01-01

Highlights: → The study examines pulmonary response in mice exposed to BaP by oral gavage. → We examined pulmonary gene and miRNA expression changes and measured DNA adducts. → We compare the mechanisms of action that operate in lungs relative to the liver. → We show differences in biological pathways activated in lungs versus the liver. → We suggest that liver miRNAs are less sensitive to perturbations than lung miRNAs. -- Abstract: Exposure to the environmental mutagen benzo(a)pyrene (BaP) alters the expression of AHR-responsive genes as well as genes involved in other pathways. We recently reported that exposure of adult mice to BaP resulted in a robust transcriptome response in the liver, but this was accompanied by a complete lack of change in microRNA (miRNA) expression. Since BaP exposure does not result in hepatocarcinogenicity, but does cause lung cancer, in the present study we examine the pulmonary mRNA and miRNA responses to BaP in the same mice. Adult male B6C3F1 mice were exposed to 150 and 300 mg/kg BaP by oral gavage for three consecutive days and sacrificed 4 h after the last exposure. Serum clinical chemistry was performed for both the doses to assess the general toxicity of BaP; a modest decrease in serum inorganic phosphorous was observed at both the doses. A small decrease in serum glucose following 150 mg/kg and alkaline phosphatase following 300 mg/kg BaP was observed. BaP-DNA adduct levels in whole lung and liver tissues were assessed by 32 P postlabelling and similar dose dependent increases were observed for lung and liver. Using DNA microarrays, pulmonary mRNA and miRNA expressions were analysed. Over 1000 genes were statistically differentially expressed (p < 0.05). The perturbed pathways included oxidative stress, xenobiotic metabolism, cell proliferation, cell cycle, B and T-cell receptor signalling and primary immunodeficiency signalling pathways. Analysis of miRNA profiles revealed downregulation of miR-150, miR-142-5p, mi

Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

International Nuclear Information System (INIS)

Ahmad, B.; Ambreen, S.; Khan, I.

2015-01-01

Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

The DD genotype of the angiotensin converting enzyme gene is negatively associated with right ventricular hypertrophy in male patients with chronic obstructive pulmonary disease

NARCIS (Netherlands)

van Suylen, R. J.; Wouters, E. F.; Pennings, H. J.; Cheriex, E. C.; van Pol, P. E.; Ambergen, A. W.; Vermelis, A. M.; Daemen, M. J.

1999-01-01

The renin angiotensin system plays an important role in the development of pulmonary artery remodeling and right ventricular hypertrophy in hypoxia-induced pulmonary hypertension as may occur in patients with COPD. Several polymorphisms of genes encoding for components of the renin angiotensin

Positive Association of D Allele of ACE Gene With High Altitude Pulmonary Edema in Indian Population.

Science.gov (United States)

Bhagi, Shuchi; Srivastava, Swati; Tomar, Arvind; Bala Singh, Shashi; Sarkar, Soma

2015-06-01

High altitude pulmonary edema (HAPE) is a potentially fatal high altitude illness occurring as a result of hypobaric hypoxia with an unknown underlying genetic mechanism. Recent studies have shown a possible association between HAPE and polymorphisms in genes of the renin-angiotensin-aldosterone system (RAAS), which play a key role in sensitivity of an individual toward HAPE. For the present investigation, study groups consisted of HAPE patients (HAPE) and acclimatized control subjects (rCON). Four single-nucleotide polymorphisms (SNPs) were genotyped using restriction fragment length polymorphism (RFLP) analysis in genes of the RAAS pathway, specifically, renin (REN) C(-4063)T (rs41317140) and RENi8-83 (rs2368564), angiotensin (AGT) M(235)T (rs699), and angiotensin-converting enzyme (ACE) insertion/deletion (I/D) (rs1799752). Only the I/D polymorphism of the ACE gene showed a significant difference between the HAPE and rCON groups. The frequency of the D allele was found to be significantly higher in the HAPE group. Arterial oxygen saturation levels were significantly lower in the HAPE group compared with the rCON group and also decreased in the I/D and D/D genotypes compared with the I/I genotype in these groups. The other polymorphisms occurring in the REN and AGT genes were not significantly different between the 2 groups. These findings demonstrate a possible association of the I/D polymorphism of the ACE gene with the development of HAPE, with D/D being the at-risk genotype. Copyright © 2015 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

Computational Biology Support: RECOMB Conference Series (Conference Support)

Energy Technology Data Exchange (ETDEWEB)

Michael Waterman

2006-06-15

This funding was support for student and postdoctoral attendance at the Annual Recomb Conference from 2001 to 2005. The RECOMB Conference series was founded in 1997 to provide a scientific forum for theoretical advances in computational biology and their applications in molecular biology and medicine. The conference series aims at attracting research contributions in all areas of computational molecular biology. Typical, but not exclusive, the topics of interest are: Genomics, Molecular sequence analysis, Recognition of genes and regulatory elements, Molecular evolution, Protein structure, Structural genomics, Gene Expression, Gene Networks, Drug Design, Combinatorial libraries, Computational proteomics, and Structural and functional genomics. The origins of the conference came from the mathematical and computational side of the field, and there remains to be a certain focus on computational advances. However, the effective use of computational techniques to biological innovation is also an important aspect of the conference. The conference had a growing number of attendees, topping 300 in recent years and often exceeding 500. The conference program includes between 30 and 40 contributed papers, that are selected by a international program committee with around 30 experts during a rigorous review process rivaling the editorial procedure for top-rate scientific journals. In previous years papers selection has been made from up to 130--200 submissions from well over a dozen countries. 10-page extended abstracts of the contributed papers are collected in a volume published by ACM Press and Springer, and are available at the conference. Full versions of a selection of the papers are published annually in a special issue of the Journal of Computational Biology devoted to the RECOMB Conference. A further point in the program is a lively poster session. From 120-300 posters have been presented each year at RECOMB 2000. One of the highlights of each RECOMB conference is a

Measuring the relative extent of pulmonary infiltrates by hierarchical classification of patient-specific image features

Science.gov (United States)

Tsevas, S.; Iakovidis, D. K.

2011-11-01

Pulmonary infiltrates are common radiological findings indicating the filling of airspaces with fluid, inflammatory exudates, or cells. They are most common in cases of pneumonia, acute respiratory syndrome, atelectasis, pulmonary oedema and haemorrhage, whereas their extent is usually correlated with the extent or the severity of the underlying disease. In this paper we propose a novel pattern recognition framework for the measurement of the extent of pulmonary infiltrates in routine chest radiographs. The proposed framework follows a hierarchical approach to the assessment of image content. It includes the following: (a) sampling of the lung fields; (b) extraction of patient-specific grey-level histogram signatures from each sample; (c) classification of the extracted signatures into classes representing normal lung parenchyma and pulmonary infiltrates; (d) the samples for which the probability of belonging to one of the two classes does not reach an acceptable level are rejected and classified according to their textural content; (e) merging of the classification results of the two classification stages. The proposed framework has been evaluated on real radiographic images with pulmonary infiltrates caused by bacterial infections. The results show that accurate measurements of the infiltration areas can be obtained with respect to each lung field area. The average measurement error rate on the considered dataset reached 9.7% ± 1.0%.

Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

Directory of Open Access Journals (Sweden)

Eddy Edward M

2007-07-01

Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

Sensitivity and specificity of Ga-67 pulmonary scans for the detection of p. carinii pneumonitis in patients with the acquired immunodefficiency syndrome and pulmonary symptoms

International Nuclear Information System (INIS)

Hattner, R.S.; Sollitto, R.A.; Golden, J.A.; Coleman, D.L.; Okerlund, M.D.

1984-01-01

Acquired immunodeficiency syndrome (AIDS) is a severe disorder of cellular immunity of obscure etiology. Since its original recognition in 1981 the incidence of AIDS has doubled in each of the succeeding six months. The most common causes of death in AIDS are Kaposi's sarcoma and p. carinii pneumonia (PCP). The latter is treatable if diagnosed early, and AIDS patients (pts) may suffer recurrent episodes of PCP. Since the invasive technique of fiberoptic bronchoscopy with transbronchial biopsy, brushing, and bronchialveolar lavage are necessary for diagnosis and follow-up a noninvasive method of categorizing which AIDS pts require this procedure would be most welcome. Twenty-one pts with the syndrome of AIDS and pulmonary symptoms underwent Ga-67 scans of the thoracic region, and fibroptic bronchoscopy with washings, and brush and transbronchial biopsy. Pulmonary activity was graded in a blinded fashion by three experienced observers as follows: 1, less than, or equal to adjacent soft tissues; 2, greater than adjacent soft tissues, but less than liver; 3, equal to liver; 4, greater than liver. Eleven pts had documented PCP, and the remaining ten had non-specific pulmonary inflammation, or other, in some cases, putative, infections. The sensitivity and specificity of Ga-67 scans ≥ grade 3 was 100% and 90% respectively. These results suggests a useful role for graded Ga-67 scans in AIDS pts with pulmonary symptoms, permitting selection of pts with a high risk of PCP for further mandatory invasive investigation of this otherwise usually fatal disease

Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

OpenAIRE

Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

2008-01-01

Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

Capturing structured, pulmonary disease-specific data elements in electronic health records.

Science.gov (United States)

Gronkiewicz, Cynthia; Diamond, Edward J; French, Kim D; Christodouleas, John; Gabriel, Peter E

2015-04-01

Electronic health records (EHRs) have the potential to improve health-care quality by allowing providers to make better decisions at the point of care based on electronically aggregated data and by facilitating clinical research. These goals are easier to achieve when key, disease-specific clinical information is documented as structured data elements (SDEs) that computers can understand and process, rather than as free-text/natural-language narrative. This article reviews the benefits of capturing disease-specific SDEs. It highlights several design and implementation considerations, including the impact on efficiency and expressivity of clinical documentation and the importance of adhering to data standards when available. Pulmonary disease-specific examples of collection instruments are provided from two commonly used commercial EHRs. Future developments that can leverage SDEs to improve clinical quality and research are discussed.

Epstein-Barr virus-induced gene 3 (EBI3) polymorphisms and expression are associated with susceptibility to pulmonary tuberculosis.

Science.gov (United States)

Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue

2015-07-01

Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis

Directory of Open Access Journals (Sweden)

Welsh Kenneth I

2003-06-01

Full Text Available Abstract Background Genes encoding cytokine mediators are prime candidates for genetic analysis in conditions with T-helper (Th cell disease driven imbalance. Idiopathic Pulmonary Fibrosis (IPF is a predominantly Th2 mediated disease associated with a paucity of interferon-gamma (IFN-γ. The paucity of IFN-γ may favor the development of progressive fibrosis in IPF. Interleukin-12 (IL-12 plays a key role in inducing IFN-γ production. The aim of the current study was to assess whether the 1188 (A/C 3'UTR single nucleotide polymorphism (SNP in the IL-12 p40 subunit gene which was recently found to be functional and the 5644 (G/A 3' UTR SNP of the IFN-γ gene were associated with susceptibility to IPF. Methods We investigated the allelic distribution in these loci in UK white Caucasoid subjects comprising 73 patients with IPF and 157 healthy controls. The SNPs were determined using the polymerase chain reaction in association with sequence-specific primers incorporating mismatches at the 3'-end. Results Our results showed that these polymorphisms were distributed similarly in the IPF and control groups Conclusion We conclude that these two potentially important candidate gene single nucleotide polymorphisms are not associated with susceptibility to IPF.

Variation in the HFE gene is associated with the development of bleomycin-induced pulmonary toxicity in testicular cancer patients.

Science.gov (United States)

van der Schoot, Gabriela G F; Westerink, Nico-Derk L; Lubberts, Sjoukje; Nuver, Janine; Zwart, Nynke; Walenkamp, Annemiek M E; Wempe, Johan B; Meijer, Coby; Gietema, Jourik A

2016-05-01

Bleomycin and cisplatin are of key importance in testicular cancer treatment. Known potential serious adverse effects are bleomycin-induced pulmonary toxicity (BIP) and cisplatin-induced renal toxicity. Iron handling may play a role in development of this toxicity. Carriage of allelic variants of the HFE gene induces altered iron metabolism and may contribute to toxicity. We investigated the association between two common allelic variants of the HFE gene, H63D and C282Y, with development of pulmonary and renal toxicity during and after treatment with bleomycin- and cisplatin-containing chemotherapy. In 369 testicular cancer patients treated with bleomycin and cisplatin at the University Medical Center Groningen between 1978 and 2006, H63D and/or C282Y genotypes were determined with an allelic discrimination assay. Data were collected on development of BIP, pulmonary function parameters, renal function, and survival. BIP developed more frequently in patients who were heterozygote (16 in 75, 21%) and homozygote (2 in 4, 50%) for the H63D variant, compared with those who had the HFE wild-type gene (31 in 278, 11%) (p = 0.012). Overall survival, testicular cancer-related survival, and change in renal function were not associated with the H63D variant. We observed an association between presence of one or both H63D alleles and development of BIP in testicular cancer patients treated with bleomycin combination chemotherapy. In patients heterozygote and homozygote for the H63D variant, BIP occurred more frequently compared with wild-type patients. When validated and confirmed, HFE H63D genotyping may be used to identify patients with increased risk for pulmonary bleomycin toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gene specific actions of thyroid hormone receptor subtypes.

Directory of Open Access Journals (Sweden)

Jean Z Lin

Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.

High-altitude pulmonary hypertension

Directory of Open Access Journals (Sweden)

X-Q. Xu

2009-03-01

Full Text Available High-altitude pulmonary hypertension (HAPH is a specific disease affecting populations that live at high elevations. The prevalence of HAPH among those residing at high altitudes needs to be further defined. Whereas reduction in nitric oxide production may be one mechanism for the development of HAPH, the roles of endothelin-1 and prostaglandin I2 pathways in the pathogenesis of HAPH deserve further study. Although some studies have suggested that genetic factors contribute to the pathogenesis of HAPH, data published to date are insufficient for the identification of a significant number of gene polymorphims in HAPH. The clinical presentation of HAPH is nonspecific. Exertional dyspnoea is the most common symptom and signs related to right heart failure are common in late stages of HAPH. Echocardiography is the most useful screening tool and right heart catheterisation is the gold standard for the diagnosis of HAPH. The ideal management for HAPH is migration to lower altitudes. Phosphodiesterase 5 is an attractive drug target for the treatment of HAPH. In addition, acetazolamide is a promising therapeutic agent for high-altitude pulmonary hypertension. To date, no evidence has confirmed whether endothelin-receptor antagonists have efficacy in the treatment of high-altitude pulmonary hypertension.

Exome sequencing in an admixed isolated population indicates NFXL1 variants confer a risk for specific language impairment.

Directory of Open Access Journals (Sweden)

Pía Villanueva

2015-03-01

Full Text Available Children affected by Specific Language Impairment (SLI fail to acquire age appropriate language skills despite adequate intelligence and opportunity. SLI is highly heritable, but the understanding of underlying genetic mechanisms has proved challenging. In this study, we use molecular genetic techniques to investigate an admixed isolated founder population from the Robinson Crusoe Island (Chile, who are affected by a high incidence of SLI, increasing the power to discover contributory genetic factors. We utilize exome sequencing in selected individuals from this population to identify eight coding variants that are of putative significance. We then apply association analyses across the wider population to highlight a single rare coding variant (rs144169475, Minor Allele Frequency of 4.1% in admixed South American populations in the NFXL1 gene that confers a nonsynonymous change (N150K and is significantly associated with language impairment in the Robinson Crusoe population (p = 2.04 × 10-4, 8 variants tested. Subsequent sequencing of NFXL1 in 117 UK SLI cases identified four individuals with heterozygous variants predicted to be of functional consequence. We conclude that coding variants within NFXL1 confer an increased risk of SLI within a complex genetic model.

A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

Science.gov (United States)

Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

2017-09-01

Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

Gene delivery to the lungs: pulmonary gene therapy for cystic fibrosis.

Science.gov (United States)

Villate-Beitia, Ilia; Zarate, Jon; Puras, Gustavo; Pedraz, José Luis

2017-07-01

Cystic fibrosis (CF) is a monogenic autosomal recessive disorder where the defective gene, the cystic fibrosis transmembrane conductance regulator (CFTR), is well identified. Moreover, the respiratory tract can be targeted through noninvasive aerosolized formulations for inhalation. Therefore, gene therapy is considered a plausible strategy to address this disease. Conventional gene therapy strategies rely on the addition of a correct copy of the CFTR gene into affected cells in order to restore the channel activity. In recent years, genome correction strategies have emerged, such as zinc-finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats associated to Cas9 nucleases. These gene editing tools aim to repair the mutated gene at its original genomic locus with high specificity. Besides, the success of gene therapy critically depends on the nucleic acids carriers. To date, several clinical studies have been carried out to add corrected copies of the CFTR gene into target cells using viral and non-viral vectors, some of them with encouraging results. Regarding genome editing systems, preliminary in vitro studies have been performed in order to repair the CFTR gene. In this review, after briefly introducing the basis of CF, we discuss the up-to-date gene therapy strategies to address the disease. The review focuses on the main factors to take into consideration when developing gene delivery strategies, such as the design of vectors and plasmid DNA, in vitro/in vivo tests, translation to human use, administration methods, manufacturing conditions and regulatory issues.

Genetic variation in the bleomycin hydrolase gene and bleomycin-induced pulmonary toxicity in germ cell cancer patients

NARCIS (Netherlands)

Nuver, J; Lutke-Holzik, MF; van Zweeden, M; Hoekstra, HJ; Meijer, C; Suurmeijer, AJH; Hofstra, RM; Sluiter, WJ; Sleijfer, D; Gietema, JA; Groen, Hendricus; Groen, Herman

Objective Use of bleomycin as a cytotoxic agent is limited by its pulmonary toxicity. Bleomycin is mainly excreted by the kidneys, but can also be inactivated by bleomycin hydrolase (BMH). An 1450A > G polymorphic site in the BMH gene results in an amino acid substitution in the C-terminal domain of

Osteopontin is an endogenous modulator of the constitutively activated phenotype of pulmonary adventitial fibroblasts in hypoxic pulmonary hypertension

Science.gov (United States)

Anwar, Adil; Li, Min; Frid, Maria G.; Kumar, Binod; Gerasimovskaya, Evgenia V.; Riddle, Suzette R.; McKeon, B. Alexandre; Thukaram, Roopa; Meyrick, Barbara O.; Fini, Mehdi A.

2012-01-01

Increased cell proliferation and migration, of several cell types are key components of vascular remodeling observed in pulmonary hypertension (PH). Our previous data demonstrate that adventitial fibroblasts isolated from pulmonary arteries of chronically hypoxic hypertensive calves (termed PH-Fibs) exhibit a “constitutively activated” phenotype characterized by high proliferative and migratory potential. Osteopontin (OPN) has been shown to promote several cellular activities including growth and migration in cancer cells. We thus tested the hypothesis that elevated OPN expression confers the “activated” highly proproliferative and promigratory/invasive phenotype of PH-Fibs. Our results demonstrate that, both in vivo and ex vivo, PH-Fibs exhibited increased expression of OPN, as well as its cognate receptors, αVβ3 and CD44, compared with control fibroblasts (CO-Fibs). Augmented OPN expression in PH-Fibs corresponded to their high proliferative, migratory, and invasive properties and constitutive activation of ERK1/2 and AKT signaling. OPN silencing via small interfering RNA or sequestering OPN production by specific antibodies led to decreased proliferation, migration, invasion, and attenuated ERK1/2, AKT phosphorylation in PH-Fibs. Furthermore, increasing OPN levels in CO-Fibs via recombinant OPN resulted in significant increases in their proliferative, migratory, and invasive capabilities to the levels resembling those of PH-Fibs. Thus our data suggest OPN as an essential contributor to the activated (highly proliferative, migratory, and proinvasive) phenotype of pulmonary adventitial fibroblasts in hypoxic PH. PMID:22582113

An Exome Sequencing Study to Assess the Role of Rare Genetic Variation in Pulmonary Fibrosis.

Science.gov (United States)

Petrovski, Slavé; Todd, Jamie L; Durheim, Michael T; Wang, Quanli; Chien, Jason W; Kelly, Fran L; Frankel, Courtney; Mebane, Caroline M; Ren, Zhong; Bridgers, Joshua; Urban, Thomas J; Malone, Colin D; Finlen Copeland, Ashley; Brinkley, Christie; Allen, Andrew S; O'Riordan, Thomas; McHutchison, John G; Palmer, Scott M; Goldstein, David B

2017-07-01

Idiopathic pulmonary fibrosis (IPF) is an increasingly recognized, often fatal lung disease of unknown etiology. The aim of this study was to use whole-exome sequencing to improve understanding of the genetic architecture of pulmonary fibrosis. We performed a case-control exome-wide collapsing analysis including 262 unrelated individuals with pulmonary fibrosis clinically classified as IPF according to American Thoracic Society/European Respiratory Society/Japanese Respiratory Society/Latin American Thoracic Association guidelines (81.3%), usual interstitial pneumonia secondary to autoimmune conditions (11.5%), or fibrosing nonspecific interstitial pneumonia (7.2%). The majority (87%) of case subjects reported no family history of pulmonary fibrosis. We searched 18,668 protein-coding genes for an excess of rare deleterious genetic variation using whole-exome sequence data from 262 case subjects with pulmonary fibrosis and 4,141 control subjects drawn from among a set of individuals of European ancestry. Comparing genetic variation across 18,668 protein-coding genes, we found a study-wide significant (P RTEL1, and PARN. A model qualifying ultrarare, deleterious, nonsynonymous variants implicated TERT and RTEL1, and a model specifically qualifying loss-of-function variants implicated RTEL1 and PARN. A subanalysis of 186 case subjects with sporadic IPF confirmed TERT, RTEL1, and PARN as study-wide significant contributors to sporadic IPF. Collectively, 11.3% of case subjects with sporadic IPF carried a qualifying variant in one of these three genes compared with the 0.3% carrier rate observed among control subjects (odds ratio, 47.7; 95% confidence interval, 21.5-111.6; P = 5.5 × 10 -22 ). We identified TERT, RTEL1, and PARN-three telomere-related genes previously implicated in familial pulmonary fibrosis-as significant contributors to sporadic IPF. These results support the idea that telomere dysfunction is involved in IPF pathogenesis.

Chronic use of PAH-specific therapy in World Health Organization Group III Pulmonary Hypertension: a systematic review and meta-analysis.

Science.gov (United States)

Prins, Kurt W; Duval, Sue; Markowitz, Jeremy; Pritzker, Marc; Thenappan, Thenappan

2017-03-01

Pulmonary hypertension (PH) complicating chronic obstructive pulmonary disease (COPD-PH) and interstitial lung disease (ILD-PH) (World Health Organization [WHO] Group III PH) increases medical costs and reduces survival. Despite limited data, many clinicians are using pulmonary arterial hypertension (PAH)-specific therapy to treat WHO Group III PH patients. To further investigate the utility of PAH-specific therapy in WHO Group III PH, we performed a systematic review and meta-analysis. Relevant studies from January 2000 through May 2016 were identified in the MEDLINE, EMBASE, and COCHRANE electronic databases and www.clinicaltrials.gov. Change in six-minute walk distance (6MWD) was estimated using random effects meta-analysis techniques. Five randomized controlled trials (RCTs) in COPD-PH (128 placebo or standard treatment and 129 PAH-medication treated patients), two RCTs in ILD-PH (23 placebo and 46 treated patients), and four single-arm clinical trials (50 patients) in ILD-PH were identified. Treatment in both COPD-PH and ILD-PH did not worsen hypoxemia. Symptomatic burden was not consistently reduced but there were trends for reduced pulmonary artery pressures and pulmonary vascular resistance with PAH-specific therapy. As compared to placebo, 6MWD was not significantly improved with PAH-specific therapy in the five COPD-PH RCTs (42.7 m; 95% confidence interval [CI], -1.0 - 86.3). In the four single-arm studies in ILD-PH patients, there was a significant improvement in 6MWD after PAH-specific treatment (46.2 m; 95% CI, 27.9-64.4), but in the two ILD-PH RCTs there was not an improvement (21.6 m; 95% CI, -17.8 - 61.0) in exercise capacity when compared to placebo. Due to the small numbers of patients evaluated and inconsistent beneficial effects, the utility of PAH-specific therapy in WHO Group III PH remains unproven. A future clinical trial that is appropriately powered is needed to definitively determine the efficacy of this widely implemented treatment

Specificity and sensitivity of noninvasive measurement of pulmonary vascular protein leak

International Nuclear Information System (INIS)

Dauber, I.M.; Pluss, W.T.; VanGrondelle, A.; Trow, R.S.; Weil, J.V.

1985-01-01

Noninvasive techniques employing external counting of radiolabeled protein have the potential for measuring pulmonary vascular protein permeability, but their specificity and sensitivity remain unclear. The authors tested the specificity and sensitivity of a double-radioisotope method by injecting radiolabeled albumin ( 131 I) and erythrocytes (/sup 99m/Tc) into anesthetized dogs and measuring the counts of each isotope for 150 min after injection with an external gamma probe fixed over the lung. They calculated the rate of increase of albumin counts measured by the probe (which reflects the rate at which protein leaks into the extravascular space). To assess permeability the authors normalized the rate of increase in albumin counts for changes in labeled erythrocyte signal to minimize influence of changes in vascular surface area and thus derived an albumin leak index. They measured the albumin leak index and gravimetric lung water during hydrostatic edema (acutely elevating left atrial pressure by left atrial balloon inflation: mean pulmonary arterial wedge pressure = 22.6 Torr) and in lung injury edema induced by high- (1.0 g/kg) and low-dose (0.25 g/kg) intravenous thiourea. To test specificity hydrostatic and high-dose thiourea edema were compared. The albumin leak index increased nearly fourfold from control after thiourea injury (27.2 +/- 2.3 x 10-4 vs. 7.6 +/- 0.9 x 10-4 min-1) but did not change from control levels after elevating left atrial pressure (8.9 +/- 1.2 x 10-4 min-1) despite comparable increases in gravimetric lung water. To test sensitivity the authors compared low-dose thiourea with controls. Following low-dose thiourea, the albumin leak index nearly doubled despite the absence of a measurable increase in lung water

Simvastatin enhances bone morphogenetic protein receptor type II expression

International Nuclear Information System (INIS)

Hu Hong; Sung, Arthur; Zhao, Guohua; Shi, Lingfang; Qiu Daoming; Nishimura, Toshihiko; Kao, Peter N.

2006-01-01

Statins confer therapeutic benefits in systemic and pulmonary vascular diseases. Bone morphogenetic protein (BMP) receptors serve essential signaling functions in cardiovascular development and skeletal morphogenesis. Mutations in BMP receptor type II (BMPR2) are associated with human familial and idiopathic pulmonary arterial hypertension, and pathologic neointimal proliferation of vascular endothelial and smooth muscle cells within small pulmonary arteries. In severe experimental pulmonary hypertension, simvastatin reversed disease and conferred a 100% survival advantage. Here, modulation of BMPR2 gene expression by simvastatin is characterized in human embryonic kidney (HEK) 293T, pulmonary artery smooth muscle, and lung microvascular endothelial cells (HLMVECs). A 1.4 kb BMPR2 promoter containing Egr-1 binding sites confers reporter gene activation in 293T cells which is partially inhibited by simvastatin. Simvastatin enhances steady-state BMPR2 mRNA and protein expression in HLMVEC, through posttranscriptional mRNA stabilization. Simvastatin induction of BMPR2 expression may improve BMP-BMPR2 signaling thereby enhancing endothelial differentiation and function

Integrated Genomics Reveals Convergent Transcriptomic Networks Underlying Chronic Obstructive Pulmonary Disease and Idiopathic Pulmonary Fibrosis.

Science.gov (United States)

Kusko, Rebecca L; Brothers, John F; Tedrow, John; Pandit, Kusum; Huleihel, Luai; Perdomo, Catalina; Liu, Gang; Juan-Guardela, Brenda; Kass, Daniel; Zhang, Sherry; Lenburg, Marc; Martinez, Fernando; Quackenbush, John; Sciurba, Frank; Limper, Andrew; Geraci, Mark; Yang, Ivana; Schwartz, David A; Beane, Jennifer; Spira, Avrum; Kaminski, Naftali

2016-10-15

Despite shared environmental exposures, idiopathic pulmonary fibrosis (IPF) and chronic obstructive pulmonary disease are usually studied in isolation, and the presence of shared molecular mechanisms is unknown. We applied an integrative genomic approach to identify convergent transcriptomic pathways in emphysema and IPF. We defined the transcriptional repertoire of chronic obstructive pulmonary disease, IPF, or normal histology lungs using RNA-seq (n = 87). Genes increased in both emphysema and IPF relative to control were enriched for the p53/hypoxia pathway, a finding confirmed in an independent cohort using both gene expression arrays and the nCounter Analysis System (n = 193). Immunohistochemistry confirmed overexpression of HIF1A, MDM2, and NFKBIB members of this pathway in tissues from patients with emphysema or IPF. Using reads aligned across splice junctions, we determined that alternative splicing of p53/hypoxia pathway-associated molecules NUMB and PDGFA occurred more frequently in IPF or emphysema compared with control and validated these findings by quantitative polymerase chain reaction and the nCounter Analysis System on an independent sample set (n = 193). Finally, by integrating parallel microRNA and mRNA-Seq data on the same samples, we identified MIR96 as a key novel regulatory hub in the p53/hypoxia gene-expression network and confirmed that modulation of MIR96 in vitro recapitulates the disease-associated gene-expression network. Our results suggest convergent transcriptional regulatory hubs in diseases as varied phenotypically as chronic obstructive pulmonary disease and IPF and suggest that these hubs may represent shared key responses of the lung to environmental stresses.

Mycobacterium tuberculosis Zinc Metalloprotease-1 Elicits Tuberculosis-specific Humoral Immune Response Independent of Mycobacterial Load in Pulmonary and Extra-Pulmonary Tuberculosis Patients

Directory of Open Access Journals (Sweden)

Mani Harika eVemula

2016-03-01

Full Text Available Conventionally, facultative intracellular pathogen, Mycobacterium tuberculosis (M.tb, the tuberculosis (TB causing bacilli in human is cleared by cell-mediated immunity (CMI with CD4+ T cells playing instrumental role in protective immunity, while antibody-mediated immunity (AMI is considered non-protective. This longstanding convention has been challenged with recent evidences of increased susceptibility of hosts with compromised AMI and monoclonal antibodies conferring passive protection against TB and other intracellular pathogens. Therefore, novel approaches towards vaccine development include strategies aiming at induction of humoral response along with CMI. This necessitates the identification of mycobacterial proteins with properties of immunomodulation and strong immunogenicity. In this study, we determined the immunogenic potential of M.tb Zinc metalloprotease-1 (Zmp1, a secretory protein essential for intracellular survival and pathogenesis of M.tb. We observed that Zmp1 was secreted by in vitro grown M.tb under granuloma-like stress conditions (acidic, oxidative, iron deficiency and nutrient deprivation and generated Th2 cytokine microenvironment upon exogenous treatment of Peripheral Blood Mononulear Cells (PBMCs with recombinant Zmp1 (rZmp1. This was supported by recording specific and robust humoral response in TB patients in a cohort of 295. The anti-Zmp1 titers were significantly higher in TB patients (n=121 as against healthy control (n=62, household contacts (n=89 and non-specific infection controls (n=23. A significant observation of the study is the presence of equally high titers of anti-Zmp1 antibodies in a range of patients with high bacilli load (sputum bacilli load of 300+ per mL to paucibacillary smear-negative pulmonary tuberculosis (PTB cases. This clearly indicated the potential of Zmp1 to evoke an effective humoral response independent of mycobacterial load. Such mycobacterial proteins can be explored as antigen

The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

Science.gov (United States)

Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

2018-04-01

Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

Energy Technology Data Exchange (ETDEWEB)

Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

2013-05-20

Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

Assessing idiopathic pulmonary fibrosis (IPF) with bronchoscopic OCT (Conference Presentation)

Science.gov (United States)

Hariri, Lida P.; Adams, David C.; Colby, Thomas V.; Tager, Andrew M.; Suter, Melissa J.

2016-03-01

Idiopathic pulmonary fibrosis (IPF) is a progressive, fatal form of fibrotic lung disease, with a 3 year survival rate of 50%. Diagnostic certainty of IPF is essential to determine the most effective therapy for patients, but often requires surgery to resect lung tissue and look for microscopic honeycombing not seen on chest computed tomography (CT). Unfortunately, surgical lung resection has high risks of associated morbidity and mortality in this patient population. We aim to determine whether bronchoscopic optical coherence tomography (OCT) can serve as a novel, low-risk paradigm for in vivo IPF diagnosis without surgery or tissue removal. OCT provides rapid 3D visualization of large tissue volumes with microscopic resolutions well beyond the capabilities of CT. We have designed bronchoscopic OCT catheters to effectively and safely access the peripheral lung, and conducted in vivo peripheral lung imaging in patients, including those with pulmonary fibrosis. We utilized these OCT catheters to perform bronchoscopic imaging in lung tissue from patients with pulmonary fibrosis to determine if bronchoscopic OCT could successfully visualize features of IPF through the peripheral airways. OCT was able to visualize characteristic features of IPF through the airway, including microscopic honeycombing (< 1 mm diameter) not visible by CT, dense peripheral fibrosis, and spatial disease heterogeneity. These findings support the potential of bronchoscopic OCT as a minimally-invasive method for in vivo IPF diagnosis. However, future clinical studies are needed to validate these findings.

Gene-specific cell labeling using MiMIC transposons.

Science.gov (United States)

Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

2015-04-30

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The clinical presentation of pulmonary embolism

International Nuclear Information System (INIS)

Otto, A.C.; Dunn, M.; Van der Merwe, B.; Katz, M.

2004-01-01

Full text: Introduction: Pulmonary embolism is often misdiagnosed by many clinicians because of confusion with pulmonary infarction. According to present literature, the latter seldomly occurs, thus pleuritic pain and hemoptysis are usually absent. The purpose of our study was to re-evaluate the clinical presentation of pulmonary embolism with specific reference to the presence of pulmonary hypertension and pulmonary infarction. Materials and methods: Ethical committee approval was obtained to study fifteen patients with abnormal lung perfusion and high probability for pulmonary embolism retrospectively. Clinical data will be presented in table format. Appropriate symptoms and signs not mentioned was considered absent. Specific investigations not available was considered not done. Results: Will be displayed in table format. The main findings can be summarized as follows: 1. Dyspnea was present in all the patients; 2. Pleuritic pain and hemoptysis was absent in all the patients; 3. None of the patients had clinical signs of pulmonary hypertension or infarction; 4. The available special investigations confirmed the above mentioned findings. Conclusion: The absence of pulmonary infarction and pulmonary hypertension with submassive pulmonary embolism (<60% of pulmonary vascular bed occluded) was reconfirmed and should be emphasized more in clinical practice. (author)

TiGER: a database for tissue-specific gene expression and regulation.

Science.gov (United States)

Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

2008-06-09

Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

TiGER: A database for tissue-specific gene expression and regulation

Directory of Open Access Journals (Sweden)

Zack Donald J

2008-06-01

Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

DC-SIGN (CD209), pentraxin 3 and vitamin D receptor gene variants associate with pulmonary tuberculosis risk in West Africans

DEFF Research Database (Denmark)

Olesen, R; Wejse, C; Velez, D R

2007-01-01

We investigated the role of DC-SIGN (CD209), long pentraxin 3 (PTX3) and vitamin D receptor (VDR) gene single nucleotide polymorphisms (SNPs) in susceptibility to pulmonary tuberculosis (TB) in 321 TB cases and 347 healthy controls from Guinea-Bissau. Five additional, functionally relevant SNPs...... within toll-like receptors (TLRs) 2, 4 and 9 were typed but found, when polymorphic, not to affect host vulnerability to pulmonary TB. We did not replicate an association between SNPs in the DC-SIGN promoter and TB. However, we found that two polymorphisms, one in DC-SIGN and one in VDR, were associated...

Dissection of two soybean QTL conferring partial resistance to Phytophthora sojae through sequence and gene expression analysis

Directory of Open Access Journals (Sweden)

Wang Hehe

2012-08-01

Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.

Science.gov (United States)

Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru

2015-01-01

Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea

Directory of Open Access Journals (Sweden)

Yoshiki eNakahara

2015-10-01

Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.

Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis.

Science.gov (United States)

DePianto, Daryle J; Chandriani, Sanjay; Abbas, Alexander R; Jia, Guiquan; N'Diaye, Elsa N; Caplazi, Patrick; Kauder, Steven E; Biswas, Sabyasachi; Karnik, Satyajit K; Ha, Connie; Modrusan, Zora; Matthay, Michael A; Kukreja, Jasleen; Collard, Harold R; Egen, Jackson G; Wolters, Paul J; Arron, Joseph R

2015-01-01

There is microscopic spatial and temporal heterogeneity of pathological changes in idiopathic pulmonary fibrosis (IPF) lung tissue, which may relate to heterogeneity in pathophysiological mediators of disease and clinical progression. We assessed relationships between gene expression patterns, pathological features, and systemic biomarkers to identify biomarkers that reflect the aggregate disease burden in patients with IPF. Gene expression microarrays (N=40 IPF; 8 controls) and immunohistochemical analyses (N=22 IPF; 8 controls) of lung biopsies. Clinical characterisation and blood biomarker levels of MMP3 and CXCL13 in a separate cohort of patients with IPF (N=80). 2940 genes were significantly differentially expressed between IPF and control samples (|fold change| >1.5, p<0.05). Two clusters of co-regulated genes related to bronchiolar epithelium or lymphoid aggregates exhibited substantial heterogeneity within the IPF population. Gene expression in bronchiolar and lymphoid clusters corresponded to the extent of bronchiolisation and lymphoid aggregates determined by immunohistochemistry in adjacent tissue sections. Elevated serum levels of MMP3, encoded in the bronchiolar cluster, and CXCL13, encoded in the lymphoid cluster, corresponded to disease severity and shortened survival time (p<10(-7) for MMP3 and p<10(-5) for CXCL13; Cox proportional hazards model). Microscopic pathological heterogeneity in IPF lung tissue corresponds to specific gene expression patterns related to bronchiolisation and lymphoid aggregates. MMP3 and CXCL13 are systemic biomarkers that reflect the aggregate burden of these pathological features across total lung tissue. These biomarkers may have clinical utility as prognostic and/or surrogate biomarkers of disease activity in interventional studies in IPF. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa.

Science.gov (United States)

Lin, F; Chen, X M

2007-05-01

Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values

In smokers, Sonic hedgehog modulates pulmonary endothelial function through vascular endothelial growth factor.

Science.gov (United States)

Henno, Priscilla; Grassin-Delyle, Stanislas; Belle, Emeline; Brollo, Marion; Naline, Emmanuel; Sage, Edouard; Devillier, Philippe; Israël-Biet, Dominique

2017-05-23

Tobacco-induced pulmonary vascular disease is partly driven by endothelial dysfunction. The Sonic hedgehog (SHH) pathway is involved in vascular physiology. We sought to establish whether the SHH pathway has a role in pulmonary endothelial dysfunction in smokers. The ex vivo endothelium-dependent relaxation of pulmonary artery rings in response to acetylcholine (Ach) was compared in 34 current or ex-smokers and 8 never-smokers. The results were expressed as a percentage of the contraction with phenylephrine. We tested the effects of SHH inhibitors (GANT61 and cyclopamine), an SHH activator (SAG) and recombinant VEGF on the Ach-induced relaxation. The level of VEGF protein in the pulmonary artery ring was measured in an ELISA. SHH pathway gene expression was quantified in reverse transcriptase-quantitative polymerase chain reactions. Ach-induced relaxation was much less intense in smokers than in never-smokers (respectively 24 ± 6% and 50 ± 7% with 10 -4 M Ach; p = 0.028). All SHH pathway genes were expressed in pulmonary artery rings from smokers. SHH inhibition by GANT61 reduced Ach-induced relaxation and VEGF gene expression in the pulmonary artery ring. Recombinant VEGF restored the ring's endothelial function. VEGF gene and protein expression levels in the pulmonary artery rings were positively correlated with the degree of Ach-induced relaxation and negatively correlated with the number of pack-years. SHH pathway genes and proteins are expressed in pulmonary artery rings from smokers, where they modulate endothelial function through VEGF.

Central role of T helper 17 cells in chronic hypoxia-induced pulmonary hypertension.

Science.gov (United States)

Maston, Levi D; Jones, David T; Giermakowska, Wieslawa; Howard, Tamara A; Cannon, Judy L; Wang, Wei; Wei, Yongyi; Xuan, Weimin; Resta, Thomas C; Gonzalez Bosc, Laura V

2017-05-01

Inflammation is a prominent pathological feature in pulmonary arterial hypertension, as demonstrated by pulmonary vascular infiltration of inflammatory cells, including T and B lymphocytes. However, the contribution of the adaptive immune system is not well characterized in pulmonary hypertension caused by chronic hypoxia. CD4 + T cells are required for initiating and maintaining inflammation, suggesting that these cells could play an important role in the pathogenesis of hypoxic pulmonary hypertension. Our objective was to test the hypothesis that CD4 + T cells, specifically the T helper 17 subset, contribute to chronic hypoxia-induced pulmonary hypertension. We compared indices of pulmonary hypertension resulting from chronic hypoxia (3 wk) in wild-type mice and recombination-activating gene 1 knockout mice (RAG1 -/- , lacking mature T and B cells). Separate sets of mice were adoptively transferred with CD4 + , CD8 + , or T helper 17 cells before normoxic or chronic hypoxic exposure to evaluate the involvement of specific T cell subsets. RAG1 -/- mice had diminished right ventricular systolic pressure and arterial remodeling compared with wild-type mice exposed to chronic hypoxia. Adoptive transfer of CD4 + but not CD8 + T cells restored the hypertensive phenotype in RAG1 -/- mice. Interestingly, RAG1 -/- mice receiving T helper 17 cells displayed evidence of pulmonary hypertension independent of chronic hypoxia. Supporting our hypothesis, depletion of CD4 + cells or treatment with SR1001, an inhibitor of T helper 17 cell development, prevented increased pressure and remodeling responses to chronic hypoxia. We conclude that T helper 17 cells play a key role in the development of chronic hypoxia-induced pulmonary hypertension. Copyright © 2017 the American Physiological Society.

Hepatocyte specific expression of human cloned genes

Energy Technology Data Exchange (ETDEWEB)

Cortese, R

1986-01-01

A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

Transforming growth factor. beta. sub 1 is present at sites of extracellular matrix gene expression in human pulmonary fibrosis

Energy Technology Data Exchange (ETDEWEB)

Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. (Washington Univ., St. Louis, MO (United States)); Colby, T.V. (Mayo Clinic, Rochester, MN (United States))

1991-08-01

Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.

High-resolution fine mapping of ps-2, a mutated gene conferring functional male sterility in tomato due to non-dehiscent anthers

NARCIS (Netherlands)

Gorguet, B.J.M.; Schipper, E.H.; Heusden, van A.W.; Lindhout, P.

2006-01-01

Functional male sterility is an important trait for the production of hybrid seeds. Among the genes coding for functional male sterility in tomato is the positional sterility gene ps-2. ps-2 is monogenic recessive, confers non-dehiscent anthers and is the most suitable for practical uses. In order

Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

Directory of Open Access Journals (Sweden)

Benjamin Mayne

2016-10-01

Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

Exploring the potential relevance of human-specific genes to complex disease

Directory of Open Access Journals (Sweden)

Cooper David N

2011-01-01

Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.

Tissue-specific functional networks for prioritizing phenotype and disease genes.

Directory of Open Access Journals (Sweden)

Yuanfang Guan

Full Text Available Integrated analyses of functional genomics data have enormous potential for identifying phenotype-associated genes. Tissue-specificity is an important aspect of many genetic diseases, reflecting the potentially different roles of proteins and pathways in diverse cell lineages. Accounting for tissue specificity in global integration of functional genomics data is challenging, as "functionality" and "functional relationships" are often not resolved for specific tissue types. We address this challenge by generating tissue-specific functional networks, which can effectively represent the diversity of protein function for more accurate identification of phenotype-associated genes in the laboratory mouse. Specifically, we created 107 tissue-specific functional relationship networks through integration of genomic data utilizing knowledge of tissue-specific gene expression patterns. Cross-network comparison revealed significantly changed genes enriched for functions related to specific tissue development. We then utilized these tissue-specific networks to predict genes associated with different phenotypes. Our results demonstrate that prediction performance is significantly improved through using the tissue-specific networks as compared to the global functional network. We used a testis-specific functional relationship network to predict genes associated with male fertility and spermatogenesis phenotypes, and experimentally confirmed one top prediction, Mbyl1. We then focused on a less-common genetic disease, ataxia, and identified candidates uniquely predicted by the cerebellum network, which are supported by both literature and experimental evidence. Our systems-level, tissue-specific scheme advances over traditional global integration and analyses and establishes a prototype to address the tissue-specific effects of genetic perturbations, diseases and drugs.

The diversity of antimicrobial resistance genes among staphylococci of animal origin.

Science.gov (United States)

Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

2013-08-01

Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

In silico design and functional assessment of semisynthetic genes that confer tolerance to phosphinothricin

Directory of Open Access Journals (Sweden)

Jenny Paola Jiménez

2016-07-01

Full Text Available Herbicide tolerance is one of the features most used in GM crops, which has shown positive results for farmers and the environment. The starting point is the development of expression cassettes that express the characteristic of interest, they are initially constructed by standard molecular biology techniques. Currently, by bioinformatics and synthetic biology tools, it is possible to design and test the construct in silico, and then hire their synthesis. This approach allows optimizing expression by modifying the codon usage. In this work there were designed and evaluated semi-synthetic versions of genes in Nicotiana benthamiana, these genes confer tolerance to the herbicide phosphinothricin. It was made an analysis of freedom to operate in order to ensure that the designed constructs not violate intellectual property in Colombia. There were obtained two expression cassettes with freedom to operate, which express versions of the bar gene.

Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

Science.gov (United States)

Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

2017-06-01

Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

Genome-scale analysis of positional clustering of mouse testis-specific genes

Directory of Open Access Journals (Sweden)

Lee Bernett TK

2005-01-01

Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.

Design of chimeric expression elements that confer high-level gene activity in chromoplasts.

Science.gov (United States)

Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph

2013-02-01

Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

Nurse administered propofol sedation for pulmonary endoscopies requires a specific protocol

DEFF Research Database (Denmark)

Jensen, Jeppe Thue; Banning, Anne-Marie; Clementsen, Paul

2012-01-01

This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline".......This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline"....

Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group

Science.gov (United States)

The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...

Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.

Science.gov (United States)

Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian

2018-06-01

Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Tissue-specific and pathogen-induced regulation of a Nicotiana plumbaginifolia beta-1,3-glucanase gene.

Science.gov (United States)

Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M

1990-01-01

The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158

Mining tissue specificity, gene connectivity and disease association to reveal a set of genes that modify the action of disease causing genes

Directory of Open Access Journals (Sweden)

Reverter Antonio

2008-09-01

Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing

13th Forum for Specification and Design Languages (FDL) conference

CERN Document Server

Morawiec, Adam; System Specification and Design Languages : Selected Contributions from FDL 2010

2012-01-01

This book brings together a selection of the best papers from the thirteenth edition of the Forum on specification and Design Languages Conference (FDL), which was held in Southampton, UK in September 2010.  FDL is a well established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modelling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. Covers design verification, automatic synthesis and mechanized debug aids; Includes language-based modeling and design techniques for embedded systems; Covers design, modeling and verification of mixed physical domain and mixed signal systems that include significant analog parts in electrical and non-electrical domains; Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven E...

10. international mouse genome conference

Energy Technology Data Exchange (ETDEWEB)

Meisler, M.H.

1996-12-31

Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.

Application of biclustering of gene expression data and gene set enrichment analysis methods to identify potentially disease causing nanomaterials

Directory of Open Access Journals (Sweden)

Andrew Williams

2015-12-01

Full Text Available Background: The presence of diverse types of nanomaterials (NMs in commerce is growing at an exponential pace. As a result, human exposure to these materials in the environment is inevitable, necessitating the need for rapid and reliable toxicity testing methods to accurately assess the potential hazards associated with NMs. In this study, we applied biclustering and gene set enrichment analysis methods to derive essential features of altered lung transcriptome following exposure to NMs that are associated with lung-specific diseases. Several datasets from public microarray repositories describing pulmonary diseases in mouse models following exposure to a variety of substances were examined and functionally related biclusters of genes showing similar expression profiles were identified. The identified biclusters were then used to conduct a gene set enrichment analysis on pulmonary gene expression profiles derived from mice exposed to nano-titanium dioxide (nano-TiO2, carbon black (CB or carbon nanotubes (CNTs to determine the disease significance of these data-driven gene sets.Results: Biclusters representing inflammation (chemokine activity, DNA binding, cell cycle, apoptosis, reactive oxygen species (ROS and fibrosis processes were identified. All of the NM studies were significant with respect to the bicluster related to chemokine activity (DAVID; FDR p-value = 0.032. The bicluster related to pulmonary fibrosis was enriched in studies where toxicity induced by CNT and CB studies was investigated, suggesting the potential for these materials to induce lung fibrosis. The pro-fibrogenic potential of CNTs is well established. Although CB has not been shown to induce fibrosis, it induces stronger inflammatory, oxidative stress and DNA damage responses than nano-TiO2 particles.Conclusion: The results of the analysis correctly identified all NMs to be inflammogenic and only CB and CNTs as potentially fibrogenic. In addition to identifying several

A comparative analysis of pulmonary ventilation-perfusion imaging with pulmonary angiography in the diagnosis of pulmonary embolism

International Nuclear Information System (INIS)

Wang Jincheng; Mi Hongzhi; Wang Qian; Zhang Weijun; Lu Biao; Yang Hao; Ding Jian; Lu Yao

2001-01-01

Objective: To assess the value of ventilation-perfusion imaging in the diagnosis of pulmonary embolism (PE). Methods: Thirty consecutive patients with clinically suspected pulmonary embolism were studied, male: female 15:15, mean age was (36.2 +- 13.9) years. The chest radiograms were obtained in all 30 patients. All patients underwent radionuclide ventilation-perfusion imaging and pulmonary angiography. Results: Of the 30 patients, 22 with lobe, multiple segment or multi-subsegment perfusion defects and normal or nearly normal ventilation images were reported as PE. 20 of them were confirmed to be with PE by pulmonary angiography, 2 patients were not confirmed. Eight of 30 patients with multiple perfusion defects, ventilative abnormalities were reported as non-PE and the diagnoses were confirmed by pulmonary angiography. The sensitivity, specificity and accuracy of diagnosis of PE by ventilation-perfusion imaging was 100%, 80.0% and 93.3% respectively. Conclusions: (1) Ventilation-perfusion imaging is one of the most valuable methods in the diagnosis of PE. (2) The results suggest that pulmonary embolism can be diagnosed non-invasively in most patients on the basis of clinical manifestation, chest radiograms and ventilation-perfusion imaging findings. (3) Pulmonary angiography is required while clinical manifestation and ventilation-perfusion imaging findings are discordant with each other

Localized pulmonary crystal-storing histiocytosis complicating pulmonary mucosa-associated lymphoid tissue lymphoma presenting with multiple mass lesions.

Science.gov (United States)

Kokuho, Nariaki; Terasaki, Yasuhiro; Kunugi, Shinobu; Onda, Naomi; Urushiyama, Hirokazu; Terasaki, Mika; Hino, Mitsunori; Gemma, Akihiko; Hatori, Tsutomu; Shimizu, Akira

2017-07-01

Crystal-storing histiocytosis (CSH) is an uncommon finding in lymphoplasmacytic disorders that presents histiocytes with abnormal intralysosomal accumulations of immunoglobulin light chains as crystals of unknown etiology. A 38-year-old woman with antiphospholipid syndrome had a surgical lung biopsy because of multiple lung mass lesions. In a right middle lobe lesion, lymphoplasmacytic cells had a monocytoid appearance, destructive lymphoepithelial lesions, and positive immunoglobulin heavy chain (IGH) gene rearrangements. A right upper lobe lesion manifested proliferating rounded histiocytes with abundant, deeply eosinophilic cytoplasm and negative IGH gene rearrangements. Electron microscopy and mass spectrometry revealed a case of pulmonary CSH: abnormal proliferation of the immunoglobulin κ chain of a variable region that may be crystallized within plasma cells and histiocytes. We report a rare case of localized pulmonary CSH complicating pulmonary mucosa-associated lymphoid tissue lymphoma with multiple mass lesions. We demonstrate advances in the understanding of the pathogenesis of CSH by various analyses of these lesions. Copyright © 2017 Elsevier Inc. All rights reserved.

Stable gene transfer of CCR5 and CXCR4 siRNAs by sleeping beauty transposon system to confer HIV-1 resistance

Directory of Open Access Journals (Sweden)

Akkina Ramesh

2008-07-01

Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins

Pulmonary vascular imaging

International Nuclear Information System (INIS)

Fedullo, P.F.; Shure, D.

1987-01-01

A wide range of pulmonary vascular imaging techniques are available for the diagnostic evaluation of patients with suspected pulmonary vascular disease. The characteristics of any ideal technique would include high sensitivity and specificity, safety, simplicity, and sequential applicability. To date, no single technique meets these ideal characteristics. Conventional pulmonary angiography remains the gold standard for the diagnosis of acute thromboembolic disease despite the introduction of newer techniques such as digital subtraction angiography and magnetic resonance imaging. Improved noninvasive lower extremity venous testing methods, particularly impedance plethysmography, and ventilation-perfusion scanning can play significant roles in the noninvasive diagnosis of acute pulmonary emboli when properly applied. Ventilation-perfusion scanning may also be useful as a screening test to differentiate possible primary pulmonary hypertension from chronic thromboembolic pulmonary hypertension. And, finally, angioscopy may be a useful adjunctive technique to detect chronic thromboembolic disease and determine operability. Optimal clinical decision-making, however, will continue to require the proper interpretation of adjunctive information obtained from the less-invasive techniques, applied with an understanding of the natural history of the various forms of pulmonary vascular disease and with a knowledge of the capabilities and shortcomings of the individual techniques

Role and diagnostic value of gene variants in assessing the risk of chronic obstructive pulmonary disease.

Science.gov (United States)

Yan, Z P; Tong, X; Liu, S T; Ma, Y; Peng, S F; Yang, X; Fan, H

2016-05-13

Meta-analyses have revealed many positive associations between gene variants and susceptibility to chronic obstructive pulmonary disease (COPD). However, some of those positive results may be false positives. Therefore, we investigated the genetic polymorphisms associated with COPD risk and determined their diagnostic value. We extracted the odds ratio (OR) and 95% confidence interval for each polymorphism from published meta-analyses concerning gene variants and COPD susceptibility in October 2014, subsequently we calculated false-positive report probabilities (FPRPs) for statistically significant associations (P value value of the true positive polymorphisms of COPD using the Meta-DiSc software. Twenty-five gene polymorphisms were significantly associated with COPD risk. The FPRP test results were as follows: 1) when the prior probability was 0.001 and the OR was 1.5, ADAM33 rs612709, CHRNA3/5 rs1051730, CHRNA3/5 rs8034191, CHRNA3/5 rs16969968, and TGFB1 rs1800470 were truly associated with COPD risk (FPRP value for COPD diagnosis.

Candidate genes for chronic obstructive pulmonary disease in two large data sets

DEFF Research Database (Denmark)

Bakke, P S; Zhu, G; Gulsvik, A

2011-01-01

Lack of reproducibility of findings has been a criticism of genetic association studies in complex diseases like chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationshipsto COPD and genotyped these variants in a case......-control study which included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post bronchodilator FEV1 in percent predicted and FEV1/FVC). The polymorphisms significantly associated...... to these phenotypes in this first study were tested in a second, family based, study that included 635 pedigrees with 1910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p

Pulmonary involvement of secondary syphilis.

Science.gov (United States)

Ogawa, Yoshihiko; Imai, Yuichiro; Yoshihara, Shingo; Fujikura, Hiroyuki; Hirai, Nobuyasu; Sato, Masatoshi; Ogawa, Taku; Uno, Kenji; Kasahara, Kei; Yano, Hisakazu; Mikasa, Keiichi

2018-01-01

Pulmonary involvement in secondary syphilis is considered a rare occurrence; however, the number of cases has increased in the 2000s. This is likely due to the increased use of computed tomography scans and molecular diagnostic testing. We report a case of an HIV-positive man with pleural chest pain and bilateral subpleural nodules on chest computed tomography. His rapid plasma reagin and Treponema pallidum hemagglutination tests were positive, and the specimen of one of the pulmonary nodules obtained by transthoracic biopsy was positive for the polA gene of Treponema pallidum. Since clinical manifestations of syphilis are highly variable, clinicians should bear in mind that pleural chest pain with bilateral subpleural nodules can be caused by pulmonary syphilis.

The Caenorhabditis chemoreceptor gene families

OpenAIRE

Robertson Hugh M; Thomas James H

2008-01-01

Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

Antitrypsin and chronic obstructive pulmonary disease among Japanese-American men.

Science.gov (United States)

Roberts, A; Kagan, A; Rhoads, G G; Pierce, J A; Bruce, R M

1977-10-01

A total of 161 patients with chronic obstructive pulmonary disease (COPD) plus 100 control subjects (identified during a study of heart disease in 6,860 Japanese-American men aged 52 to 75 years who were residing in Hawaii) were analyzed for phenotype in search of the antitrypsin gene Z, which has been shown to be associated with pulmonary emphysema in other racial groups. No carriers of the Z gene were found, and the question of whether the rarity or absence of this gene relates to a low frequency of COPD among Japanese-Americans is reviewed.

MCP1 haplotypes associated with protection from pulmonary tuberculosis

Directory of Open Access Journals (Sweden)

Owusu-Dabo Ellis

2011-04-01

Full Text Available Abstract Background The monocyte chemoattractant protein 1 (MCP-1 is involved in the recruitment of lymphocytes and monocytes and their migration to sites of injury and cellular immune reactions. In a Ghanaian tuberculosis (TB case-control study group, associations of the MCP1 -362C and the MCP1 -2581G alleles with resistance to TB were recently described. The latter association was in contrast to genetic effects previously described in study groups originating from Mexico, Korea, Peru and Zambia. This inconsistency prompted us to further investigate the MCP1 gene in order to determine causal variants or haplotypes genetically and functionally. Results A 14 base-pair deletion in the first MCP1 intron, int1del554-567, was strongly associated with protection against pulmonary TB (OR = 0.84, CI 0.77-0.92, Pcorrected = 0.00098. Compared to the wildtype combination, a haplotype comprising the -2581G and -362C promoter variants and the intronic deletion conferred an even stronger protection than did the -362C variant alone (OR = 0.78, CI 0.69-0.87, Pnominal = 0.00002; adjusted Pglobal = 0.0028. In a luciferase reporter gene assay, a significant reduction of luciferase gene expression was observed in the two constructs carrying the MCP1 mutations -2581 A or G plus the combination -362C and int1del554-567 compared to the wildtype haplotype (P = 0.02 and P = 0.006. The associated variants, in particular the haplotypes composed of these latter variants, result in decreased MCP-1 expression and a decreased risk of pulmonary TB. Conclusions In addition to the results of the previous study of the Ghanaian TB case-control sample, we have now identified the haplotype combination -2581G/-362C/int1del554-567 that mediates considerably stronger protection than does the MCP1 -362C allele alone (OR = 0.78, CI 0.69-0.87 vs OR = 0.83, CI 0.76-0.91. Our findings in both the genetic analysis and the reporter gene study further indicate a largely negligible role of the

Genetic influences on chronic obstructive pulmonary disease - a twin study

DEFF Research Database (Denmark)

Sylvan Ingebrigtsen, Truls; Thomsen, Simon Francis; Vestbo, Jørgen

2010-01-01

Genes that contribute to the risk of developing Chronic Obstructive Pulmonary Disease (COPD) have been identified, but an attempt to accurately quantify the total genetic contribution to COPD has to our knowledge never been conducted.......Genes that contribute to the risk of developing Chronic Obstructive Pulmonary Disease (COPD) have been identified, but an attempt to accurately quantify the total genetic contribution to COPD has to our knowledge never been conducted....

Pulmonary microRNA profiling: implications in upper lobe predominant lung disease.

Science.gov (United States)

Armstrong, David A; Nymon, Amanda B; Ringelberg, Carol S; Lesseur, Corina; Hazlett, Haley F; Howard, Louisa; Marsit, Carmen J; Ashare, Alix

2017-01-01

Numerous pulmonary diseases manifest with upper lobe predominance including cystic fibrosis, smoking-related chronic obstructive pulmonary disease, and tuberculosis. Zonal hypoxia, characteristic of these pulmonary maladies, and oxygen stress in general is known to exert profound effects on various important aspects of cell biology. Lung macrophages are major participants in the pulmonary innate immune response and regional differences in macrophage responsiveness to hypoxia may contribute in the development of lung disease. MicroRNAs are ubiquitous regulators of human biology and emerging evidence indicates altered microRNA expression modulates respiratory disease processes. The objective of this study is to gain insight into the epigenetic and cellular mechanisms influencing regional differences in lung disease by investigating effect of hypoxia on regional microRNA expression in the lung. All studies were performed using primary alveolar macrophages ( n  = 10) or bronchoalveolar lavage fluid ( n  = 16) isolated from human subjects. MicroRNA was assayed via the NanoString nCounter microRNA assay. Divergent molecular patterns of microRNA expression were observed in alternate lung lobes, specifically noted was disparate expression of miR-93 and miR-4454 in alveolar macrophages along with altered expression of miR-451a and miR-663a in bronchoalveolar lavage fluid. Gene ontology was used to identify potential downstream targets of divergent microRNAs. Targets include cytokines and matrix metalloproteinases, molecules that could have a significant impact on pulmonary inflammation and fibrosis. Our findings show variant regional microRNA expression associated with hypoxia in alveolar macrophages and BAL fluid in the lung-upper vs lower lobe. Future studies should address whether these specific microRNAs may act intracellularly, in a paracrine/endocrine manner to direct the innate immune response or may ultimately be involved in pulmonary host-to-pathogen trans

Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

Directory of Open Access Journals (Sweden)

Yusuke Ohnishi

Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

Discovery of cancer common and specific driver gene sets

Science.gov (United States)

2017-01-01

Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295

Candidate gene analysis and identification of TRAP and SSR markers linked to the Or5 gene, which confers sunflower resistance to race E of broomrape (Orobanche cumana Wallr.)

Science.gov (United States)

Sunflower broomrape (Orobanche cumana Wallr.) is a root holoparasitic angiosperm considered as being one of the major constraints for sunflower production in Mediterranean areas. Breeding for resistance has been crucial for protecting sunflowers from broomrape damage. The Or5 gene, which confers re...

Pulmonary alveolar microlithiasis

International Nuclear Information System (INIS)

Vallejo, Franco Javier; Vallejo, Alejandro; Parra, Maximiliano

2007-01-01

Pulmonary alveolar microlithiasis (PAM) is a rare disease characterized by the diffuse and bilateral presence of calcium phosphate microlite in the alveolar spaces. The progression of this potentially lethal disease is show and most of the patients remain asymptomatic during years or decades, resulting in a show deterioration of the pulmonary function. The typical finding of the sand storm in the chest X-ray is characteristic of this entity. Mutations in the SLC34A2 gene that does the coding for the type II co-transporter of sodium phosphate were identified as responsible for this disease. Of the almost 600 cases, only 6 have been reported in Colombia. We are presenting a case of pulmonary alveolar microlite in a 27 year old man, with progressive respiratory distress whose diagnosis was made by the X-ray findings and confirmed by trans bronchial biopsy. In the 2 years follow-up, shows evolution towards deterioration of his respiratory function making him a candidate for lung transplantation.

Nilai Diagnostik Metode “Real Time” PCR GeneXpert pada TB Paru BTA Negatif

Directory of Open Access Journals (Sweden)

Eka Kurniawan

2016-09-01

description of TB and it’s depend on doctor's decision, so this can lead to under or over-diagnosis. Molecular examination with real time PCR method of GeneXpert is a breakthrough invention to diagnose TB quickly. The objective of this study was to assess the validity of GeneXpert in smear negative pulmonary TB and it’s compared with Loweinstein Jensen culture. Study design was diagnostic test with cross sectional study. Research conducted on 40 patients with smear negative pulmonary TB in public health centers around the city of Padang and the patients who were treated at the Internal Medicine department of dr. M. Djamil hospital Padang. Sputum examination conducted by GeneXpert compared with Loweinstein Jensen culture. Diagnostic value of GeneXpert for diagnosing smear negative pulmonary tuberculosis are sensitivity 83.33%, specificity 95.46%, positive predictive value 93.75%, negative predictive value 87.5% and accuracy 90%. Kappa value is 0.796. GeneXpert has a high sensitivity, specificity, positive predictive value, negative predictive value and accuracy on smear negative pulmonary tuberculosis.Keywords: diagnostic value, smear negative pulmonary tuberculosis, GeneXpert

Imaging features of diffuse pulmonary hemorrhage

International Nuclear Information System (INIS)

Schmit, M.; Vogel, W.; Horger, M.

2006-01-01

There are diverse etiologies of diffuse pulmonary hemorrhage, so specific diagnosis may be difficult. Conventional radiography tends to be misleading as hemoptysis may lacking in patients with hemorrhagic anemia. Diffuse pulmonary hemorrhage should be differentiated from focal pulmonary hemorrhage resulting from chronic bronchitis, bronchiectasis, active infection (tuberculosis) neoplasia, trauma, or embolism. (orig.)

Pulmonary Hypertension

Science.gov (United States)

Kim, John S.; McSweeney, Julia; Lee, Joanne; Ivy, Dunbar

2015-01-01

Objective Review the pharmacologic treatment options for pulmonary arterial hypertension (PAH) in the cardiac intensive care setting and summarize the most-recent literature supporting these therapies. Data Sources and Study Selection Literature search for prospective studies, retrospective analyses, and case reports evaluating the safety and efficacy of PAH therapies. Data Extraction Mechanisms of action and pharmacokinetics, treatment recommendations, safety considerations, and outcomes for specific medical therapies. Data Synthesis Specific targeted therapies developed for the treatment of adult patients with PAH have been applied for the benefit of children with PAH. With the exception of inhaled nitric oxide, there are no PAH medications approved for children in the US by the FDA. Unfortunately, data on treatment strategies in children with PAH are limited by the small number of randomized controlled clinical trials evaluating the safety and efficacy of specific treatments. The treatment options for PAH in children focus on endothelial-based pathways. Calcium channel blockers are recommended for use in a very small, select group of children who are responsive to vasoreactivity testing at cardiac catheterization. Phosphodiesterase type 5 inhibitor therapy is the most-commonly recommended oral treatment option in children with PAH. Prostacyclins provide adjunctive therapy for the treatment of PAH as infusions (intravenous and subcutaneous) and inhalation agents. Inhaled nitric oxide is the first line vasodilator therapy in persistent pulmonary hypertension of the newborn, and is commonly used in the treatment of PAH in the Intensive Care Unit (ICU). Endothelin receptor antagonists have been shown to improve exercise tolerance and survival in adult patients with PAH. Soluble Guanylate Cyclase Stimulators are the first drug class to be FDA approved for the treatment of chronic thromboembolic pulmonary hypertension. Conclusions Literature and data supporting the

Host lung immunity is severely compromised during tropical pulmonary eosinophilia: role of lung eosinophils and macrophages.

Science.gov (United States)

Sharma, Pankaj; Sharma, Aditi; Vishwakarma, Achchhe Lal; Agnihotri, Promod Kumar; Sharma, Sharad; Srivastava, Mrigank

2016-04-01

Eosinophils play a central role in the pathogenesis of tropical pulmonary eosinophilia, a rare, but fatal, manifestation of filariasis. However, no exhaustive study has been done to identify the genes and proteins of eosinophils involved in the pathogenesis of tropical pulmonary eosinophilia. In the present study, we established a mouse model of tropical pulmonary eosinophilia that mimicked filarial manifestations of human tropical pulmonary eosinophilia pathogenesis and used flow cytometry-assisted cell sorting and real-time RT-PCR to study the gene expression profile of flow-sorted, lung eosinophils and lung macrophages during tropical pulmonary eosinophilia pathogenesis. Our results show that tropical pulmonary eosinophilia mice exhibited increased levels of IL-4, IL-5, CCL5, and CCL11 in the bronchoalveolar lavage fluid and lung parenchyma along with elevated titers of IgE and IgG subtypes in the serum. Alveolar macrophages from tropical pulmonary eosinophilia mice displayed decreased phagocytosis, attenuated nitric oxide production, and reduced T-cell proliferation capacity, and FACS-sorted lung eosinophils from tropical pulmonary eosinophilia mice upregulated transcript levels of ficolin A and anti-apoptotic gene Bcl2,but proapoptotic genes Bim and Bax were downregulated. Similarly, flow-sorted lung macrophages upregulated transcript levels of TLR-2, TLR-6, arginase-1, Ym-1, and FIZZ-1 but downregulated nitric oxide synthase-2 levels, signifying their alternative activation. Taken together, we show that the pathogenesis of tropical pulmonary eosinophilia is marked by functional impairment of alveolar macrophages, alternative activation of lung macrophages, and upregulation of anti-apoptotic genes by eosinophils. These events combine together to cause severe lung inflammation and compromised lung immunity. Therapeutic interventions that can boost host immune response in the lungs might thus provide relief to patients with tropical pulmonary eosinophilia. �

Importance of polymerase chain reaction in diagnosis of pulmonary and extra-pulmonary tuberculosis

International Nuclear Information System (INIS)

Iqbal, S.; Ahmed, R.; Adhami, S.U.Z.

2011-01-01

Pakistan ranks eighth on the list of 22 high-burden tuberculosis (TB) countries in the world according to the World Health Organisation's (WHO) Global Tuberculosis Control 2009. Including other reasons the main cause is improper and late diagnosis of the disease. PCR may play an important role to control the disease with its rapid, sensitive and specific diagnosis. But in Pakistan due to lake of knowledge about this latest technique we are not using this technique appropriately. Clinicians still trust on conventional methods of TB diagnosis, which are time consuming or insensitive. The present study was arranged to highlight the importance of PCR in TB diagnosis in pulmonary and extra-pulmonary cases and its comparison with conventional methods. Methods: Samples obtained from 290 patients of suspected TB (pulmonary or extra-pulmonary) were subjected to ZN smear examination, LJ medium culture and PCR test by amplifying 541 bp fragment of Mycobacterium tuberculosis complex genome. The present prospective study is performed at Shalamar Hospital Lahore from November 2008 to November 2010. Results: A distinctly difference was observed in the test results done by PCR and other conventional techniques in pulmonary or extra-pulmonary tuberculosis samples (p<0.001). The sensitivity of different tests was 68.62% for PCR, 26.90% for LJ medium culture, and 14.14% for ZN smear examination (p<0.05). However, there was no significant difference between different tests as for as specificity was concerned. PCR test sensitivity in pulmonary and extra-pulmonary clinical samples was 78.34 and 61.76% respectively, being significantly higher (p<0.05) when compared with sensitivity of other tests. The mean detection time for M. tuberculosis was 25 days by LJ medium culture and less than 1 day by smear examination and PCR test. Conclusion: PCR test is more sensitive than ZN smear examination and LJ medium culture for the diagnosis of TB in pulmonary and extra-pulmonary clinical samples

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

TNFA-863 polymorphism is associated with a reduced risk of Chronic Obstructive Pulmonary Disease: A replication study

Directory of Open Access Journals (Sweden)

Medina-Coello Chaxiraxi

2011-10-01

Full Text Available Background TNF-α mediated inflammation is thought to play a key role in the respiratory and systemic features of Chronic Obstructive Pulmonary Disease. The aim of the present study was to replicate and extend recent findings in Taiwanese and Caucasian populations of associations between COPD susceptibility and variants of the TNFA gene in a Spanish cohort. Methods The 3 reported SNPs were complemented with nine tag single nucleotide polymorphisms (SNP of the TNFA and LTA genes and genotyped in 724 individuals (202 COPD patients, 90 smokers without COPD and 432 healthy controls. Pulmonary function parameters and serum inflammatory markers were also measured in COPD patients. Results The TNFA rs1800630 (-863C/A SNP was associated with a lower COPD susceptibility (ORadj = 0.50, 95% CI = 0.33-0.77, p = 0.001. The -863A allele was also associated with less severe forms of the disease (GOLD stages I and II (ORadj = 0.303, 95%CI = 0.14-0.65, p = 0.014 and with lower scores of the BODE index (1 percent predicted (p = 0.004 and a lower BODE index (p = 0.003 over a 2 yrs follow-up period. None of the TNFA or LTA gene variants correlated with the serum inflammatory markers in COPD patients (p > 0.05. Conclusions We replicated the previously reported association between the TNFA -863 SNP and COPD. TNFA -863A allele may confer a protective effect to the susceptibility to the disease in the Spanish population.

Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA.

Science.gov (United States)

Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J

2013-05-01

FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.

Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

Science.gov (United States)

Bandaranayake, Pradeepa C G; Yoder, John I

2013-05-01

Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

Specific detection of Aspergillus fumigatus in sputum sample of ...

African Journals Online (AJOL)

We developed a two-step PCR assay that specifically amplifies a region of the 18S rRNA gene that is highly conserved in Aspergillus fumigatus. This assay allows direct and rapid detection of down to 10 fg of Aspergillus fumigatus DNA corresponding to 1 to 5 colony forming unit (CFU) per ml of sputum sample of pulmonary ...

Molecular Mechanisms of Nanosized Titanium Dioxide–Induced Pulmonary Injury in Mice

Science.gov (United States)

Sang, Xuezi; Cui, Yaling; Wang, Xiaochun; Gui, Suxin; Tan, Danlin; Zhu, Min; Zhao, Xiaoyang; Sheng, Lei; Wang, Ling; Hong, Fashui; Tang, Meng

2013-01-01

The pulmonary damage induced by nanosized titanium dioxide (nano-TiO2) is of great concern, but the mechanism of how this damage may be incurred has yet to be elucidated. Here, we examined how multiple genes may be affected by nano-TiO2 exposure to contribute to the observed damage. The results suggest that long-term exposure to nano-TiO2 led to significant increases in inflammatory cells, and levels of lactate dehydrogenase, alkaline phosphate, and total protein, and promoted production of reactive oxygen species and peroxidation of lipid, protein and DNA in mouse lung tissue. We also observed nano-TiO2 deposition in lung tissue via light and confocal Raman microscopy, which in turn led to severe pulmonary inflammation and pneumonocytic apoptosis in mice. Specifically, microarray analysis showed significant alterations in the expression of 847 genes in the nano-TiO2-exposed lung tissues. Of 521 genes with known functions, 361 were up-regulated and 160 down-regulated, which were associated with the immune/inflammatory responses, apoptosis, oxidative stress, the cell cycle, stress responses, cell proliferation, the cytoskeleton, signal transduction, and metabolic processes. Therefore, the application of nano-TiO2 should be carried out cautiously, especially in humans. PMID:23409001

Pleural subxyphoid drain confers better pulmonary function and clinical outcomes in chronic obstructive pulmonary disease after off-pump coronary artery bypass grafting: a randomized controlled trial.

Science.gov (United States)

Guizilini, Solange; Viceconte, Marcela; Esperança, Gabriel Tavares da M; Bolzan, Douglas W; Vidotto, Milena; Moreira, Rita Simone L; Câncio, Andréia Azevedo; Gomes, Walter J

2014-01-01

To evaluate the lung function and clinical outcome in severe chronic obstructive pulmonary disease in patients undergoing off-pump coronary artery bypass grafting with left internal thoracic artery graft, comparing the pleural drain insertion in the intercostal versus subxyphoid region. A randomized controlled trial. Chronic obstructive pulmonary disease patients were randomized into two groups according pleural drain site: II group (n=27) - pleural drain in intercostal space; SI group (n=29) - pleural drain in the subxyphoid region. Spirometry values (Forced Vital Capacity - and Forced expiratory volume in 1 second) were obtained on preoperative and 1, 3 and 5 postoperative days. Chest x-ray from preoperative until postoperative day 5 (POD5) was performed for monitoring respiratory events, such as atelectasis and pleural effusion. Pulmonary shunt fraction and pain score was evaluate preoperatively and on postoperative day 1. In both groups there was a significant decrease of the spirometry values (Forced Vital Capacity and Forced expiratory volume in 1 second) until POD5 (Ppleural drainage in severe Chronic obstructive pulmonary disease patients determined better preservation and recovery of pulmonary capacity and volumes with lower pulmonary shunt fraction and better clinical outcomes on early postoperative off-pump coronary artery bypass grafting.

Dissecting specific and global transcriptional regulation of bacterial gene expression

NARCIS (Netherlands)

Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

Science.gov (United States)

Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

2017-09-01

Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

Characterization of proximal pulmonary arterial cells from chronic thromboembolic pulmonary hypertension patients

Directory of Open Access Journals (Sweden)

Quarck Rozenn

2012-03-01

Full Text Available Abstract Background Chronic thromboembolic pulmonary hypertension (CTEPH is associated with proximal pulmonary artery obstruction and vascular remodeling. We hypothesized that pulmonary arterial smooth muscle (PASMC and endothelial cells (PAEC may actively contribute to remodeling of the proximal pulmonary vascular wall in CTEPH. Our present objective was to characterize PASMC and PAEC from large arteries of CTEPH patients and investigate their potential involvement in vascular remodeling. Methods Primary cultures of proximal PAEC and PASMC from patients with CTEPH, with non-thromboembolic pulmonary hypertension (PH and lung donors have been established. PAEC and PASMC have been characterized by immunofluorescence using specific markers. Expression of smooth muscle specific markers within the pulmonary vascular wall has been studied by immunofluorescence and Western blotting. Mitogenic activity and migratory capacity of PASMC and PAEC have been investigated in vitro. Results PAEC express CD31 on their surface, von Willebrand factor in Weibel-Palade bodies and take up acetylated LDL. PASMC express various differentiation markers including α-smooth muscle actin (α-SMA, desmin and smooth muscle myosin heavy chain (SMMHC. In vascular tissue from CTEPH and non-thromboembolic PH patients, expression of α-SMA and desmin is down-regulated compared to lung donors; desmin expression is also down-regulated in vascular tissue from CTEPH compared to non-thromboembolic PH patients. A low proportion of α-SMA positive cells express desmin and SMMHC in the neointima of proximal pulmonary arteries from CTEPH patients. Serum-induced mitogenic activity of PAEC and PASMC, as well as migratory capacity of PASMC, were increased in CTEPH only. Conclusions Modified proliferative and/or migratory responses of PASMC and PAEC in vitro, associated to a proliferative phenotype of PASMC suggest that PASMC and PAEC could contribute to proximal vascular remodeling in CTEPH.

Out of proportion pulmonary hypertension in obstructive lung diseases.

Science.gov (United States)

Chatterjee, Kshitij; Tarawneh, Ahmad R; Alam, Shoaib

2018-03-01

Pulmonary hypertension is common (25-90%) in chronic obstructive pulmonary diseases (COPDs). Severe pulmonary hypertension, however, is quite rare (1-3%). The term 'out of proportion' pulmonary hypertension is still widely used. New guidelines instead propose to use the term 'Severe pulmonary hypertension' if mean pulmonary arterial pressure at least 35 mmHg or cardiac index (CI) is less than 2.0 l/min/m on right heart catheterization (RHC). Why only a minority of COPD patients develop severe pulmonary hypertension is unclear. When present, severe pulmonary hypertension in COPD is associated with increased dyspnea and decreased survival and often does not closely correlate with degree of obstructive abnormality on pulmonary function testing. COPD patients with severe pulmonary hypertension experience circulatory limitation at maximum exercise, and not ventilatory limitation, which is typical for moderate-to-severe COPD patients with no or moderate pulmonary hypertension. There is no conclusive evidence to support or completely reject the possibility of the use of specific pulmonary arterial hypertension (PAH) therapies in pulmonary hypertension associated with COPD. In mild-to-moderate COPD patients who have severe and progressive symptoms, and have evidence of severe pulmonary hypertension on RHC, specific PAH therapies may be used similar to WHO group-I PAH guidelines.

Description of electrophoretic loci and tissue specific gene ...

African Journals Online (AJOL)

Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.

Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.

Science.gov (United States)

Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy

2017-12-01

Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.

High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

Directory of Open Access Journals (Sweden)

Clark Taane G

2010-04-01

Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes

Pleural subxyphoid drain confers better pulmonary function and clinical outcomes in chronic obstructive pulmonary disease after off-pump coronary artery bypass grafting: a randomized controlled trial

Directory of Open Access Journals (Sweden)

Solange Guizilini

2014-12-01

Full Text Available Objective: To evaluate the lung function and clinical outcome in severe chronic obstructive pulmonary disease in patients undergoing off-pump coronary artery bypass grafting with left internal thoracic artery graft, comparing the pleural drain insertion in the intercostal versus subxyphoid region. Methods: A randomized controlled trial. Chronic obstructive pulmonary disease patients were randomized into two groups according pleural drain site: II group (n=27 - pleural drain in intercostal space; SI group (n=29 - pleural drain in the subxyphoid region. Spirometry values (Forced Vital Capacity - and Forced expiratory volume in 1 second were obtained on preoperative and 1, 3 and 5 postoperative days. Chest x-ray from preoperative until postoperative day 5 (POD5 was performed for monitoring respiratory events, such as atelectasis and pleural effusion. Pulmonary shunt fraction and pain score was evaluate preoperatively and on postoperative day 1. Results: In both groups there was a significant decrease of the spirometry values (Forced Vital Capacity and Forced expiratory volume in 1 second until POD5 (P<0.05. However, when compared, SI group presented less decrease in these parameters (P<0.05. Pulmonary shunt fraction was significantly lower in SI group (P<0.05. Respiratory events, pain score, orotracheal intubation time and postoperative length of hospital stay were lower in the SI group (P<0.05. Conclusion: Subxyphoid pleural drainage in severe Chronic obstructive pulmonary disease patients determined better preservation and recovery of pulmonary capacity and volumes with lower pulmonary shunt fraction and better clinical outcomes on early postoperative off-pump coronary artery bypass grafting.

MsZEP, a novel zeaxanthin epoxidase gene from alfalfa (Medicago sativa), confers drought and salt tolerance in transgenic tobacco.

Science.gov (United States)

Zhang, Zhiqiang; Wang, Yafang; Chang, Leqin; Zhang, Tong; An, Jie; Liu, Yushi; Cao, Yuman; Zhao, Xia; Sha, Xuyang; Hu, Tianming; Yang, Peizhi

2016-02-01

The zeaxanthin epoxidase gene ( MsZEP ) was cloned and characterized from alfalfa and validated for its function of tolerance toward drought and salt stresses by heterologous expression in Nicotiana tabacum. Zeaxanthin epoxidase (ZEP) plays important roles in plant response to various environment stresses due to its functions in ABA biosynthetic and the xanthophyll cycle. To understand the expression characteristics and the biological functions of ZEP in alfalfa (Medicago sativa), a novel gene, designated as MsZEP (KM044311), was cloned, characterized and overexpressed in Nicotiana tabacum. The open reading frame of MsZEP contains 1992 bp nucleotides and encodes a 663-amino acid polypeptide. Amino acid sequence alignment indicated that deduced MsZEP protein was highly homologous to other plant ZEP sequences. Phylogenetic analysis showed that MsZEP was grouped into a branch with other legume plants. Real-time quantitative PCR revealed that MsZEP gene expression was clearly tissue-specific, and the expression levels were higher in green tissues (leaves and stems) than in roots. MsZEP expression decreased in shoots under drought, cold, heat and ABA treatment, while the expression levels in roots showed different trends. Besides, the results showed that nodules could up-regulate the MsZEP expression under non-stressful conditions and in the earlier stage of different abiotic stress. Heterologous expression of the MsZEP gene in N. tabacum could confer tolerance to drought and salt stress by affecting various physiological pathways, ABA levels and stress-responsive genes expression. Taken together, these results suggested that the MsZEP gene may be involved in alfalfa responses to different abiotic stresses and nodules, and could enhance drought and salt tolerance of transgenic tobacco by heterologous expression.

Circulating microparticles in severe pulmonary arterial hypertension increase intercellular adhesion molecule-1 expression selectively in pulmonary artery endothelium

Directory of Open Access Journals (Sweden)

Leslie A. Blair

2016-10-01

Full Text Available Abstract Background Microparticles (MPs stimulate inflammatory adhesion molecule expression in systemic vascular diseases, however it is unknown whether circulating MPs stimulate localized ICAM-1 expression in the heterogeneically distinct pulmonary endothelium during pulmonary arterial hypertension (PAH. Pulmonary vascular lesions with infiltrating inflammatory cells in PAH form in the pulmonary arteries and arterioles, but not the microcirculation. Therefore, we sought to determine whether circulating MPs from PAH stimulate pulmonary artery endothelial cell-selective ICAM-1 expression. Results Pulmonary artery endothelial cells (PAECs were exposed to MPs isolated from the circulation of a rat model of severe PAH. During late-stage (8-weeks PAH, but not early-stage (3-weeks, an increase in ICAM-1 was observed. To determine whether PAH MP-induced ICAM-1 was selective for a specific segment of the pulmonary circulation, pulmonary microvascular endothelial cells (PMVECs were exposed to late-stage PAH MPs and no increase in ICAM-1 was detected. A select population of circulating MPs, the late-stage endoglin + MPs, were used to assess their ability to stimulate ICAM-1 and it was determined that the endoglin + MPs were sufficient to promote ICAM-1 increases in the whole cell, but not surface only expression. Conclusions Late-stage, but not early-stage, MPs in a model of severe PAH selectively induce ICAM-1 in pulmonary artery endothelium, but not pulmonary microcirculation. Further, the selected endoglin + PAH MPs, but not endoglin + MPs from control, are sufficient to promote whole cell ICAM-1 in PAECs. The implications of this work are that MPs in late-stage PAH are capable of inducing ICAM-1 expression selectively in the pulmonary artery. ICAM-1 likely plays a significant role in the observed inflammatory cell recruitment, specifically to vascular lesions in the pulmonary artery and not the pulmonary microcirculation.

Evolutionary constraints shape caste-specific gene expression across 15 ant species.

Science.gov (United States)

Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki

2017-05-01

Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

New frontier in regenerative medicine: site-specific gene correction in patient-specific induced pluripotent stem cells.

Science.gov (United States)

Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C

2013-06-01

Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.

Rat Models of Cardiovascular Disease Demonstrate Distinctive Pulmonary Gene Expressions for Vascular Response Genes: Impact of Ozone Exposure

Science.gov (United States)

Comparative gene expression profiling of multiple tissues from rat strains with genetic predisposition to diverse cardiovascular diseases (CVD) can help decode the transcriptional program that governs organ-specific functions. We examined expressions of CVD genes in the lungs of ...

Enhanced magnetic resonance pulmonary perfusion imaging in diagnosing pulmonary embolism: preliminary investigation

International Nuclear Information System (INIS)

Huang Xiaoyong; Du Jing; Zhang Zhaoqi; Guo Xi; Yan Zixu; Jiang Hong; Wang Wei

2005-01-01

Objective: This study was designed to investigate the sensitivity and specificity of magnetic resonance pulmonary perfusion imaging (MRPP) in diagnosing pulmonary embolism (PE) compared with enhanced magnetic resonance pulmonary angiography (MRPA) and pulmonary radionuclide perfusion imaging. Methods: Fourteen patients were definitely diagnosed as PE, whose ages were from 19 to 71 years old and mean 45.5 ± 19.8 years old. All patients under went MRPA and MRPP and 3 patients were examined again after thrombolytic treatment. Five patients underwent pulmonary radionuclide perfusion imaging. Setting ROI in top, middle, bottom of lung area and abnormal area respectively, we detected signal intensity and time-signal curve to obtain the transformation rate of signal (TROS) during perfusion peak value. Results: In 14 pulmonary embolism patients, MRPA found 62 branches of pulmonary artery obstruction. Fifty-five abnormal pulmonary perfusion zones were found by MRPP, and the above results were very alike. The coincidence was 88.71%. In 14 cases, MRPP could show 25 subsegments lesion below segments. In 5 patients who had both results Of MRPP and ECT at the same time. MRPP shows 33 perfusion defect zones and 37 segments were found by ECT, the sensitivity was 89.19%. After thrombolytic treatment, both the status of the affected pulmonary artery improved markedly and perfusion defect zones reduced obviously in 3 cases by MRPP and MRPA. TROS in normal perfusion zones perfusion defect zones and low perfusion zones had significant difference (t=22.882, P<0.01). Conclusion: Contrast enhanced MR pulmonary perfusion can show both perfusion defect zones and low perfusion zones in pulmonary embolism. Time-signal curve can show the period of maximum no perfusion zones in pulmonary artery embolism zones. And the amplitude of fluctuation is small with miminum TROS. MRPP has significant values especially in showing pulmonary artery embolism in segments and subsegments. Using both MRPP and

Organization, execution and evaluation of the 2014 Academic Emergency Medicine consensus conference on Gender-Specific Research in Emergency Care - an executive summary.

Science.gov (United States)

Safdar, Basmah; Greenberg, Marna R

2014-12-01

With the goal of reducing inequalities in patient care, the 2014 Academic Emergency Medicine (AEM) consensus conference, "Gender-Specific Research in Emergency Care: Investigate, Understand, and Translate How Gender Affects Patient Outcomes," convened a diverse group of researchers, clinicians, health care providers, patients, and representatives of federal agencies and policy-makers in Dallas, Texas, in May 2014. The executive and steering committees identified seven clinical domains as key to gender-specific emergency care: cardiovascular, neurological, trauma/injury, substance abuse, pain, mental health, and diagnostic imaging. The main aims of the conference were to: 1) summarize and consolidate current data related to sex- and gender-specific research for acute care and identify critical gender-related gaps in knowledge to inform an EM research agenda; 2) create a consensus-driven research agenda that advances sex- and gender-specific research in the prevention, diagnosis, and management of acute diseases and identify strategies to investigate them; and 3) build a multinational interdisciplinary consortium to disseminate and study the sex and gender medicine of acute conditions. Over a 2-year period, this collaborative network of stakeholders identified key areas where sex- and gender-specific research is most likely to improve clinical care and ultimately patient outcomes. The iterative consensus process culminated in a daylong conference on May 13, 2014, with a total of 133 registrants, with the majority being between ages 31 and 50 years (57%), females (71%), and whites (79%). Content experts led the consensus-building workshops at the conference and used the nominal group technique to consolidate consensus recommendations for priority research. In addition, panel sessions addressed funding mechanisms for gender-specific research as well as gender-specific regulatory challenges to product development and approval. This special issue of AEM reports the

Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.

Science.gov (United States)

Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong

2016-05-20

Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

Identification of the two rotavirus genes determining neutralization specificities

International Nuclear Information System (INIS)

Offit, P.A.; Blavat, G.

1986-01-01

Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities

Identification of the two rotavirus genes determining neutralization specificities

Energy Technology Data Exchange (ETDEWEB)

Offit, P.A.; Blavat, G.

1986-01-01

Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.

Transcriptional Profiling Identifies Location-Specific and Breed-Specific Differentially Expressed Genes in Embryonic Myogenesis in Anas Platyrhynchos.

Directory of Open Access Journals (Sweden)

Rong-Ping Zhang

Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only

Pulmonary Hypertension in the Intensive Care Unit.

Science.gov (United States)

Jentzer, Jacob C; Mathier, Michael A

2016-07-01

Pulmonary hypertension occurs as the result of disease processes increasing pressure within the pulmonary circulation, eventually leading to right ventricular failure. Patients may become critically ill from complications of pulmonary hypertension and right ventricular failure or may develop pulmonary hypertension as the result of critical illness. Diagnostic testing should evaluate for common causes such as left heart failure, hypoxemic lung disease and pulmonary embolism. Relatively few patients with pulmonary hypertension encountered in clinical practice require specific pharmacologic treatment of pulmonary hypertension targeting the pulmonary vasculature. Management of right ventricular failure involves optimization of preload, maintenance of systemic blood pressure and augmentation of inotropy to restore systemic perfusion. Selected patients may require pharmacologic therapy to reduce right ventricular afterload by directly targeting the pulmonary vasculature, but only after excluding elevated left heart filling pressures and confirming increased pulmonary vascular resistance. Critically-ill patients with pulmonary hypertension remain at high risk of adverse outcomes, requiring a diligent and thoughtful approach to diagnosis and treatment. © The Author(s) 2015.

Study on Fusion Protein and Its gene in Baculovirus Specificity

International Nuclear Information System (INIS)

Nemr, W.A.H.

2012-01-01

Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at

9. international mouse genome conference

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-12-31

This conference was held November 12--16, 1995 in Ann Arbor, Michigan. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on genetic mapping in mice. This report contains abstracts of presentations, focusing on the following areas: mutation identification; comparative mapping; informatics and complex traits; mutagenesis; gene identification and new technology; and genetic and physical mapping.

Transcriptional activation of a MYB gene controls the tissue-specific anthocyanin accumulation in a purple cauliflower mutant

Science.gov (United States)

Flavonoids such as anthocyanins possess significant health benefits to humans and play important physiological roles in plants. An interesting Purple gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving intense purple color in very young leaves, curds, and see...

Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

Science.gov (United States)

Wai, T; Grumet, R

1995-09-01

The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

The Caenorhabditis chemoreceptor gene families

Directory of Open Access Journals (Sweden)

Robertson Hugh M

2008-10-01

Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

The Caenorhabditis chemoreceptor gene families.

Science.gov (United States)

Thomas, James H; Robertson, Hugh M

2008-10-06

Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

Pulmonary hypertension associated with left-sided heart disease.

Science.gov (United States)

Maeder, Micha Tobias; Schoch, Otto D; Kleiner, Rebekka; Joerg, Lucas; Weilenmann, Daniel; Swiss Society For Pulmonary Hypertension

2017-01-19

Pulmonary hypertension associated with left-sided heart disease (PH-LHD) is the most common type of pulmonary hypertension. In patients with left-sided heart disease, the presence of pulmonary hypertension is typically a marker of more advanced disease, more severe symptoms, and worse prognosis. In contrast to pulmonary arterial hypertension, PH-LHD is characterised by an elevated pulmonary artery wedge pressure (postcapillary pulmonary hypertension) without or with an additional precapillary component (isolated postcapillary versus combined postcapillary and precapillary pulmonary hypertension). Transthoracic echocardiography is the primary nonin-vasive imaging tool to estimate the probability of pulmonary hypertension and to establish a working diagnosis on the mechanism of pulmonary hyperten-sion. However, right heart catheterisation is always required if significant pulmonary hypertension is sus-pected and exact knowledge of the haemodynamic constellation is necessary. The haemodynamic con-stellation (mean pulmonary artery pressure, mean pulmonary artery wedge pressure, left ventricular end-diastolic pressure) in combination with clinical infor-mation and imaging findings (mainly echocardiog-raphy, coronary angiography and cardiac magnetic resonance imaging) will usually allow the exact mech-anism underlying PH-LHD to be defined, which is a prerequisite for appropriate treatment. The general principle for the management of PH-LHD is to treat the underlying left-sided heart disease in an optimal man-ner using drugs and/or interventional or surgical ther-apy. There is currently no established indication for pulmonary arterial hypertension-specific therapies in PH-LHD, and specific therapies may even cause harm in patients with PH-LHD.

Tissue-specifically regulated site-specific excision of selectable marker genes in bivalent insecticidal, genetically-modified rice.

Science.gov (United States)

Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu

2013-12-01

Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.

Changes in IgA protease expression are conferred by changes in genomes during persistent infection by nontypeable Haemophilus influenzae in chronic obstructive pulmonary disease.

Science.gov (United States)

Gallo, Mary C; Kirkham, Charmaine; Eng, Samantha; Bebawee, Remon S; Kong, Yong; Pettigrew, Melinda M; Tettelin, Hervé; Murphy, Timothy F

2018-05-14

Nontypeable Haemophilus influenzae (NTHi) is an exclusively human pathobiont that plays a critical role in the course and pathogenesis of chronic obstructive pulmonary disease (COPD). NTHi causes acute exacerbations of COPD and also causes persistent infection of the lower airways. NTHi expresses four IgA protease variants (A1, A2, B1, and B2) that play different roles in virulence. Expression of IgA proteases varies among NTHi strains, but little is known about the frequency and mechanisms by which NTHi modulates IgA protease expression during infection in COPD. To assess expression of IgA protease during natural infection in COPD, we studied IgA protease expression of 101 persistent strains (median duration of persistence 161 days, range 2 to 1422) collected longitudinally from patients enrolled in a 20-year study of COPD upon initial acquisition and immediately before clearance from the host. Upon acquisition, 89 (88%) expressed IgA protease. A total of 16 of 101 (16%) strains of NTHi altered expression of IgA protease during persistence. Indels and slipped-strand mispairing of mononucleotide repeats conferred changes in expression of igaA1, igaA2, and igaB1 Strains with igaB2 underwent frequent changes in expression of IgA protease B2 during persistence, mediated by slipped-strand mispairing of a 7-nucleotide repeat, TCAAAAT, within the open reading frame of igaB2 We conclude that changes in iga gene sequences result in changes in expression of IgA proteases by NTHi during persistent infection in the respiratory tract of patients with COPD. Copyright © 2018 American Society for Microbiology.

Cerebral Venous Thrombosis and Pulmonary Embolism with Prothrombin G20210A Gene Mutation

OpenAIRE

Dagli, Canan Eren; Koksal, Nurhan; Guler, Selma; Gelen, Mehmet Emin; Atilla, Nurhan; Tuncel, Deniz

2010-01-01

A 25-year-old man presented with symptoms of syncope, cough, headache and hemoptysis. Cranial MR and venography showed thrombus formation in the right transverse sinus and superior sagittal sinus. Computed tomographic pulmonary angiography (CTPA) showed an embolic thrombus in the right pulmonary truncus and lung abscess. The patient was young, and there were no signs of lower extremity deep venous thrombosis or other major risk factors for pulmonary embolism (PE) including cardiac anomaly. Th...

Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

Science.gov (United States)

Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

2016-03-12

Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

Age-specific association between percent body fat and pulmonary ...

African Journals Online (AJOL)

This study describes the association between percent body fat and pulmonary function among apparently normal twenty male children tidal volume aged 4 years and twenty male children aged 10 years in Ogbomoso. The mean functional residual capacity of the lung in male children aged 10 years was significantly higher ...

Pulmonary embolism and nuclear medicine

International Nuclear Information System (INIS)

Peltier, P.; Planchon, B.; Faucal, P. de; Touze, M.D.; Dupas, B.

1988-01-01

Risks related to pulmonary embolism require use of diagnostic procedures with good sensitivity, and the potential complications of effective anticoagulant therapy require procedures with good specificity. Clinical signs are not more accurate for diagnosis of pulmonary than are ECG, blood gas and chest X ray examinations. Perfusion-ventilation scintigraphy has good diagnostic accuracy approaching that of pulmonary angiography which remains the gold standard. Since pulmonary embolism is usually a complication of deep venous thrombosis, distal clot detection should be associated with lung explorations. Plethysmography, ultrasonography, doppler studies and scintigraphy of the lower limbs could provide data supplementing those of contrast venography. The value and role of these examinations are analyzed and discussed in terms of different clinical situations [fr

miR-30c is specifically repressed in patients with active pulmonary tuberculosis.

Science.gov (United States)

Spinelli, Silvana V; Fernández, Rocío Del V; Zoff, Luciana; Bongiovanni, Bettina; Díaz, Ariana; D'Attilio, Luciano; Santucci, Natalia; Alvarez, Tomás; Marchesini, Marcela M; Bogue, Cristina; Bay, Maria L; Bottasso, Oscar A

2017-07-01

Tuberculous pleurisy (PLTB) is a common form of extrapulmonary tuberculosis. It often resolves without chemotherapy being hence considered a rather benign manifestation of the disease. Patients with PLTB mount an effective anti-mycobacterial response, unlike those with active pulmonary TB (pTB) that were shown to present an imbalance in plasma immune and endocrine mediators. In this work, we explored whether expression of the active isoform of the glucocorticoid receptor (hGRα) in the context of the inflammatory-anti-inflammatory responses of TB patients may be associated to microRNA levels. As expected, the inflammatory response triggered in patients coexists with increased circulating cortisol and altered hGRα levels in the peripheral blood mononuclear cells. However, while hGRα expression is significantly downregulated in PLTB, its levels in pTB patients are higher within the control values. These results point out to the existence of an additional mechanism tending to preserve hGRα levels probably to deal with the chronic inflammation observed in pTB. In this regard, we found that miR-30c is strongly downregulated in mononuclear cells of pTB patients compared to PLTB cases, showing an expression profile opposite to that seen with hGRα. Interestingly, low levels of miR-30c are specific for this active form of TB, as its expression is not altered in mononuclear cells from either healthy controls or patients with tuberculous or non-tuberculous pleurisy. Moreover, miR-30c and hGRα also showed an inverse expression pattern in M. tuberculosis-stimulated THP-1 macrophage cultures. In sum, our studies identify miR-30c as a specific correlate of pulmonary manifestations of TB, potentially involved in the altered glucocorticoid sensitivity observed in these patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

Elevated expression of NEU1 sialidase in idiopathic pulmonary fibrosis provokes pulmonary collagen deposition, lymphocytosis, and fibrosis.

Science.gov (United States)

Luzina, Irina G; Lockatell, Virginia; Hyun, Sang W; Kopach, Pavel; Kang, Phillip H; Noor, Zahid; Liu, Anguo; Lillehoj, Erik P; Lee, Chunsik; Miranda-Ribera, Alba; Todd, Nevins W; Goldblum, Simeon E; Atamas, Sergei P

2016-05-15

Idiopathic pulmonary fibrosis (IPF) poses challenges to understanding its underlying cellular and molecular mechanisms and the development of better therapies. Previous studies suggest a pathophysiological role for neuraminidase 1 (NEU1), an enzyme that removes terminal sialic acid from glycoproteins. We observed increased NEU1 expression in epithelial and endothelial cells, as well as fibroblasts, in the lungs of patients with IPF compared with healthy control lungs. Recombinant adenovirus-mediated gene delivery of NEU1 to cultured primary human cells elicited profound changes in cellular phenotypes. Small airway epithelial cell migration was impaired in wounding assays, whereas, in pulmonary microvascular endothelial cells, NEU1 overexpression strongly impacted global gene expression, increased T cell adhesion to endothelial monolayers, and disrupted endothelial capillary-like tube formation. NEU1 overexpression in fibroblasts provoked increased levels of collagen types I and III, substantial changes in global gene expression, and accelerated degradation of matrix metalloproteinase-14. Intratracheal instillation of NEU1 encoding, but not control adenovirus, induced lymphocyte accumulation in bronchoalveolar lavage samples and lung tissues and elevations of pulmonary transforming growth factor-β and collagen. The lymphocytes were predominantly T cells, with CD8(+) cells exceeding CD4(+) cells by nearly twofold. These combined data indicate that elevated NEU1 expression alters functional activities of distinct lung cell types in vitro and recapitulates lymphocytic infiltration and collagen accumulation in vivo, consistent with mechanisms implicated in lung fibrosis.

Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

Directory of Open Access Journals (Sweden)

Harindra E. Amarasinghe

2015-07-01

Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

Epigenetic repression of male gametophyte-specific genes in the Arabidopsis sporophyte

DEFF Research Database (Denmark)

Hoffmann, Robert D; Palmgren, Michael Broberg

2013-01-01

Tissue formation, the identity of cells, and the functions they fulfill, are results of gene regulation. The male gametophyte of plants, pollen, is outstanding in this respect as several hundred genes expressed in pollen are not expressed in the sporophyte. How pollen-specific genes are down......-regulated in the sporophyte has yet to be established. In this study, we have performed a bioinformatics analysis of publicly available genome-wide epigenetics data of several sporophytic tissues. By combining this analysis with DNase I footprinting data, we assessed means by which the repression of pollen-specific genes...

NRAMP1 and VDR gene polymorphisms in susceptibility to pulmonary tuberculosis among Andhra Pradesh population in India: a case-control study.

Science.gov (United States)

Medapati, Rooth Vasantha; Suvvari, Sridevi; Godi, Sudhakar; Gangisetti, Paddaiah

2017-06-05

The aim of the present study was to evaluate the association of NRAMP1 -3'UTR, 274-CT,VDR- Fok1 VDR-Taq1 Polymorphisms with the risk of pulmonary tuberculosis. A case -control study was conducted on Andhra Pradesh Population of India. Analysis of gene polymorphisms of NRAMP1 gene (3'UTR, 274CT) and VDR gene (Fok1 and Taq1) was done by using Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in Tuberculosis (TB) patients and healthy controls. The obtained results were observed using 2% Agarose Gel electrophoresis and analysed statistically using Chi-square test and Odds Ratio. Statistical significance was observed between the patients and the controls in the NRAMP1-3'UTR (P = 0.005; OR = 2.997; 95% CI = 1.019-8.813) and VDR-Taq1 (P  0.05). 3'UTR-NRAMP1 gene and VDR-Taq1 gene Polymorphisms are statistically associated with the susceptibility of TB in Andhra Pradesh Population in India.

Identification of a rice gene (Bph 1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers.

Science.gov (United States)

Kim, Suk-Man; Sohn, Jae-Keun

2005-08-31

This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.

Genomic Evidence of Chemotrophic Metabolisms in Deep-Dwelling Chloroflexi Conferred by Ancient Horizontal Gene Transfer Events

Science.gov (United States)

Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.

2017-12-01

The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates

Characterization of a cis-acting element involved in cell-specific expression of the zebrafish brain aromatase gene.

Science.gov (United States)

Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad

2008-10-01

The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.

Polymorphisms of SP110 are associated with both pulmonary and extra-pulmonary tuberculosis among the Vietnamese.

Directory of Open Access Journals (Sweden)

Gregory J Fox

Full Text Available Tuberculosis (TB is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results.To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam.Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451 under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860 and one with extra-pulmonary TB (rs10498244.SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection.

Polymorphisms of SP110 are associated with both pulmonary and extra-pulmonary tuberculosis among the Vietnamese.

Science.gov (United States)

Fox, Gregory J; Sy, Dinh Ngoc; Nhung, Nguyen Viet; Yu, Bing; Ellis, Magda K; Van Hung, Nguyen; Cuong, Nguyen Kim; Thi Lien, Luu; Marks, Guy B; Saunders, Bernadette M; Britton, Warwick J

2014-01-01

Tuberculosis (TB) is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results. To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam. Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451) under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860) and one with extra-pulmonary TB (rs10498244). SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection.

Polymorphisms of SP110 Are Associated with both Pulmonary and Extra-Pulmonary Tuberculosis among the Vietnamese

Science.gov (United States)

Fox, Gregory J.; Sy, Dinh Ngoc; Nhung, Nguyen Viet; Yu, Bing; Ellis, Magda K.; Van Hung, Nguyen; Cuong, Nguyen Kim; Thi Lien, Luu; Marks, Guy B.; Saunders, Bernadette M.; Britton, Warwick J.

2014-01-01

Background Tuberculosis (TB) is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results. Methods To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam. Results Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451) under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860) and one with extra-pulmonary TB (rs10498244). Conclusion SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection. PMID:25006821

Pulmonary hypertension CT imaging

International Nuclear Information System (INIS)

Nedevska, A.

2013-01-01

Full text: The right heart catheterization is the gold standard in the diagnosis and determines the severity of pulmonary hypertension. The significant technical progress of noninvasive diagnostic imaging methods significantly improves the pixel density and spatial resolution in the study of cardiovascular structures, thus changes their role and place in the overall diagnostic plan. Learning points: What is the etiology, clinical manifestation and general pathophysiological disorders in pulmonary hypertension. What are the established diagnostic methods in the diagnosis and follow-up of patients with pulmonary hypertension. What is the recommended protocol for CT scanning for patients with clinically suspected or documented pulmonary hypertension. What are the important diagnostic findings in CT scan of a patient with pulmonary hypertension. Discussion: The prospect of instantaneous complex - anatomical and functional cardiopulmonary and vascular diagnostics seems extremely attractive. The contrast enhanced multislice computed (CT ) and magnetic resonance imaging are very suitable methods for imaging the structures of the right heart, with the possibility of obtaining multiple projections and three-dimensional imaging reconstructions . There are specific morphological features that, if carefully analyzed, provide diagnostic information. Thus, it is possible to avoid or at least reduce the frequency of use of invasive diagnostic cardiac catheterization in patients with pulmonary hypertension. Conclusion: This review focuses on the use of contrast-enhanced CT for comprehensive evaluation of patients with pulmonary hypertension and presents the observed characteristic changes in the chest, lung parenchyma , the structures of the right half of the heart and pulmonary vessels

DNA sequencing conference, 2

Energy Technology Data Exchange (ETDEWEB)

Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

1991-06-19

This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

Heritable and lineage-specific gene knockdown in zebrafish embryo.

Directory of Open Access Journals (Sweden)

Mei Dong

Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.

Prediction of target genes for miR-140-5p in pulmonary arterial hypertension using bioinformatics methods.

Science.gov (United States)

Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang

2017-12-01

The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

18th edition of the Forum on specification and Design Languages Conference

CERN Document Server

Wille, Robert

2016-01-01

This book brings together a selection of the best papers from the eighteenth edition of the Forum on specification and Design Languages Conference (FDL), which took place on September 14-16, 2015, in Barcelona, Spain. FDL is a well-established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modeling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. Covers Assertion Based Design, Verification & Debug; Includes language-based modeling and design techniques for embedded systems; Covers design, modeling and verification of mixed physical domain and mixed signal systems that include significant analog parts in electrical and non-electrical domains; Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven Engineering...

17th edition of the Forum on specification and Design Languages Conference

CERN Document Server

Pasaje, Julio

2016-01-01

This book brings together a selection of the best papers from the seventeenth edition of the Forum on specification and Design Languages Conference (FDL), which took place on October 14-16, 2014, in Munich, Germany.  FDL is a well-established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modeling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems.   •Covers Assertion Based Design, Verification & Debug; •Includes language-based modeling and design techniques for embedded systems; •Covers design, modeling and verification of mixed physical domain and mixed signal systems; •Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven Engineering (MDE); •Covers parallel architectures – both as platforms f...

Pulmonary thromboembolism in children

Energy Technology Data Exchange (ETDEWEB)

Babyn, Paul S.; Gahunia, Harpal K. [Hospital for Sick Children, Department of Pediatric Diagnostic Imaging, Toronto, ON (Canada); Massicotte, Patricia [Stollery Children' s Hospital and University of Alberta, Departments of Pediatric Hematology and Cardiology, Edmonton, AB (Canada)

2005-03-01

Pulmonary thromboembolism (PTE) is uncommonly diagnosed in the pediatric patient, and indeed often only discovered on autopsy. The incidence of pediatric PTE depends upon the associated underlying disease, diagnostic tests used, and index of suspicion. Multiple risk factors can be found including: peripartum asphyxia, dyspnea, haemoptysis, chest pain, dehydration, septicemia, central venous lines (CVLs), trauma, surgery, ongoing hemolysis, vascular lesions, malignancy, renal disease, foreign bodies or, uncommonly, intracranial venous sinus thrombosis, burns, or nonbacterial thrombotic endocarditis. Other types of embolism can occur uncommonly in childhood and need to be recognized, as the required treatment will vary. These include pulmonary cytolytic thrombi, foreign bodies, tumor and septic emboli, and post-traumatic fat emboli. No single noninvasive test for pulmonary embolism is both sensitive and specific. A combination of diagnostic procedures must be used to identify suspect or confirmed cases of PTE. This article reviews the risk factors, clinical presentation and treatment of pulmonary embolism in children. It also highlights the current diagnostic tools and protocols used to evaluate pulmonary embolism in pediatric patients. (orig.)

Pulmonary thromboembolism in children

International Nuclear Information System (INIS)

Babyn, Paul S.; Gahunia, Harpal K.; Massicotte, Patricia

2005-01-01

Pulmonary thromboembolism (PTE) is uncommonly diagnosed in the pediatric patient, and indeed often only discovered on autopsy. The incidence of pediatric PTE depends upon the associated underlying disease, diagnostic tests used, and index of suspicion. Multiple risk factors can be found including: peripartum asphyxia, dyspnea, haemoptysis, chest pain, dehydration, septicemia, central venous lines (CVLs), trauma, surgery, ongoing hemolysis, vascular lesions, malignancy, renal disease, foreign bodies or, uncommonly, intracranial venous sinus thrombosis, burns, or nonbacterial thrombotic endocarditis. Other types of embolism can occur uncommonly in childhood and need to be recognized, as the required treatment will vary. These include pulmonary cytolytic thrombi, foreign bodies, tumor and septic emboli, and post-traumatic fat emboli. No single noninvasive test for pulmonary embolism is both sensitive and specific. A combination of diagnostic procedures must be used to identify suspect or confirmed cases of PTE. This article reviews the risk factors, clinical presentation and treatment of pulmonary embolism in children. It also highlights the current diagnostic tools and protocols used to evaluate pulmonary embolism in pediatric patients. (orig.)

Overexpression of Rice Auxilin-Like Protein, XB21, Induces Necrotic Lesions, up-Regulates Endocytosis-Related Genes, and Confers Enhanced Resistance to Xanthomonas oryzae pv. oryzae.

Science.gov (United States)

Park, Chang-Jin; Wei, Tong; Sharma, Rita; Ronald, Pamela C

2017-12-01

The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differential expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in 'cell death' and 'vesicle-mediated transport'. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling 'vesicle-mediated transport' in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.

Value of the ventilation/perfusion scan in acute pulmonary embolism: Results of the prospective investigation of pulmonary embolism diagnosis (PIOPED)

International Nuclear Information System (INIS)

Anon.

1990-01-01

To determine the sensitivities and specificities of ventilation/perfusion lung scans for acute pulmonary embolism, a random sample of 933 of 1,493 patients was studied prospectively. Nine hundred thirty-one underwent scintigraphy and 755 underwent pulmonary angiography; 251 (33%) of 755 demonstrated pulmonary embolism. Almost all patients with pulmonary embolism had abnormal scans of high, intermediate, or low probability, but so did most without pulmonary embolism. Of 116 patients with high-probability scans and definitive angiograms, 102 (88%) had pulmonary embolism, but only a minority with pulmonary embolism had high-probability scans. Of 322 with intermediate-probability scans and definitive angiograms, 105 (33%) had pulmonary embolism. Follow-up and angiography together suggest pulmonary embolism occurred among 12% of patients with low-probability scans. Clinical assessment combined with the ventilation/perfusion scan established the diagnosis or exclusion of pulmonary embolism only for a minority of patients--those with clear and concordant clinical and ventilation/perfusion scan findings

Pulmonary Hypertension and Pulmonary Vasodilators.

Science.gov (United States)

Keller, Roberta L

2016-03-01

Pulmonary hypertension in the perinatal period can present acutely (persistent pulmonary hypertension of the newborn) or chronically. Clinical and echocardiographic diagnosis of acute pulmonary hypertension is well accepted but there are no broadly validated criteria for echocardiographic diagnosis of pulmonary hypertension later in the clinical course, although there are significant populations of infants with lung disease at risk for this diagnosis. Contributing cardiovascular comorbidities are common in infants with pulmonary hypertension and lung disease. It is not clear who should be treated without confirmation of pulmonary vascular disease by cardiac catheterization, with concurrent evaluation of any contributing cardiovascular comorbidities. Copyright © 2016 Elsevier Inc. All rights reserved.

miR-1 is increased in pulmonary hypertension and downregulates Kv1.5 channels in rat pulmonary arteries.

Science.gov (United States)

Mondejar-Parreño, Gema; Callejo, María; Barreira, Bianca; Morales-Cano, Daniel; Esquivel-Ruiz, Sergio; Moreno, Laura; Cogolludo, Angel; Perez-Vizcaino, Francisco

2018-05-02

■The expression of miR-1 is increased in lungs from the Hyp/Su5416 PAH rat model. ■PASMC from this animal model are more depolarised and show decreased expression and activity of Kv1.5. ■miR-1 directly targets Kv1.5 channels, reduces Kv1.5 activity and induces membrane depolarization. ■Antagomir-1 prevents Kv1.5 channel downregulation and the depolarization induced by hypoxia/Su5416 exposition. Impairment of voltage-dependent potassium channel (Kv) plays a central role in the development of cardiovascular diseases, including pulmonary arterial hypertension (PAH). MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the 3'-UTR region of specific mRNAs. The aim of this study was to analyze the effects of miR-1 on Kv channel function in pulmonary arteries (PA). Kv channel activity was studied in PA from healthy animals transfected with miR-1 or scrambled-miR. Kv currents were studied using the whole-cell configuration of patch-clamp technique. The characterization of the Kv1.5 currents was performed with the selective inhibitor DPO-1. miR-1 expression was increased and Kv1.5 channels were decreased in lungs from a rat model of PAH induced by hypoxia and Su5416. miR-1 transfection increased cell capacitance, reduced Kv1.5 currents and induced membrane depolarization in isolated pulmonary artery smooth muscle cells (PASMCs). Luciferase reporter assay indicated that KCNA5, which encodes Kv1.5 channels, is a direct target gene of miR-1. Incubation of PA with Su5416 and hypoxia (3% O 2 ) increased miR-1 and induced a decline in Kv1.5 currents, which was prevented by antagomiR-1. In conclusion, these data indicate that miR-1 induces PASMC hypertrophy and reduces the activity and expression of Kv channels, suggesting a pathophysiological role in PAH. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Pulmonary hypertension in childhood interstitial lung disease: A systematic review of the literature.

Science.gov (United States)

Bromley, Susan; Vizcaya, David

2017-05-01

Childhood interstitial lung disease (chILD) comprises a wide heterogeneous group of rare parenchymal lung disorders associated with substantial morbidity and mortality. Pulmonary hypertension is a common comorbidity in adults with interstitial lung disease (ILD) and associated with poor survival. We aimed to systematically review the literature regarding the occurrence of pulmonary hypertension (PH) in chILD, its effect on prognosis and healthcare use, and its treatment in clinical practice. Searches of PubMed and EMBASE databases (up to February 2016), and American Thoracic Society conference abstracts (2009-2015) were conducted using relevant keywords. References from selected articles and review papers were scanned to identify further relevant articles. A total of 20 articles were included; estimates of PH in chILD ranged from 1% to 64% with estimates among specific chILD entities ranging from 0% to 43%. Comparisons between studies were limited by differences in the study populations, including the size, age range, and heterogeneous composition of the ILD case series in terms of the nature and severity of the clinical entities, and also the methods used to diagnose PH. Three studies found that among patients with chILD, those with PH had a significantly higher risk (up to sevenfold) of death compared with those without PH. Information on the treatment of pulmonary hypertension in chILD or the effect of PH on healthcare use was not available. Data on the use and effectiveness of treatments for pulmonary hypertension in chILD are required to address this area of unmet need. Pediatr Pulmonol. 2017;52:689-698. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Transcriptional blood signatures distinguish pulmonary tuberculosis, pulmonary sarcoidosis, pneumonias and lung cancers.

Science.gov (United States)

Bloom, Chloe I; Graham, Christine M; Berry, Matthew P R; Rozakeas, Fotini; Redford, Paul S; Wang, Yuanyuan; Xu, Zhaohui; Wilkinson, Katalin A; Wilkinson, Robert J; Kendrick, Yvonne; Devouassoux, Gilles; Ferry, Tristan; Miyara, Makoto; Bouvry, Diane; Valeyre, Dominique; Dominique, Valeyre; Gorochov, Guy; Blankenship, Derek; Saadatian, Mitra; Vanhems, Phillip; Beynon, Huw; Vancheeswaran, Rama; Wickremasinghe, Melissa; Chaussabel, Damien; Banchereau, Jacques; Pascual, Virginia; Ho, Ling-Pei; Lipman, Marc; O'Garra, Anne

2013-01-01

New approaches to define factors underlying the immunopathogenesis of pulmonary diseases including sarcoidosis and tuberculosis are needed to develop new treatments and biomarkers. Comparing the blood transcriptional response of tuberculosis to other similar pulmonary diseases will advance knowledge of disease pathways and help distinguish diseases with similar clinical presentations. To determine the factors underlying the immunopathogenesis of the granulomatous diseases, sarcoidosis and tuberculosis, by comparing the blood transcriptional responses in these and other pulmonary diseases. We compared whole blood genome-wide transcriptional profiles in pulmonary sarcoidosis, pulmonary tuberculosis, to community acquired pneumonia and primary lung cancer and healthy controls, before and after treatment, and in purified leucocyte populations. An Interferon-inducible neutrophil-driven blood transcriptional signature was present in both sarcoidosis and tuberculosis, with a higher abundance and expression in tuberculosis. Heterogeneity of the sarcoidosis signature correlated significantly with disease activity. Transcriptional profiles in pneumonia and lung cancer revealed an over-abundance of inflammatory transcripts. After successful treatment the transcriptional activity in tuberculosis and pneumonia patients was significantly reduced. However the glucocorticoid-responsive sarcoidosis patients showed a significant increase in transcriptional activity. 144-blood transcripts were able to distinguish tuberculosis from other lung diseases and controls. Tuberculosis and sarcoidosis revealed similar blood transcriptional profiles, dominated by interferon-inducible transcripts, while pneumonia and lung cancer showed distinct signatures, dominated by inflammatory genes. There were also significant differences between tuberculosis and sarcoidosis in the degree of their transcriptional activity, the heterogeneity of their profiles and their transcriptional response to treatment.

A gene regulatory network armature for T-lymphocyte specification

Energy Technology Data Exchange (ETDEWEB)

Fung, Elizabeth-sharon [Los Alamos National Laboratory

2008-01-01

Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

Directory of Open Access Journals (Sweden)

Kozmin Stanislav G

2005-06-01

Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model.

Science.gov (United States)

Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard

2007-09-01

The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.

Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription.

Science.gov (United States)

Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L

1996-12-01

The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

MicroRNA mimicry blocks pulmonary fibrosis

Science.gov (United States)

Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva

2014-01-01

Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947

Amiodarone pulmonary toxicity: Case report

Directory of Open Access Journals (Sweden)

Vasić Nada

2014-01-01

Full Text Available Introduction. Amiodarone, an antiarrhythmic drug, which contains iodine compound, has a tendency to accumulate in some organs including the lungs. This is age, drug dosage and therapy duration dependent. Case Outline. We present a case of a 73-year-old man, a smoker, who was admitted as emergency case due to severe dyspnea, tachypnea with signs of cyanosis and respiratory insufficiency. Chest x-ray revealed bilateral diffuse pulmonary shadows in the middle and upper parts of the lungs, similar to those in tuberculosis. His illness history showed chronic obstructive pulmonary disease, arterial hypertension, and atrial fibrillation which has been treated with amiodarone for six years. Sputum smears were negative for mycobacteria, and by the diagnostic elimination method for specific, non-specific and malignant disease the diagnosis of amiodarone pulmonary toxicity was made. Fiberoptic bronchoscopy and pathohistological findings of bronchiolitis obliterans organizing pneumonia confirmed the diagnosis. As the first therapeutic approach, amiodarone therapy was stopped. Then, systemic therapy with methylprednisolone 21 (sodium succinate 40 mg i.v. daily during the first two weeks was initiated and continued with daily dose of methylprednisolone 30 mg orally during the next three months. The patient showed a marked subjective improvement during the first week, which was followed by the improvement of respiratory function and withdrawal of pulmonary changes with complete radiographic and CT resolution after eight months. Conclusion. Amiodarone pulmonary toxicity should be taken into consideration, especially in elderly patients with respiratory symptoms and pulmonary changes, even if only a low dose of amiodarone is administred over a longer time period.

A horizontally gene transferred copper resistance locus confers hyper‐resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages

Science.gov (United States)

Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.

2018-01-01

Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441

Gene expression in cardiac tissues from infants with idiopathic conotruncal defects

Directory of Open Access Journals (Sweden)

Lofland Gary K

2011-01-01

Full Text Available Abstract Background Tetralogy of Fallot (TOF is the most commonly observed conotruncal congenital heart defect. Treatment of these patients has evolved dramatically in the last few decades, yet a genetic explanation is lacking for the failure of cardiac development for the majority of children with TOF. Our goal was to perform genome wide analyses and characterize expression patterns in cardiovascular tissue (right ventricle, pulmonary valve and pulmonary artery obtained at the time of reconstructive surgery from 19 children with tetralogy of Fallot. Methods We employed genome wide gene expression microarrays to characterize cardiovascular tissue (right ventricle, pulmonary valve and pulmonary artery obtained at the time of reconstructive surgery from 19 children with TOF (16 idiopathic and three with 22q11.2 deletions and compared gene expression patterns to normally developing subjects. Results We detected a signal from approximately 26,000 probes reflecting expression from about half of all genes, ranging from 35% to 49% of array probes in the three tissues. More than 1,000 genes had a 2-fold change in expression in the right ventricle (RV of children with TOF as compared to the RV from matched control infants. Most of these genes were involved in compensatory functions (e.g., hypertrophy, cardiac fibrosis and cardiac dilation. However, two canonical pathways involved in spatial and temporal cell differentiation (WNT, p = 0.017 and Notch, p = 0.003 appeared to be generally suppressed. Conclusions The suppression of developmental networks may represent a remnant of a broad malfunction of regulatory pathways leading to inaccurate boundary formation and improper structural development in the embryonic heart. We suggest that small tissue specific genomic and/or epigenetic fluctuations could be cumulative, leading to regulatory network disruption and failure of proper cardiac development.

Ortholog Alleles at Xa3/Xa26 Locus Confer Conserved Race-Specific Resistance against Xanthomonas oryzae in Rice

Institute of Scientific and Technical Information of China (English)

Hong-Jing Li; Xiang-Hua Li; Jing-Hua Xiao; Rod A. Wing; Shi-Ping Wang

2012-01-01

The rice disease resistance (R) gene Xa3/Xa26 (having also been named Xa3 and Xa26) against Xanthomonas oryzae pv.oryzae (Xoo),which causes bacterial blight disease,belongs to a multiple gene family clustered in chromosome 11 and is from an AA genome rice cultivar (Oryza sativa L.).This family encodes leucine-rich repeat (LRR) receptor kinasetype proteins.Here,we show that the orthologs (alleles) of Xa3/Xa26,Xa3/Xa26-2,and Xa3/Xa26-3,from wild Oryza species O.officinalis (CC genome) and O.minuta (BBCC genome),respectively,were also R genes against Xoo.Xa3/Xa26-2 and Xa3/Xa26-3 conferred resistance to 16 of the 18 Xoo strains examined.Comparative sequence analysis of the Xa3/Xa26 families in the two wild Oryza species showed that Xa3/Xa26-3 appeared to have originated from the CC genome of O.minuta.The predicted proteins encoded by Xa3/Xa26,Xa3/Xa26-2,and Xa3/Xa26-3 share 91-99％ sequence identity and 94-99％ sequence similarity.Transgenic plants carrying a single copy of Xa3/Xa26,Xa3/Xa26-2,or Xa3/Xa26-3,in the same genetic background,showed a similar resistance spectrum to a set of Xoo strains,although plants carrying Xa3/Xa26-2 or Xa3/Xa26-3 showed lower resistance levels than the plants carrying Xa3/Xa26.These results suggest that the Xa3/Xa26 locus predates the speciation of A and C genome,which is approximately 7.5 million years ago.Thus,the resistance specificity of this locus has been conserved for a long time.

Mechanisms of right heart disease in pulmonary hypertension (2017 Grover Conference Series).

Science.gov (United States)

Asosingh, Kewal; Erzurum, Serpil

2018-01-01

Current dogma is that pathological hypertrophy of the right ventricle is a direct consequence of pulmonary vascular remodeling. However, progression of right ventricle dysfunction is not always lung-dependent. Increased afterload caused by pulmonary vascular remodeling initiates the right ventricle hypertrophy, but determinants leading to adaptive or maladaptive hypertrophy and failure remain unknown. Ischemia in a hypertrophic right ventricle may directly contribute to right heart failure. Rapidly enlarging cardiomyocytes switch from aerobic to anaerobic energy generation resulting in cell growth under relatively hypoxic conditions. Cardiac muscle reacts to an increased afterload by over-activation of the sympathetic system and uncoupling and downregulation of β-adrenergic receptors. Recent studies suggest that β blocker therapy in PH is safe, well tolerated, and preserves right ventricle function and cardiac output by reducing right ventricular glycolysis. Fibrosis, an evolutionary conserved process in host defense and wound healing, is dysregulated in maladaptive cardiac tissue contributing directly to right ventricle failure. Despite several mechanisms having been suggested in right heart disease, the causes of maladaptive cardiac remodeling remain unknown and require further research.

Functional and structural analysis of the DNA sequence conferring glucocorticoid inducibility to the mouse mammary tumor virus gene

International Nuclear Information System (INIS)

Skroch, P.

1987-05-01

In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

Directory of Open Access Journals (Sweden)

Hettne Kristina M

2013-01-01

Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

Directory of Open Access Journals (Sweden)

Bingfu eGuo

2015-10-01

Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

A large-scale analysis of tissue-specific pathology and gene expression of human disease genes and complexes

DEFF Research Database (Denmark)

Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart

2008-01-01

to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...

Gene program-specific regulation of PGC-1{alpha} activity

DEFF Research Database (Denmark)

Schmidt, Søren F; Mandrup, Susanne

2011-01-01

Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

Multidimensional fatigue in pulmonary hypertension: prevalence, severity and predictors

Science.gov (United States)

Tartavoulle, Todd M.; Karpinski, Aryn C.; Aubin, Andrew; Kluger, Benzi M.; Distler, Oliver; Saketkoo, Lesley Ann

2018-01-01

Pulmonary hypertension is a potentially fatal disease. Despite pharmacological advances in pulmonary hypertension, fatigue remains common in patients with pulmonary hypertension. A convenience sample of 120 participants at an international patient conference completed the Multidimensional Fatigue Inventory (MFI)-20 scale. Data on New York Heart Association Functional Class, body mass index, oxygen use and medication type/use were also collected. There was a high prevalence of “severe” to “very severe” fatigue for each dimension: General Fatigue (60%), Physical Fatigue (55.8%), Reduced Activity (41.7%), Reduced Motivation (32.5%) and Mental Fatigue (27.5%). The mean±sd overall MFI-20 score was 58±5.1. Dimensions with the highest averaged levels were General Fatigue (13.40±3.61), Physical Fatigue (13.23±3.67) and Reduced Activity (11.33±4.16). Body mass index correlated with higher fatigue scores. Phosphodiesterase inhibitor plus endothelin receptor antagonist combination negatively predicted General Fatigue, Physical Fatigue, Reduced Motivation and Reduced Activity. Triple therapy was a significant predictor of General Fatigue, Physical Fatigue and Reduced Activity. There were no significant predictors of Mental Fatigue. Multidimensional fatigue is common and severe in patients with pulmonary hypertension. Phosphodiesterase inhibitor plus endothelin receptor antagonist combination resulted in lower scores in most fatigue dimensions. Comprehensive assessment of fatigue should be considered in the clinical care of patients with pulmonary hypertension and clinical research to develop formal interventions that target this disabling symptom. PMID:29577043

Ovine model for studying pulmonary immune responses

International Nuclear Information System (INIS)

Joel, D.D.; Chanana, A.D.

1984-01-01

Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

Ovine model for studying pulmonary immune responses

Energy Technology Data Exchange (ETDEWEB)

Joel, D.D.; Chanana, A.D.

1984-11-25

Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

Acrolein - a pulmonary hazard.

Science.gov (United States)

Bein, Kiflai; Leikauf, George D

2011-09-01

Acrolein is a respiratory irritant that can be generated during cooking and is in environmental tobacco smoke. More plentiful in cigarette smoke than polycyclic aromatic hydrocarbons (PAH), acrolein can adduct tumor suppressor p53 (TP53) DNA and may contribute to TP53-mutations in lung cancer. Acrolein is also generated endogenously at sites of injury, and excessive breath levels (sufficient to activate metalloproteinases and increase mucin transcripts) have been detected in asthma and chronic obstructive pulmonary disease (COPD). Because of its reactivity with respiratory-lining fluid or cellular macromolecules, acrolein alters gene regulation, inflammation, mucociliary transport, and alveolar-capillary barrier integrity. In laboratory animals, acute exposures have lead to acute lung injury and pulmonary edema similar to that produced by smoke inhalation whereas lower concentrations have produced bronchial hyperreactivity, excessive mucus production, and alveolar enlargement. Susceptibility to acrolein exposure is associated with differential regulation of cell surface receptor, transcription factor, and ubiquitin-proteasome genes. Consequent to its pathophysiological impact, acrolein contributes to the morbidly and mortality associated with acute lung injury and COPD, and possibly asthma and lung cancer. Copyright © 2011 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

Directory of Open Access Journals (Sweden)

Farré Domènec

2007-12-01

Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

Defective angiogenesis delays thrombus resolution: a potential pathogenetic mechanism underlying chronic thromboembolic pulmonary hypertension

Science.gov (United States)

Panzenboeck, Adelheid; Winter, Max P; Schubert, Uwe; Voswinckel, Robert; Frey, Maria K; Jakowitsch, Johannes; Alimohammadi, Arman; Hobohm, Lukas; Mangold, Andreas; Bergmeister, Helga; Sibilia, Maria; Wagner, Erwin F; Mayer, Eckhard; Klepetko, Walter; Hoelzenbein, Thomas J; Preissner, Klaus T; Lang, Irene M

2015-01-01

Objective Restoration of patency is a natural target of vascular remodeling following venous thrombosis that involves vascular endothelial cells and smooth muscle cells as well as leukocytes. Acute pulmonary emboli usually resolve within six months. However, in some instances, thrombi transform into fibrous vascular obstructions, resulting in occlusion of the deep veins, or in chronic thromboembolic pulmonary hypertension (CTEPH). We proposed that dysregulated thrombus angiogenesis may contribute to thrombus persistence. Approach and Results Mice with an endothelial-cell-specific conditional deletion of vascular endothelial growth factor receptor 2/kinase insert domain protein receptor (VEGF-R2/Kdr) were utilized in a model of stagnant flow venous thrombosis closely resembling human deep vein thrombosis. Biochemical and functional analyses were performed on pulmonary endarterectomy specimens from patients with CTEPH, a human model of non-resolving venous thromboembolism. Endothelial cell-specific deletion of Kdr and subsequent ablation of thrombus vascularization delayed thrombus resolution. In accordance with these findings, organized human CTEPH thrombi were largely devoid of vascular structures. Several vessel-specific genes such as KDR, vascular endothelial cadherin and podoplanin were expressed at lower levels in white CTEPH thrombi than in organizing deep vein thrombi and organizing thrombi from aortic aneurysms. In addition, red CTEPH thrombi attenuated the angiogenic response induced by VEGF. Conclusions In the present work, we propose a mechanism of thrombus non-resolution demonstrating that endothelial cell-specific deletion of Kdr abates thrombus vessel formation, misguiding thrombus resolution. Medical conditions associated with the development of CTEPH may be compromising early thrombus angiogenesis. PMID:24526692

Protein-protein association and cellular localization of four essential gene products encoded by tellurite resistance-conferring cluster "ter" from pathogenic Escherichia coli.

Science.gov (United States)

Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan

2013-12-01

Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.

Differential gene expression during Trypanosoma cruzi metacyclogenesis

Directory of Open Access Journals (Sweden)

Marco Aurelio Krieger

1999-09-01

Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

Science.gov (United States)

Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

2015-01-01

In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

Science.gov (United States)

Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

2018-01-01

The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

Repressor-mediated tissue-specific gene expression in plants

Science.gov (United States)

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Multistudy fine mapping of chromosome 2q identifies XRCC5 as a chronic obstructive pulmonary disease susceptibility gene

DEFF Research Database (Denmark)

Hersh, Craig P; Pillai, Sreekumar G; Zhu, Guohua

2010-01-01

to the identification of chronic obstructive pulmonary disease (COPD) susceptibility genes on chromosome 2q. METHODS: Within the chromosome 2q linkage region, 2,843 SNPs were genotyped in 806 COPD cases and 779 control subjects from Norway, and 2,484 SNPs were genotyped in 309 patients with severe COPD from...... the National Emphysema Treatment Trial and 330 community control subjects. Significant associations from the combined results across the two case-control studies were followed up in 1,839 individuals from 603 families from the International COPD Genetics Network (ICGN) and in 949 individuals from 127 families...

The genetics of chronic obstructive pulmonary disease

Directory of Open Access Journals (Sweden)

Silverman Edwin K

2001-01-01

Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a significant cause of global morbidity and mortality. Previous studies have shown that COPD aggregates in families, suggesting a genetic predisposition to airflow obstruction. Many candidate genes have been assessed, but the data are often conflicting. We review the genetic factors that predispose smokers to COPD and highlight the future role of genomic scans in identifying novel susceptibility genes.

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

NARCIS (Netherlands)

Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

2013-01-01

BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

NARCIS (Netherlands)

Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.

2013-01-01

Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set

Candidate genes for COPD: current evidence and research

Directory of Open Access Journals (Sweden)

Kim WJ

2015-10-01

Full Text Available Woo Jin Kim,1 Sang Do Lee2 1Department of Internal Medicine and Environmental Health Center, Kangwon National University, Chuncheon, 2Department of Pulmonary and Critical Care Medicine, Clinical Research Center for Chronic Obstructive Airway Diseases, Asan Medical Center, University of Ulsan College of Medicine, Seoul, South Korea Abstract: COPD is a common complex disease characterized by progressive airflow limitation. Several genome-wide association studies (GWASs have discovered genes that are associated with COPD. Recently, candidate genes for COPD identified by GWASs include CHRNA3/5 (cholinergic nicotine receptor alpha 3/5, IREB2 (iron regulatory binding protein 2, HHIP (hedgehog-interacting protein, FAM13A (family with sequence similarity 13, member A, and AGER (advanced glycosylation end product–specific receptor. Their association with COPD susceptibility has been replicated in multiple populations. Since these candidate genes have not been considered in COPD, their pathological roles are still largely unknown. Herein, we review some evidences that they can be effective drug targets or serve as biomarkers for diagnosis or subtyping. However, more study is required to understand the functional roles of these candidate genes. Future research is needed to characterize the effect of genetic variants, validate gene function in humans and model systems, and elucidate the genes’ transcriptional and posttranscriptional regulatory mechanisms. Keywords: chronic obstructive pulmonary disease, genetics, genome-wide association study

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

Directory of Open Access Journals (Sweden)

Yi-Bing Zhang

Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

A perpetual cascade of cytokines postirradiation leads to pulmonary fibrosis

International Nuclear Information System (INIS)

Rubin, Philip; Johnston, Carl J.; Williams, Jacqueline P.; McDonald, Sandra; Finkelstein, Jacob N.

1995-01-01

: These studies clearly demonstrate the early and persistent elevation of cytokine production following pulmonary irradiation. The temporal relationship between the elevation of specific cytokines and the histological and biochemical evidence of fibrosis serves to illustrate the continuum of response, which, we believe, underlies pulmonary radiation reactions and supports the concept of a perpetual cascade of cytokines produced immediately after irradiation, prompting collagen genes to turn on, and persisting until the expression of late effects becomes apparent pathologically and clinically

Radiographic findings in pulmonary hypertension from unresolved embolism

Energy Technology Data Exchange (ETDEWEB)

Woodruff, W.W. III; Hoeck, B.E.; Chitwood, W.R. Jr.; Lyerly, H.K.; Sabiston, D.C. Jr.; Chen, J.T.T.

1985-04-01

Pulmonary artery hypertension with chronic pulmonary embolism is an uncommon entity that is potentially treatable with pulmonary embolectomy. Although the classic radiographic features have been described, several recent investigators report a significant percentage of these patients with normal chest radiographs. In a series of 22 patients, no normal radiographs were seen. Findings included cardiomegaly (86.4%) with right-sided enlargement (68.4%), right descending pulmonary artery enlargement (54.5%), azygos vein enlargement (27.3%), mosaic oligemia (68.2%), chronic volume loss (27.3%), atelectasis and/or effusion (22.7%), and pleural thickening (13.6%). Good correlation with specific areas of diminished vascularity was seen on chest radiographs compared with pulmonary angiograms.

Radiographic findings in pulmonary hypertension from unresolved embolism

International Nuclear Information System (INIS)

Woodruff, W.W. III; Hoeck, B.E.; Chitwood, W.R. Jr.; Lyerly, H.K.; Sabiston, D.C. Jr.; Chen, J.T.T.

1985-01-01

Pulmonary artery hypertension with chronic pulmonary embolism is an uncommon entity that is potentially treatable with pulmonary embolectomy. Although the classic radiographic features have been described, several recent investigators report a significant percentage of these patients with normal chest radiographs. In a series of 22 patients, no normal radiographs were seen. Findings included cardiomegaly (86.4%) with right-sided enlargement (68.4%), right descending pulmonary artery enlargement (54.5%), azygos vein enlargement (27.3%), mosaic oligemia (68.2%), chronic volume loss (27.3%), atelectasis and/or effusion (22.7%), and pleural thickening (13.6%). Good correlation with specific areas of diminished vascularity was seen on chest radiographs compared with pulmonary angiograms

Differential pulmonary and cardiac effects of pulmonary exposure to a panel of particulate matter-associated metals

International Nuclear Information System (INIS)

Wallenborn, J. Grace; Schladweiler, Mette J.; Richards, Judy H.; Kodavanti, Urmila P.

2009-01-01

Biological mechanisms underlying the association between particulate matter (PM) exposure and increased cardiovascular health effects are under investigation. Water-soluble metals reaching systemic circulation following pulmonary exposure are likely exerting a direct effect. However, it is unclear whether specific PM-associated metals may be driving this. We hypothesized that exposure to equimolar amounts of five individual PM-associated metals would cause differential pulmonary and cardiac effects. We exposed male WKY rats (14 weeks old) via a single intratracheal instillation (IT) to saline or 1 μmol/kg body weight of zinc, nickel, vanadium, copper, or iron in sulfate form. Responses were analyzed 4, 24, 48, or 96 h after exposure. Pulmonary effects were assessed by bronchoalveolar lavage fluid levels of total cells, macrophages, neutrophils, protein, albumin, and activities of lactate dehydrogenase, γ-glutamyl transferase, and n-acetyl glucosaminidase. Copper induced earlier pulmonary injury/inflammation, while zinc and nickel produced later effects. Vanadium or iron exposure induced minimal pulmonary injury/inflammation. Zinc, nickel, or copper increased serum cholesterol, red blood cells, and white blood cells at different time points. IT of nickel and copper increased expression of metallothionein-1 (MT-1) in the lung. Zinc, nickel, vanadium, and iron increased hepatic MT-1 expression. No significant changes in zinc transporter-1 (ZnT-1) expression were noted in the lung or liver; however, zinc increased cardiac ZnT-1 at 24 h, indicating a possible zinc-specific cardiac effect. Nickel exposure induced an increase in cardiac ferritin 96 h after IT. This data set demonstrating metal-specific cardiotoxicity is important in linking metal-enriched anthropogenic PM sources with adverse health effects.

Bronchus-associated lymphoid tissue in pulmonary hypertension produces pathologic autoantibodies.

Science.gov (United States)

Colvin, Kelley L; Cripe, Patrick J; Ivy, D Dunbar; Stenmark, Kurt R; Yeager, Michael E

2013-11-01

Autoimmunity has long been associated with pulmonary hypertension. Bronchus-associated lymphoid tissue plays important roles in antigen sampling and self-tolerance during infection and inflammation. We reasoned that activated bronchus-associated lymphoid tissue would be evident in rats with pulmonary hypertension, and that loss of self-tolerance would result in production of pathologic autoantibodies that drive vascular remodeling. We used animal models, histology, and gene expression assays to evaluate the role of bronchus-associated lymphoid tissue in pulmonary hypertension. Bronchus-associated lymphoid tissue was more numerous, larger, and more active in pulmonary hypertension compared with control animals. We found dendritic cells in and around lymphoid tissue, which were composed of CD3(+) T cells over a core of CD45RA(+) B cells. Antirat IgG and plasma from rats with pulmonary hypertension decorated B cells in lymphoid tissue, resistance vessels, and adventitia of large vessels. Lymphoid tissue in diseased rats was vascularized by aquaporin-1(+) high endothelial venules and vascular cell adhesion molecule-positive vessels. Autoantibodies are produced in bronchus-associated lymphoid tissue and, when bound to pulmonary adventitial fibroblasts, change their phenotype to one that may promote inflammation. Passive transfer of autoantibodies into rats caused pulmonary vascular remodeling and pulmonary hypertension. Diminution of lymphoid tissue reversed pulmonary hypertension, whereas immunologic blockade of CCR7 worsened pulmonary hypertension and hastened its onset. Bronchus-associated lymphoid tissue expands in pulmonary hypertension and is autoimmunologically active. Loss of self-tolerance contributes to pulmonary vascular remodeling and pulmonary hypertension. Lymphoid tissue-directed therapies may be beneficial in treating pulmonary hypertension.

An improved method for transformation of lettuce by Agrobacterium tumefaciens with a gene that confers freezing resistance

Directory of Open Access Journals (Sweden)

Pileggi Marcos

2001-01-01

Full Text Available An efficient method for constructing transgenic lettuce cultivars by Agrobacterium tumefaciens was described by Torres et al., 1993. In the present work, an improvement of the above procedure is described and applied to transform the cultivar Grand Rapids with a mutated P5CS gene. The major modifications were concerned with turning more practical the transformation and regeneration protocols. Also we tried to improve transformation steps by increasing injured area in explants and prolonging co-cultivation with Agrobacteria (in larger concentration. A more significant selective pressure was used against non-transformed plants and bacteria. In these work we were concerned to obtain T1 and T2 seeds. The P5CS gene codes for a delta¹-pyrroline-5-carboxylate synthetase, a bifunctional enzyme that catalyzes two steps of proline biosynthesis in plants (Zhang et al., 1995; Peng et al., 1996, while the mutated gene is insensitive to feedback inhibition by proline. The potential benefit of this gene is to confer water stress resistance (drought, salt, cold due to increased intracellular levels of proline that works like an osmoprotectant. In this work could obtain and characterize transgenic lettuce lineages which are resistant to freezing temperature.

Recessive resistance to Bean common mosaic virus conferred by the bc-1 and bc-2 genes in common bean (Phaseolus vulgaris L.) affects long distance movement of the virus.

Science.gov (United States)

Feng, Xue; Orellana, Gardenia; Myers, James; Karasev, Alexander V

2018-04-12

Recessive resistance to Bean common mosaic virus (BCMV) in common bean (Phaseolus vulgaris L.) is governed by four genes that include one strain-nonspecific helper gene bc-u, and three strain-specific genes bc-1, bc-2, and bc-3. The bc-3 gene was identified as an eIF4E translation initiation factor gene mediating resistance through disruption of the interaction between this protein and the VPg protein of the virus. The mode of action of bc-1 and bc-2 in expression of BCMV resistance is unknown, although bc-1 gene was found to affect systemic spread of a related potyvirus, Bean common mosaic necrosis virus. To investigate the possible role of both bc-1 and bc-2 genes in replication, cell-to-cell, and long distance movement of BCMV in P. vulgaris, we tested virus spread of eight BCMV isolates representing pathogroups I, IV, VI, VII, and VIII, in a set of bean differentials expressing different combinations of six resistance alleles including bc-u, bc-1, bc-1 2 , bc-2, bc-2 2 , and bc-3. All studied BCMV isolates were able to replicate and spread in inoculated leaves of bean cultivars harboring bc-u, bc-1, bc-1 2 , bc-2, and bc-2 2 alleles and their combinations, while no BCMV replication was found in inoculated leaves of 'IVT7214' carrying the bc-u, bc-2 and bc-3 genes, except for isolate 1755a capable of overcoming the resistance conferred by bc-2 and bc-3. In contrast, the systemic spread of all BCMV isolates from pathogroups I, IV,VI, VII, and VIII was impaired in common bean cultivars carrying bc-1, bc-1 2 , bc-2, and bc-2 2 alleles. The data suggest that bc-1 and bc-2 recessive resistance genes have no effect on the replication and cell-to-cell movement of BCMV, but affect systemic spread of BCMV in common bean. The BCMV resistance conferred by bc-1 and bc-2 and affecting systemic spread was found only partially effective when these two genes were expressed singly. The efficiency of the restriction of the systemic spread of the virus was greatly enhanced when

Differential concentration-specific effects of caffeine on cell viability, oxidative stress, and cell cycle in pulmonary oxygen toxicity in vitro

International Nuclear Information System (INIS)

Tiwari, Kirti Kumar; Chu, Chun; Couroucli, Xanthi; Moorthy, Bhagavatula; Lingappan, Krithika

2014-01-01

Highlights: • Caffeine at 0.05 mM decreases oxidative stress in hyperoxia. • Caffeine at 1 mM decreases cell viability, increases oxidative stress in hyperoxia. • Caffeine at 1 but not 0.05 mM, abrogates hyperoxia-induced G2/M arrest. - Abstract: Caffeine is used to prevent bronchopulmonary dysplasia (BPD) in premature neonates. Hyperoxia contributes to the development of BPD, inhibits cell proliferation and decreases cell survival. The mechanisms responsible for the protective effect of caffeine in pulmonary oxygen toxicity remain largely unknown. A549 and MLE 12 pulmonary epithelial cells were exposed to hyperoxia or maintained in room air, in the presence of different concentrations (0, 0.05, 0.1 and 1 mM) of caffeine. Caffeine had a differential concentration-specific effect on cell cycle progression, oxidative stress and viability, with 1 mM concentration being deleterious and 0.05 mM being protective. Reactive oxygen species (ROS) generation during hyperoxia was modulated by caffeine in a similar concentration-specific manner. Caffeine at 1 mM, but not at the 0.05 mM concentration decreased the G2 arrest in these cells. Taken together this study shows the novel funding that caffeine has a concentration-specific effect on cell cycle regulation, ROS generation, and cell survival in hyperoxic conditions

Differential concentration-specific effects of caffeine on cell viability, oxidative stress, and cell cycle in pulmonary oxygen toxicity in vitro

Energy Technology Data Exchange (ETDEWEB)

Tiwari, Kirti Kumar; Chu, Chun; Couroucli, Xanthi; Moorthy, Bhagavatula; Lingappan, Krithika, E-mail: lingappa@bcm.edu

2014-08-08

Highlights: • Caffeine at 0.05 mM decreases oxidative stress in hyperoxia. • Caffeine at 1 mM decreases cell viability, increases oxidative stress in hyperoxia. • Caffeine at 1 but not 0.05 mM, abrogates hyperoxia-induced G2/M arrest. - Abstract: Caffeine is used to prevent bronchopulmonary dysplasia (BPD) in premature neonates. Hyperoxia contributes to the development of BPD, inhibits cell proliferation and decreases cell survival. The mechanisms responsible for the protective effect of caffeine in pulmonary oxygen toxicity remain largely unknown. A549 and MLE 12 pulmonary epithelial cells were exposed to hyperoxia or maintained in room air, in the presence of different concentrations (0, 0.05, 0.1 and 1 mM) of caffeine. Caffeine had a differential concentration-specific effect on cell cycle progression, oxidative stress and viability, with 1 mM concentration being deleterious and 0.05 mM being protective. Reactive oxygen species (ROS) generation during hyperoxia was modulated by caffeine in a similar concentration-specific manner. Caffeine at 1 mM, but not at the 0.05 mM concentration decreased the G2 arrest in these cells. Taken together this study shows the novel funding that caffeine has a concentration-specific effect on cell cycle regulation, ROS generation, and cell survival in hyperoxic conditions.

Conservation and sex-specific splicing of the doublesex gene

Indian Academy of Sciences (India)

Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...

Freedom of expression: cell-type-specific gene profiling.

Science.gov (United States)

Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

2014-01-01

Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.

International conference on string theory

CERN Document Server

2017-01-01

The Strings 2017 conference is part of the "Strings" series of annual conferences, that bring the entire string theory community together. It will include reviews of major developments in the field, and specialized talks on specific topics. There will also be several public lectures given by conference participants, a pre-Strings school at the Technion, and a post-Strings workshop at the Weizmann Institute.

Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

Directory of Open Access Journals (Sweden)

Vaiman Daniel

2005-05-01

Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

Science.gov (United States)

2013-01-01

Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the

Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

Directory of Open Access Journals (Sweden)

Masaki Takahashi

2015-01-01

Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

[Analysis of tissue-specific differentially methylated genes with differential gene expression in non-small cell lung cancer].

Science.gov (United States)

Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q

2014-01-01

Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.

Towards the identification of flower-specific genes in Citrus spp

Directory of Open Access Journals (Sweden)

Marcelo Carnier Dornelas

2007-01-01

Full Text Available Citrus sinensis is a perennial woody species, for which genetic approaches to the study of reproductive development are not readily amenable. Here, the usefulness of the CitEST Expressed Sequence Tag (EST database is demonstrated as a reliable new resource for identifying novel genes exclusively related to Citrus reproductive biology. We performed the analysis of an EST dataset of the CitEST Project containing 4,330 flower-derived cDNA sequences. Relying on bioinformatics tools, sequences exclusively present in this flower-derived sequence collection were selected and used for the identification of Citrus putative flower-specific genes. Our analysis revealed several Citrus sequences showing significant similarity to conserved genes known to have flower-specific expression and possessing functions related to flower metabolism and/or reproductive development in diverse plant species. Comparison of the Citrus flower-specific sequences with all available plant peptide sequences unraveled 247 unique transcripts not identified elsewhere within the plant kingdom. Additionally, 49 transcripts, for which no biological function could be attributed by means of sequence comparisons, were found to be conserved among plant species. These results allow further gene expression analysis and possibly novel approaches to the understanding of reproductive development in Citrus.

Analysis of cell-type-specific gene expression during mouse spermatogenesis

DEFF Research Database (Denmark)

Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser

2004-01-01

In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...

Do market participants learn from conference calls?

NARCIS (Netherlands)

Roelofsen, E.; Verbeeten, F.; Mertens, G.

2014-01-01

We examine whether market participants learn from the information that is disseminated during the Q-and-A section of conference calls. Specifically, we investigate whether stock prices react to information on intangible assets provided during conference calls, and whether conference calls

A novel multi-network approach reveals tissue-specific cellular modulators of fibrosis in systemic sclerosis.

Science.gov (United States)

Taroni, Jaclyn N; Greene, Casey S; Martyanov, Viktor; Wood, Tammara A; Christmann, Romy B; Farber, Harrison W; Lafyatis, Robert A; Denton, Christopher P; Hinchcliff, Monique E; Pioli, Patricia A; Mahoney, J Matthew; Whitfield, Michael L

2017-03-23

Systemic sclerosis (SSc) is a multi-organ autoimmune disease characterized by skin fibrosis. Internal organ involvement is heterogeneous. It is unknown whether disease mechanisms are common across all involved affected tissues or if each manifestation has a distinct underlying pathology. We used consensus clustering to compare gene expression profiles of biopsies from four SSc-affected tissues (skin, lung, esophagus, and peripheral blood) from patients with SSc, and the related conditions pulmonary fibrosis (PF) and pulmonary arterial hypertension, and derived a consensus disease-associate signature across all tissues. We used this signature to query tissue-specific functional genomic networks. We performed novel network analyses to contrast the skin and lung microenvironments and to assess the functional role of the inflammatory and fibrotic genes in each organ. Lastly, we tested the expression of macrophage activation state-associated gene sets for enrichment in skin and lung using a Wilcoxon rank sum test. We identified a common pathogenic gene expression signature-an immune-fibrotic axis-indicative of pro-fibrotic macrophages (MØs) in multiple tissues (skin, lung, esophagus, and peripheral blood mononuclear cells) affected by SSc. While the co-expression of these genes is common to all tissues, the functional consequences of this upregulation differ by organ. We used this disease-associated signature to query tissue-specific functional genomic networks to identify common and tissue-specific pathologies of SSc and related conditions. In contrast to skin, in the lung-specific functional network we identify a distinct lung-resident MØ signature associated with lipid stimulation and alternative activation. In keeping with our network results, we find distinct MØ alternative activation transcriptional programs in SSc-associated PF lung and in the skin of patients with an "inflammatory" SSc gene expression signature. Our results suggest that the innate immune

Genetic and molecular risk factors within the newly identified primate-specific exon of the SAP97/DLG1 gene in the 3q29 schizophrenia-associated locus.

Science.gov (United States)

Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru

2017-12-01

The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.

Specific gene mutations induced by heavy ions

International Nuclear Information System (INIS)

Freeling, M.; Karoly, C.W.; Cheng, D.S.K.

1980-01-01

This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens

Denervation of pulmonary artery during mitral valve surgery in patients with high pulmonary hypertension

Directory of Open Access Journals (Sweden)

А. В. Богачев-Прокофьев

2016-01-01

Full Text Available Objective. Pulmonary hypertension impairs the mitral valve and often leads to more severe symptoms of heart failure, low exercise tolerance and thus higher rates of morbidity and mortality. The purpose of this study is to evaluate the safety and efficacy of simultaneous radiofrequency ablation of ganglionated plexi of the pulmonary artery in patients with high pulmonary hypertension during mitral valve surgery.Methods. The inclusion criteria were based on patients’ echocardiography/right heart catheterization data. The main criteria were mean pulmonary artery pressure ≥40 mm Hg at rest and a positive reactive test with nitric oxide inhalation. From January 2014 to May 2015, 14 patients underwent radiofrequency denervation of the pulmonary artery in addition to planned mitral valve surgery. Mean patient age was 53.4±7.8 years, with 57.1% of patients being females.Results. Mean cardiopulmonary bypass time was 116±12 minutes, mean cross-clamp time was 95±13 minutes, and mean ablation time amounted to 9.5±3.1 minutes. Pulmonary artery pressure decreased significantly from a mean of 56.5±9.8 mmHg to 32.0±7.3 mmHg immediately after the operation (p<0.001, and to 28.4±5.2 mmHg and 29.7±4.4 mmHg on the first and third days at ICU respectively. Mean ICU stay was 3.1±1.2 days. There were neither early deaths nor specific complications.Conclusions. Simultaneous radiofrequency ablation of pulmonary artery ganglionated plexi when performing mitral valve surgery in patients with pulmonary hypertension is a safe and effective procedure. Further research and long-term follow-up would help to determine whether a decrease in the mean pressure of the pulmonary artery can be interpreted as a clinical advantage.

Pulmonary artery-to-pulmonary artery anastomoses: angiographic demonstration in patients with chronic thromboembolic pulmonary hypertension

International Nuclear Information System (INIS)

Hodson, J.; Graham, A.; Hughes, J.M.B.; Gibbs, J.S.R.; Jackson, J.E.

2006-01-01

AIM: To describe direct pulmonary artery-to-pulmonary artery anastomoses seen at pulmonary angiography in patients with chronic thromboembolic pulmonary hypertension and discuss their possible significance. MATERIALS AND METHODS: Between 1 August 2000 and 31 July 2004 43 patients (male-to-female ratio 25:18) with a diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH) underwent selective pulmonary angiography to assess the extent of disease and suitability for surgical pulmonary endarterectomy. The mean pulmonary artery pressure ranged from 27-84 mmHg (average of 51 mmHg). Selective bilateral digital subtraction pulmonary angiograms performed in all individuals were reviewed for the presence of intrapulmonary collaterals. RESULTS: In 15 of the 43 patients (male-to-female ratio =7:8) definite (n=12) or probable (n=3) pulmonary artery-to-pulmonary artery anastomoses were demonstrated. Of the remaining 28 patients in whom intrapulmonary collaterals were not seen it was felt that in 16 the angiograms were of insufficient diagnostic quality (grades 4-5) to exclude their presence. Twelve patients, eight of whom had angiograms of sufficient diagnostic quality (grades 1-3), demonstrated one or more areas of luxury perfusion but intrapulmonary collaterals were not seen. CONCLUSION: Direct pulmonary artery-to-pulmonary artery anastomoses were demonstrated in patients with chronic thromboembolic pulmonary hypertension, which to our knowledge have not been previously described. The importance of these collateral vessels is unclear but they may play a role in the maintenance of pulmonary parenchymal viability in patients with chronic pulmonary embolic disease. The rate of development of these collaterals and their prognostic significance in patients with chronic thromboembolic pulmonary hypertension are areas worthy of further study

Pulmonary artery-to-pulmonary artery anastomoses: angiographic demonstration in patients with chronic thromboembolic pulmonary hypertension

Energy Technology Data Exchange (ETDEWEB)

Hodson, J. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Graham, A. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Hughes, J.M.B. [Department of Respiratory Medicine, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Gibbs, J.S.R. [Department of Cardiology, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Jackson, J.E. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom)]. E-mail: jejackson@hhnt.org

2006-03-15

AIM: To describe direct pulmonary artery-to-pulmonary artery anastomoses seen at pulmonary angiography in patients with chronic thromboembolic pulmonary hypertension and discuss their possible significance. MATERIALS AND METHODS: Between 1 August 2000 and 31 July 2004 43 patients (male-to-female ratio 25:18) with a diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH) underwent selective pulmonary angiography to assess the extent of disease and suitability for surgical pulmonary endarterectomy. The mean pulmonary artery pressure ranged from 27-84 mmHg (average of 51 mmHg). Selective bilateral digital subtraction pulmonary angiograms performed in all individuals were reviewed for the presence of intrapulmonary collaterals. RESULTS: In 15 of the 43 patients (male-to-female ratio =7:8) definite (n=12) or probable (n=3) pulmonary artery-to-pulmonary artery anastomoses were demonstrated. Of the remaining 28 patients in whom intrapulmonary collaterals were not seen it was felt that in 16 the angiograms were of insufficient diagnostic quality (grades 4-5) to exclude their presence. Twelve patients, eight of whom had angiograms of sufficient diagnostic quality (grades 1-3), demonstrated one or more areas of luxury perfusion but intrapulmonary collaterals were not seen. CONCLUSION: Direct pulmonary artery-to-pulmonary artery anastomoses were demonstrated in patients with chronic thromboembolic pulmonary hypertension, which to our knowledge have not been previously described. The importance of these collateral vessels is unclear but they may play a role in the maintenance of pulmonary parenchymal viability in patients with chronic pulmonary embolic disease. The rate of development of these collaterals and their prognostic significance in patients with chronic thromboembolic pulmonary hypertension are areas worthy of further study.

SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.

Science.gov (United States)

Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan

2013-04-30

The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.

Injury, inflammation and the emergence of human specific genes

Science.gov (United States)

2016-07-12

genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate

Acrolein effects in pulmonary cells: relevance to chronic obstructive pulmonary disease.

Science.gov (United States)

Moretto, Nadia; Volpi, Giorgia; Pastore, Fiorella; Facchinetti, Fabrizio

2012-07-01

Acrolein (2-propenal) is a highly reactive α,β-unsaturated aldehyde and a respiratory irritant that is ubiquitously present in the environment but that can also be generated endogenously at sites of inflammation. Acrolein is abundant in tobacco smoke, which is the major environmental risk factor for chronic obstructive pulmonary disease (COPD), and elevated levels of acrolein are found in the lung fluids of COPD patients. Its high electrophilicity makes acrolein notorious for its facile reaction with biological nucleophiles, leading to the modification of proteins and DNA and depletion of antioxidant defenses. As a consequence, acrolein results in oxidative stress as well as altered intracellular signaling and gene transcription/translation. In pulmonary cells, acrolein, at subtoxic concentrations, can activate intracellular stress kinases, alter the production of inflammatory mediators and proteases, modify innate immune response, induce mucus hypersecretion, and damage airway epithelium. A better comprehension of the mechanisms underlying acrolein effects in the airways may suggest novel treatment strategies in COPD. © 2012 New York Academy of Sciences.

125I-Clq-binding and specific antibodies as indicators of pulmonary disease activity in cystic fibrosis

International Nuclear Information System (INIS)

Moss, R.B.; Hsu, Y.P.; Lewiston, N.J.

1981-01-01

We studied the incidence and levels of circulating immune complexes by the 125 I-Clq-binding assay in patients with cystic fibrosis in relation to clinical respiratory status and specific IgG and IgE antibodies to Pseudomonas aeruginosa. Staphylococcus aureus, Aspergillus fumigatus, and Candida albicans. Overall prevalence of CIC was 43%, but 86% of serially studied patients had evidence of CIC at some time. Patients with acute respiratory exacerbations and deteriorating pulmonary function had a higher incidence of CIC (76%) as compared to stable patients (36%, P less than 0.01), as well as significantly higher levels of CIC. Acute exacerbations were also associated with significant increases in IgG antibody to Pseudomonas (P less than 0.005) but not in other antibodies. CIC did not correlate with Pseudomonas-specific IgG nor with any other specific antibody studied. A variety of age-related differences in specific antibody levels were seen. The episodic appearance of CIC is common in CF and is usually associated with exacerbation of lung disease

Fibroblast growth factor 10 haploinsufficiency causes chronic obstructive pulmonary disease.

Science.gov (United States)

Klar, Joakim; Blomstrand, Peter; Brunmark, Charlott; Badhai, Jitendra; Håkansson, Hanna Falk; Brange, Charlotte Sollie; Bergendal, Birgitta; Dahl, Niklas

2011-10-01

Genetic factors influencing lung function may predispose to chronic obstructive pulmonary disease (COPD). The fibroblast growth factor 10 (FGF10) signalling pathway is critical for lung development and lung epithelial renewal. The hypothesis behind this study was that constitutive FGF10 insufficiency may lead to pulmonary disorder. Therefore investigation of the pulmonary functions of patients heterozygous for loss of function mutations in the FGF10 gene was performed. The spirometric measures of lung function from patients and non-carrier siblings were compared and both groups were related to matched reference data for normal human lung function. The patients show a significant decrease in lung function parameters when compared to control values. The average FEV1/IVC quota (FEV1%) for the patients is 0.65 (80% of predicted) and reversibility test using Terbutalin resulted in a 3.7% increase in FEV1. Patients with FGF10 haploinsufficiency have lung function parameters indicating COPD. A modest response to Terbutalin confirms an irreversible obstructive lung disease. These findings support the idea that genetic variants affecting the FGF10 signalling pathway are important determinants of lung function that may ultimately contribute to COPD. Specifically, the results show that FGF10 haploinsufficiency affects lung function measures providing a model for a dosage sensitive effect of FGF10 in the development of COPD.

Radiation-induced pulmonary gene expression changes are attenuated by the CTGF antibody Pamrevlumab.

Science.gov (United States)

Sternlicht, Mark D; Wirkner, Ute; Bickelhaupt, Sebastian; Lopez Perez, Ramon; Tietz, Alexandra; Lipson, Kenneth E; Seeley, Todd W; Huber, Peter E

2018-01-18

Fibrosis is a delayed side effect of radiation therapy (RT). Connective tissue growth factor (CTGF) promotes the development of fibrosis in multiple settings, including pulmonary radiation injury. To better understand the cellular interactions involved in RT-induced lung injury and the role of CTGF in these responses, microarray expression profiling was performed on lungs of irradiated and non-irradiated mice, including mice treated with the anti-CTGF antibody pamrevlumab (FG-3019). Between group comparisons (Welch's t-tests) and principal components analyses were performed in Genespring. At the mRNA level, the ability of pamrevlumab to prolong survival and ameliorate RT-induced radiologic, histologic and functional lung deficits was correlated with the reversal of a clear enrichment in mast cell, macrophage, dendritic cell and mesenchymal gene signatures. Cytokine, growth factor and matrix remodeling genes that are likely to contribute to RT pneumonitis and fibrosis were elevated by RT and attenuated by pamrevlumab, and likely contribute to the cross-talk between enriched cell-types in injured lung. CTGF inhibition had a normalizing effect on select cell-types, including immune cells not typically regarded as being regulated by CTGF. These results suggest that interactions between RT-recruited cell-types are critical to maintaining the injured state; that CTGF plays a key role in this process; and that pamrevlumab can ameliorate RT-induced lung injury in mice and may provide therapeutic benefit in other immune and fibrotic disorders.

Next-generation text-mining mediated generation of chemical response-specific gene sets for interpretation of gene expression data

NARCIS (Netherlands)

K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)

2013-01-01

textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with

Role of nuclear medicine in pulmonary neoplastic processes

International Nuclear Information System (INIS)

Waxman, A.D.

1986-01-01

It has been demonstrated that the single most important factor in determining survival in patients with bronchogenic carcinoma is the extent of spread of metastasis from the primary lesion. This explains the extensive efforts in developing accurate staging tests for pulmonary tumors, both primary and metastatic, with special emphasis on the determination of pulmonary hilar and mediastinal spread of disease. Continued improvements in nuclear medicine instrumentation along with the development of tumor specific radiopharmaceuticals, as well as agents that have the capability of tracking tumor viability, have changed the orientation of scintigraphic techniques in the evaluation of pulmonary neoplastic processes. Gallium scintigraphy is no longer considered as a primary imaging modality in the staging of pulmonary tumors, and in most institutions has been replaced by computed tomography (CT) for this purpose. It has been demonstrated that gallium, relative to other imaging modalities, is a sensitive indicator of hilar spread of tumor. However, because of the normally high background activity within the sternum and spine, mediastinal abnormalities are poorly detected. Since most pulmonary tumors metastasize via regional nodes to the pulmonary hilum and then to the mediastinum, the high sensitivity for the detection of pulmonary hilar abnormalities and the high specificity for mediastinal lesion detection suggest that gallium scintigraphy is a valuable adjunctive test when used appropriately. Thallium 201 as a tumor agent is being studied by several institutions. Preliminary results indicate a high degree of sensitivity for the detection of pulmonary hilar and mediastinal lesions and there are early indications that thallium is a promising agent to evaluate tumor viability. 52 references

Heterozygous RTEL1 mutations are associated with familial pulmonary fibrosis.

Science.gov (United States)

Kannengiesser, Caroline; Borie, Raphael; Ménard, Christelle; Réocreux, Marion; Nitschké, Patrick; Gazal, Steven; Mal, Hervé; Taillé, Camille; Cadranel, Jacques; Nunes, Hilario; Valeyre, Dominique; Cordier, Jean François; Callebaut, Isabelle; Boileau, Catherine; Cottin, Vincent; Grandchamp, Bernard; Revy, Patrick; Crestani, Bruno

2015-08-01

Pulmonary fibrosis is a fatal disease with progressive loss of respiratory function. Defective telomere maintenance leading to telomere shortening is a cause of pulmonary fibrosis, as mutations in the telomerase component genes TERT (reverse transcriptase) and TERC (RNA component) are found in 15% of familial pulmonary fibrosis (FPF) cases. However, so far, about 85% of FPF remain genetically uncharacterised.Here, in order to identify new genetic causes of FPF, we performed whole-exome sequencing, with a candidate-gene approach, of 47 affected subjects from 35 families with FPF without TERT and TERC mutations.We identified heterozygous mutations in regulator of telomere elongation helicase 1 (RTEL1) in four families. RTEL1 is a DNA helicase with roles in DNA replication, genome stability, DNA repair and telomere maintenance. The heterozygous RTEL1 mutations segregated as an autosomal dominant trait in FPF, and were predicted by structural analyses to severely affect the function and/or stability of RTEL1. In agreement with this, RTEL1-mutated patients exhibited short telomeres in comparison with age-matched controls.Our results provide evidence that heterozygous RTEL1 mutations are responsible for FPF and, thereby, extend the clinical spectrum of RTEL1 deficiency. Thus, RTEL1 enlarges the number of telomere-associated genes implicated in FPF. Copyright ©ERS 2015.

Pulmonary alveolar microlithiasis. A review including ultrastructural and pulmonary function studies

International Nuclear Information System (INIS)

Prakash, U.B.; Barham, S.S.; Rosenow, E.C.; Brown, M.L.; Payne, W.S.

1983-01-01

Pulmonary alveolar microlithiasis is a rare disease of unknown cause in which calcium phosphate microliths are deposited throughout the lungs. These deposits are of sufficient density to be almost diagnostic on chest roentgenograms. The Mayo Clinic experience with 8 patients is added to the approximately 120 cases reported in the world literature. The age range of all patients is from newborn to 80 years, with a mean age at diagnosis of about 35 years. No sexual predominance has been noted, but in about half of the reported cases a familial pattern has been found. The progression of the disease is generally very slow, some patients having been followed up for more than 30 years without evidence of change. No specific treatment is available. Pulmonary function studies demonstrate a tendency toward a restrictive pattern. Technetium-99m scanning and scanning and transmission electron microscopy are useful procedures for analysis of pulmonary alveolar microliths

bHLH106 Integrates Functions of Multiple Genes through Their G-Box to Confer Salt Tolerance on Arabidopsis.

Science.gov (United States)

Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu

2015-01-01

An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.

Molecular detection and species-specific identification of medically important Aspergillus species by real-time PCR in experimental invasive pulmonary aspergillosis.

Science.gov (United States)

Walsh, Thomas J; Wissel, Mark C; Grantham, Kevin J; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P; Hughes, Johanna E; Greene, Lora; Bacher, John D; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B; Reddy, Sushruth K

2011-12-01

Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P < 0.0007) and treated (P ≤ 0.008) animals, respectively. For infections caused by A. terreus and A. niger, culture and PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients.

2012 Gordon Research Conference, Mitochondria and Chloroplasts, July 29 - Aug 3 2012

Energy Technology Data Exchange (ETDEWEB)

Barkan, Alice [Univ. of Oregon, Eugene, OR (United States)

2012-08-03

The 2012 Gordon Research Conference on Mitochondria and Chloroplasts will assemble an international group of scientists investigating fundamental properties of these organelles, and their integration into broader physiological processes. The conference will emphasize the many commonalities between mitochondria and chloroplasts: their evolution from bacterial endosymbionts, their genomes and gene expression systems, their energy transducing membranes whose proteins derive from both nuclear and organellar genes, the challenge of maintaining organelle integrity in the presence of the reactive oxygen species that are generated during energy transduction, their incorporation into organismal signaling pathways, and more. The conference will bring together investigators working in animal, plant, fungal and protozoan systems who specialize in cell biology, genetics, biochemistry, physiology, proteomics, genomics, and structural biology. As such, this conference will provide a unique forum that engenders cross-disciplinary discussions concerning the biogenesis, dynamics, and regulation of these key cellular structures. By fostering interactions among mammalian, fungal and plant organellar biologists, this conference also provides a conduit for the transmission of mechanistic insights obtained in model organisms to applications in medicine and agriculture. The 2012 conference will highlight areas that are moving rapidly and emerging themes. These include new insights into the ultrastructure and organization of the energy transducing membranes, the coupling of organellar gene expression with the assembly of photosynthetic and respiratory complexes, the regulatory networks that couple organelle biogenesis with developmental and physiological signals, the signaling events through which organellar physiology influences nuclear gene expression, and the roles of organelles in disease and development.

Imaging features of diffuse pulmonary hemorrhage; Roentgenmorphologie von diffusen Lungenhaemorrhagien

Energy Technology Data Exchange (ETDEWEB)

Schmit, M.; Vogel, W.; Horger, M.

2006-09-15

There are diverse etiologies of diffuse pulmonary hemorrhage, so specific diagnosis may be difficult. Conventional radiography tends to be misleading as hemoptysis may lacking in patients with hemorrhagic anemia. Diffuse pulmonary hemorrhage should be differentiated from focal pulmonary hemorrhage resulting from chronic bronchitis, bronchiectasis, active infection (tuberculosis) neoplasia, trauma, or embolism. (orig.)

ACR Appropriateness Criteria® Suspected Pulmonary Hypertension.

Science.gov (United States)

Sirajuddin, Arlene; Donnelly, Edwin F; Crabtree, Traves P; Henry, Travis S; Iannettoni, Mark D; Johnson, Geoffrey B; Kazerooni, Ella A; Maldonado, Fabien; Olsen, Kathryn M; Wu, Carol C; Mohammed, Tan-Lucien; Kanne, Jeffrey P

2017-05-01

Pulmonary hypertension may be idiopathic or related to a large variety of diseases. Various imaging examinations that may be helpful in diagnosing and determining the etiology of pulmonary hypertension are discussed. Imaging examinations that may aid in the diagnosis of pulmonary hypertension include chest radiography, ultrasound echocardiography, ventilation/perfusion scans, CT, MRI, right heart catheterization, pulmonary angiography, and fluorine-18-2-fluoro-2-deoxy-d-glucose PET/CT. The American College of Radiology Appropriateness Criteria are evidence-based guidelines for specific clinical conditions that are reviewed annually by a multidisciplinary expert panel. The guideline development and revision include an extensive analysis of current medical literature from peer reviewed journals and the application of well-established methodologies (RAND/UCLA Appropriateness Method and Grading of Recommendations Assessment, Development, and Evaluation or GRADE) to rate the appropriateness of imaging and treatment procedures for specific clinical scenarios. In those instances where evidence is lacking or equivocal, expert opinion may supplement the available evidence to recommend imaging or treatment. Copyright © 2017 American College of Radiology. Published by Elsevier Inc. All rights reserved.

The Writing Conference as Performance.

Science.gov (United States)

Newkirk, Thomas

1995-01-01

Provides an overview of the conversational roles taken on by students and teachers during college-level writing conferences. Uses the performative theory of Erving Goffman to analyze these role patterns. Illuminates the specific performative demands presented by writing conferences on both students and teachers. (HB)

Identification of regulated genes conferring resistance to high concentrations of glyphosate in a new strain of Enterobacter.

Science.gov (United States)

Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie

2013-12-01

Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

[Study of androgen receptor and phosphoglycerate kinase gene polymorphism in major cellular components of the so-called pulmonary sclerosing hemangioma].

Science.gov (United States)

Qi, Feng-jie; Zhang, Xiu-wei; Zhang, Yong-xing; Dai, Shun-dong; Wang, En-hua

2006-05-01

To study the clonality of polygonal cells and surface cuboidal cells in the so-called pulmonary sclerosing hemangioma (PSH). 17 female surgically resected PSH were found. The polygonal cells and surface cuboidal cells of the 17 PSH cases were microdissected from routine hematoxylin and eosin-stained sections. Genomic DNA was extracted, pretreated through incubation with methylation-sensitive restrictive endonuclease HhaI or HpaII, and amplified by nested polymerase chain reaction for X chromosome-linked androgen receptor (AR) and phosphoglycerate kinase (PGK) genes. The length polymorphism of AR gene was demonstrated by denaturing polyacrylamide gel electrophoresis and silver staining. The PGK gene products were treated with Bst XI and resolved on agarose gel. Amongst the 17 female cases of PSH, 15 samples were successfully amplified for AR and PGK genes. The rates of polymorphism were 53% (8/15) and 27% (4/15) for AR and PGK genes respectively. Polygonal cells and surface cuboidal cells of 10 cases which were suitable for clonality study, showed the same loss of alleles (clonality ratio = 0) or unbalanced methylation pattern (clonality ratio < 0.25). The polygonal cells and surface cuboidal cells in PSH demonstrate patterns of monoclonal proliferation, indicating that both represent true neoplastic cells.

Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.

Science.gov (United States)

Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

2017-06-08

A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.

The Critical Role of Pulmonary Arterial Compliance in Pulmonary Hypertension

Science.gov (United States)

Prins, Kurt W.; Pritzker, Marc R.; Scandurra, John; Volmers, Karl; Weir, E. Kenneth

2016-01-01

The normal pulmonary circulation is a low-pressure, high-compliance system. Pulmonary arterial compliance decreases in the presence of pulmonary hypertension because of increased extracellular matrix/collagen deposition in the pulmonary arteries. Loss of pulmonary arterial compliance has been consistently shown to be a predictor of increased mortality in patients with pulmonary hypertension, even more so than pulmonary vascular resistance in some studies. Decreased pulmonary arterial compliance causes premature reflection of waves from the distal pulmonary vasculature, leading to increased pulsatile right ventricular afterload and eventually right ventricular failure. Evidence suggests that decreased pulmonary arterial compliance is a cause rather than a consequence of distal small vessel proliferative vasculopathy. Pulmonary arterial compliance decreases early in the disease process even when pulmonary artery pressure and pulmonary vascular resistance are normal, potentially enabling early diagnosis of pulmonary vascular disease, especially in high-risk populations. With the recognition of the prognostic importance of pulmonary arterial compliance, its impact on right ventricular function, and its contributory role in the development and progression of distal small-vessel proliferative vasculopathy, pulmonary arterial compliance is an attractive target for the treatment of pulmonary hypertension. PMID:26848601

Multiyear evaluation of the durability of the resistance conferred by Ma and RMia genes to Meloidogyne incognita in Prunus under controlled conditions.

Science.gov (United States)

Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel

2013-08-01

Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to

Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.

Directory of Open Access Journals (Sweden)

Chen Xie

2012-09-01

Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.

Translation to Spanish and Validation of the Specific Saint George's Questionnaire for Idiopathic Pulmonary Fibrosis.

Science.gov (United States)

Capparelli, Ignacio; Fernandez, Martín; Saadia Otero, Marcela; Steimberg, Jimena; Brassesco, María; Campobasso, Ana; Palacios, Sandra; Caro, Fabian; Alberti, María Laura; Rabinovich, Roberto A; Paulin, Francisco

2018-02-01

Interstitial lung disease (ILD) is associated with low exercise tolerance, dyspnea, and decreased health-related quality of life (HRQL). Idiopathic pulmonary fibrosis (IPF) is one of the most prevalent in the group. A specific version of the Saint George's questionnaire (SGRQ-I) has been developed to quantify the HRQL of IPF patients. However, this tool is not currently validated in the Spanish language. The objective was to translate into Spanish and validate the specific Saint George's Respiratory Questionnaire for idiopathic pulmonary fibrosis (SGRQ-I). The repeatability, internal consistency and construct validity of the SGRQ-I in Spanish were analyzed after a backtranslation process. In total, 23 outpatients with IPF completed the translated SGRQ-I twice, 7 days apart. Repeatability was studied, revealing good concordance in test-retest with an ICC (interclass correlation coefficient) of 0.96 (P<.001). Internal consistency was good for different questionnaire items (Cronbach's alpha of 0.9 including and 0.81 excluding the total value) (P<.001). The total score of the questionnaire showed good correlation with forced vital capacity FVC% (r=-0.44; P=.033), diffusing capacity of the lungs for carbon monoxide (DL CO %) (r=-0.55; P=.011), partial pressure of oxygen in arterial blood PaO 2 (r=-0.44; P=.036), Medical Research Council Dyspnea scale (r=-0.65; P<.001), and number of steps taken in 24hours (r=-0.47; P=.024). The Spanish version of SGRQ-Ideveloped by our group shows good internal consistency, reproducibility and validity, so it can be used for the evaluation of quality of life (QOL) in IPF patients. Copyright © 2017 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

Epistasis among Drosophila persimilis factors conferring hybrid male sterility with D. pseudoobscura bogotana.

Directory of Open Access Journals (Sweden)

Audrey S Chang

2010-10-01

Full Text Available The Bateson-Dobzhansky-Muller model posits that hybrid incompatibilities result from genetic changes that accumulate during population divergence. Indeed, much effort in recent years has been devoted to identifying genes associated with hybrid incompatibilities, often with limited success, suggesting that hybrid sterility and inviability are frequently caused by complex interactions between multiple loci and not by single or a small number of gene pairs. Our previous study showed that the nature of epistasis between sterility-conferring QTL in the Drosophila persimilis-D. pseudoobscura bogotana species pair is highly specific. Here, we further dissect one of the three QTL underlying hybrid male sterility between these species and provide evidence for multiple factors within this QTL. This result indicates that the number of loci thought to contribute to hybrid dysfunction may have been underestimated, and we discuss how linkage and complex epistasis may be characteristic of the genetics of hybrid incompatibilities. We further pinpoint the location of one locus that confers hybrid male sterility when homozygous, dubbed "mule-like", to roughly 250 kilobases.

Epistasis among Drosophila persimilis factors conferring hybrid male sterility with D. pseudoobscura bogotana.

Science.gov (United States)

Chang, Audrey S; Bennett, Sarah M; Noor, Mohamed A F

2010-10-27

The Bateson-Dobzhansky-Muller model posits that hybrid incompatibilities result from genetic changes that accumulate during population divergence. Indeed, much effort in recent years has been devoted to identifying genes associated with hybrid incompatibilities, often with limited success, suggesting that hybrid sterility and inviability are frequently caused by complex interactions between multiple loci and not by single or a small number of gene pairs. Our previous study showed that the nature of epistasis between sterility-conferring QTL in the Drosophila persimilis-D. pseudoobscura bogotana species pair is highly specific. Here, we further dissect one of the three QTL underlying hybrid male sterility between these species and provide evidence for multiple factors within this QTL. This result indicates that the number of loci thought to contribute to hybrid dysfunction may have been underestimated, and we discuss how linkage and complex epistasis may be characteristic of the genetics of hybrid incompatibilities. We further pinpoint the location of one locus that confers hybrid male sterility when homozygous, dubbed "mule-like", to roughly 250 kilobases.

Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.

OpenAIRE

Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M

1989-01-01

Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...

Differentially expressed plasma microRNAs and the potential regulatory function of Let-7b in chronic thromboembolic pulmonary hypertension.

Directory of Open Access Journals (Sweden)

Lijuan Guo

Full Text Available Chronic thromboembolic pulmonary hypertension (CTEPH is a progressive disease characterized by misguided thrombolysis and remodeling of pulmonary arteries. MicroRNAs are small non-coding RNAs involved in multiple cell processes and functions. During CTEPH, circulating microRNA profile endued with characteristics of diseased cells could be identified as a biomarker, and might help in recognition of pathogenesis. Thus, in this study, we compared the differentially expressed microRNAs in plasma of CTEPH patients and healthy controls and investigated their potential functions. Microarray was used to identify microRNA expression profile and qRT-PCR for validation. The targets of differentially expressed microRNAs were identified in silico, and the Gene Ontology database and Kyoto Encyclopedia of Genes and Genomes pathway database were used for functional investigation of target gene profile. Targets of let-7b were validated by fluorescence reporter assay. Protein expression of target genes was determined by ELISA or western blotting. Cell migration was evaluated by wound healing assay. The results showed that 1 thirty five microRNAs were differentially expressed in CTEPH patients, among which, a signature of 17 microRNAs, which was shown to be related to the disease pathogenesis by in silico analysis, gave diagnostic efficacy of both sensitivity and specificity >0.9. 2 Let-7b, one of the down-regulated anti-oncogenic microRNAs in the signature, was validated to decrease to about 0.25 fold in CTEPH patients. 3 ET-1 and TGFBR1 were direct targets of let-7b. Altering let-7b level influenced ET-1 and TGFBR1 expression in pulmonary arterial endothelial cells (PAECs as well as the migration of PAECs and pulmonary arterial smooth muscle cells (PASMCs. These results suggested that CTEPH patients had aberrant microRNA signature which might provide some clue for pathogenesis study and biomarker screening. Reduced let-7b might be involved in the pathogenesis of

Differentially Expressed Plasma MicroRNAs and the Potential Regulatory Function of Let-7b in Chronic Thromboembolic Pulmonary Hypertension

Science.gov (United States)

Guo, Lijuan; Yang, Yuanhua; Liu, Jie; Wang, Lei; Li, Jifeng; Wang, Ying; Liu, Yan; Gu, Song; Gan, Huili; Cai, Jun; Yuan, Jason X.-J.; Wang, Jun; Wang, Chen

2014-01-01

Chronic thromboembolic pulmonary hypertension (CTEPH) is a progressive disease characterized by misguided thrombolysis and remodeling of pulmonary arteries. MicroRNAs are small non-coding RNAs involved in multiple cell processes and functions. During CTEPH, circulating microRNA profile endued with characteristics of diseased cells could be identified as a biomarker, and might help in recognition of pathogenesis. Thus, in this study, we compared the differentially expressed microRNAs in plasma of CTEPH patients and healthy controls and investigated their potential functions. Microarray was used to identify microRNA expression profile and qRT-PCR for validation. The targets of differentially expressed microRNAs were identified in silico, and the Gene Ontology database and Kyoto Encyclopedia of Genes and Genomes pathway database were used for functional investigation of target gene profile. Targets of let-7b were validated by fluorescence reporter assay. Protein expression of target genes was determined by ELISA or western blotting. Cell migration was evaluated by wound healing assay. The results showed that 1) thirty five microRNAs were differentially expressed in CTEPH patients, among which, a signature of 17 microRNAs, which was shown to be related to the disease pathogenesis by in silico analysis, gave diagnostic efficacy of both sensitivity and specificity >0.9. 2) Let-7b, one of the down-regulated anti-oncogenic microRNAs in the signature, was validated to decrease to about 0.25 fold in CTEPH patients. 3) ET-1 and TGFBR1 were direct targets of let-7b. Altering let-7b level influenced ET-1 and TGFBR1 expression in pulmonary arterial endothelial cells (PAECs) as well as the migration of PAECs and pulmonary arterial smooth muscle cells (PASMCs). These results suggested that CTEPH patients had aberrant microRNA signature which might provide some clue for pathogenesis study and biomarker screening. Reduced let-7b might be involved in the pathogenesis of CTEPH by

Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

Directory of Open Access Journals (Sweden)

Quan Li

Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

Introgression and pyramiding into common bean market class fabada of genes conferring resistance to anthracnose and potyvirus.

Science.gov (United States)

Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón

2012-03-01

Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled

A rare sugar, d-allose, confers resistance to rice bacterial blight with upregulation of defense-related genes in Oryza sativa.

Science.gov (United States)

Kano, Akihito; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Satoh, Masaru; Fukumoto, Takeshi; Ohtani, Kouhei; Tajima, Shigeyuki; Izumori, Ken; Tanaka, Keiji; Ishida, Yutaka; Tada, Yasuomi; Nishizawa, Yoko; Akimitsu, Kazuya

2010-01-01

We investigated responses of rice plant to three rare sugars, d-altrose, d-sorbose, and d-allose, due to establishment of mass production methods for these rare sugars. Root growth and shoot growth were significantly inhibited by d-allose but not by the other rare sugars. A large-scale gene expression analysis using a rice microarray revealed that d-allose treatment causes a high upregulation of many defense-related, pathogenesis-related (PR) protein genes in rice. The PR protein genes were not upregulated by other rare sugars. Furthermore, d-allose treatment of rice plants conferred limited resistance of the rice against the pathogen Xanthomonas oryzae pv. oryzae but the other tested sugars did not. These results indicate that d-allose has a growth inhibitory effect but might prove to be a candidate elicitor for reducing disease development in rice.

Conferences as a Dramaturgical Learning Space

DEFF Research Database (Denmark)

Hansen, Nicoline Jacoby

Arguing that conferences are an important but under-researched and under-developed dimension of continuing education, the paper proposes a notion of conferences as a dramatic learning space. Using the design-based research methodology, a theoretical framework drawing on adult learning theories...... and dramaturgy is developed, consisting of four design principles: rhythm, reflection, involvement and interaction. These are sought implemented in a specific conference program, the case of the ECCI X conference, and the final program is explained and discussed....

Pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis

Energy Technology Data Exchange (ETDEWEB)

Chung, Myung Jin; Goo, Jin Mo E-mail: jmgoo@plaza.snu.ac.kr; Im, Jung-Gi

2004-11-01

Objectives: Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk of pulmonary tuberculosis. However, detecting pulmonary tuberculosis may be difficult due to the underlying fibrosis. The aim of this report is to describe the radiological and clinical findings of pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis. Materials and methods: We reviewed 143 consecutive patients in whom IPF was diagnosed by either the histological or radio-clinical criteria. Among them, nine patients were histologically (n=2) or bacteriologically (n=7) confirmed to have active pulmonary tuberculosis. The location and patterns of pulmonary tuberculosis were examined on a thin section CT scan. Results: The most common thin section CT findings were subpleural nodules (n=6; mean diameter, 3.2 cm) and a lobar or segmental consolidation (n=3). The lesions were located most commonly in the right lower lobe (n=4). The incidence of tuberculosis in patients with idiopathic pulmonary fibrosis was more than five times higher than that of the general population. Conclusion: The atypical manifestation of pulmonary tuberculosis is common in patients with idiopathic pulmonary fibrosis, which may mimic lung cancer or bacterial pneumonia.

Pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis

International Nuclear Information System (INIS)

Chung, Myung Jin; Goo, Jin Mo; Im, Jung-Gi

2004-01-01

Objectives: Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk of pulmonary tuberculosis. However, detecting pulmonary tuberculosis may be difficult due to the underlying fibrosis. The aim of this report is to describe the radiological and clinical findings of pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis. Materials and methods: We reviewed 143 consecutive patients in whom IPF was diagnosed by either the histological or radio-clinical criteria. Among them, nine patients were histologically (n=2) or bacteriologically (n=7) confirmed to have active pulmonary tuberculosis. The location and patterns of pulmonary tuberculosis were examined on a thin section CT scan. Results: The most common thin section CT findings were subpleural nodules (n=6; mean diameter, 3.2 cm) and a lobar or segmental consolidation (n=3). The lesions were located most commonly in the right lower lobe (n=4). The incidence of tuberculosis in patients with idiopathic pulmonary fibrosis was more than five times higher than that of the general population. Conclusion: The atypical manifestation of pulmonary tuberculosis is common in patients with idiopathic pulmonary fibrosis, which may mimic lung cancer or bacterial pneumonia

Idiopathic Pulmonary Fibrosis: A Genetic Disease That Involves Mucociliary Dysfunction of the Peripheral Airways

Science.gov (United States)

Evans, Christopher M.; Fingerlin, Tasha E.; Schwarz, Marvin I.; Lynch, David; Kurche, Jonathan; Warg, Laura; Yang, Ivana V.; Schwartz, David A.

2016-01-01

Idiopathic pulmonary fibrosis (IPF) is an incurable complex genetic disorder that is associated with sequence changes in 7 genes (MUC5B, TERT, TERC, RTEL1, PARN, SFTPC, and SFTPA2) and with variants in at least 11 novel loci. We have previously found that 1) a common gain-of-function promoter variant in MUC5B rs35705950 is the strongest risk factor (genetic and otherwise), accounting for 30-35% of the risk of developing IPF, a disease that was previously considered idiopathic; 2) the MUC5B promoter variant can potentially be used to identify individuals with preclinical pulmonary fibrosis and is predictive of radiologic progression of preclinical pulmonary fibrosis; and 3) MUC5B may be involved in the pathogenesis of pulmonary fibrosis with MUC5B message and protein expressed in bronchiolo-alveolar epithelia of IPF and the characteristic IPF honeycomb cysts. Based on these considerations, we hypothesize that excessive production of MUC5B either enhances injury due to reduced mucociliary clearance or impedes repair consequent to disruption of normal regenerative mechanisms in the distal lung. In aggregate, these novel considerations should have broad impact, resulting in specific etiologic targets, early detection of disease, and novel biologic pathways for use in the design of future intervention, prevention, and mechanistic studies of IPF. PMID:27630174

Evolving Concepts of Pulmonary Hypertension Secondary to Left Heart Disease.

Science.gov (United States)

Ramu, Bhavadharini; Thenappan, Thenappan

2016-04-01

Pulmonary hypertension associated with left heart disease is the most common form of pulmonary hypertension. Although its pathophysiology remains incompletely understood, it is now well recognized that the presence of pulmonary hypertension is associated with a worse prognosis. Right ventricular failure has independent and additive prognostic value over pulmonary hypertension for adverse outcomes in left heart disease. Recently, several new terminologies have been introduced to better define and characterize the nature and severity of pulmonary hypertension. Several new treatment options including the use of pulmonary arterial hypertension specific therapies are being considered, but there is lack of evidence. Here, we review the recent advances in this field and summarize the diagnostic and therapeutic modalities of use in the management of pulmonary hypertension associated with left heart disease.

Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

Science.gov (United States)

Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

2017-01-01

Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

Allele-specific gene expression in a wild nonhuman primate population

Science.gov (United States)

Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

2015-01-01

Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

Single nucleotide polymorphisms of DNA mismatch repair genes MSH2 and MLH1 confer susceptibility to esophageal cancer.

Science.gov (United States)

Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong

2014-01-01

Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.

Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans.

Science.gov (United States)

Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B

2017-11-24

Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.

Area-Specific Cell Stimulation via Surface-Mediated Gene Transfer Using Apatite-Based Composite Layers

Directory of Open Access Journals (Sweden)

Yushin Yazaki

2015-04-01

Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.

High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

Science.gov (United States)

Kassir, Yona

2017-01-01

Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

Durable broad-spectrum powdery mildew resistance in pea er1 plants is conferred by natural loss-of-function mutations in PsMLO1

NARCIS (Netherlands)

Humphry, M.; Reinstädler, A.; Ivanov, S.; Bisseling, T.; Panstruga, R.

2011-01-01

Loss-of-function alleles of plant-specific MLO (Mildew Resistance Locus O) genes confer broad-spectrum powdery mildew resistance in monocot (barley) and dicot (Arabidopsis thaliana, tomato) plants. Recessively inherited powdery mildew resistance in pea (Pisum sativum) er1 plants is, in many aspects,

CERN automatic audio-conference service

CERN Multimedia

Sierra Moral, R

2009-01-01

Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first Euro...

CERN automatic audio-conference service

CERN Document Server

Sierra Moral, R

2010-01-01

Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first Euro...

Update on chronic thromboembolic pulmonary hypertension.

Science.gov (United States)

Robbins, Ivan M; Pugh, Meredith E; Hemnes, Anna R

2017-01-01

Chronic, unresolved thromboemboli are an important cause of pulmonary hypertension (PH) with specific treatment strategies differing from other types of PH. Chronic thromboembolic pulmonary hypertension (CTEPH) is classified as group 4 PH by the World Health Organization. It is a rare, but underdiagnosed, complication of acute pulmonary embolism that does not resolve and results in occlusion of large pulmonary arteries with a fibro-thrombotic material. The etiology of CTEPH remains uncertain, and it is unknown why certain patients with acute pulmonary embolism develop this disorder. The evaluation for CTEPH is an important part of the evaluation for PH in general, and it is crucial not to overlook this diagnosis, as it is the only form of PH that is potentially curable. Patients diagnosed with CTEPH should be referred to an expert center for consideration of pulmonary endarterectomy, and surgical removal of the chronic thromboembolic material. Not all patients with CTEPH are surgical candidates, however, and there are emerging treatments-medical therapy and balloon pulmonary angioplasty-that have shown benefit in this patient population. Without treatment, CTEPH can lead to progressive pulmonary vascular obstruction, right heart failure, and death. Thus, it is important for clinicians to recognize this subtype of PH. In this review, we provide an overview of current understanding of the pathogenesis of CTEPH and highlight recommendations and recent advances in the evaluation and treatment of CTEPH. Copyright © 2016 Elsevier Inc. All rights reserved.

The radiographic findings in diagnosis of pulmonary lymphoma

International Nuclear Information System (INIS)

Song Wei; Wang Li; Yan Hongzhen

2001-01-01

Objective: To study the radiographic findings in the diagnosis of pulmonary lymphoma and pseudo lymphoma. Methods: Eight patients with pulmonary lymphoma and 2 with pseudo lymphoma were examined by X-ray film, tomography, and CT. Results: Single or multiple nodules or masses were observed in 8 patients with pulmonary lymphoma, shaggy borders or halo of ground-glass attenuation in 7 patients, 2 patients had multiple patchy infiltrates bilaterally, 2 had diffuse interstitial infiltrates and 1 had miliary nodules. Multiple consolidations with air bronchogram and without hilar and mediastinal lymphadenopathy were observed in 2 patients with pulmonary pseudo lymphoma. Conclusion: Radiographic findings of pulmonary lymphoma were varied, the most common findings were the nodules or masses with shaggy borders or halo of ground-glass attenuation. The specific findings of pulmonary pseudo lymphoma were multiple consolidations with air bronchogram and without hilar and mediastinal lymphadenopathy. The final diagnosis relied on pathology

Effect of collagen type IV, MMPs and TIMPs on remodeling of radiation pulmonary injury

International Nuclear Information System (INIS)

Diao Ruiying; Song Liangwen; Wang Shaoxia; Yin Jiye

2007-01-01

Objective: To explore the effect of collagen type IV, matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs(TIMPs) on early remodeling after radiation pulmonary injury. Methods: Right lungs of rats were irradiated by 60 Co γ-rays at a dose of 20 Gy to induce radiation pulmonary injury, and the lung specimens were taken at weeks 1, 2, 4 after irradiation. Quantitative analysis was performed on pulmonary collagen type IV, MMP-2, MMP-9, TIMP-2, TIMP-1 at the level of gene expression and protein synthesis using real-time PCR or immunohistochemistry. Results: Gene detection using real-time PCR: gene expression of collagen type IV increased at week 1 and decreased at week 2 after irradiation; MMP-2 reached peak at week 2 in which an opposed alteration trend was displayed; MMP-9 appeared a significant trend of elevation, then decrease and elevation again which was similar to those of collagen type IV; expression of TIMP-1 was lower, and there was no marked difference among all time points; TIMP-2 displayed a trend of slight elevation, then decrease and elevation again, which was opposed to MMP-2. Immunohistochemistry-image analysis: Pulmonary collagen type IV obviously increased at week 1, and began to decrease at week 2; MMP-2 decreased at week 2 and then increased; an opposed alteration trend to that of collagen type IV was displayed; alteration trend of MMP-9 was similar to that of collagen type IV but the extent was higher; gene expression of TIMP-1 slightly increased at 2 week and an opposed trend to of MMP-9 was displayed. Conclusions: Collagen type IV, MMP-2, MMP-9 and their tissue inhibitors were involved in ineffective remodeling in the early radiation pulmonary injury; MMP-2 and MMP-9 play an important role in degradation of collagen type IV; Disturbance of collagen type IV degradation might have relationship with the initiation of pulmonary fibrosis. (authors)

The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

Science.gov (United States)

Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

2012-06-01

Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

Inference of cancer-specific gene regulatory networks using soft computing rules.

Science.gov (United States)

Wang, Xiaosheng; Gotoh, Osamu

2010-03-24

Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Pulmonary capillary haemangiomatosis: a rare cause of pulmonary hypertension.

Science.gov (United States)

Babu, K Anand; Supraja, K; Singh, Raj B

2014-01-01

Pulmonary capillary haemangiomatosis (PCH) is a rare disorder of unknown aetiology, characterised by proliferating capillaries that invade the pulmonary interstitium, alveolar septae and the pulmonary vasculature. It is often mis-diagnosed as primary pulmonary hypertension and pulmonary veno-occlusive disease. Pulmonary capillary haemangiomatosis is a locally aggressive benign vascular neoplasm of the lung. We report the case of a 19-year-old female who was referred to us in the early post-partum period with severe pulmonary artery hypertension, which was diagnosed as PCH by open lung biopsy.

[Role of MRI for detection and characterization of pulmonary nodules].

Science.gov (United States)

Sommer, G; Koenigkam-Santos, M; Biederer, J; Puderbach, M

2014-05-01

Due to physical and technical limitations, magnetic resonance imaging (MRI) has hitherto played only a minor role in image-based diagnostics of the lungs. However, as a consequence of important methodological developments during recent years, MRI has developed into a technically mature and clinically well-proven method for specific pulmonary questions. The purpose of this article is to provide an overview on the currently available sequences and techniques for assessment of pulmonary nodules and analyzes the clinical significance according to the current literature. The main focus is on the detection of lung metastases, the detection of primary pulmonary malignancies in high-risk individuals and the differentiation between pulmonary nodules of benign and malignant character. The MRI technique has a sensitivity of approximately 80 % for detection of malignant pulmonary nodules compared to the reference standard low-dose computed tomography (CT) and is thus somewhat inferior to CT. Advantages of MRI on the other hand are a higher specificity in differentiating malignant and benign pulmonary nodules and the absence of ionizing radiation exposure. A systematic use of MRI as a primary tool for detection and characterization of pulmonary nodules is currently not recommended due to insufficient data. The diagnostic potential of MRI for early detection and staging of malignant pulmonary diseases, however, seems promising. Therefore, further evaluation of MRI as a secondary imaging modality in clinical trials is highly warranted.

The α and Δ isoforms of CREB1 are required to maintain normal pulmonary vascular resistance.

Directory of Open Access Journals (Sweden)

Lili Li

Full Text Available Chronic hypoxia causes pulmonary hypertension associated with structural alterations in pulmonary vessels and sustained vasoconstriction. The transcriptional mechanisms responsible for these distinctive changes are unclear. We have previously reported that CREB1 is activated in the lung in response to alveolar hypoxia but not in other organs. To directly investigate the role of α and Δ isoforms of CREB1 in the regulation of pulmonary vascular resistance we examined the responses of mice in which these isoforms of CREB1 had been inactivated by gene mutation, leaving only the β isoform intact (CREB(αΔ mice. Here we report that expression of CREB regulated genes was altered in the lungs of CREB(αΔ mice. CREB(αΔ mice had greater pulmonary vascular resistance than wild types, both basally in normoxia and following exposure to hypoxic conditions for three weeks. There was no difference in rho kinase mediated vasoconstriction between CREB(αΔ and wild type mice. Stereological analysis of pulmonary vascular structure showed characteristic wall thickening and lumen reduction in hypoxic wild-type mice, with similar changes observed in CREB(αΔ. CREB(αΔ mice had larger lungs with reduced epithelial surface density suggesting increased pulmonary compliance. These findings show that α and Δ isoforms of CREB1 regulate homeostatic gene expression in the lung and that normal activity of these isoforms is essential to maintain low pulmonary vascular resistance in both normoxic and hypoxic conditions and to maintain the normal alveolar structure. Interventions that enhance the actions of α and Δ isoforms of CREB1 warrant further investigation in hypoxic lung diseases.

Indeterminate Pulmonary Nodules at Colorectal Cancer Staging

DEFF Research Database (Denmark)

Nordholm-Carstensen, Andreas; Wille-Jørgensen, Peer A; Jorgensen, Lars N

2013-01-01

This study aimed to estimate the prevalence of indeterminate pulmonary nodules and specific radiological and clinical characteristics that predict malignancy of these at initial staging chest computed tomography (CT) in patients with colorectal cancer. A considerable number of indeterminate...... pulmonary nodules, which cannot readily be classified as either benign or malignant, are detected at initial staging chest CT in colorectal cancer patients....

Inhaled tolafentrine reverses pulmonary vascular remodeling via inhibition of smooth muscle cell migration

Directory of Open Access Journals (Sweden)

Weissmann Norbert

2005-11-01

Full Text Available Abstract Background The aim of the study was to assess the chronic effects of combined phosphodiesterase 3/4 inhibitor tolafentrine, administered by inhalation, during monocrotaline-induced pulmonary arterial hypertension (PAH in rats. Methods CD rats were given a single subcutaneous injection of monocrotaline to induce PAH. Four weeks after, rats were subjected to inhalation of tolafentrine or sham nebulization in an unrestrained, whole body aerosol exposure system. In these animals (i the acute pulmonary vasodilatory efficacy of inhaled tolafentrine (ii the anti-remodeling effect of long-term inhalation of tolafentrine (iii the effects of tolafentrine on the expression profile of 96 genes encoding cell adhesion and extracellular matrix regulation were examined. In addition, the inhibitory effect of tolafentrine on ex vivo isolated pulmonary artery SMC cell migration was also investigated. Results Monocrotaline injection provoked severe PAH (right ventricular systolic pressure increased from 25.9 ± 4.0 to 68.9 ± 3.2 after 4 weeks and 74.9 ± 5.1 mmHg after 6 weeks, cardiac output depression and right heart hypertrophy. The media thickness of the pulmonary arteries and the proportion of muscularization of small precapillary resistance vessels increased dramatically, and the migratory response of ex-vivo isolated pulmonary artery smooth muscle cells (PASMC was increased. Micro-arrays and subsequent confirmation with real time PCR demonstrated upregulation of several extracellular matrix regulation and adhesion genes, such as matrixmetalloproteases (MMP 2, 8, 9, 10, 11, 12, 20, Icam, Itgax, Plat and serpinb2. When chronically nebulized from day 28 to 42 (12 daily aerosol maneuvers, after full establishment of severe pulmonary hypertension, tolafentrine reversed about 60% of all hemodynamic abnormalities, right heart hypertrophy and monocrotaline-induced structural lung vascular changes, including the proportion of pulmonary artery

Vaccination with recombinant heat shock protein 60 from Histoplasma capsulatum protects mice against pulmonary histoplasmosis.

Science.gov (United States)

Gomez, F J; Allendoerfer, R; Deepe, G S

1995-07-01

HIS-62 is a glycoprotein that has been isolated from the cell wall and cell membrane fraction of the pathogenic fungus Histoplasma capsulatum. It is a target of the cellular immune response to this fungus, and it protects mice against a lethal intravenous inoculum of H. capsulatum yeast cells. In this study, we cloned the gene encoding this antigen to reveal its biological nature and studied the immunological activity of recombinant antigen. The amino acid sequences of the NH2 terminus and internal peptides were obtained by Edman degradation. Degenerate oligonucleotides were used to isolate a gene fragment of HIS-62 by PCR. One 680-bp segment that corresponded to the known peptide sequence was amplified from H. capsulatum DNA. This DNA was used to screen a genomic library, and the full-length gene was isolated and sequenced. The deduced amino acid sequence of the gene demonstrated approximately 70 and approximately 50% identity to heat shock protein 60 (hsp 60) from Saccharomyces cerevisiae and hsp 60 from Escherichia coli, respectively. A cDNA was synthesized by reverse transcription PCR and was expressed in E. coli. Recombinant protein reacted with a monospecific polyclonal rabbit antiserum raised against native HIS-62, with monoclonal HIS-62-reactive T cells, and with splenocytes from mice immunized with viable yeast cells. Moreover, vaccination with the recombinant protein conferred protection in mice against a lethal intranasal inoculation with yeast cells. Thus, HIS-62 is a member of the hsp 60 family, and the recombinant hsp 60 is protective against pulmonary histoplasmosis in mice.

Influences of the disease resistance conferred by the individual ...

African Journals Online (AJOL)

To research possible influences of the disease resistance conferred by different trans-resistance genes on the transgenic rice plants in their yields and grain quality, three transgenic rice lines, including two with the resistance genes Pi-d2 and Pi-d3, respectively, for rice blast, and one with the resistance gene Xa21 for rice ...

Associations between presence of relevant information in referrals to radiology and prevalence rates in patients with suspected pulmonary embolism.

Science.gov (United States)

Hedner, Charlotta; Sundgren, Pia C; Kelly, Aine Marie

2013-09-01

The purpose of this study was to assess if the presence of information including the pretest probability (Wells score), other known risk factors, and symptoms given on referrals for computed tomography (CT) pulmonary angiography correlated with prevalence rates for pulmonary embolism (PE). Also, to evaluate for differences between a university and a regional hospital setting regarding patient characteristics, amount of relevant information provided on referrals, and prevalence rates for pulmonary embolism. Retrospective review of all consecutive referrals (emergency room, inpatient, and outpatient) for CT performed on children and adults for suspected PE from two sites: a tertiary (university) hospital (site 1) and a secondary (regional) hospital (site 2) over a 5-year period. The overall prevalence rate was 510/3641 or 14% of all referrals. Significantly higher number of males had a positive CT compared to women (18% versus 12%, P relevant information on the referral and the probability for positive finding existed, a slight trend was noted (P = .09). In two categories, "hypoxia" and "signs of deep vein thrombosis," the presence of this information conferred a higher probability for pulmonary embolism, P information conferred a higher probability for pulmonary embolism. The amount of relevant clinical information on the request did not correlate with prevalence rates, which may reflect a lack of documentation on the part of emergency physicians who may use a "gestalt" approach. Request forms likely did not capture all relevant patient risks and many factors may interact with each other, both positively and negatively. Pretest probability estimations were rarely performed, despite their inclusion in major society guidelines. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.

Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

Directory of Open Access Journals (Sweden)

Edberg Jeffrey C

2010-03-01

Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

Science.gov (United States)

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author

Annual International DIC Society Conference and SEM Fall Conference

CERN Document Server

Reu, Phillip

2017-01-01

This collection represents a single volume of technical papers presented at the Annual International DIC Society Conference and SEM Fall Conference organized by the Society for Experimental Mechanics and Sandia National Laboratories and held in Philadelphia, PA, November 7-10, 2016. The volume presents early findings from experimental, standards development and various other investigations concerning digital image correlation - an important area within Experimental Mechanics. The area of Digital Image Correlation has been an integral track within the SEM Annual Conference spearheaded by Professor Michael Sutton from the University of South Carolina. In 2016, the SEM and Sandia joined their collaborative strengths to launch a standing fall meeting focusing specifically on developments in the area of Digital Image Correlation. The contributed papers within this volume span numerous technical aspects of DIC including standards development for the industry. .

Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

Occupational chronic obstructive pulmonary disease

DEFF Research Database (Denmark)

Omland, Oyvind; Würtz, Else Toft; Aasen, Tor Børvig

2014-01-01

Occupational-attributable chronic obstructive pulmonary disease (COPD) presents a substantial health challenge. Focusing on spirometric criteria for airflow obstruction, this review of occupational COPD includes both population-wide and industry-specific exposures....

Conferring specificity in redox pathways by enzymatic thiol/disulfide exchange reactions.

Science.gov (United States)

Netto, Luis Eduardo S; de Oliveira, Marcos Antonio; Tairum, Carlos A; da Silva Neto, José Freire

2016-01-01

Thiol-disulfide exchange reactions are highly reversible, displaying nucleophilic substitutions mechanism (S(N)2 type). For aliphatic, low molecular thiols, these reactions are slow, but can attain million times faster rates in enzymatic processes. Thioredoxin (Trx) proteins were the first enzymes described to accelerate thiol-disulfide exchange reactions and their high reactivity is related to the high nucleophilicity of the attacking thiol. Substrate specificity in Trx is achieved by several factors, including polar, hydrophobic, and topological interactions through a groove in the active site. Glutaredoxin (Grx) enzymes also contain the Trx fold, but they do not share amino acid sequence similarity with Trx. A conserved glutathione binding site is a typical feature of Grx that can reduce substrates by two mechanisms (mono and dithiol). The high reactivity of Grx enzymes is related to the very acid pK(a) values of reactive Cys that plays roles as good leaving groups. Therefore, although distinct oxidoreductases catalyze similar thiol–disulfide exchange reactions, their enzymatic mechanisms vary. PDI and DsbA are two other oxidoreductases, but they are involved in disulfide bond formation, instead of disulfide reduction, which is related to the oxidative environment where they are found. PDI enzymes and DsbC are endowed with disulfide isomerase activity, which is related with their tetra-domain architecture. As illustrative description of specificity in thiol-disulfide exchange, redox aspects of transcription activation in bacteria, yeast, and mammals are presented in an evolutionary perspective. Therefore, thiol-disulfide exchange reactions play important roles in conferring specificity to pathways, a required feature for signaling.

Pulmonary endarterectomy outputs in chronic thromboembolic pulmonary hypertension.

Science.gov (United States)

López Gude, María Jesús; Pérez de la Sota, Enrique; Pérez Vela, Jose Luís; Centeno Rodríguez, Jorge; Muñoz Guijosa, Christian; Velázquez, María Teresa; Alonso Chaterina, Sergio; Hernández González, Ignacio; Escribano Subías, Pilar; Cortina Romero, José María

2017-07-07

Pulmonary thromboendarterectomy surgery is the treatment of choice for patients with chronic thromboembolic pulmonary hypertension; extremely high pulmonary vascular resistance constitutes a risk factor for hospital mortality. The objective of this study was to analyze the immediate and long-term results of the surgical treatment of chronic thromboembolic pulmonary hypertension in patients with very severe pulmonary hypertension. Since February 1996, we performed 160 pulmonary thromboendarterectomies. We divided the patient population in 2 groups: group 1, which included 40 patients with pulmonary vascular resistance≥1090dyn/sec/cm -5 , and group 2, which included the remaining 120 patients. Hospital mortality (15 vs. 2.5%), reperfusion pulmonary edema (33 vs. 14%) and heart failure (23 vs. 3.3%) were all higher in group 1; however, after one year of follow-up, there were no significant differences in the clinical, hemodynamic and echocardiographic conditions of both groups. Survival rate after 5 years was 77% in group 1 and 92% in group 2 (P=.033). After the learning curve including the 46 first patients, there was no difference in hospital mortality (3.8 vs. 2.3%) or survival rate after 5 years (96.2% in group 1 and 96.2% in group 2). Pulmonary thromboendarterectomy is linked to significantly higher morbidity and mortality rates in patients with severe chronic thromboembolic pulmonary hypertension. Nevertheless, these patients benefit the same from the procedure in the mid-/long-term. In our experience, after the learning curve, this surgery is safe in severe pulmonary hypertension and no level of pulmonary vascular resistance should be an absolute counter-indication for this surgery. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS

Directory of Open Access Journals (Sweden)

Scott Jewell

2012-08-01

Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.

Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.

Directory of Open Access Journals (Sweden)

Erin C Macaulay

Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.

Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

LENUS (Irish Health Repository)

Vacic, Vladimir

2011-03-24

Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

The antibiotic resistome: gene flow in environments, animals and human beings.

Science.gov (United States)

Hu, Yongfei; Gao, George F; Zhu, Baoli

2017-06-01

The antibiotic resistance is natural in bacteria and predates the human use of antibiotics. Numerous antibiotic resistance genes (ARGs) have been discovered to confer resistance to a wide range of antibiotics. The ARGs in natural environments are highly integrated and tightly regulated in specific bacterial metabolic networks. However, the antibiotic selection pressure conferred by the use of antibiotics in both human medicine and agriculture practice leads to a significant increase of antibiotic resistance and a steady accumulation of ARGs in bacteria. In this review, we summarized, with an emphasis on an ecological point of view, the important research progress regarding the collective ARGs (antibiotic resistome) in bacterial communities of natural environments, human and animals, i.e., in the one health settings.We propose that the resistance gene flow in nature is "from the natural environments" and "to the natural environments"; human and animals, as intermediate recipients and disseminators, contribute greatly to such a resistance gene "circulation."

X-linked Hyper IgM Syndrome Presenting as Pulmonary Alveolar Proteinosis.

Science.gov (United States)

Gallagher, Joel; Adams, Juan; Hintermeyer, Mary; Torgerson, Troy R; Lopez-Guisa, Jesus; Ochs, Hans D; Szabo, Sara; Salib, Mina; Verbsky, James; Routes, John

2016-08-01

X-linked hyper IgM syndrome (XHIGM) is a combined immunodeficiency caused by mutations in the CD40 ligand (CD40L) gene that typically results in decreased or absent CD40L expression on activated T cells, leading to defective class switching and somatic hypermutation. We describe an infant who presented with respiratory failure due to pulmonary alveolar proteinosis (PAP) with a novel damaging missense mutation in the CD40L gene. Whole exome sequencing (WES) was used to identify a mutation in the CD40L gene. CD40L expression and function were determined by flow cytometry. A 5-month-old previously-healthy male presented with respiratory failure and diffuse pulmonary ground glass opacities on CT scan of the chest. Laboratory evaluation revealed an undetectable IgG, normal IgA, and elevated IgM. A bronchoalveolar lavage demonstrated pulmonary alveolar proteinosis. WES demonstrated a c.608G > C mutation in the CD40L gene resulting in p.R203T. Flow cytometry demonstrated normal CD40L expression on activated T cells but absent binding of CD40-Ig to CD40L on activated patient T cells. The clinical manifestations of XHIGM in our patient had several unique features, including the presentation with PAP, normal serum IgA, and expression of non-functional CD40L on activated T cells. To our knowledge, this is the first published case of PAP in a patient with XHIGM.

The zinc transporter ZIP12 regulates the pulmonary vascular response to chronic hypoxia.

Science.gov (United States)

Zhao, Lan; Oliver, Eduardo; Maratou, Klio; Atanur, Santosh S; Dubois, Olivier D; Cotroneo, Emanuele; Chen, Chien-Nien; Wang, Lei; Arce, Cristina; Chabosseau, Pauline L; Ponsa-Cobas, Joan; Frid, Maria G; Moyon, Benjamin; Webster, Zoe; Aldashev, Almaz; Ferrer, Jorge; Rutter, Guy A; Stenmark, Kurt R; Aitman, Timothy J; Wilkins, Martin R

2015-08-20

The typical response of the adult mammalian pulmonary circulation to a low oxygen environment is vasoconstriction and structural remodelling of pulmonary arterioles, leading to chronic elevation of pulmonary artery pressure (pulmonary hypertension) and right ventricular hypertrophy. Some mammals, however, exhibit genetic resistance to hypoxia-induced pulmonary hypertension. We used a congenic breeding program and comparative genomics to exploit this variation in the rat and identified the gene Slc39a12 as a major regulator of hypoxia-induced pulmonary vascular remodelling. Slc39a12 encodes the zinc transporter ZIP12. Here we report that ZIP12 expression is increased in many cell types, including endothelial, smooth muscle and interstitial cells, in the remodelled pulmonary arterioles of rats, cows and humans susceptible to hypoxia-induced pulmonary hypertension. We show that ZIP12 expression in pulmonary vascular smooth muscle cells is hypoxia dependent and that targeted inhibition of ZIP12 inhibits the rise in intracellular labile zinc in hypoxia-exposed pulmonary vascular smooth muscle cells and their proliferation in culture. We demonstrate that genetic disruption of ZIP12 expression attenuates the development of pulmonary hypertension in rats housed in a hypoxic atmosphere. This new and unexpected insight into the fundamental role of a zinc transporter in mammalian pulmonary vascular homeostasis suggests a new drug target for the pharmacological management of pulmonary hypertension.

Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans

Directory of Open Access Journals (Sweden)

Assaf Gottlieb

2017-11-01

Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort

Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.

Science.gov (United States)

Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua

2018-04-01

Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.

Comparative diagnostic value of pulmonary perfusion and ventilation scintigraphy and angiopneumography in pulmonary embolism

International Nuclear Information System (INIS)

Peltier, P.; Cesbron, J.P.; Dupas, B.; Crochet, D.; Delhumeau, J.

1984-01-01

Fourty-six patients suspected clinically of having a pulmonary embolism (PE) were investigated by angiopneumography (AGP) and perfusion (99m-Tc aggregates) and ventilation (99m-Tc colloid) scintigraohy (SPV Tc). Findings were assessed under blind conditions. A positive diagnosis of pulmonary embolism was made in 19 patients. The SPV Tc was considered as positive if perfusional deficiencies were greater than ventilatory defects, and this was evaluated as such in 23 cases (19 true and 4 false positives). False negatives were not observed. The 4 false positive results corresponded to scintigraphic anomalies suggestive of pulmonary emboli subsegmental in size; true positives were either subsegmental (8), segmental (6) or lobar (5). Sensitivity of the SPV Tc was therefore 100 %; its specificity, all results considered was 76 %, but was 100 % if only images of lobar or segmental lesions are considered [fr

The management of neonatal pulmonary hypertension.

Science.gov (United States)

Dhillon, Rami

2012-05-01

Most neonates with clinically significant pulmonary hypertension (PH) will have either persistent PH of the newborn (PPHN) or bronchopulmonary dysplasia. Cyanotic congenital heart disease must be actively ruled out as part of the differential diagnosis of PPHN. The maintenance of ductal patency with prostaglandins E1 or E2 in cases of doubt is safe and potentially beneficial given their pulmonary vasorelaxant properties. Specific tools in the treatment of PPHN include modern ventilatory strategies, inhaled nitric oxide, sildenafil, prostacyclin and extracorporeal membrane oxygenation. Rarely will a cardiac lesion be primarily responsible for neonatal PH although pulmonary vein stenosis and the persistence of an arterial duct must be considered, particularly in the older preterm baby with bronchopulmonary dysplasia.

A human-specific de novo protein-coding gene associated with human brain functions.

Directory of Open Access Journals (Sweden)

Chuan-Yun Li

2010-03-01

Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.

Large-scale modeling of condition-specific gene regulatory networks by information integration and inference.

Science.gov (United States)

Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner

2014-12-01

Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Using a periclinal chimera to unravel layer-specific gene expression in plants.

Science.gov (United States)

Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

2013-09-01

Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

Partial anomalous pulmonary venous return in patients with pulmonary hypertension

International Nuclear Information System (INIS)

Sung, Won-kyung; Au, Virginia; Rose, Anand

2012-01-01

Anomalous pulmonary venous return is an uncommon congenital malformation, and may be partial or total. Partial anomalous pulmonary venous return (PAPVR) is more common than total anomalous pulmonary venous return, and is often associated with other congenital cardiac anomalies. Whilst many patients with PAPVR remain asymptomatic, some may present in later age with symptoms related to left-to-right shunt, right heart failure and pulmonary hypertension. We report two cases of PAPVR detected on Computed Tomography Pulmonary Angiogram (CTPA) for the work up of pulmonary hypertension. The cases demonstrate that, although uncommon, partial anomalous pulmonary venous return can be a contributing factor to pulmonary hypertension and pulmonary veins should be carefully examined when reading a CTPA study.

Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

Directory of Open Access Journals (Sweden)

Wolfgang Boecker

2004-04-01

Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

Expression of TGFbeta1 in pulmonary vein stenosis after radiofrequency ablation in chronic atrial fibrillation of dogs.

Science.gov (United States)

Li, Shufeng; Li, Hongli; Mingyan, E; Yu, Bo

2009-02-01

The development of pulmonary vein stenosis has recently been described after radiofrequency ablation (RF) to treat atrial fibrillation (AF). The purpose of this study was to examine expression of TGFbeta1 in pulmonary vein stenosis after radiofrequency ablation in chronic atrial fibrillation of dogs. About 28 mongrel dogs were randomly assigned to the sham-operated group (n = 7), the AF group (n = 7), AF + RF group (n = 7), and RF group (n = 7). In AF or AF + RF groups, dogs underwent chronic pulmonary vein (PV) pacing to induce sustained AF. RF application was applied around the PVs until electrical activity was eliminated. Histological assessment of pulmonary veins was performed using hematoxylin and eosin staining; TGFbeta1 gene expression in pulmonary veins was examined by RT-PCR analysis; expression of TGFbeta1 protein in pulmonary veins was assessed by Western blot analysis. Rapid pacing from the left superior pulmonary vein (LSPV) induced sustained AF in AF group and AF + RF group. Pulmonary vein ablation terminated the chronic atrial fibrillation in dogs. Histological examination revealed necrotic tissues in various stages of collagen replacement, intimal thickening, and cartilaginous metaplasia with chondroblasts and chondroclasts. Compared with sham-operated and AF group, TGFbeta1 gene and protein expressions was increased in AF + RF or RF groups. It was concluded that TGFbeta1 might be associated with pulmonary vein stenosis after radiofrequency ablation in chronic atrial fibrillation of dogs.

A comparative study of pulmonary hypoperfusion secondary to cancerous invasion of central pulmonary artery in lung cancer with CT and DSA

International Nuclear Information System (INIS)

Guo Dajing; Miao Jingtao; Lu Wusheng; Bai Hongli

2003-01-01

Objective: To study CT features of pulmonary hypoperfusion in lung cancer with cancerous invasion of central pulmonary artery (CICPA) and the diagnostic value of CT. Methods: The pre-operative pulmonary DSA and contrast-enhanced spiral CT (including HRCT) findings in 20 cases of lung cancer with CICPA were carried out prospectively and comparatively. On DSA and CT, the distribution and quantitative variation of subpleural terminal pulmonary arterioles (pulmonary vessel signs), the filling degree of lung capillary, the post-contrast density changes of lung parenchyma, and the fluctuations of the time-density curve (pulmonary parenchymal signs) were blindly observed. The CT and DSA findings and their consistence were analyzed statistically. The diagnostic values of CT in secondary pulmonary hypoperfusion in lung cancer with CICPA were evaluated. Results: There were 30 lobar arteries with cancerous invasion among the 20 cases and 90% (27/30) of them presented pulmonary hypoperfusion on DSA. For diagnosing pulmonary hypoperfusion, CT had a sensitivity of 78%(21/27), a specificity of 100% (3/3), and an accuracy of 80%(24/30). There were no statistical correlation between pulmonary hypoperfusion and the degree of central pulmonary artery (CPA) stenosis (r s =0.40, P=0.073). Pulmonary vessel signs on CT had a good consistence with that on DSA (Kappa=0.69, P<0.001), while that of pulmonary parenchymal signs was lower (Kappa=0.37, P=0.011). Conclusion: Pulmonary hypoperfusion is one of the common findings in lung cancer with CICPA. CT is of great value in qualitative diagnosis on it, while for quantitative diagnosis, its value is limited to a certain degree

Characterization of a novel autophagy-specific gene, ATG29

International Nuclear Information System (INIS)

Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori

2005-01-01

Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins

Pulmonary biomarkers in chronic obstructive pulmonary disease

NARCIS (Netherlands)

Barnes, Peter J.; Chowdhury, Badrul; Kharitonov, Sergei A.; Magnussen, Helgo; Page, Clive P.; Postma, Dirkje; Saetta, Marina

2006-01-01

There has been increasing interest in using pulmonary biomarkers to understand and monitor the inflammation in the respiratory tract of patients with chronic obstructive pulmonary disease (COPD). In this Pulmonary Perspective we discuss the merits of the various approaches by reviewing the current

Endothelial nanomedicine for the treatment of pulmonary disease.

Science.gov (United States)

Brenner, Jacob S; Greineder, Colin; Shuvaev, Vladimir; Muzykantov, Vladimir

2015-02-01

Even though pulmonary diseases are among the leading causes of morbidity and mortality in the world, exceedingly few life-prolonging therapies have been developed for these maladies. Relief may finally come from nanomedicine and targeted drug delivery. Here, we focus on four conditions for which the pulmonary endothelium plays a pivotal role: acute respiratory distress syndrome, primary graft dysfunction occurring immediately after lung transplantation, pulmonary arterial hypertension and pulmonary embolism. For each of these diseases, we first evaluate the targeted drug delivery approaches that have been tested in animals. Then we suggest a 'need specification' for each disease: a list of criteria (e.g., macroscale delivery method, stability, etc.) that nanomedicine agents must meet in order to warrant human clinical trials and investment from industry. For the diseases profiled here, numerous nanomedicine agents have shown promise in animal models. However, to maximize the chances of creating products that reach patients, nanomedicine engineers and clinicians must work together and use each disease's need specification to guide the design of practical and effective nanomedicine agents.

Cutis laxa and fatal pulmonary hypertension: a newly recognized syndrome?

Science.gov (United States)

Brunetti-Pierri, Nicola; Piccolo, Pasquale; Morava, Eva; Wevers, Ron A.; McGuirk, Megan; Johnson, Yvette R.; Urban, Zsolt; Dishop, Megan K.; Potocki, Lorraine

2015-01-01

Cutis laxa is a connective tissue disorder with distinctive lax, redundant, and inelastic skin. It is a genetically heterogenous disorder with autosomal dominant and recessive patterns of inheritance. We report a patient with cutis laxa supported by clinical, microscopic, and ultrastructural findings. Molecular analysis of fibulin-4 and -5, of the α2 subunit of the V-type H+ ATPase, and of the component of the oligomeric Golgi complex 7 (COG7) genes excluded the type I and type II autosomal recessive forms of cutis laxa, and congenital disorders of glycosylation associated with cutis laxa. Remarkably, our patient also presented severe and lethal pulmonary hypertension as a newborn. This case with cutis laxa, severe pulmonary hypertension, and no detectable mutations in fibulin-4 and -5 genes may represent a previously unrecognized syndrome. PMID:21285876

Chronic obstructive pulmonary disease

International Nuclear Information System (INIS)

Karabulut, N.

2012-01-01

Full text: Chronic obstructive pulmonary diseases (COPD) denote progressive lung diseases characterized by airway obstruction. COPD exhibits specific morphologic changes in the lung parenchyma, central and peripheral airways and pulmonary vasculature. A person with COPD may have either emphysema or chronic bronchitis, but most have both. Some people with COPD may also have an asthma-like or reactive component. Imaging modalities play important role in the detection or exclusion of COPD, distribution and extent of disease processes. Combined inspiratory and expiratory high resolution CT allows phenotyping of COPD (emphysema predominant, airway predominant, or mixed) and quantification of severity. Magnetic resonance imaging enables functional evaluation and demonstrates ventilation defects correlating closely with pulmonary function tests. Imaging techniques are also helpful in guiding the treatment, such as bullectomy in patients with bullous emphysema, lung volume reduction surgery or endoscopic interventions in those with severe emphysema, and smoking cessation and medical treatment designed to stop lung destruction in patients with mild or moderate emphysema or bronchiectasis.

Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules

Directory of Open Access Journals (Sweden)

Xiaosheng Wang

2010-03-01

Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression

International Nuclear Information System (INIS)

Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe

2005-01-01

We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells

Updates on the COPD gene list

Science.gov (United States)

Bossé, Yohan

2012-01-01

A genetic contribution to develop chronic obstructive pulmonary disease (COPD) is well established. However, the specific genes responsible for enhanced risk or host differences in susceptibility to smoke exposure remain poorly understood. The goal of this review is to provide a comprehensive literature overview on the genetics of COPD, highlight the most promising findings during the last few years, and ultimately provide an updated COPD gene list. Candidate gene studies on COPD and related phenotypes indexed in PubMed before January 5, 2012 are tabulated. An exhaustive list of publications for any given gene was looked for. This well-documented COPD candidate-gene list is expected to serve many purposes for future replication studies and meta-analyses as well as for reanalyzing collected genomic data in the field. In addition, this review summarizes recent genetic loci identified by genome-wide association studies on COPD, lung function, and related complications. Assembling resources, integrative genomic approaches, and large sample sizes of well-phenotyped subjects is part of the path forward to elucidate the genetic basis of this debilitating disease. PMID:23055711

Pulmonary venous remodeling in COPD-pulmonary hypertension and idiopathic pulmonary arterial hypertension

DEFF Research Database (Denmark)

Andersen, Kasper Hasseriis; Andersen, Claus Bøgelund; Gustafsson, Finn

2017-01-01

Pulmonary vascular arterial remodeling is an integral and well-understood component of pulmonary hypertension (PH). In contrast, morphological alterations of pulmonary veins in PH are scarcely described. Explanted lungs (n = 101) from transplant recipients with advanced chronic obstructive...... pulmonary disease (COPD) and idiopathic pulmonary arterial hypertension (IPAH) were analyzed for venous vascular involvement according to a pre-specified, semi-quantitative grading scheme, which categorizes the intensity of venous remodeling in three groups of incremental severity: venous hypertensive (VH......) grade 0 = characterized by an absence of venous vascular remodeling; VH grade 1 = defined by a dominance of either arterialization or intimal fibrosis; and VH grade 2 = a substantial composite of arterialization and intimal fibrosis. Patients were grouped according to clinical and hemodynamic...

Sorted gene genealogies and species-specific nonsynonymous substitutions point to putative postmating prezygotic isolation genes in Allonemobius crickets

Directory of Open Access Journals (Sweden)

Suegene Noh

2016-02-01

Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of

Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues

OpenAIRE

Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.

2010-01-01

MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...

Measurement of regional pulmonary blood volume in patients with increased pulmonary blood flow or pulmonary arterial hypertension

International Nuclear Information System (INIS)

Wollmer, P.; Rozcovek, A.; Rhodes, C.G.; Allan, R.M.; Maseri, A.

1984-01-01

The effects of chronic increase in pulmonary blood flow and chronic pulmonary hypertension on regional pulmonary blood volume was measured in two groups of patients. One group of patients had intracardiac, left-to-right shunts without appreciable pulmonary hypertension, and the other consisted of patients with Eisenmenger's syndrome or primary pulmonary hypertension, i.e. patients with normal or reduced blood flow and severe pulmonary hypertension. A technique based on positron tomography was used to measure lung density (by transmission scanning) and regional pulmonary blood volume (after inhalation of /sup 11/CO). The distribution of pulmonary blood volume was more uniform in patients with chronic increase in pulmonary blood flow than in normal subjects. There were also indications of an absolute increase in intrapulmonary blood volume by about 15%. In patients with chronic pulmonary arterial hypertension, the distribution of pulmonary blood volume was also abnormally uniform. There was, however, no indication that overall intrapulmonary blood volume was substantially different from normal subjects. The abnormally uniform distribution of pulmonary blood volume can be explained by recruitment and/or dilatation of vascular beds. Intrapulmonary blood volume appears to be increased in patients with intracardiac, left-to-right shunts. With the development of pulmonary hypertension, intrapulmonary blood volume falls, which may be explained by reactive changes in the vasculature and/or obliteration of capillaries

When a pulmonary embolism is not a pulmonary embolism: a rare case of primary pulmonary leiomyosarcoma

Directory of Open Access Journals (Sweden)

Nargiz Muganlinskaya

2015-12-01

Full Text Available Arterial leiomyosarcomas account for up to 21% of vascular leiomyosarcomas, with 56% of arterial leiomyosarcomas occurring in the pulmonary artery. While isolated cases of primary pulmonary artery leiomyosarcoma document survival up to 36 months after treatment, these uncommon, aggressive tumors are highly lethal, with 1-year survival estimated at 20% from the onset of symptoms. We discuss a rare case of a pulmonary artery leiomyosarcoma that was originally diagnosed as a pulmonary embolism (PE. A 72-year-old Caucasian female was initially diagnosed with ‘saddle pulmonary embolism’ based on computerized tomographic angiography of the chest 2 months prior to admission and placed on anticoagulation. Dyspnea escalated, and serial computed tomography scans showed cardiomegaly with pulmonary emboli involving the right and left main pulmonary arteries with extension into the right and left upper and lower lobe branches. An echocardiogram on admission showed severe pulmonary hypertension with a pulmonary artery pressure of 82.9 mm Hg, and a severely enlarged right ventricle. Respiratory distress and multiorgan failure developed and, unfortunately, the patient expired. Autopsy showed a lobulated, yellow mass throughout the main pulmonary arteries measuring 13 cm in diameter. The mass extended into the parenchyma of the right upper lobe. On microscopy, the mass was consistent with a high-grade primary pulmonary artery leiomyosarcoma. Median survival of patients with primary pulmonary artery leiomyosarcoma without surgery is one and a half months, and mortality is usually due to right-sided heart failure. Pulmonary artery leiomyosarcoma is a rare but highly lethal disease commonly mistaken for PE. Thus, we recommend clinicians to suspect this malignancy when anticoagulation fails to relieve initial symptoms. In conclusion, early detection and suspicion of pulmonary artery leiomyosarcoma should be considered in patients refractory to anticoagulation

Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

Science.gov (United States)

Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

2018-05-03

Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

Biothechnology conferences held in Cuba. Cuba no biotechnology gakkai ni sankashite

Energy Technology Data Exchange (ETDEWEB)

Murata, M. (Ajinomoto Co. Inc., Tokyo, (Japan))

1990-04-25

Three biotechnology conferences including Cuba International Interferon Conference were held at Havana in April 1989, and the author participated in them. The number of participants was about 3,000. Most of them were from the Middle and the Central America, but there were also those from Europe, the USSR and the USA. The three conferences were composed of 16 symposiums and they covered a wide range of field such as medical science, agriculture and industry. High leveled reports were read in the conferences: on the application of interferons to medical treatments, curing effects of infections caused by herpes virus and B type hepatitis virus, anti-tumor effects, and anti-virus effects against AIDS virus; on the production of protein and vaccini by gene engineering, large quantity production of interleukin and epithelium cell multiplication genes. Especially impressing were the efforts the whole nation of Cuba makes to promote biotechnology and its modern facilities. 3 figs.

Identification of genuine primary pulmonary NK cell lymphoma via clinicopathologic observation and clonality assay.

Science.gov (United States)

Gong, Li; Wei, Long-Xiao; Huang, Gao-Sheng; Zhang, Wen-Dong; Wang, Lu; Zhu, Shao-Jun; Han, Xiu-Juan; Yao, Li; Lan, Miao; Li, Yan-Hong; Zhang, Wei

2013-08-19

Extranodal natural killer (NK)/T-cell lymphoma, nasal type, is an uncommon lymphoma associated with the Epstein-Barr virus (EBV). It most commonly involves the nasal cavity and upper respiratory tract. Primary pulmonary NK/T cell lymphoma is extremely rare. If a patient with a NK or T-cell tumor has an unusual reaction to treatment or an unusual prognosis, it is wise to differentiate NK from T-cell tumors. The clinicopathologic characteristics, immunophenotype, EBV in situ hybridization, and T cell receptor (TCR) gene rearrangement of primary pulmonary NK cell lymphoma from a 73-year-old Chinese woman were investigated and the clonal status was determined using female X-chromosomal inactivation mosaicism and polymorphisms at the phosphoglycerate kinase (PGK) gene. The lesion showed the typical histopathologic characteristics and immunohistochemical features of NK/T cell lymphoma. However, the sample was negative for TCR gene rearrangement. A clonality assay demonstrated that the lesion was monoclonal. It is concluded that this is the first recorded case of genuine primary pulmonary NK cell lymphoma. The purpose of the present work is to recommend that pathologists carefully investigate the whole lesion to reduce the likelihood that primary pulmonary NK cell lymphoma will be misdiagnosed as an infectious lesion. In addition, TCR gene rearrangement and clonal analysis, which is based on female X-chromosomal inactivation mosaicism and polymorphisms at PGK and androgen receptor (AR) loci, were found to play important roles in differentiating NK cell lymphoma from T cell lymphoma. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5205300349457729.

Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

Directory of Open Access Journals (Sweden)

David Haase

Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.