Energy Technology Data Exchange (ETDEWEB)
Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))
1990-08-01
Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.
Pulmonary phenotypes associated with genetic variation in telomere-related genes.
Hoffman, Thijs W; van Moorsel, Coline H M; Borie, Raphael; Crestani, Bruno
2018-05-01
Genomic mutations in telomere-related genes have been recognized as a cause of familial forms of idiopathic pulmonary fibrosis (IPF). However, it has become increasingly clear that telomere syndromes and telomere shortening are associated with various types of pulmonary disease. Additionally, it was found that also single nucleotide polymorphisms (SNPs) in telomere-related genes are risk factors for the development of pulmonary disease. This review focuses on recent updates on pulmonary phenotypes associated with genetic variation in telomere-related genes. Genomic mutations in seven telomere-related genes cause pulmonary disease. Pulmonary phenotypes associated with these mutations range from many forms of pulmonary fibrosis to emphysema and pulmonary vascular disease. Telomere-related mutations account for up to 10% of sporadic IPF, 25% of familial IPF, 10% of connective-tissue disease-associated interstitial lung disease, and 1% of COPD. Mixed disease forms have also been found. Furthermore, SNPs in TERT, TERC, OBFC1, and RTEL1, as well as short telomere length, have been associated with several pulmonary diseases. Treatment of pulmonary disease caused by telomere-related gene variation is currently based on disease diagnosis and not on the underlying cause. Pulmonary phenotypes found in carriers of telomere-related gene mutations and SNPs are primarily pulmonary fibrosis, sometimes emphysema and rarely pulmonary vascular disease. Genotype-phenotype relations are weak, suggesting that environmental factors and genetic background of patients determine disease phenotypes to a large degree. A disease model is presented wherever genomic variation in telomere-related genes cause specific pulmonary disease phenotypes whenever triggered by environmental exposure, comorbidity, or unknown factors.
Erythroid-specific transcriptional changes in PBMCs from pulmonary hypertension patients.
Directory of Open Access Journals (Sweden)
Chris Cheadle
Full Text Available Gene expression profiling of peripheral blood mononuclear cells (PBMCs is a powerful tool for the identification of surrogate markers involved in disease processes. The hypothesis tested in this study was that chronic exposure of PBMCs to a hypertensive environment in remodeled pulmonary vessels would be reflected by specific transcriptional changes in these cells.The transcript profiles of PBMCs from 30 idiopathic pulmonary arterial hypertension patients (IPAH, 19 patients with systemic sclerosis without pulmonary hypertension (SSc, 42 scleroderma-associated pulmonary arterial hypertensio patients (SSc-PAH, and 8 patients with SSc complicated by interstitial lung disease and pulmonary hypertension (SSc-PH-ILD were compared to the gene expression profiles of PBMCs from 41 healthy individuals. Multiple gene expression signatures were identified which could distinguish various disease groups from controls. One of these signatures, specific for erythrocyte maturation, is enriched specifically in patients with PH. This association was validated in multiple published datasets. The erythropoiesis signature was strongly correlated with hemodynamic measures of increasing disease severity in IPAH patients. No significant correlation of the same type was noted for SSc-PAH patients, this despite a clear signature enrichment within this group overall. These findings suggest an association of the erythropoiesis signature in PBMCs from patients with PH with a variable presentation among different subtypes of disease.In PH, the expansion of immature red blood cell precursors may constitute a response to the increasingly hypoxic conditions prevalent in this syndrome. A correlation of this erythrocyte signature with more severe hypertension cases may provide an important biomarker of disease progression.
Isolation of cowpea genes conferring drought tolerance ...
African Journals Online (AJOL)
The main objective of this study was to identify and isolate the genes conferring drought tolerance in cowpea. A cDNA library enriched for cowpea genes expressed specifically during responses to drought was constructed. A procedure called suppression subtractive hybridisation (SSH) was successfully employed to obtain ...
Mvubu, Nontobeko Eunice; Pillay, Balakrishna; Gamieldien, Junaid; Bishai, William; Pillay, Manormoney
2016-12-01
Although pulmonary epithelial cells are integral to innate and adaptive immune responses during Mycobacterium tuberculosis infection, global transcriptomic changes in these cells remain largely unknown. Changes in gene expression induced in pulmonary epithelial cells infected with M. tuberculosis F15/LAM4/KZN, F11, F28, Beijing and Unique genotypes were investigated by RNA sequencing (RNA-Seq). The Illumina HiSeq 2000 platform generated 50 bp reads that were mapped to the human genome (Hg19) using Tophat (2.0.10). Differential gene expression induced by the different strains in infected relative to the uninfected cells was quantified and compared using Cufflinks (2.1.0) and MeV (4.0.9), respectively. Gene expression varied among the strains with the total number of genes as follows: F15/LAM4/KZN (1187), Beijing (1252), F11 (1639), F28 (870), Unique (886) and H37Rv (1179). A subset of 292 genes was commonly induced by all strains, where 52 genes were down-regulated while 240 genes were up-regulated. Differentially expressed genes were compared among the strains and the number of induced strain-specific gene signatures were as follows: F15/LAM4/KZN (138), Beijing (52), F11 (255), F28 (55), Unique (186) and H37Rv (125). Strain-specific molecular gene signatures associated with functional pathways were observed only for the Unique and H37Rv strains while certain biological functions may be associated with other strain signatures. This study demonstrated that strains of M. tuberculosis induce differential gene expression and strain-specific molecular signatures in pulmonary epithelial cells. Specific signatures induced by clinical strains of M. tuberculosis can be further explored for novel host-associated biomarkers and adjunctive immunotherapies. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki
2006-01-01
Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes
Induction of virulence gene expression in Staphylococcus aureus by pulmonary surfactant.
Ishii, Kenichi; Adachi, Tatsuo; Yasukawa, Jyunichiro; Suzuki, Yutaka; Hamamoto, Hiroshi; Sekimizu, Kazuhisa
2014-04-01
We performed a genomewide analysis using a next-generation sequencer to investigate the effect of pulmonary surfactant on gene expression in Staphylococcus aureus, a clinically important opportunistic pathogen. RNA sequence (RNA-seq) analysis of bacterial transcripts at late log phase revealed 142 genes that were upregulated >2-fold following the addition of pulmonary surfactant to the culture medium. Among these genes, we confirmed by quantitative reverse transcription-PCR analysis that mRNA amounts for genes encoding ESAT-6 secretion system C (EssC), an unknown hypothetical protein (NWMN_0246; also called pulmonary surfactant-inducible factor A [PsiA] in this study), and hemolysin gamma subunit B (HlgB) were increased 3- to 10-fold by the surfactant treatment. Among the major constituents of pulmonary surfactant, i.e., phospholipids and palmitate, only palmitate, which is the most abundant fatty acid in the pulmonary surfactant and a known antibacterial substance, stimulated the expression of these three genes. Moreover, these genes were also induced by supplementing the culture with detergents. The induction of gene expression by surfactant or palmitate was not observed in a disruption mutant of the sigB gene, which encodes an alternative sigma factor involved in bacterial stress responses. Furthermore, each disruption mutant of the essC, psiA, and hlgB genes showed attenuation of both survival in the lung and host-killing ability in a murine pneumonia model. These findings suggest that S. aureus resists membrane stress caused by free fatty acids present in the pulmonary surfactant through the regulation of virulence gene expression, which contributes to its pathogenesis within the lungs of the host animal.
TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis
Directory of Open Access Journals (Sweden)
T. W. Hoffman
2016-01-01
Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.
Directory of Open Access Journals (Sweden)
Richard B Rothman
Full Text Available The use of fenfluramines can increase the risk of developing pulmonary arterial hypertension (PAH in humans, but the mechanisms responsible are unresolved. A recent study reported that female mice lacking the gene for tryptophan hydroxylase-1 (Tph1(-/- mice were protected from PAH caused by chronic dexfenfluramine, suggesting a pivotal role for peripheral serotonin (5-HT in the disease process. Here we tested two alternative hypotheses which might explain the lack of dexfenfluramine-induced PAH in Tph1(-/- mice. We postulated that: 1 Tph1(-/- mice express lower levels of pulmonary 5-HT transporter (SERT when compared to wild-type controls, and 2 Tph1(-/- mice display adaptive changes in the expression of non-serotonergic pulmonary genes which are implicated in PAH. SERT was measured using radioligand binding methods, whereas gene expression was measured using microarrays followed by quantitative real time PCR (qRT-PCR. Contrary to our first hypothesis, the number of pulmonary SERT sites was modestly up-regulated in female Tph1(-/- mice. The expression of 51 distinct genes was significantly altered in the lungs of female Tph1(-/- mice. Consistent with our second hypothesis, qRT-PCR confirmed that at least three genes implicated in the pathogenesis of PAH were markedly up-regulated: Has2, Hapln3 and Retlna. The finding that female Tph1(-/- mice are protected from dexfenfluramine-induced PAH could be related to compensatory changes in pulmonary gene expression, in addition to reductions in peripheral 5-HT. These observations emphasize the intrinsic limitation of interpreting data from studies conducted in transgenic mice that are not fully characterized.
International Nuclear Information System (INIS)
Khalil, K. F.; Butt, T.
2015-01-01
Objective: To measure the diagnostic yield of Bronchoalveolar Lavage (BAL) gene Xpert (Xpert MTB/RIF assay), to detect Mycobacterium tuberculosis (MTB) and rifampicin resistance and compare it with that of mycobacterial cultures in a suspected case of pulmonary tuberculosis. Study Design: An analytical study. Place and Duration of Study: Department of Pulmonology, Fauji Foundation Hospital (FFH), Rawalpindi, from December 2012 to August 2013. Methodology: BAL specimens of 93 patients with suspected pulmonary tuberculosis with smear-negative or sputumscarce disease, who presented to the Department of Pulmonology, FFH, Rawalpindi were inducted. A smear-negative case was one in whom three consecutive early morning sputum samples did not reveal acid fast bacilli when examined by microscopy with Zeihl Nelson (ZN) stain. Patients who had sputum amount less than 1 ml were defined to have sputumscarce disease. The same was evaluated with ZN stain, gene Xpert and mycobacterial cultures. Sensitivity analysis was carried out using culture as the gold standard. Results: The frequency of positive mycobacterial cultures was 85 (91.4%). The sensitivity, specificity, positive predictive value and negative predictive values of BAL gene Xpert to detect Mycobacterium tuberculosis were 91.86%, 71.42%, 97.53% and 41.66% respectively. Xpert MTB/RIF assay had a sensitivity and specificity of 83.33% and 100% to detect rifampicin resistance. Conclusion: Bronchoalveolar lavage gene Xpert had a superior diagnostic yield in patients with either smear-negative or sputum-scarce pulmonary tuberculosis. Hence a positive Xpert MTB/RIF assay may be a useful adjunct to diagnosis and detection of MDR-TB in bronchoalveolar lavage specimens. (author)
D. Talbot; P. Collis; M. Antoniou (Michael); M. Vidal; F.G. Grosveld (Frank); D.R. Greaves (David)
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell
A Time- and Compartment-Specific Activation of Lung Macrophages in Hypoxic Pulmonary Hypertension.
Pugliese, Steven C; Kumar, Sushil; Janssen, William J; Graham, Brian B; Frid, Maria G; Riddle, Suzette R; El Kasmi, Karim C; Stenmark, Kurt R
2017-06-15
Studies in various animal models suggest an important role for pulmonary macrophages in the pathogenesis of pulmonary hypertension (PH). Yet, the molecular mechanisms characterizing the functional macrophage phenotype relative to time and pulmonary localization and compartmentalization remain largely unknown. In this study, we used a hypoxic murine model of PH in combination with FACS to quantify and isolate lung macrophages from two compartments over time and characterize their programing via RNA sequencing approaches. In response to hypoxia, we found an early increase in macrophage number that was restricted to the interstitial/perivascular compartment, without recruitment of macrophages to the alveolar compartment or changes in the number of resident alveolar macrophages. Principal component analysis demonstrated significant differences in overall gene expression between alveolar and interstitial macrophages (IMs) at baseline and after 4 and 14 d hypoxic exposure. Alveolar macrophages at both day 4 and 14 and IMs at day 4 shared a conserved hypoxia program characterized by mitochondrial dysfunction, proinflammatory gene activation, and mTORC1 signaling, whereas IMs at day 14 demonstrated a unique anti-inflammatory/proreparative programming state. We conclude that the pathogenesis of vascular remodeling in hypoxic PH involves an early compartment-independent activation of lung macrophages toward a conserved hypoxia program, with the development of compartment-specific programs later in the course of the disease. Thus, harnessing time- and compartment-specific differences in lung macrophage polarization needs to be considered in the therapeutic targeting of macrophages in hypoxic PH and potentially other inflammatory lung diseases. Copyright © 2017 by The American Association of Immunologists, Inc.
International Nuclear Information System (INIS)
Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng
2005-01-01
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases
Hopper, Rachel K; Feinstein, Jeffrey A; Manning, Melanie A; Benitz, William; Hudgins, Louanne
2015-04-01
Mutations in RAF1 are associated with Noonan syndrome and hypertrophic cardiomyopathy. We present two infants with Noonan syndrome and an identical RAF1 mutation, p.Ser257Leu (c.770C>T), who developed severe pulmonary arterial hypertension (PAH) that proved to be fatal. The RAF1 gene encodes Raf-1 kinase, part of the Ras/mitogen-activated kinase (MAPK) signaling pathway, which has been linked to the development of PAH. This specific mutation has been associated with dephosphorylation of a critical serine residue and constitutive activation of the Raf-1 kinase. These two cases suggest that abnormal activation of the Ras/MAPK pathway may play a significant role in the development of pulmonary vascular disease in the subset of patients with Noonan syndrome and a specific RAF1 mutation. © 2015 Wiley Periodicals, Inc.
Ancestral genes can control the ability of horizontally acquired loci to confer new traits.
Directory of Open Access Journals (Sweden)
H Deborah Chen
2011-07-01
Full Text Available Horizontally acquired genes typically function as autonomous units conferring new abilities when introduced into different species. However, we reasoned that proteins preexisting in an organism might constrain the functionality of a horizontally acquired gene product if it operates on an ancestral pathway. Here, we determine how the horizontally acquired pmrD gene product activates the ancestral PmrA/PmrB two-component system in Salmonella enterica but not in the closely related bacterium Escherichia coli. The Salmonella PmrD protein binds to the phosphorylated PmrA protein (PmrA-P, protecting it from dephosphorylation by the PmrB protein. This results in transcription of PmrA-dependent genes, including those conferring polymyxin B resistance. We now report that the E. coli PmrD protein can activate the PmrA/PmrB system in Salmonella even though it cannot do it in E. coli, suggesting that these two species differ in an additional component controlling PmrA-P levels. We establish that the E. coli PmrB displays higher phosphatase activity towards PmrA-P than the Salmonella PmrB, and we identified a PmrB subdomain responsible for this property. Replacement of the E. coli pmrB gene with the Salmonella homolog was sufficient to render E. coli resistant to polymyxin B under PmrD-inducing conditions. Our findings provide a singular example whereby quantitative differences in the biochemical activities of orthologous ancestral proteins dictate the ability of a horizontally acquired gene product to confer species-specific traits. And they suggest that horizontally acquired genes can potentiate selection at ancestral loci.
Talbot, D.; Collis, P.; Antoniou, Michael; Vidal, M.; Grosveld, Frank; Greaves, David
1989-01-01
textabstractThe regulatory elements that determine the expression pattern of a number of eukaryotic genes expressed specifically in certain tissues have been defined and studied in detail. In general, however, the expression conferred by these elements on genes reintroduced into the genomes of cell lines and transgenic animals has turned out to be at a low level relative to that of endogenous genes, and influenced by the chromosomal site of insertion of the exogenous construct. We have previo...
International Nuclear Information System (INIS)
Tobinaga, Shuichi; Matsumoto, Keitaro; Nagayasu, Takeshi; Furukawa, Katsuro; Abo, Takafumi; Yamasaki, Naoya; Tsuchiya, Tomoshi; Miyazaki, Takuro; Koji, Takehiko
2015-01-01
Pulmonary emphysema is a progressive disease with airspace destruction and an effective therapy is needed. Keratinocyte growth factor (KGF) promotes pulmonary epithelial proliferation and has the potential to induce lung regeneration. The aim of this study was to determine the possibility of using KGF gene therapy for treatment of a mouse emphysema model induced by porcine pancreatic elastase (PPE). Eight-week-old BALB/c male mice treated with intra-tracheal PPE administration were transfected with 80 μg of a recombinant human KGF (rhKGF)-expressing FLAG-CMV14 plasmid (pKGF-FLAG gene), or with the pFLAG gene expressing plasmid as a control, into the quadriceps muscle by electroporation. In the lung, the expression of proliferating cell nuclear antigen (PCNA) was augmented, and surfactant protein A (SP-A) and KGF receptor (KGFR) were co-expressed in PCNA-positive cells. Moreover, endogenous KGF and KGFR gene expression increased significantly by pKGF-FLAG gene transfection. Arterial blood gas analysis revealed that the PaO 2 level was not significantly reduced on day 14 after PPE instillation with pKGF-FLAG gene transfection compared to that of normal mice. These results indicated that KGF gene therapy with electroporation stimulated lung epithelial proliferation and protected depression of pulmonary function in a mouse emphysema model, suggesting a possible method of treating pulmonary emphysema
Sputum smear negative pulmonary tuberculosis: sensitivity and specificity of diagnostic algorithm
Directory of Open Access Journals (Sweden)
Mugusi Ferdinand M
2011-11-01
Full Text Available Abstract Background The diagnosis of pulmonary tuberculosis in patients with Human Immunodeficiency Virus (HIV is complicated by the increased presence of sputum smear negative tuberculosis. Diagnosis of smear negative pulmonary tuberculosis is made by an algorithm recommended by the National Tuberculosis and Leprosy Programme that uses symptoms, signs and laboratory results. The objective of this study is to determine the sensitivity and specificity of the tuberculosis treatment algorithm used for the diagnosis of sputum smear negative pulmonary tuberculosis. Methods A cross-section study with prospective enrollment of patients was conducted in Dar-es-Salaam Tanzania. For patients with sputum smear negative, sputum was sent for culture. All consenting recruited patients were counseled and tested for HIV. Patients were evaluated using the National Tuberculosis and Leprosy Programme guidelines and those fulfilling the criteria of having active pulmonary tuberculosis were started on anti tuberculosis therapy. Remaining patients were provided appropriate therapy. A chest X-ray, mantoux test, and Full Blood Picture were done for each patient. The sensitivity and specificity of the recommended algorithm was calculated. Predictors of sputum culture positive were determined using multivariate analysis. Results During the study, 467 subjects were enrolled. Of those, 318 (68.1% were HIV positive, 127 (27.2% had sputum culture positive for Mycobacteria Tuberculosis, of whom 66 (51.9% were correctly treated with anti-Tuberculosis drugs and 61 (48.1% were missed and did not get anti-Tuberculosis drugs. Of the 286 subjects with sputum culture negative, 107 (37.4% were incorrectly treated with anti-Tuberculosis drugs. The diagnostic algorithm for smear negative pulmonary tuberculosis had a sensitivity and specificity of 38.1% and 74.5% respectively. The presence of a dry cough, a high respiratory rate, a low eosinophil count, a mixed type of anaemia and
Molecular characterization of the porcine surfactant, pulmonary-associated protein C gene
DEFF Research Database (Denmark)
Cirera, S.; Nygård, A.B.; Jensen, H.E.
2006-01-01
The surfactant, pulmonary-associated protein C (SFTPC) is a peptide secreted by the alveolar type II pneumocytes of the lung. We have characterized the porcine SFTPC gene at genomic, transcriptional, and protein levels. The porcine SFTPC is a single-copy gene on pig chromosome 14. Two transcripts...
Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.
Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J
1999-11-23
The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.
The Impact of Immunosenescence on Pulmonary Disease.
LENUS (Irish Health Repository)
Murray, Michelle A
2015-08-01
The global population is aging with significant gains in life expectancy particularly in the developed world. Consequently, greater focus on understanding the processes that underlie physiological aging has occurred. Key facets of advancing age include genomic instability, telomere shortening, epigenetic changes, and declines in immune function termed immunosenescence. Immunosenescence and its associated chronic low grade systemic "inflamm-aging" contribute to the development and progression of pulmonary disease in older individuals. These physiological processes predispose to pulmonary infection and confer specific and unique clinical phenotypes observed in chronic respiratory disease including late-onset asthma, chronic obstructive pulmonary disease, and pulmonary fibrosis. Emerging concepts of the gut and airway microbiome further complicate the interrelationship between host and microorganism particularly from an immunological perspective and especially so in the setting of immunosenescence. This review focuses on our current understanding of the aging process, immunosenescence, and how it can potentially impact on various pulmonary diseases and the human microbiome.
O'Neill, M; Chen, A; Murray, N E
1997-12-23
Type II restriction and modification (R-M) genes have been described as selfish because they have been shown to impose selection for the maintenance of the plasmid that encodes them. In our experiments, the type I R-M system EcoKI does not behave in the same way. The genes specifying EcoKI are, however, normally residents of the chromosome and therefore our analyses were extended to monitor the deletion of chromosomal genes rather than loss of plasmid vector. If EcoKI were to behave in the same way as the plasmid-encoded type II R-M systems, the loss of the relevant chromosomal genes by mutation or recombination should lead to cell death because the cell would become deficient in modification enzyme and the bacterial chromosome would be vulnerable to the restriction endonuclease. Our data contradict this prediction; they reveal that functional type I R-M genes in the chromosome are readily replaced by mutant alleles and by alleles encoding a type I R-M system of different specificity. The acquisition of allelic genes conferring a new sequence specificity, but not the loss of the resident genes, is dependent on the product of an unlinked gene, one predicted [Prakash-Cheng, A., Chung, S. S. & Ryu, J. (1993) Mol. Gen. Genet. 241, 491-496] to be relevant to control of expression of the genes that encode EcoKI. Our evidence suggests that not all R-M systems are evolving as "selfish" units; rather, the diversity and distribution of the family of type I enzymes we have investigated require an alternative selective pressure.
Specific echocardiographic findings useful for the diagnosis of common pulmonary vein atresia
Directory of Open Access Journals (Sweden)
Hiroyuki Nagasawa
2015-12-01
Full Text Available In this paper, we report a case of common pulmonary vein atresia, which is a very rare disease characterized by cyanosis, heart failure and pulmonary hypertension. Reverse flow in the pulmonary artery at end-diastole as well as in the isthmus of the aorta from early systole to end-diastole detected by echocardiography were found to be specific features useful in diagnosing the disease.
Directory of Open Access Journals (Sweden)
Jordan K. Boutilier
2017-09-01
Full Text Available The pulmonary myocardium is a muscular coat surrounding the pulmonary and caval veins. Although its definitive physiological function is unknown, it may have a pathological role as the source of ectopic beats initiating atrial fibrillation. How the pulmonary myocardium gains pacemaker function is not clearly defined, although recent evidence indicates that changed transcriptional gene expression networks are at fault. The gene expression profile of this distinct cell type in situ was examined to investigate underlying molecular events that might contribute to atrial fibrillation. Via systems genetics, a whole-lung transcriptome data set from the BXD recombinant inbred mouse resource was analyzed, uncovering a pulmonary cardiomyocyte gene network of 24 transcripts, coordinately regulated by chromosome 1 and 2 loci. Promoter enrichment analysis and interrogation of publicly available ChIP-seq data suggested that transcription of this gene network may be regulated by the concerted activity of NKX2-5, serum response factor, myocyte enhancer factor 2, and also, at a post-transcriptional level, by RNA binding protein motif 20. Gene ontology terms indicate that this gene network overlaps with molecular markers of the stressed heart. Therefore, we propose that perturbed regulation of this gene network might lead to altered calcium handling, myocyte growth, and contractile force contributing to the aberrant electrophysiological properties observed in atrial fibrillation. We reveal novel molecular interactions and pathways representing possible therapeutic targets for atrial fibrillation. In addition, we highlight the utility of recombinant inbred mouse resources in detecting and characterizing gene expression networks of relatively small populations of cells that have a pathological significance.
International Nuclear Information System (INIS)
Yu Lunyin; Quinn, Deborah A.; Garg, Hari G.; Hales, Charles A.
2006-01-01
The balance between cell proliferation and cell quiescence is regulated delicately by a variety of mediators, in which cyclin-dependent kinases (CDK) and CDK inhibitors (CDKI) play a very important role. Heparin which inhibits pulmonary artery smooth muscle cell (PASMC) proliferation increases the levels of two CDKIs, p21 and p27, although only p27 is important in inhibition of PASMC growth in vitro and in vivo. In the present study we investigated the expression profile of all the cell cycle regulating genes, including all seven CDKIs (p21, p27, p57, p15, p16, p18, and p19), in the lungs of mice with hypoxia-induced pulmonary hypertension. A cell cycle pathway specific gene microarray was used to profile the 96 genes involved in cell cycle regulation. We also observed the effect of heparin on gene expression. We found that (a) hypoxic exposure for two weeks significantly inhibited p27 expression and stimulated p18 activity, showing a 98% decrease in p27 and 81% increase in p18; (b) other CDKIs, p21, p57, p15, p16, and p19 were not affected significantly in response to hypoxia; (c) heparin treatment restored p27 expression, but did not influence p18; (d) ERK1/2 and p38 were mediators in heparin upregulation of p27. This study provides an expression profile of cell cycle regulating genes under hypoxia in mice with hypoxia-induced pulmonary hypertension and strengthens the previous finding that p27 is the only CDKI involved in heparin regulation of PASMC proliferation and hypoxia-induced pulmonary hypertension
Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo
2018-05-15
, because probiotic bacteria are used for human and animal consumption, one of the safety concerns over these bacteria is the presence of antibiotic resistance genes, since the human gut is a densely populated habitat that could favor the transfer of genetic material to potential pathogens. In this study, we analyzed the genetic basis responsible for the erythromycin and clindamycin resistance phenotype of B. breve CECT7263. We were able to identify and characterize a novel gene homologous to rRNA methylase genes which confers erythromycin and clindamycin resistance. This gene seems to be very uncommon in other bifidobacteria and in the gut microbiomes of both adults and infants. Even though conjugation experiments showed the absence of transferability under in vitro conditions, it has been predicted to be located in a putative genomic island recently acquired by specific bifidobacterial strains. Copyright © 2018 American Society for Microbiology.
Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.
Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki
2012-12-01
Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.
Seo, Heewon; Kwon, Eun Jin; You, Young-Ah; Park, Yoomi; Min, Byung Joo; Yoo, Kyunghun; Hwang, Han-Sung; Kim, Ju Han; Kim, Young Ju
2018-01-24
Ritodrine is a commonly used tocolytic to prevent preterm labour. However, it can cause unexpected serious adverse reactions, such as pulmonary oedema, pulmonary congestion, and tachycardia. It is unknown whether such adverse reactions are associated with pharmacogenomic variants in patients. Whole-exome sequencing of 13 subjects with serious ritodrine-induced cardiac and pulmonary side-effects was performed to identify causal genes and variants. The deleterious impact of nonsynonymous substitutions for all genes was computed and compared between cases (n = 13) and controls (n = 30). The significant genes were annotated with Gene Ontology (GO), and the associated disease terms were categorised into four functional classes for functional enrichment tests. To assess the impact of distributed rare variants in cases with side effects, we carried out rare variant association tests with a minor allele frequency ≤ 1% using the burden test, the sequence Kernel association test (SKAT), and optimised SKAT. We identified 28 genes that showed significantly lower gene-wise deleteriousness scores in cases than in controls. Three of the identified genes-CYP1A1, CYP8B1, and SERPINA7-are pharmacokinetic genes. The significantly identified genes were categorized into four functional classes: ion binding, ATP binding, Ca 2+ -related, and ciliopathies-related. These four classes were significantly enriched with ciliary genes according to SYSCILIA Gold Standard genes (P side effects may be associated with deleterious genetic variants in ciliary and pharmacokinetic genes.
Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.
2001-01-01
The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,
Lung-specific loss of α3 laminin worsens bleomycin-induced pulmonary fibrosis.
Morales-Nebreda, Luisa I; Rogel, Micah R; Eisenberg, Jessica L; Hamill, Kevin J; Soberanes, Saul; Nigdelioglu, Recep; Chi, Monica; Cho, Takugo; Radigan, Kathryn A; Ridge, Karen M; Misharin, Alexander V; Woychek, Alex; Hopkinson, Susan; Perlman, Harris; Mutlu, Gokhan M; Pardo, Annie; Selman, Moises; Jones, Jonathan C R; Budinger, G R Scott
2015-04-01
Laminins are heterotrimeric proteins that are secreted by the alveolar epithelium into the basement membrane, and their expression is altered in extracellular matrices from patients with pulmonary fibrosis. In a small number of patients with pulmonary fibrosis, we found that the normal basement membrane distribution of the α3 laminin subunit was lost in fibrotic regions of the lung. To determine if these changes play a causal role in the development of fibrosis, we generated mice lacking the α3 laminin subunit specifically in the lung epithelium by crossing mice expressing Cre recombinase driven by the surfactant protein C promoter (SPC-Cre) with mice expressing floxed alleles encoding the α3 laminin gene (Lama3(fl/fl)). These mice exhibited no developmental abnormalities in the lungs up to 6 months of age, but, compared with control mice, had worsened mortality, increased inflammation, and increased fibrosis after the intratracheal administration of bleomycin. Similarly, the severity of fibrosis induced by an adenovirus encoding an active form of transforming growth factor-β was worse in mice deficient in α3 laminin in the lung. Taken together, our results suggest that the loss of α3 laminin in the lung epithelium does not affect lung development, but plays a causal role in the development of fibrosis in response to bleomycin or adenovirally delivered transforming growth factor-β. Thus, we speculate that the loss of the normal basement membrane organization of α3 laminin that we observe in fibrotic regions from the lungs of patients with pulmonary fibrosis contributes to their disease progression.
A novel gene of Kalanchoe daigremontiana confers plant drought resistance.
Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi
2018-02-07
Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)
2007-07-01
As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.
Directory of Open Access Journals (Sweden)
Simon Blankley
Full Text Available Mycobacterium tuberculosis infection is a leading cause of infectious death worldwide. Gene-expression microarray studies profiling the blood transcriptional response of tuberculosis (TB patients have been undertaken in order to better understand the host immune response as well as to identify potential biomarkers of disease. To date most of these studies have focused on pulmonary TB patients with gene-expression profiles of extra-pulmonary TB patients yet to be compared to those of patients with pulmonary TB or sarcoidosis.A novel cohort of patients with extra-pulmonary TB and sarcoidosis was recruited and the transcriptional response of these patients compared to those with pulmonary TB using a variety of transcriptomic approaches including testing a previously defined 380 gene meta-signature of active TB.The 380 meta-signature broadly differentiated active TB from healthy controls in this new dataset consisting of pulmonary and extra-pulmonary TB. The top 15 genes from this meta-signature had a lower sensitivity for differentiating extra-pulmonary TB from healthy controls as compared to pulmonary TB. We found the blood transcriptional responses in pulmonary and extra-pulmonary TB to be heterogeneous and to reflect the extent of symptoms of disease.The transcriptional signature in extra-pulmonary TB demonstrated heterogeneity of gene expression reflective of symptom status, while the signature of pulmonary TB was distinct, based on a higher proportion of symptomatic individuals. These findings are of importance for the rational design and implementation of mRNA based TB diagnostics.
Pulmonary arterial hypertension
2013-01-01
Pulmonary arterial hypertension (PAH) is a chronic and progressive disease leading to right heart failure and ultimately death if untreated. The first classification of PH was proposed in 1973. In 2008, the fourth World Symposium on PH held in Dana Point (California, USA) revised previous classifications. Currently, PH is devided into five subgroups. Group 1 includes patients suffering from idiopathic or familial PAH with or without germline mutations. Patients with a diagnosis of PAH should systematically been screened regarding to underlying mutations of BMPR2 gene (bone morphogenetic protein receptor type 2) or more rarely of ACVRL1 (activine receptor-like kinase type 1), ENG (endogline) or Smad8 genes. Pulmonary veno occusive disease and pulmonary capillary hemagiomatosis are individualized and designated as clinical group 1'. Group 2 'Pulmonary hypertension due to left heart diseases' is divided into three sub-groups: systolic dysfonction, diastolic dysfonction and valvular dysfonction. Group 3 'Pulmonary hypertension due to respiratory diseases' includes a heterogenous subgroup of respiratory diseases like PH due to pulmonary fibrosis, COPD, lung emphysema or interstitial lung disease for exemple. Group 4 includes chronic thromboembolic pulmonary hypertension without any distinction of proximal or distal forms. Group 5 regroup PH patients with unclear multifactorial mechanisms. Invasive hemodynamic assessment with right heart catheterization is requested to confirm the definite diagnosis of PH showing a resting mean pulmonary artery pressure (mPAP) of ≥ 25 mmHg and a normal pulmonary capillary wedge pressure (PCWP) of ≤ 15 mmHg. The assessment of PCWP may allow the distinction between pre-capillary and post-capillary PH (PCWP > 15 mmHg). Echocardiography is an important tool in the management of patients with underlying suspicion of PH. The European Society of Cardiology and the European Respiratory Society (ESC-ERS) guidelines specify its role
Li, Xian-Wei; Du, Jie; Li, Yuan-Jian
2013-03-01
To observe the effect of calcitonin gene-related peptide (CGRP) on pulmonary vascular collagen accumulation in hypoxia rats in order to study the effect of CGRP on hypoxic pulmonary vascular structural remodeling and its possible mechanism. Rats were acclimated for 1 week, and then were randomly divided into three groups: normoxia group, hypoxia group, and hypoxia plus capsaicin group. Pulmonary arterial hypertension was induced by hypoxia in rats. Hypoxia plus capsaicin group, rats were given capsaicin (50 mg/(kg x d), s.c) 4 days before hypoxia to deplete endogenous CGRP. Hypoxia (3% O2) stimulated proliferation of pulmonary arterial smooth muscle cells (PASMCs) and proliferation was measured by BrdU marking. The expression levels of CGRP, phosphorylated ERK1/2 (p-ERK1/ 2), collagen I and collagen III were detected by real-time PCR or Western blot. Right ventricle systolic pressure (RVSP) and mean pulmonary arterial pressure (mPAP) of pulmonary arterial hypertension (PAH) rats induced by hypoxia were higher than those of normoxia rats. By HE and Masson staining, it was demonstrated that hypoxia also significantly induced hypertrophy of pulmonary arteries and increased level of collagen accumulation. Hypoxia dramatically decreased the CGRP level and increased the expression of p-ERK1/2, collagen I, collagen III in pulmonary arteries. All these effects of hypoxia were further aggravated by pre-treatment of rats with capsaicin. CGRP concentration-dependently inhibited hypoxia-induced proliferation of PASMCs, markedly decreased the expression of p-ERK1/2, collagen I and collagen III. All these effects of CGRP were abolished in the presence of CGRP8-37. These results suggest that CGRP might inhibit hypoxia-induced PAH and pulmonary vascular remodeling, through inhibiting phosphorylation of ERK1/2 and alleviating the collagen accumulation of pulmonary arteries.
DEFF Research Database (Denmark)
Husain, Mainul; Saber, Anne Thoustrup; Guo, Charles
2013-01-01
We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO2). Female C57BL/6 mice were exposed to rutile nano-TiO2 via single intratracheal instillations of 18, 54, and 162......μg/mouse. Mice were sampled 1, 3, and 28days post-exposure. The deposition of nano-TiO2 in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific q...
Zhao, Qiang; Liu, Zixiong; Wang, Zhe; Yang, Cheng; Liu, Jun; Lu, Jun
2007-08-01
Calcitonin gene-related peptide (CGRP) is a potent smooth muscle cell proliferation inhibitor and vasodilator. It is now believed that CGRP plays an important role in maintaining a low pulmonary vascular resistance. We evaluated the therapeutic effect of intravenously administered CGRP-expressing endothelial progenitor cells (EPCs) on left-to-right shunt-induced pulmonary hypertension in rats. Endothelial progenitor cells were obtained from cultured human peripheral blood mononuclear cells. The genetic sequence for CGRP was subcloned into cultured EPCs by human expression plasmid. Pulmonary hypertension was established in immunodeficient rats with an abdominal aorta to inferior vena cava shunt operation. The transfected EPCs were injected through the left jugular vein at 10 weeks after the shunt operation. Mean pulmonary artery pressure and total pulmonary vascular resistance were detected with right cardiac catheterization at 4 weeks. The distribution of EPCs in the lung tissue was examined with immunofluorescence technique. Histopathologic changes in the structure of the pulmonary arteries was observed with electron microscopy and subjected to computerized image analysis. The lungs of rats transplanted with CGRP-expressing EPCs demonstrated a decrease in both mean pulmonary artery pressure (17.64 +/- 0.79 versus 22.08 +/- 0.95 mm Hg; p = 0.018) and total pulmonary vascular resistance (1.26 +/- 0.07 versus 2.45 +/- 0.18 mm Hg x min/mL; p = 0.037) at 4 weeks. Immunofluorescence revealed that intravenously administered cells were incorporated into the pulmonary vasculature. Pulmonary vascular remodeling was remarkably attenuated with the administration of CGRP-expressing EPCs. The transplantation of CGRP-expressing EPCs may effectively attenuate established pulmonary hypertension and exert reversal effects on pulmonary vascular remodeling. Our findings suggest that the therapy based on the combination of both CGRP transfection and EPCs may be a potentially useful
Cerebral Venous Thrombosis and Pulmonary Embolism with Prothrombin G20210A Gene Mutation.
Dagli, Canan Eren; Koksal, Nurhan; Guler, Selma; Gelen, Mehmet Emin; Atilla, Nurhan; Tuncel, Deniz
2010-04-01
A 25-year-old man presented with symptoms of syncope, cough, headache and hemoptysis. Cranial MR and venography showed thrombus formation in the right transverse sinus and superior sagittal sinus. Computed tomographic pulmonary angiography (CTPA) showed an embolic thrombus in the right pulmonary truncus and lung abscess. The patient was young, and there were no signs of lower extremity deep venous thrombosis or other major risk factors for pulmonary embolism (PE) including cardiac anomaly. The only risk factor we were able to identify was the presence of the prothrombin G20210A gene mutation. Anticoagulant treatment with oral warfarin (10 mg daily) and imipenem (4X500 mg) was started. The patient was hospitalized for antibiotic and anticoagulation therapies for three weeks and was discharged on lifelong treatment with warfarin (5 mg daily).
Directory of Open Access Journals (Sweden)
Xinyan Wang
Full Text Available Chronic obstructive pulmonary disease (COPD is a multi-factor disease, in which metabolic disturbances played important roles. In this paper, functional information was integrated into a COPD-related metabolic network to assess similarity between genes. Then a gene prioritization method was applied to the COPD-related metabolic network to prioritize COPD candidate genes. The gene prioritization method was superior to ToppGene and ToppNet in both literature validation and functional enrichment analysis. Top-ranked genes prioritized from the metabolic perspective with functional information could promote the better understanding about the molecular mechanism of this disease. Top 100 genes might be potential markers for diagnostic and effective therapies.
Comprehensive analysis of gene-expression profile in chronic obstructive pulmonary disease
Directory of Open Access Journals (Sweden)
Wei L
2015-06-01
Full Text Available Lei Wei,1,* Dong Xu,2,* Yechang Qian,1 Guoyi Huang,1 Wei Ma,1 Fangying Liu,1 Yanhua Shen,1 Zhongfu Wang,1 Li Li,1 Shanfang Zhang,1 Yafang Chen1 1Department of Respiratory Disease, Baoshan District Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai, 2Medical College of Soochow University, Suzhou, People's Republic of China *These authors contributed equally to this work Objective: To investigate the gene-expression profile of chronic obstructive pulmonary disease (COPD patients and explore the possible therapeutic targets. Methods: The microarray raw dataset GSE29133, including three COPD samples and three normal samples, was obtained from Gene Expression Omnibus. After data preprocessing with the Affy package, Student’s t-test was employed to identify the differentially expressed genes (DEGs. The up- and downregulated DEGs were then pooled for gene-ontology and pathway-enrichment analyses using the Database for Annotation, Visualization and Integrated Discovery (DAVID. The upstream regulatory elements of these DEGs were also explored by using Whole-Genome rVISTA. Furthermore, we constructed a protein–protein interaction (PPI network for DEGs. The surfactant protein D (SP-D serum level and HLA-A gene frequency in COPD patients and healthy controls were also measured by enzyme-linked immunosorbent assay (ELISA and real-time polymerase chain reaction, respectively. Results: A total of 39 up- and 15 downregulated DEGs were screened. Most of the upregulated genes were involved in the immune response process, while the downregulated genes were involved in the steroid metabolic process. Moreover, we also found that HLA-A has the highest degree in the PPI network. The SP-D serum level and HLA-A gene frequency in COPD patients were significantly higher than those in healthy controls (13.62±2.09 ng/mL vs 10.28±2.86 ng/mL; 62.5% vs 12.5%; P<0.05. Conclusion: Our results may help further the understanding of the mechanisms of
Resistance to Downy Mildew in Lettuce 'La Brillante' is Conferred by Dm50 Gene and Multiple QTL.
Simko, Ivan; Ochoa, Oswaldo E; Pel, Mathieu A; Tsuchida, Cayla; Font I Forcada, Carolina; Hayes, Ryan J; Truco, Maria-Jose; Antonise, Rudie; Galeano, Carlos H; Michelmore, Richard W
2015-09-01
Many cultivars of lettuce (Lactuca sativa L.) are susceptible to downy mildew, a nearly globally ubiquitous disease caused by Bremia lactucae. We previously determined that Batavia type cultivar 'La Brillante' has a high level of field resistance to the disease in California. Testing of a mapping population developed from a cross between 'Salinas 88' and La Brillante in multiple field and laboratory experiments revealed that at least five loci conferred resistance in La Brillante. The presence of a new dominant resistance gene (designated Dm50) that confers complete resistance to specific isolates was detected in laboratory tests of seedlings inoculated with multiple diverse isolates. Dm50 is located in the major resistance cluster on linkage group 2 that contains at least eight major, dominant Dm genes conferring resistance to downy mildew. However, this Dm gene is ineffective against the isolates of B. lactucae prevalent in the field in California and the Netherlands. A quantitative trait locus (QTL) located at the Dm50 chromosomal region (qDM2.2) was detected, though, when the amount of disease was evaluated a month before plants reached harvest maturity. Four additional QTL for resistance to B. lactucae were identified on linkage groups 4 (qDM4.1 and qDM4.2), 7 (qDM7.1), and 9 (qDM9.2). The largest effect was associated with qDM7.1 (up to 32.9% of the total phenotypic variance) that determined resistance in multiple field experiments. Markers identified in the present study will facilitate introduction of these resistance loci into commercial cultivars of lettuce.
Directory of Open Access Journals (Sweden)
Kathie-Anne Walters
Full Text Available Pulmonary exposure to Francisella tularensis is associated with severe lung pathology and a high mortality rate. The lack of induction of classical inflammatory mediators, including IL1-β and TNF-α, during early infection has led to the suggestion that F. tularensis evades detection by host innate immune surveillance and/or actively suppresses inflammation. To gain more insight into the host response to Francisella infection during the acute stage, transcriptomic analysis was performed on lung tissue from mice exposed to virulent (Francisella tularensis ssp tularensis SchuS4. Despite an extensive transcriptional response in the lungs of animals as early as 4 hrs post-exposure, Francisella tularensis was associated with an almost complete lack of induction of immune-related genes during the initial 24 hrs post-exposure. This broad subversion of innate immune responses was particularly evident when compared to the pulmonary inflammatory response induced by other lethal (Yersinia pestis and non-lethal (Legionella pneumophila, Pseudomonas aeruginosa pulmonary infections. However, the unique induction of a subset of inflammation-related genes suggests a role for dysregulation of lymphocyte function and anti-inflammatory pathways in the extreme virulence of Francisella. Subsequent activation of a classical inflammatory response 48 hrs post-exposure was associated with altered abundance of Francisella-specific transcripts, including those associated with bacterial surface components. In summary, virulent Francisella induces a unique pulmonary inflammatory response characterized by temporal regulation of innate immune pathways correlating with altered bacterial gene expression patterns. This study represents the first simultaneous measurement of both host and Francisella transcriptome changes that occur during in vivo infection and identifies potential bacterial virulence factors responsible for regulation of host inflammatory pathways.
Directory of Open Access Journals (Sweden)
Shi-Min Yuan
2018-04-01
Full Text Available Pulmonary artery hypertension (PAH is very rare in childhood, and it can be divided into heritable, idiopathic drug- and toxin-induced and other disease (connective tissue disease, human immunodeficiency virus infection, portal hypertension, congenital heart disease, or schistosomiasis-associated types. PAH could not be interpreted solely by pathophysiological theories. The impact of the transforming growth factor-β superfamily-related genes on the development of PAH in children remains to be clarified. Pertinent literature on the transforming growth factor-β superfamily-related genes in relation to PAH in children published after the year 2000 was reviewed and analyzed. Bone morphogenetic protein receptor type II gene mutation promotes cell division or prevents cell death, resulting in an overgrowth of cells in small arteries throughout the lungs. About 20% of individuals with a bone morphogenetic protein receptor type II gene mutation develop symptomatic PAH. In heritable PAH, bone morphogenetic protein receptor type II mutations may be absent; while mutations of other genes, such as type I receptor activin receptor-like kinase 1 and the type III receptor endoglin (both associated with hereditary hemorrhagic telangiectasia, caveolin-1 and KCNK3, the gene encoding potassium channel subfamily K, member 3, can be detected, instead. Gene mutations, environmental changes and acquired adjustment, etc. may explain the development of PAH. The researches on PAH rat model and familial PAH members may facilitate the elucidations of the mechanisms and further provide theories for prophylaxis and treatment of PAH. Key Words: bone morphogenetic proteins, mutation, pulmonary hypertension
Genetics of pulmonary hypertension in the clinic.
Girerd, Barbara; Lau, Edmund; Montani, David; Humbert, Marc
2017-09-01
Heritable pulmonary arterial hypertension (PAH) is an autosomal dominant disease with incomplete penetrance because of mutations in bone morphogenetic protein receptor-II (BMPR2), activin A receptor type II-like kinase 1, endoglin, caveolin-1, potassium channel subfamily K, member 3, and T-box gene 4 genes. Heritable pulmonary veno-occlusive disease and/or pulmonary capillary hemangiomatosis (PVOD/PCH) is an autosomal recessive disease because of biallelic mutations in the eukaryotic translation initiation factor 2 alpha kinase 4 gene. The 2015 european society of cardiology (ESC) and european respiratory society (ERS) pulmonary hypertension guidelines recommend genetic counselling and testing to adults and children with PAH or PVOD/PCH as well as in adult relatives at risk of carrying a predisposing mutation. In France, genetic counseling and testing are offered to all patients displaying sporadic or familial form of PAH or PVOD/PCH and to their relatives at high risk of carrying a predisposing mutation. Patients with a heritable form of PAH are younger at diagnosis with a worse hemodynamic and a dismal prognosis. Patients with a heritable form of PVOD/PCH are younger at diagnosis with a worse response to specific PAH therapies. A program to detect PAH in an early phase was offered to all asymptomatic BMPR2 mutation carriers, according to the 2015 ESC/ERS guidelines. Finally, preimplantation genetic diagnosis has been performed in families with a history of BMPR2 mutations. Genetic counseling and testing has to be implemented in pulmonary hypertension centers.
Figueira, Cláudio Pereira; Croda, Julio; Choy, Henry A; Haake, David A; Reis, Mitermayer G; Ko, Albert I; Picardeau, Mathieu
2011-06-09
In comparison to other bacterial pathogens, our knowledge of the molecular basis of the pathogenesis of leptospirosis is extremely limited. An improved understanding of leptospiral pathogenetic mechanisms requires reliable tools for functional genetic analysis. Leptospiral immunoglobulin-like (Lig) proteins are surface proteins found in pathogenic Leptospira, but not in saprophytes. Here, we describe a system for heterologous expression of the Leptospira interrogans genes ligA and ligB in the saprophyte Leptospira biflexa serovar Patoc. The genes encoding LigA and LigB under the control of a constitutive spirochaetal promoter were inserted into the L. biflexa replicative plasmid. We were able to demonstrate expression and surface localization of LigA and LigB in L. biflexa. We found that the expression of the lig genes significantly enhanced the ability of transformed L. biflexa to adhere in vitro to extracellular matrix components and cultured cells, suggesting the involvement of Lig proteins in cell adhesion. This work reports a complete description of the system we have developed for heterologous expression of pathogen-specific proteins in the saprophytic L. biflexa. We show that expression of LigA and LigB proteins from the pathogen confers a virulence-associated phenotype on L. biflexa, namely adhesion to eukaryotic cells and fibronectin in vitro. This study indicates that L. biflexa can serve as a surrogate host to characterize the role of key virulence factors of the causative agent of leptospirosis.
Association of P2X7 gene common polymorphisms with pulmonary tuberculosis in Lur population of Iran
Directory of Open Access Journals (Sweden)
Ali Amiri
2018-07-01
Full Text Available Background: Different genetic and environmental factors are associated with susceptibility to pulmonary tuberculosis (TB in different individuals of different populations. Based on previous studies role of P2X7 gene common polymorphisms in susceptibility to pulmonary TB was associated with ethnicities. Aim: We intend to perform this study on genetic reservoir (gene pool of Lur population of western Iran. Methods: For the present case-control study, 100 unrelated pulmonary TB patients and 100 unrelated controls were enrolled through convenient sampling. TB confirmation was through smear and culture of sputum. Polymerase chain reaction with restriction fragment length polymorphism (PCR-RFLP was used for molecular assay. This study has been approved in the ethic committee of Lorestan University of Medical Sciences with registration number LUMS.REC.1396.253. Results: Among the genotypes of polymorphism 1513A/C, AA genotype was associated with susceptibility to pulmonary TB (P = .0001; OR = 4.750 whereas AC genotype was a protecting factor (P = .0001; OR = 0.192. Higher genetic reservoir of A allele was associated with more susceptibility to pulmonary TB (P = .0001; OR = 2.879 whereas C allele was a protecting factor (P = .0001; OR = 0.347. No significant result was found for −762T/C polymorphism. Conclusion: In Lur population of Iran, 1513A/C polymorphism of P2X7 is associated with susceptibility to pulmonary TB. It is suggested that bio-information banks should be established and developed in countries. Keywords: Pulmonary tuberculosis, Immunogenetics, P2X7, Population genetics
Zhang, Xing; Guo, Jing; Fan, Shufeng; Li, Yanyuan; Wei, Liliang; Yang, Xiuyun; Jiang, Tingting; Chen, Zhongliang; Wang, Chong; Liu, Jiyan; Ping, Zepeng; Xu, Dandan; Wang, Jiaxiong; Li, Zhongjie; Qiu, Yunqing; Li, Ji-Cheng
2013-01-01
It is very difficult to prevent pulmonary tuberculosis (TB) due to the lack of specific and diagnostic markers, which could lead to a high incidence of pulmonary TB. We screened the differentially expressed serum microRNAs (miRNAs) as potential biomarkers for the diagnosis of pulmonary TB. In this study, serum miRNAs were screened using the Solexa sequencing method as the potential biomarkers for the diagnosis of pulmonary TB. The stem-loop quantitative reverse-transcription polymerase chain reaction (qRT-PCR) assay was used to verify differentially expressed serum miRNAs. The receiver operating characteristic (ROC) curve and logistic regression model were used to analyze the sensitivity and specificity of the single miRNA and a combination of miRNAs for diagnosis, respectively. Using the predicted target genes, we constructed the regulatory networks of miRNAs and genes that were related to pulmonary TB. The Solexa sequencing data showed that 91 serum miRNAs were differentially expressed in pulmonary TB patients, compared to healthy controls. Following qRT-PCR confirmation, six serum miRNAs (hsa-miR-378, hsa-miR-483-5p, hsa-miR-22, hsa-miR-29c, hsa-miR-101 and hsa-miR-320b) showed significant difference among pulmonary TB patients, healthy controls (P<0.001) and differential diagnosis groups (including patients with pneumonia, lung cancer and chronic obstructive pulmonary disease) (P<0.05). The logistic regression analysis of a combination of six serum miRNAs revealed that the sensitivity and the specificity of TB diagnosis were 95.0% and 91.8% respectively. The miRNAs-gene regulatory networks revealed that several miRNAs may regulate some target genes involved in immune pathways and participate in the pathogenesis of pulmonary TB. Our study suggests that a combination of six serum miRNAs have great potential to serve as non-invasive biomarkers of pulmonary TB.
Deterding, Robin R.; Wert, Susan E.; White, Frances V.; Dishop, Megan K.; Alfano, Danielle N.; Halbower, Ann C.; Planer, Benjamin; Stephan, Mark J.; Uchida, Derek A.; Williames, Lee D.; Rosenfeld, Jill A.; Lebel, Robert Roger; Young, Lisa R.; Cole, F. Sessions; Nogee, Lawrence M.
2013-01-01
Background: Mutations in the gene encoding thyroid transcription factor, NKX2-1, result in neurologic abnormalities, hypothyroidism, and neonatal respiratory distress syndrome (RDS) that together are known as the brain-thyroid-lung syndrome. To characterize the spectrum of associated pulmonary phenotypes, we identified individuals with mutations in NKX2-1 whose primary manifestation was respiratory disease. Methods: Retrospective and prospective approaches identified infants and children with unexplained diffuse lung disease for NKX2-1 sequencing. Histopathologic results and electron micrographs were assessed, and immunohistochemical analysis for surfactant-associated proteins was performed in a subset of 10 children for whom lung tissue was available. Results: We identified 16 individuals with heterozygous missense, nonsense, and frameshift mutations and five individuals with heterozygous, whole-gene deletions of NKX2-1. Neonatal RDS was the presenting pulmonary phenotype in 16 individuals (76%), interstitial lung disease in four (19%), and pulmonary fibrosis in one adult family member. Altogether, 12 individuals (57%) had the full triad of neurologic, thyroid, and respiratory manifestations, but five (24%) had only pulmonary symptoms at the time of presentation. Recurrent respiratory infections were a prominent feature in nine subjects. Lung histopathology demonstrated evidence of disrupted surfactant homeostasis in the majority of cases, and at least five cases had evidence of disrupted lung growth. Conclusions: Patients with mutations in NKX2-1 may present with pulmonary manifestations in the newborn period or during childhood when thyroid or neurologic abnormalities are not apparent. Surfactant dysfunction and, in more severe cases, disrupted lung development are likely mechanisms for the respiratory disease. PMID:23430038
Hassanpour, Hossein; Khalaji-Pirbalouty, Valiallah; Nasiri, Leila; Mohebbi, Abdonnaser; Bahadoran, Shahab
2015-11-01
To evaluate oxidant and antioxidant status of the brain (hindbrain, midbrain, and forebrain) in chickens with cold-induced pulmonary hypertension, the measurements of lipid peroxidation, protein oxidation, antioxidant capacity, enzymatic activity, and gene expression (for catalase, glutathione peroxidase, and superoxide dismutases) were done. There were high lipid peroxidation/protein oxidation and low antioxidant capacity in the hindbrain of cold-induced pulmonary hypertensive chickens compared to control ( P pulmonary hypertension.
Genus and species-specific IgG and IgM antibodies pulmonary tuberculosis
International Nuclear Information System (INIS)
Butt, T.; Abbassi, S.A.; Ahmad, R.N.; Mahmood, A.; Karamat, K.A; Malik, H.S.; Anwar, M.
2004-01-01
Objective: To evaluate three different enzyme immunoassays for serological diagnosis of pulmonary tuberculosis and to compare their diagnostic accuracy in different combinations. Subjects and Methods: Sera from patients suffering from pulmonary tuberculosis (n=94) with sputum positive for acid fast bacilli (AFB) and sera from control group of healthy individuals (n=90) with sputum negative for AFB were tested by Pathozyme-Myco G EIA, Pathozyme-TB Complex Plus EIA and Pathozyme Myco M EIA kits for the genus-specific IgG and IgM, and the species-specific IgG antibodies against antigens of Mycobacterium tuberculosis. Results: The detection of IgG against genus-specific antigens by Pathozyme-Myco G had a sensitivity of 46% and a specificity of 93%, of IgG against species-specific antigens by Pathozyme- TB Complex Plus had a sensitivity of 64% and specificity of 97% and of IgM against genus-specific antigens by Pathozyme Myco M had a sensitivity of 67% and specificity of 98%. When the results of these immunoassays were evaluated in combination, their sensitivity improved. Combination of genus-specific IgM and species-specific IgG yielded best results with a sensitivity of 87% and specificity of 93%. Conclusion: The sensitivity of serological diagnosis of tuberculosis is low, but it can be increased by utilizing a combination of several antigens. (author)
Krall, Jenna R; Ladva, Chandresh N; Russell, Armistead G; Golan, Rachel; Peng, Xing; Shi, Guoliang; Greenwald, Roby; Raysoni, Amit U; Waller, Lance A; Sarnat, Jeremy A
2018-01-03
Concentrations of traffic-related air pollutants are frequently higher within commuting vehicles than in ambient air. Pollutants found within vehicles may include those generated by tailpipe exhaust, brake wear, and road dust sources, as well as pollutants from in-cabin sources. Source-specific pollution, compared to total pollution, may represent regulation targets that can better protect human health. We estimated source-specific pollution exposures and corresponding pulmonary response in a panel study of commuters. We used constrained positive matrix factorization to estimate source-specific pollution factors and, subsequently, mixed effects models to estimate associations between source-specific pollution and pulmonary response. We identified four pollution factors that we named: crustal, primary tailpipe traffic, non-tailpipe traffic, and secondary. Among asthmatic subjects (N = 48), interquartile range increases in crustal and secondary pollution were associated with changes in lung function of -1.33% (95% confidence interval (CI): -2.45, -0.22) and -2.19% (95% CI: -3.46, -0.92) relative to baseline, respectively. Among non-asthmatic subjects (N = 51), non-tailpipe pollution was associated with pulmonary response only at 2.5 h post-commute. We found no significant associations between pulmonary response and primary tailpipe pollution. Health effects associated with traffic-related pollution may vary by source, and therefore some traffic pollution sources may require targeted interventions to protect health.
Kokuho, Nariaki; Terasaki, Yasuhiro; Urushiyama, Hirokazu; Terasaki, Mika; Kunugi, Shinobu; Morimoto, Taisuke; Azuma, Arata; Usuda, Jitsuo; Gemma, Akihiko; Eishi, Yoshinobu; Shimizu, Akira
2016-05-01
Differentiating low-grade lymphoma from preexisting sarcoidosis is difficult because of their pathological similarity. This article describes a case of pulmonary mucosa-associated lymphoid tissue lymphoma associated with pulmonary sarcoidosis. The patient, a 45-year-old Japanese man, presented with a 10-year history of pulmonary sarcoidosis and 5-year history of ocular sarcoidosis with histologic findings. Because only the right S3 lung nodule had gradually enlarged, partial resection was performed. Pathological study revealed noncaseous epithelioid granulomas with lymphoplasmacytic proliferation but also marked lymphoid cell proliferation with lymphoepithelial lesion findings that differed from findings of typical sarcoid lesions. Our lymphoepithelial lesion evaluation via immunohistochemistry and analysis of Ig heavy-chain gene rearrangements with assessment of Propionibacterium acnes-specific antibody reactions allow us to report, for the first time, this case of pulmonary mucosa-associated lymphoid tissue lymphoma associated with pulmonary sarcoidosis in exactly the same location, which may be significant for differentiating these diseases and understanding their pathogenic association. Copyright © 2016 Elsevier Inc. All rights reserved.
Ankyrin-1 Gene Exhibits Allelic Heterogeneity in Conferring Protection Against Malaria
Directory of Open Access Journals (Sweden)
Hong Ming Huang
2017-09-01
Full Text Available Allelic heterogeneity is a common phenomenon where a gene exhibits a different phenotype depending on the nature of its genetic mutations. In the context of genes affecting malaria susceptibility, it allowed us to explore and understand the intricate host–parasite interactions during malaria infections. In this study, we described a gene encoding erythrocytic ankyrin-1 (Ank-1 which exhibits allelic-dependent heterogeneous phenotypes during malaria infections. We conducted an ENU mutagenesis screen on mice and identified two Ank-1 mutations, one resulting in an amino acid substitution (MRI95845, and the other a truncated Ank-1 protein (MRI96570. Both mutations caused hereditary spherocytosis-like phenotypes and confer differing protection against Plasmodium chabaudi infections. Upon further examination, the Ank-1(MRI96570 mutation was found to inhibit intraerythrocytic parasite maturation, whereas Ank-1(MRI95845 caused increased bystander erythrocyte clearance during infection. This is the first description of allelic heterogeneity in ankyrin-1 from the direct comparison between two Ank-1 mutations. Despite the lack of direct evidence from population studies, this data further supported the protective roles of ankyrin-1 mutations in conferring malaria protection. This study also emphasized the importance of such phenomena in achieving a better understanding of host–parasite interactions, which could be the basis of future studies.
An efficient parallel simulation of unsteady blood flows in patient-specific pulmonary artery.
Kong, Fande; Kheyfets, Vitaly; Finol, Ender; Cai, Xiao-Chuan
2018-04-01
Simulation of blood flows in the pulmonary artery provides some insight into certain diseases by examining the relationship between some continuum metrics, eg, the wall shear stress acting on the vascular endothelium, which responds to flow-induced mechanical forces by releasing vasodilators/constrictors. V. Kheyfets, in his previous work, studies numerically a patient-specific pulmonary circulation to show that decreasing wall shear stress is correlated with increasing pulmonary vascular impedance. In this paper, we develop a scalable parallel algorithm based on domain decomposition methods to investigate an unsteady model with patient-specific pulsatile waveforms as the inlet boundary condition. The unsteady model offers tremendously more information about the dynamic behavior of the flow field, but computationally speaking, the simulation is a lot more expensive since a problem which is similar to the steady-state problem has to be solved many times, and therefore, the traditional sequential approach is not suitable anymore. We show computationally that simulations using the proposed parallel approach with up to 10 000 processor cores can be obtained with much reduced compute time. This makes the technology potentially usable for the routine study of the dynamic behavior of blood flows in the pulmonary artery, in particular, the changes of the blood flows and the wall shear stress in the spatial and temporal dimensions. Copyright © 2017 John Wiley & Sons, Ltd.
Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks.
Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina
2017-11-28
Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD.
Tanaka, Mio; Kohashi, Kenichi; Kushitani, Kei; Yoshida, Misa; Kurihara, Sho; Kawashima, Masumi; Ueda, Yuka; Souzaki, Ryota; Kinoshita, Yoshiaki; Oda, Yoshinao; Takeshima, Yukio; Hiyama, Eiso; Taguchi, Tomoaki; Tanaka, Yukichi
2017-08-01
We report 2 infantile cases of pulmonary tumor carrying a chimeric A2M-ALK gene. A2M-ALK is a newly identified anaplastic lymphoma kinase (ALK)-related chimeric gene from a tumor diagnosed as fetal lung interstitial tumor (FLIT). FLIT is a recently recognized infantile pulmonary lesion defined as a mass-like lesion that morphologically resembles the fetal lung. Grossly, FLIT characteristically appears as a well-circumscribed spongy mass, whereas the tumors in these patients were solid and firm. Histologically, the tumors showed intrapulmonary lesions composed of densely proliferating polygonal or spindle-shaped mesenchymal cells with diffuse and dense infiltrations of inflammatory cells forming microcystic or micropapillary structures lined by thyroid transcription factor 1-positive pneumocytes, favoring inflammatory myofibroblastic tumor rather than FLIT. The proliferating cells were immunoreactive for ALK, and A2M-ALK was identified in both tumors with reverse-transcription polymerase chain reaction. The dense infiltration of inflammatory cells, immunoreactivity for ALK, and identification of an ALK-related chimeric gene suggested a diagnosis of inflammatory myofibroblastic tumor. Histologically, most reported FLITs show sparse inflammatory infiltrates and a relatively low density of interstitial cells in the septa, although prominent infiltration of inflammatory cells and high cellularity of interstitial cells are seen in some FLITs. The present cases suggest that ALK rearrangements, including the chimeric A2M-ALK gene, may be present in these infantile pulmonary lesions, especially those with inflammatory cell infiltration. We propose that these infantile pulmonary lesions containing a chimeric A2M-ALK gene be categorized as a specific type of inflammatory myofibroblastic tumor that develops exclusively in neonates and infants. Copyright © 2017 Elsevier Inc. All rights reserved.
Suen, Colin M; Mei, Shirley H J; Kugathasan, Lakshmi; Stewart, Duncan J
2013-10-01
Pulmonary arterial hypertension (PAH) is a devastating disease that, despite significant advances in medical therapies over the last several decades, continues to have an extremely poor prognosis. Gene therapy is a method to deliver therapeutic genes to replace defective or mutant genes or supplement existing cellular processes to modify disease. Over the last few decades, several viral and nonviral methods of gene therapy have been developed for preclinical PAH studies with varying degrees of efficacy. However, these gene delivery methods face challenges of immunogenicity, low transduction rates, and nonspecific targeting which have limited their translation to clinical studies. More recently, the emergence of regenerative approaches using stem and progenitor cells such as endothelial progenitor cells (EPCs) and mesenchymal stem cells (MSCs) have offered a new approach to gene therapy. Cell-based gene therapy is an approach that augments the therapeutic potential of EPCs and MSCs and may deliver on the promise of reversal of established PAH. These new regenerative approaches have shown tremendous potential in preclinical studies; however, large, rigorously designed clinical studies will be necessary to evaluate clinical efficacy and safety. © 2013 American Physiological Society. Compr Physiol 3:1749-1779, 2013.
Chandrasekhar, Kottakota; Vijayalakshmi, Muvva; Vani, Kalasamudramu; Kaul, Tanushri; Reddy, Malireddy K
2014-05-01
Rice production is severely hampered by insect pests. Garlic lectin gene (ASAL) holds great promise in conferring protection against chewing (lepidopteran) and sap-sucking (homopteran) insect pests. We have developed transgenic rice lines resistant to sap-sucking brown hopper (Nilaparvata lugens) by ectopic expression of ASAL in their phloem tissues. Molecular analyses of T0 lines confirmed stable integration of transgene. T1 lines (NP 1-2, 4-3, 11-6 & 17-7) showed active transcription and translation of ASAL transgene. ELISA revealed ASAL expression was as high as 0.95% of total soluble protein. Insect bioassays on T2 homozygous lines (NP 18 & 32) revealed significant reduction (~74-83%) in survival rate, development and fecundity of brown hoppers in comparison to wild type. Transgenics exhibited enhanced resistance (1-2 score) against brown hoppers, minimal plant damage and no growth penalty or phenotypic abnormalities.
Chen, Gang; Korfhagen, Thomas R; Xu, Yan; Kitzmiller, Joseph; Wert, Susan E; Maeda, Yutaka; Gregorieff, Alexander; Clevers, Hans; Whitsett, Jeffrey A
2009-10-01
Various acute and chronic inflammatory stimuli increase the number and activity of pulmonary mucus-producing goblet cells, and goblet cell hyperplasia and excess mucus production are central to the pathogenesis of chronic pulmonary diseases. However, little is known about the transcriptional programs that regulate goblet cell differentiation. Here, we show that SAM-pointed domain-containing Ets-like factor (SPDEF) controls a transcriptional program critical for pulmonary goblet cell differentiation in mice. Initial cell-lineage-tracing analysis identified nonciliated secretory epithelial cells, known as Clara cells, as the progenitors of goblet cells induced by pulmonary allergen exposure in vivo. Furthermore, in vivo expression of SPDEF in Clara cells caused rapid and reversible goblet cell differentiation in the absence of cell proliferation. This was associated with enhanced expression of genes regulating goblet cell differentiation and protein glycosylation, including forkhead box A3 (Foxa3), anterior gradient 2 (Agr2), and glucosaminyl (N-acetyl) transferase 3, mucin type (Gcnt3). Consistent with these findings, levels of SPDEF and FOXA3 were increased in mouse goblet cells after sensitization with pulmonary allergen, and the proteins were colocalized in goblet cells lining the airways of patients with chronic lung diseases. Deletion of the mouse Spdef gene resulted in the absence of goblet cells in tracheal/laryngeal submucosal glands and in the conducting airway epithelium after pulmonary allergen exposure in vivo. These data show that SPDEF plays a critical role in regulating a transcriptional network mediating the goblet cell differentiation and mucus hyperproduction associated with chronic pulmonary disorders.
International Nuclear Information System (INIS)
Husain, Mainul; Saber, Anne T.; Guo, Charles; Jacobsen, Nicklas R.; Jensen, Keld A.; Yauk, Carole L.; Williams, Andrew; Vogel, Ulla; Wallin, Hakan; Halappanavar, Sabina
2013-01-01
We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO 2 ). Female C57BL/6 mice were exposed to rutile nano-TiO 2 via single intratracheal instillations of 18, 54, and 162 μg/mouse. Mice were sampled 1, 3, and 28 days post-exposure. The deposition of nano-TiO 2 in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific qPCR arrays, and tissue protein ELISA. Hyperspectral mapping showed dose-dependent retention of nano-TiO 2 in the lungs up to 28 days post-instillation. DNA microarray analysis revealed approximately 3000 genes that were altered across all treatment groups (± 1.3 fold; p 2 in the absence of inflammation over time may potentially perturb calcium and ion homeostasis, and affect smooth muscle activities. - Highlights: • Pulmonary effects following exposure to low doses of nano-TiO 2 were examined. • Particle retention in lungs was assessed using nanoscale hyperspectral microscopy. • Particles persisted up to 28 days in lungs in all dose groups. • Inflammation was the pathway affected in the high dose group at all time points. • Ion homeostasis and muscle activity pathways were affected in the low dose group
[Recurrent pulmonary infection and oral mucosal ulcer].
Kuang, Fei-Mei; Tang, Lan-Lan; Zhang, Hui; Xie, Min; Yang, Ming-Hua; Yang, Liang-Chun; Yu, Yan; Cao, Li-Zhi
2017-04-01
An 8-year-old girl who had experienced intermittent cough and fever over a 3 year period, was admitted after experiencing a recurrence for one month. One year ago the patient experienced a recurrent oral mucosal ulcer. Physical examination showed vitiligo in the skin of the upper right back. Routine blood tests and immune function tests performed in other hospitals had shown normal results. Multiple lung CT scans showed pulmonary infection. The patient had recurrent fever and cough and persistent presence of some lesions after anti-infective therapy. The antitubercular therapy was ineffective. Routine blood tests after admission showed agranulocytosis. Gene detection was performed and she was diagnosed with dyskeratosis congenita caused by homozygous mutation in RTEL1. Patients with dyskeratosis congenita with RTEL1 gene mutation tend to develop pulmonary complications. Since RTEL1 gene sequence is highly variable with many mutation sites and patterns and can be inherited via autosomal dominant or recessive inheritance, this disease often has various clinical manifestations, which may lead to missed diagnosis or misdiagnosis. For children with unexplained recurrent pulmonary infection, examinations of the oral cavity, skin, and nails and toes should be taken and routine blood tests should be performed to exclude dyskeratosis congenita. There are no specific therapies for dyskeratosis congenita at present, and when bone marrow failure and pulmonary failure occur, hematopoietic stem cell transplantation and lung transplantation are the only therapies. Androgen and its derivatives are effective in some patients. Drugs targeting the telomere may be promising for patients with dyskeratosis congenita.
Genetics of sputum gene expression in chronic obstructive pulmonary disease.
Directory of Open Access Journals (Sweden)
Weiliang Qiu
Full Text Available Previous expression quantitative trait loci (eQTL studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs. The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5, the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus.
Genetics of Sputum Gene Expression in Chronic Obstructive Pulmonary Disease
Qiu, Weiliang; Cho, Michael H.; Riley, John H.; Anderson, Wayne H.; Singh, Dave; Bakke, Per; Gulsvik, Amund; Litonjua, Augusto A.; Lomas, David A.; Crapo, James D.; Beaty, Terri H.; Celli, Bartolome R.; Rennard, Stephen; Tal-Singer, Ruth; Fox, Steven M.; Silverman, Edwin K.; Hersh, Craig P.
2011-01-01
Previous expression quantitative trait loci (eQTL) studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD) patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP) data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs). The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS) dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5), the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD) bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus. PMID:21949713
Multisociety task force recommendations of competencies in Pulmonary and Critical Care Medicine.
Buckley, John D; Addrizzo-Harris, Doreen J; Clay, Alison S; Curtis, J Randall; Kotloff, Robert M; Lorin, Scott M; Murin, Susan; Sessler, Curtis N; Rogers, Paul L; Rosen, Mark J; Spevetz, Antoinette; King, Talmadge E; Malhotra, Atul; Parsons, Polly E
2009-08-15
Numerous accrediting organizations are calling for competency-based medical education that would help define specific specialties and serve as a foundation for ongoing assessment throughout a practitioner's career. Pulmonary Medicine and Critical Care Medicine are two distinct subspecialties, yet many individual physicians have expertise in both because of overlapping content. Establishing specific competencies for these subspecialties identifies educational goals for trainees and guides practitioners through their lifelong learning. To define specific competencies for graduates of fellowships in Pulmonary Medicine and Internal Medicine-based Critical Care. A Task Force composed of representatives from key stakeholder societies convened to identify and define specific competencies for both disciplines. Beginning with a detailed list of existing competencies from diverse sources, the Task Force categorized each item into one of six core competency headings. Each individual item was reviewed by committee members individually, in group meetings, and conference calls. Nominal group methods were used for most items to retain the views and opinions of the minority perspective. Controversial items underwent additional whole group discussions with iterative modified-Delphi techniques. Consensus was ultimately determined by a simple majority vote. The Task Force identified and defined 327 specific competencies for Internal Medicine-based Critical Care and 276 for Pulmonary Medicine, each with a designation as either: (1) relevant, but competency is not essential or (2) competency essential to the specialty. Specific competencies in Pulmonary and Critical Care Medicine can be identified and defined using a multisociety collaborative approach. These recommendations serve as a starting point and set the stage for future modification to facilitate maximum quality of care as the specialties evolve.
Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana
2011-01-01
Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species
Smith, Milo R; Glicksberg, Benjamin S; Li, Li; Chen, Rong; Morishita, Hirofumi; Dudley, Joel T
2018-01-01
High and increasing prevalence of neurodevelopmental disorders place enormous personal and economic burdens on society. Given the growing realization that the roots of neurodevelopmental disorders often lie in early childhood, there is an urgent need to identify childhood risk factors. Neurodevelopment is marked by periods of heightened experience-dependent neuroplasticity wherein neural circuitry is optimized by the environment. If these critical periods are disrupted, development of normal brain function can be permanently altered, leading to neurodevelopmental disorders. Here, we aim to systematically identify human variants in neuroplasticity-related genes that confer risk for neurodevelopmental disorders. Historically, this knowledge has been limited by a lack of techniques to identify genes related to neurodevelopmental plasticity in a high-throughput manner and a lack of methods to systematically identify mutations in these genes that confer risk for neurodevelopmental disorders. Using an integrative genomics approach, we determined loss-of-function (LOF) variants in putative plasticity genes, identified from transcriptional profiles of brain from mice with elevated plasticity, that were associated with neurodevelopmental disorders. From five shared differentially expressed genes found in two mouse models of juvenile-like elevated plasticity (juvenile wild-type or adult Lynx1-/- relative to adult wild-type) that were also genotyped in the Mount Sinai BioMe Biobank we identified multiple associations between LOF genes and increased risk for neurodevelopmental disorders across 10,510 patients linked to the Mount Sinai Electronic Medical Records (EMR), including epilepsy and schizophrenia. This work demonstrates a novel approach to identify neurodevelopmental risk genes and points toward a promising avenue to discover new drug targets to address the unmet therapeutic needs of neurodevelopmental disease.
Pulmonary hypertension and vascular remodeling in mice exposed to crystalline silica.
Zelko, Igor N; Zhu, Jianxin; Ritzenthaler, Jeffrey D; Roman, Jesse
2016-11-28
Occupational and environmental exposure to crystalline silica may lead to the development of silicosis, which is characterized by inflammation and progressive fibrosis. A substantial number of patients diagnosed with silicosis develop pulmonary hypertension. Pulmonary hypertension associated with silicosis and with related restrictive lung diseases significantly reduces survival in affected subjects. An animal model of silicosis has been described previously however, the magnitude of vascular remodeling and hemodynamic effects of inhaled silica are largely unknown. Considering the importance of such information, this study investigated whether mice exposed to silica develop pulmonary hypertension and vascular remodeling. C57BL6 mice were intratracheally injected with either saline or crystalline silica at doses 0.2 g/kg, 0.3 g/kg and 0.4 g/kg and then studied at day 28 post-exposure. Pulmonary hypertension was characterized by changes in right ventricular systolic pressure and lung histopathology. Mice exposed to saline showed normal lung histology and hemodynamic parameters while mice exposed to silica showed increased right ventricular systolic pressure and marked lung pathology characterized by a granulomatous inflammatory reaction and increased collagen deposition. Silica-exposed mice also showed signs of vascular remodeling with pulmonary artery muscularization, vascular occlusion, and medial thickening. The expression of pro-inflammatory genes such as TNF-α and MCP-1 was significantly upregulated as well as the expression of the pro-remodeling genes collagen type I, fibronectin and the metalloproteinases MMP-2 and TIMP-1. On the other hand, the expression of several vasculature specific genes involved in the regulation of endothelial function was significantly attenuated. We characterized a new animal model of pulmonary hypertension secondary to pulmonary fibrosis induced by crystalline silica. Our data suggest that silica promotes the damage of the
Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A
2017-08-01
Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.
Abraham, Nader G; Quan, Shuo; Mieyal, Paul A; Yang, Liming; Burke-Wolin, Theresa; Mingone, Christopher J; Goodman, Alvin I; Nasjletti, Alberto; Wolin, Michael S
2002-11-01
Carbon monoxide (CO) stimulates guanylate cyclase (GC) and increases guanosine 3',5'-cyclic monophosphate (cGMP) levels. We transfected rat-lung pulmonary endothelial cells with a retrovirus-mediated human heme oxygenase (hHO)-1 gene. Pulmonary cells that expressed hHO-1 exhibited a fourfold increase in HO activity associated with decreases in the steady-state levels of heme and cGMP without changes in soluble GC (sGC) and endothelial nitric oxide synthase (NOS) proteins or basal nitrite production. Heme elicited significant increases in CO production and intracellular cGMP levels in both pulmonary endothelial and pulmonary hHO-1-expressing cells. N(omega)-nitro-L-arginine methyl ester (L-NAME), an inhibitor of NOS, significantly decreased cGMP levels in heme-treated pulmonary endothelial cells but not heme-treated hHO-1-expressing cells. In the presence of exogenous heme, CO and cGMP levels in hHO-1-expressing cells exceeded the corresponding levels in pulmonary endothelial cells. Acute exposure of endothelial cells to SnCl2, which is an inducer of HO-1, increased cGMP levels, whereas chronic exposure decreased heme and cGMP levels. These results indicate that prolonged overexpression of HO-1 ultimately decreases sGC activity by limiting the availability of cellular heme. Heme activates sGC and enhances cGMP levels via a mechanism that is largely insensitive to NOS inhibition.
Proteome analysis of Radiation-induced pulmonary fibrosis
International Nuclear Information System (INIS)
Song, Jie Young; Lim, Hee Soon; Kim, Hyung Doo; Shim, Ji Young; Han, Young Soo; Son, Hyeog Jin Son; Yun, Yeon Sook
2005-01-01
Pulmonary fibrosis is perhaps the most universal late effect of organ damage after both chemical insult and irradiation in the treatment of lung cancer. The use chemotherapy and radiation therapy, alone or combined, can be associated with clinically significant pulmonary toxicity, which leads to pneumonia and pulmonary fibrosis. It is also reported that about 100,000 people in the United States are suffered from pulmonary fibrosis. Therefore, pulmonary fibrosis will be more focused by medicinal researchers. Because current therapies, aimed at inhibiting pulmonary inflammation that often precedes fibrosis, are effective only in a minority of suffered patients, novel therapeutic methods are highly needed. Some researchers have used bleomycininduced pulmonary fibrosis as a basis for looking at the molecular mechanisms of fibrosis, and total gene expression was monitored using genomics method. However, radiation-induced pulmonary fibrosis has not been fully focused and investigated. Here, we have analyzed changes in gene expression in response to γ- irradiation by using proteomic analysis
Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia
2015-01-01
Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...
Directory of Open Access Journals (Sweden)
Gauldie Jack
2010-12-01
Full Text Available Abstract Background Micro-computed tomography (micro-CT is a novel tool for monitoring acute and chronic disease states in small laboratory animals. Its value for assessing progressive lung fibrosis in mice has not been reported so far. Here we examined the importance of in vivo micro-CT as non-invasive tool to assess progression of pulmonary fibrosis in mice over time. Methods Pulmonary fibrosis was induced in mice by intratracheal delivery of an adenoviral gene vector encoding biologically active TGF-ß1 (AdTGF-ß1. Respiratory gated and ungated micro-CT scans were performed at 1, 2, 3, and 4 weeks post pulmonary adenoviral gene or control vector delivery, and were then correlated with respective histopathology-based Ashcroft scoring of pulmonary fibrosis in mice. Visual assessment of image quality and consolidation was performed by 3 observers and a semi-automated quantification algorithm was applied to quantify aerated pulmonary volume as an inverse surrogate marker for pulmonary fibrosis. Results We found a significant correlation between classical Ashcroft scoring and micro-CT assessment using both visual assessment and the semi-automated quantification algorithm. Pulmonary fibrosis could be clearly detected in micro-CT, image quality values were higher for respiratory gated exams, although differences were not significant. For assessment of fibrosis no significant difference between respiratory gated and ungated exams was observed. Conclusions Together, we show that micro-CT is a powerful tool to assess pulmonary fibrosis in mice, using both visual assessment and semi-automated quantification algorithms. These data may be important in view of pre-clinical pharmacologic interventions for the treatment of lung fibrosis in small laboratory animals.
Energy Technology Data Exchange (ETDEWEB)
Husain, Mainul, E-mail: mainul.husain@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Saber, Anne T., E-mail: ats@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Guo, Charles, E-mail: charles.guo@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Jacobsen, Nicklas R., E-mail: nrj@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Jensen, Keld A., E-mail: kaj@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Yauk, Carole L., E-mail: carole.yauk@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada); Williams, Andrew, E-mail: andrew.williams@hc-sc.gc.ca [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Vogel, Ulla, E-mail: ubv@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Department of Micro- and Nanotechnology, Technical University of Denmark, Kgs. Lyngby DK-2800 (Denmark); Wallin, Hakan, E-mail: hwa@nrcwe.dk [The Danish NanoSafety Centre, National Research Centre for the Working Environment, Copenhagen DK-2100 (Denmark); Institute of Public Health, University of Copenhagen, Copenhagen DK-1014 (Denmark); Halappanavar, Sabina, E-mail: sabina.halappanavar@hc-sc.gc.ca [Environmental Health Science and Research Bureau, Health Canada, Ottawa, Ontario K1A 0K9 (Canada)
2013-06-15
We investigated gene expression, protein synthesis, and particle retention in mouse lungs following intratracheal instillation of varying doses of nano-sized titanium dioxide (nano-TiO{sub 2}). Female C57BL/6 mice were exposed to rutile nano-TiO{sub 2} via single intratracheal instillations of 18, 54, and 162 μg/mouse. Mice were sampled 1, 3, and 28 days post-exposure. The deposition of nano-TiO{sub 2} in the lungs was assessed using nanoscale hyperspectral microscopy. Biological responses in the pulmonary system were analyzed using DNA microarrays, pathway-specific real-time RT-PCR (qPCR), gene-specific qPCR arrays, and tissue protein ELISA. Hyperspectral mapping showed dose-dependent retention of nano-TiO{sub 2} in the lungs up to 28 days post-instillation. DNA microarray analysis revealed approximately 3000 genes that were altered across all treatment groups (± 1.3 fold; p < 0.1). Several inflammatory mediators changed in a dose- and time-dependent manner at both the mRNA and protein level. Although no influx of neutrophils was detected at the low dose, changes in the expression of several genes and proteins associated with inflammation were observed. Resolving inflammation at the medium dose, and lack of neutrophil influx in the lung fluid at the low dose, were associated with down-regulation of genes involved in ion homeostasis and muscle regulation. Our gene expression results imply that retention of nano-TiO{sub 2} in the absence of inflammation over time may potentially perturb calcium and ion homeostasis, and affect smooth muscle activities. - Highlights: • Pulmonary effects following exposure to low doses of nano-TiO{sub 2} were examined. • Particle retention in lungs was assessed using nanoscale hyperspectral microscopy. • Particles persisted up to 28 days in lungs in all dose groups. • Inflammation was the pathway affected in the high dose group at all time points. • Ion homeostasis and muscle activity pathways were affected in the low dose
Directory of Open Access Journals (Sweden)
Varga Andreea
2016-12-01
Full Text Available A 62 year-old caucasian male was admitted in our pulmonary hypertension expert center with initial diagnosis of pulmonary veno-occlusive disease for validation and specific treatment approach. Routine examinations revealed no apparent cause of pulmonary hypertension. Patient was referred for a thorax contrast enhanced multi-slice computed tomography which revealed extensive bilateral thrombi in pulmonary lower lobe arteries, pleading for chronic post embolic lesions. A right heart catheterization and pulmonary angiography confirmed the diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH. Following the local regulations, the patient underwent thrombophilia screening including molecular genetic testing, with positive findings for heterozygous for VCORK1 -1639G>A gene single nucleotide polymorphism, PAI-1 4G/5G and factor II G20210A gene. With heterozygous genetic profile of 3 mutations he has a genetic predisposition for developing a thrombophilic disease which could be involved in the etiology of CTEPH. Familial screening was extended to descendants; the unique son was tested with positive results for the same three genes. Supportive pulmonary hypertension drug therapy was initiated together with patient self-monitoring management of oral anticoagulation therapy. For optimal control of targeted anticoagulation due to a very high risk of thrombotic state the patient used a point-of-care device (CoaguChek®XS System, Roche Diagnostics for coagulation self-monitoring.
Simian virus 40 vectors for pulmonary gene therapy
Directory of Open Access Journals (Sweden)
Oppenheim Ariella
2007-10-01
Full Text Available Abstract Background Sepsis remains the leading cause of death in critically ill patients. One of the primary organs affected by sepsis is the lung, presenting as the Acute Respiratory Distress Syndrome (ARDS. Organ damage in sepsis involves an alteration in gene expression, making gene transfer a potential therapeutic modality. This work examines the feasibility of applying simian virus 40 (SV40 vectors for pulmonary gene therapy. Methods Sepsis-induced ARDS was established by cecal ligation double puncture (2CLP. SV40 vectors carrying the luciferase reporter gene (SV/luc were administered intratracheally immediately after sepsis induction. Sham operated (SO as well as 2CLP rats given intratracheal PBS or adenovirus expressing luciferase served as controls. Luc transduction was evaluated by in vivo light detection, immunoassay and luciferase mRNA detection by RT-PCR in tissue harvested from septic rats. Vector abundance and distribution into alveolar cells was evaluated using immunostaining for the SV40 VP1 capsid protein as well as by double staining for VP1 and for the surfactant protein C (proSP-C. Immunostaining for T-lymphocytes was used to evaluate the cellular immune response induced by the vector. Results Luc expression measured by in vivo light detection correlated with immunoassay from lung tissue harvested from the same rats. Moreover, our results showed vector presence in type II alveolar cells. The vector did not induce significant cellular immune response. Conclusion In the present study we have demonstrated efficient uptake and expression of an SV40 vector in the lungs of animals with sepsis-induced ARDS. These vectors appear to be capable of in vivo transduction of alveolar type II cells and may thus become a future therapeutic tool.
Directory of Open Access Journals (Sweden)
Mai-Juan Ma
Full Text Available BACKGROUND: Susceptibility to tuberculosis is not only determined by Mycobacterium tuberculosis infection, but also by the genetic component of the host. Macrophage receptor with a collagenous structure (MARCO is essential components required for toll like receptor-signaling in macrophage response to Mycobacterium tuberculosis, which may contribute to tuberculosis risk. PRINCIPAL FINDINGS: To specifically investigated whether single nucleotide polymorphisms (SNPs in MARCO gene are associated with pulmonary tuberculosis in Chinese Han population. By selecting tagging SNPs in MARCO gene, 17 tag SNPs were identified and genotyped in 923 pulmonary tuberculosis patients and 1033 healthy control subjects using a hospital based case-control association study. Single-point and haplotype analysis revealed an association in intron and exon region of MARCO gene. One SNP (rs17009726 was associated with susceptibility to pulmonary tuberculosis, where the carriers of the G allele had a 1.65 fold (95% CI = 1.32-2.05, p(corrected = 9.27E-5 increased risk of pulmonary tuberculosis. Haplotype analysis revealed that haplotype GC containing G allele of 17009726 and haplotype TGCC (rs17795618T/A, rs1371562G/T, rs6761637T/C, rs2011839C/T were also associated with susceptibility to pulmonary tuberculosis (p(corrected = 0.0001 and 0.029, respectively. CONCLUSIONS: Our study suggested that genetic variants in MARCO gene were associated with pulmonary tuberculosis susceptibility in Chinese Han population, and the findings emphasize the importance of MARCO mediated immune responses in the pathogenesis of tuberculosis.
Pulmonary gene and microRNA expression changes in mice exposed to benzo(a)pyrene by oral gavage
International Nuclear Information System (INIS)
Halappanavar, Sabina; Wu, Dongmei; Williams, Andrew; Kuo, Byron; Godschalk, Roger W.; Van Schooten, Frederik J.; Yauk, Carole Lyn
2011-01-01
Highlights: → The study examines pulmonary response in mice exposed to BaP by oral gavage. → We examined pulmonary gene and miRNA expression changes and measured DNA adducts. → We compare the mechanisms of action that operate in lungs relative to the liver. → We show differences in biological pathways activated in lungs versus the liver. → We suggest that liver miRNAs are less sensitive to perturbations than lung miRNAs. -- Abstract: Exposure to the environmental mutagen benzo(a)pyrene (BaP) alters the expression of AHR-responsive genes as well as genes involved in other pathways. We recently reported that exposure of adult mice to BaP resulted in a robust transcriptome response in the liver, but this was accompanied by a complete lack of change in microRNA (miRNA) expression. Since BaP exposure does not result in hepatocarcinogenicity, but does cause lung cancer, in the present study we examine the pulmonary mRNA and miRNA responses to BaP in the same mice. Adult male B6C3F1 mice were exposed to 150 and 300 mg/kg BaP by oral gavage for three consecutive days and sacrificed 4 h after the last exposure. Serum clinical chemistry was performed for both the doses to assess the general toxicity of BaP; a modest decrease in serum inorganic phosphorous was observed at both the doses. A small decrease in serum glucose following 150 mg/kg and alkaline phosphatase following 300 mg/kg BaP was observed. BaP-DNA adduct levels in whole lung and liver tissues were assessed by 32 P postlabelling and similar dose dependent increases were observed for lung and liver. Using DNA microarrays, pulmonary mRNA and miRNA expressions were analysed. Over 1000 genes were statistically differentially expressed (p < 0.05). The perturbed pathways included oxidative stress, xenobiotic metabolism, cell proliferation, cell cycle, B and T-cell receptor signalling and primary immunodeficiency signalling pathways. Analysis of miRNA profiles revealed downregulation of miR-150, miR-142-5p, mi
International Nuclear Information System (INIS)
Ahmad, B.; Ambreen, S.; Khan, I.
2015-01-01
Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)
van Suylen, R. J.; Wouters, E. F.; Pennings, H. J.; Cheriex, E. C.; van Pol, P. E.; Ambergen, A. W.; Vermelis, A. M.; Daemen, M. J.
1999-01-01
The renin angiotensin system plays an important role in the development of pulmonary artery remodeling and right ventricular hypertrophy in hypoxia-induced pulmonary hypertension as may occur in patients with COPD. Several polymorphisms of genes encoding for components of the renin angiotensin
Bhagi, Shuchi; Srivastava, Swati; Tomar, Arvind; Bala Singh, Shashi; Sarkar, Soma
2015-06-01
High altitude pulmonary edema (HAPE) is a potentially fatal high altitude illness occurring as a result of hypobaric hypoxia with an unknown underlying genetic mechanism. Recent studies have shown a possible association between HAPE and polymorphisms in genes of the renin-angiotensin-aldosterone system (RAAS), which play a key role in sensitivity of an individual toward HAPE. For the present investigation, study groups consisted of HAPE patients (HAPE) and acclimatized control subjects (rCON). Four single-nucleotide polymorphisms (SNPs) were genotyped using restriction fragment length polymorphism (RFLP) analysis in genes of the RAAS pathway, specifically, renin (REN) C(-4063)T (rs41317140) and RENi8-83 (rs2368564), angiotensin (AGT) M(235)T (rs699), and angiotensin-converting enzyme (ACE) insertion/deletion (I/D) (rs1799752). Only the I/D polymorphism of the ACE gene showed a significant difference between the HAPE and rCON groups. The frequency of the D allele was found to be significantly higher in the HAPE group. Arterial oxygen saturation levels were significantly lower in the HAPE group compared with the rCON group and also decreased in the I/D and D/D genotypes compared with the I/I genotype in these groups. The other polymorphisms occurring in the REN and AGT genes were not significantly different between the 2 groups. These findings demonstrate a possible association of the I/D polymorphism of the ACE gene with the development of HAPE, with D/D being the at-risk genotype. Copyright © 2015 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.
Computational Biology Support: RECOMB Conference Series (Conference Support)
Energy Technology Data Exchange (ETDEWEB)
Michael Waterman
2006-06-15
This funding was support for student and postdoctoral attendance at the Annual Recomb Conference from 2001 to 2005. The RECOMB Conference series was founded in 1997 to provide a scientific forum for theoretical advances in computational biology and their applications in molecular biology and medicine. The conference series aims at attracting research contributions in all areas of computational molecular biology. Typical, but not exclusive, the topics of interest are: Genomics, Molecular sequence analysis, Recognition of genes and regulatory elements, Molecular evolution, Protein structure, Structural genomics, Gene Expression, Gene Networks, Drug Design, Combinatorial libraries, Computational proteomics, and Structural and functional genomics. The origins of the conference came from the mathematical and computational side of the field, and there remains to be a certain focus on computational advances. However, the effective use of computational techniques to biological innovation is also an important aspect of the conference. The conference had a growing number of attendees, topping 300 in recent years and often exceeding 500. The conference program includes between 30 and 40 contributed papers, that are selected by a international program committee with around 30 experts during a rigorous review process rivaling the editorial procedure for top-rate scientific journals. In previous years papers selection has been made from up to 130--200 submissions from well over a dozen countries. 10-page extended abstracts of the contributed papers are collected in a volume published by ACM Press and Springer, and are available at the conference. Full versions of a selection of the papers are published annually in a special issue of the Journal of Computational Biology devoted to the RECOMB Conference. A further point in the program is a lively poster session. From 120-300 posters have been presented each year at RECOMB 2000. One of the highlights of each RECOMB conference is a
Tsevas, S.; Iakovidis, D. K.
2011-11-01
Pulmonary infiltrates are common radiological findings indicating the filling of airspaces with fluid, inflammatory exudates, or cells. They are most common in cases of pneumonia, acute respiratory syndrome, atelectasis, pulmonary oedema and haemorrhage, whereas their extent is usually correlated with the extent or the severity of the underlying disease. In this paper we propose a novel pattern recognition framework for the measurement of the extent of pulmonary infiltrates in routine chest radiographs. The proposed framework follows a hierarchical approach to the assessment of image content. It includes the following: (a) sampling of the lung fields; (b) extraction of patient-specific grey-level histogram signatures from each sample; (c) classification of the extracted signatures into classes representing normal lung parenchyma and pulmonary infiltrates; (d) the samples for which the probability of belonging to one of the two classes does not reach an acceptable level are rejected and classified according to their textural content; (e) merging of the classification results of the two classification stages. The proposed framework has been evaluated on real radiographic images with pulmonary infiltrates caused by bacterial infections. The results show that accurate measurements of the infiltration areas can be obtained with respect to each lung field area. The average measurement error rate on the considered dataset reached 9.7% ± 1.0%.
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Directory of Open Access Journals (Sweden)
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
International Nuclear Information System (INIS)
Hattner, R.S.; Sollitto, R.A.; Golden, J.A.; Coleman, D.L.; Okerlund, M.D.
1984-01-01
Acquired immunodeficiency syndrome (AIDS) is a severe disorder of cellular immunity of obscure etiology. Since its original recognition in 1981 the incidence of AIDS has doubled in each of the succeeding six months. The most common causes of death in AIDS are Kaposi's sarcoma and p. carinii pneumonia (PCP). The latter is treatable if diagnosed early, and AIDS patients (pts) may suffer recurrent episodes of PCP. Since the invasive technique of fiberoptic bronchoscopy with transbronchial biopsy, brushing, and bronchialveolar lavage are necessary for diagnosis and follow-up a noninvasive method of categorizing which AIDS pts require this procedure would be most welcome. Twenty-one pts with the syndrome of AIDS and pulmonary symptoms underwent Ga-67 scans of the thoracic region, and fibroptic bronchoscopy with washings, and brush and transbronchial biopsy. Pulmonary activity was graded in a blinded fashion by three experienced observers as follows: 1, less than, or equal to adjacent soft tissues; 2, greater than adjacent soft tissues, but less than liver; 3, equal to liver; 4, greater than liver. Eleven pts had documented PCP, and the remaining ten had non-specific pulmonary inflammation, or other, in some cases, putative, infections. The sensitivity and specificity of Ga-67 scans ≥ grade 3 was 100% and 90% respectively. These results suggests a useful role for graded Ga-67 scans in AIDS pts with pulmonary symptoms, permitting selection of pts with a high risk of PCP for further mandatory invasive investigation of this otherwise usually fatal disease
Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles
2008-01-01
Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...
Capturing structured, pulmonary disease-specific data elements in electronic health records.
Gronkiewicz, Cynthia; Diamond, Edward J; French, Kim D; Christodouleas, John; Gabriel, Peter E
2015-04-01
Electronic health records (EHRs) have the potential to improve health-care quality by allowing providers to make better decisions at the point of care based on electronically aggregated data and by facilitating clinical research. These goals are easier to achieve when key, disease-specific clinical information is documented as structured data elements (SDEs) that computers can understand and process, rather than as free-text/natural-language narrative. This article reviews the benefits of capturing disease-specific SDEs. It highlights several design and implementation considerations, including the impact on efficiency and expressivity of clinical documentation and the importance of adhering to data standards when available. Pulmonary disease-specific examples of collection instruments are provided from two commonly used commercial EHRs. Future developments that can leverage SDEs to improve clinical quality and research are discussed.
Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue
2015-07-01
Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.
Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis
Directory of Open Access Journals (Sweden)
Welsh Kenneth I
2003-06-01
Full Text Available Abstract Background Genes encoding cytokine mediators are prime candidates for genetic analysis in conditions with T-helper (Th cell disease driven imbalance. Idiopathic Pulmonary Fibrosis (IPF is a predominantly Th2 mediated disease associated with a paucity of interferon-gamma (IFN-γ. The paucity of IFN-γ may favor the development of progressive fibrosis in IPF. Interleukin-12 (IL-12 plays a key role in inducing IFN-γ production. The aim of the current study was to assess whether the 1188 (A/C 3'UTR single nucleotide polymorphism (SNP in the IL-12 p40 subunit gene which was recently found to be functional and the 5644 (G/A 3' UTR SNP of the IFN-γ gene were associated with susceptibility to IPF. Methods We investigated the allelic distribution in these loci in UK white Caucasoid subjects comprising 73 patients with IPF and 157 healthy controls. The SNPs were determined using the polymerase chain reaction in association with sequence-specific primers incorporating mismatches at the 3'-end. Results Our results showed that these polymorphisms were distributed similarly in the IPF and control groups Conclusion We conclude that these two potentially important candidate gene single nucleotide polymorphisms are not associated with susceptibility to IPF.
van der Schoot, Gabriela G F; Westerink, Nico-Derk L; Lubberts, Sjoukje; Nuver, Janine; Zwart, Nynke; Walenkamp, Annemiek M E; Wempe, Johan B; Meijer, Coby; Gietema, Jourik A
2016-05-01
Bleomycin and cisplatin are of key importance in testicular cancer treatment. Known potential serious adverse effects are bleomycin-induced pulmonary toxicity (BIP) and cisplatin-induced renal toxicity. Iron handling may play a role in development of this toxicity. Carriage of allelic variants of the HFE gene induces altered iron metabolism and may contribute to toxicity. We investigated the association between two common allelic variants of the HFE gene, H63D and C282Y, with development of pulmonary and renal toxicity during and after treatment with bleomycin- and cisplatin-containing chemotherapy. In 369 testicular cancer patients treated with bleomycin and cisplatin at the University Medical Center Groningen between 1978 and 2006, H63D and/or C282Y genotypes were determined with an allelic discrimination assay. Data were collected on development of BIP, pulmonary function parameters, renal function, and survival. BIP developed more frequently in patients who were heterozygote (16 in 75, 21%) and homozygote (2 in 4, 50%) for the H63D variant, compared with those who had the HFE wild-type gene (31 in 278, 11%) (p = 0.012). Overall survival, testicular cancer-related survival, and change in renal function were not associated with the H63D variant. We observed an association between presence of one or both H63D alleles and development of BIP in testicular cancer patients treated with bleomycin combination chemotherapy. In patients heterozygote and homozygote for the H63D variant, BIP occurred more frequently compared with wild-type patients. When validated and confirmed, HFE H63D genotyping may be used to identify patients with increased risk for pulmonary bleomycin toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gene specific actions of thyroid hormone receptor subtypes.
Directory of Open Access Journals (Sweden)
Jean Z Lin
Full Text Available There are two homologous thyroid hormone (TH receptors (TRs α and β, which are members of the nuclear hormone receptor (NR family. While TRs regulate different processes in vivo and other highly related NRs regulate distinct gene sets, initial studies of TR action revealed near complete overlaps in their actions at the level of individual genes. Here, we assessed the extent that TRα and TRβ differ in target gene regulation by comparing effects of equal levels of stably expressed exogenous TRs +/- T(3 in two cell backgrounds (HepG2 and HeLa. We find that hundreds of genes respond to T(3 or to unliganded TRs in both cell types, but were not able to detect verifiable examples of completely TR subtype-specific gene regulation. TR actions are, however, far from identical and we detect TR subtype-specific effects on global T(3 response kinetics in HepG2 cells and many examples of TR subtype specificity at the level of individual genes, including effects on magnitude of response to TR +/- T(3, TR regulation patterns and T(3 dose response. Cycloheximide (CHX treatment confirms that at least some differential effects involve verifiable direct TR target genes. TR subtype/gene-specific effects emerge in the context of widespread variation in target gene response and we suggest that gene-selective effects on mechanism of TR action highlight differences in TR subtype function that emerge in the environment of specific genes. We propose that differential TR actions could influence physiologic and pharmacologic responses to THs and selective TR modulators (STRMs.
High-altitude pulmonary hypertension
Directory of Open Access Journals (Sweden)
X-Q. Xu
2009-03-01
Full Text Available High-altitude pulmonary hypertension (HAPH is a specific disease affecting populations that live at high elevations. The prevalence of HAPH among those residing at high altitudes needs to be further defined. Whereas reduction in nitric oxide production may be one mechanism for the development of HAPH, the roles of endothelin-1 and prostaglandin I2 pathways in the pathogenesis of HAPH deserve further study. Although some studies have suggested that genetic factors contribute to the pathogenesis of HAPH, data published to date are insufficient for the identification of a significant number of gene polymorphims in HAPH. The clinical presentation of HAPH is nonspecific. Exertional dyspnoea is the most common symptom and signs related to right heart failure are common in late stages of HAPH. Echocardiography is the most useful screening tool and right heart catheterisation is the gold standard for the diagnosis of HAPH. The ideal management for HAPH is migration to lower altitudes. Phosphodiesterase 5 is an attractive drug target for the treatment of HAPH. In addition, acetazolamide is a promising therapeutic agent for high-altitude pulmonary hypertension. To date, no evidence has confirmed whether endothelin-receptor antagonists have efficacy in the treatment of high-altitude pulmonary hypertension.
Directory of Open Access Journals (Sweden)
Pía Villanueva
2015-03-01
Full Text Available Children affected by Specific Language Impairment (SLI fail to acquire age appropriate language skills despite adequate intelligence and opportunity. SLI is highly heritable, but the understanding of underlying genetic mechanisms has proved challenging. In this study, we use molecular genetic techniques to investigate an admixed isolated founder population from the Robinson Crusoe Island (Chile, who are affected by a high incidence of SLI, increasing the power to discover contributory genetic factors. We utilize exome sequencing in selected individuals from this population to identify eight coding variants that are of putative significance. We then apply association analyses across the wider population to highlight a single rare coding variant (rs144169475, Minor Allele Frequency of 4.1% in admixed South American populations in the NFXL1 gene that confers a nonsynonymous change (N150K and is significantly associated with language impairment in the Robinson Crusoe population (p = 2.04 × 10-4, 8 variants tested. Subsequent sequencing of NFXL1 in 117 UK SLI cases identified four individuals with heterozygous variants predicted to be of functional consequence. We conclude that coding variants within NFXL1 confer an increased risk of SLI within a complex genetic model.
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
Gene delivery to the lungs: pulmonary gene therapy for cystic fibrosis.
Villate-Beitia, Ilia; Zarate, Jon; Puras, Gustavo; Pedraz, José Luis
2017-07-01
Cystic fibrosis (CF) is a monogenic autosomal recessive disorder where the defective gene, the cystic fibrosis transmembrane conductance regulator (CFTR), is well identified. Moreover, the respiratory tract can be targeted through noninvasive aerosolized formulations for inhalation. Therefore, gene therapy is considered a plausible strategy to address this disease. Conventional gene therapy strategies rely on the addition of a correct copy of the CFTR gene into affected cells in order to restore the channel activity. In recent years, genome correction strategies have emerged, such as zinc-finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats associated to Cas9 nucleases. These gene editing tools aim to repair the mutated gene at its original genomic locus with high specificity. Besides, the success of gene therapy critically depends on the nucleic acids carriers. To date, several clinical studies have been carried out to add corrected copies of the CFTR gene into target cells using viral and non-viral vectors, some of them with encouraging results. Regarding genome editing systems, preliminary in vitro studies have been performed in order to repair the CFTR gene. In this review, after briefly introducing the basis of CF, we discuss the up-to-date gene therapy strategies to address the disease. The review focuses on the main factors to take into consideration when developing gene delivery strategies, such as the design of vectors and plasmid DNA, in vitro/in vivo tests, translation to human use, administration methods, manufacturing conditions and regulatory issues.
Nuver, J; Lutke-Holzik, MF; van Zweeden, M; Hoekstra, HJ; Meijer, C; Suurmeijer, AJH; Hofstra, RM; Sluiter, WJ; Sleijfer, D; Gietema, JA; Groen, Hendricus; Groen, Herman
Objective Use of bleomycin as a cytotoxic agent is limited by its pulmonary toxicity. Bleomycin is mainly excreted by the kidneys, but can also be inactivated by bleomycin hydrolase (BMH). An 1450A > G polymorphic site in the BMH gene results in an amino acid substitution in the C-terminal domain of
Anwar, Adil; Li, Min; Frid, Maria G.; Kumar, Binod; Gerasimovskaya, Evgenia V.; Riddle, Suzette R.; McKeon, B. Alexandre; Thukaram, Roopa; Meyrick, Barbara O.; Fini, Mehdi A.
2012-01-01
Increased cell proliferation and migration, of several cell types are key components of vascular remodeling observed in pulmonary hypertension (PH). Our previous data demonstrate that adventitial fibroblasts isolated from pulmonary arteries of chronically hypoxic hypertensive calves (termed PH-Fibs) exhibit a “constitutively activated” phenotype characterized by high proliferative and migratory potential. Osteopontin (OPN) has been shown to promote several cellular activities including growth and migration in cancer cells. We thus tested the hypothesis that elevated OPN expression confers the “activated” highly proproliferative and promigratory/invasive phenotype of PH-Fibs. Our results demonstrate that, both in vivo and ex vivo, PH-Fibs exhibited increased expression of OPN, as well as its cognate receptors, αVβ3 and CD44, compared with control fibroblasts (CO-Fibs). Augmented OPN expression in PH-Fibs corresponded to their high proliferative, migratory, and invasive properties and constitutive activation of ERK1/2 and AKT signaling. OPN silencing via small interfering RNA or sequestering OPN production by specific antibodies led to decreased proliferation, migration, invasion, and attenuated ERK1/2, AKT phosphorylation in PH-Fibs. Furthermore, increasing OPN levels in CO-Fibs via recombinant OPN resulted in significant increases in their proliferative, migratory, and invasive capabilities to the levels resembling those of PH-Fibs. Thus our data suggest OPN as an essential contributor to the activated (highly proliferative, migratory, and proinvasive) phenotype of pulmonary adventitial fibroblasts in hypoxic PH. PMID:22582113
An Exome Sequencing Study to Assess the Role of Rare Genetic Variation in Pulmonary Fibrosis.
Petrovski, Slavé; Todd, Jamie L; Durheim, Michael T; Wang, Quanli; Chien, Jason W; Kelly, Fran L; Frankel, Courtney; Mebane, Caroline M; Ren, Zhong; Bridgers, Joshua; Urban, Thomas J; Malone, Colin D; Finlen Copeland, Ashley; Brinkley, Christie; Allen, Andrew S; O'Riordan, Thomas; McHutchison, John G; Palmer, Scott M; Goldstein, David B
2017-07-01
Idiopathic pulmonary fibrosis (IPF) is an increasingly recognized, often fatal lung disease of unknown etiology. The aim of this study was to use whole-exome sequencing to improve understanding of the genetic architecture of pulmonary fibrosis. We performed a case-control exome-wide collapsing analysis including 262 unrelated individuals with pulmonary fibrosis clinically classified as IPF according to American Thoracic Society/European Respiratory Society/Japanese Respiratory Society/Latin American Thoracic Association guidelines (81.3%), usual interstitial pneumonia secondary to autoimmune conditions (11.5%), or fibrosing nonspecific interstitial pneumonia (7.2%). The majority (87%) of case subjects reported no family history of pulmonary fibrosis. We searched 18,668 protein-coding genes for an excess of rare deleterious genetic variation using whole-exome sequence data from 262 case subjects with pulmonary fibrosis and 4,141 control subjects drawn from among a set of individuals of European ancestry. Comparing genetic variation across 18,668 protein-coding genes, we found a study-wide significant (P RTEL1, and PARN. A model qualifying ultrarare, deleterious, nonsynonymous variants implicated TERT and RTEL1, and a model specifically qualifying loss-of-function variants implicated RTEL1 and PARN. A subanalysis of 186 case subjects with sporadic IPF confirmed TERT, RTEL1, and PARN as study-wide significant contributors to sporadic IPF. Collectively, 11.3% of case subjects with sporadic IPF carried a qualifying variant in one of these three genes compared with the 0.3% carrier rate observed among control subjects (odds ratio, 47.7; 95% confidence interval, 21.5-111.6; P = 5.5 × 10 -22 ). We identified TERT, RTEL1, and PARN-three telomere-related genes previously implicated in familial pulmonary fibrosis-as significant contributors to sporadic IPF. These results support the idea that telomere dysfunction is involved in IPF pathogenesis.
Prins, Kurt W; Duval, Sue; Markowitz, Jeremy; Pritzker, Marc; Thenappan, Thenappan
2017-03-01
Pulmonary hypertension (PH) complicating chronic obstructive pulmonary disease (COPD-PH) and interstitial lung disease (ILD-PH) (World Health Organization [WHO] Group III PH) increases medical costs and reduces survival. Despite limited data, many clinicians are using pulmonary arterial hypertension (PAH)-specific therapy to treat WHO Group III PH patients. To further investigate the utility of PAH-specific therapy in WHO Group III PH, we performed a systematic review and meta-analysis. Relevant studies from January 2000 through May 2016 were identified in the MEDLINE, EMBASE, and COCHRANE electronic databases and www.clinicaltrials.gov. Change in six-minute walk distance (6MWD) was estimated using random effects meta-analysis techniques. Five randomized controlled trials (RCTs) in COPD-PH (128 placebo or standard treatment and 129 PAH-medication treated patients), two RCTs in ILD-PH (23 placebo and 46 treated patients), and four single-arm clinical trials (50 patients) in ILD-PH were identified. Treatment in both COPD-PH and ILD-PH did not worsen hypoxemia. Symptomatic burden was not consistently reduced but there were trends for reduced pulmonary artery pressures and pulmonary vascular resistance with PAH-specific therapy. As compared to placebo, 6MWD was not significantly improved with PAH-specific therapy in the five COPD-PH RCTs (42.7 m; 95% confidence interval [CI], -1.0 - 86.3). In the four single-arm studies in ILD-PH patients, there was a significant improvement in 6MWD after PAH-specific treatment (46.2 m; 95% CI, 27.9-64.4), but in the two ILD-PH RCTs there was not an improvement (21.6 m; 95% CI, -17.8 - 61.0) in exercise capacity when compared to placebo. Due to the small numbers of patients evaluated and inconsistent beneficial effects, the utility of PAH-specific therapy in WHO Group III PH remains unproven. A future clinical trial that is appropriately powered is needed to definitively determine the efficacy of this widely implemented treatment
Specificity and sensitivity of noninvasive measurement of pulmonary vascular protein leak
International Nuclear Information System (INIS)
Dauber, I.M.; Pluss, W.T.; VanGrondelle, A.; Trow, R.S.; Weil, J.V.
1985-01-01
Noninvasive techniques employing external counting of radiolabeled protein have the potential for measuring pulmonary vascular protein permeability, but their specificity and sensitivity remain unclear. The authors tested the specificity and sensitivity of a double-radioisotope method by injecting radiolabeled albumin ( 131 I) and erythrocytes (/sup 99m/Tc) into anesthetized dogs and measuring the counts of each isotope for 150 min after injection with an external gamma probe fixed over the lung. They calculated the rate of increase of albumin counts measured by the probe (which reflects the rate at which protein leaks into the extravascular space). To assess permeability the authors normalized the rate of increase in albumin counts for changes in labeled erythrocyte signal to minimize influence of changes in vascular surface area and thus derived an albumin leak index. They measured the albumin leak index and gravimetric lung water during hydrostatic edema (acutely elevating left atrial pressure by left atrial balloon inflation: mean pulmonary arterial wedge pressure = 22.6 Torr) and in lung injury edema induced by high- (1.0 g/kg) and low-dose (0.25 g/kg) intravenous thiourea. To test specificity hydrostatic and high-dose thiourea edema were compared. The albumin leak index increased nearly fourfold from control after thiourea injury (27.2 +/- 2.3 x 10-4 vs. 7.6 +/- 0.9 x 10-4 min-1) but did not change from control levels after elevating left atrial pressure (8.9 +/- 1.2 x 10-4 min-1) despite comparable increases in gravimetric lung water. To test sensitivity the authors compared low-dose thiourea with controls. Following low-dose thiourea, the albumin leak index nearly doubled despite the absence of a measurable increase in lung water
Simvastatin enhances bone morphogenetic protein receptor type II expression
International Nuclear Information System (INIS)
Hu Hong; Sung, Arthur; Zhao, Guohua; Shi, Lingfang; Qiu Daoming; Nishimura, Toshihiko; Kao, Peter N.
2006-01-01
Statins confer therapeutic benefits in systemic and pulmonary vascular diseases. Bone morphogenetic protein (BMP) receptors serve essential signaling functions in cardiovascular development and skeletal morphogenesis. Mutations in BMP receptor type II (BMPR2) are associated with human familial and idiopathic pulmonary arterial hypertension, and pathologic neointimal proliferation of vascular endothelial and smooth muscle cells within small pulmonary arteries. In severe experimental pulmonary hypertension, simvastatin reversed disease and conferred a 100% survival advantage. Here, modulation of BMPR2 gene expression by simvastatin is characterized in human embryonic kidney (HEK) 293T, pulmonary artery smooth muscle, and lung microvascular endothelial cells (HLMVECs). A 1.4 kb BMPR2 promoter containing Egr-1 binding sites confers reporter gene activation in 293T cells which is partially inhibited by simvastatin. Simvastatin enhances steady-state BMPR2 mRNA and protein expression in HLMVEC, through posttranscriptional mRNA stabilization. Simvastatin induction of BMPR2 expression may improve BMP-BMPR2 signaling thereby enhancing endothelial differentiation and function
Kusko, Rebecca L; Brothers, John F; Tedrow, John; Pandit, Kusum; Huleihel, Luai; Perdomo, Catalina; Liu, Gang; Juan-Guardela, Brenda; Kass, Daniel; Zhang, Sherry; Lenburg, Marc; Martinez, Fernando; Quackenbush, John; Sciurba, Frank; Limper, Andrew; Geraci, Mark; Yang, Ivana; Schwartz, David A; Beane, Jennifer; Spira, Avrum; Kaminski, Naftali
2016-10-15
Despite shared environmental exposures, idiopathic pulmonary fibrosis (IPF) and chronic obstructive pulmonary disease are usually studied in isolation, and the presence of shared molecular mechanisms is unknown. We applied an integrative genomic approach to identify convergent transcriptomic pathways in emphysema and IPF. We defined the transcriptional repertoire of chronic obstructive pulmonary disease, IPF, or normal histology lungs using RNA-seq (n = 87). Genes increased in both emphysema and IPF relative to control were enriched for the p53/hypoxia pathway, a finding confirmed in an independent cohort using both gene expression arrays and the nCounter Analysis System (n = 193). Immunohistochemistry confirmed overexpression of HIF1A, MDM2, and NFKBIB members of this pathway in tissues from patients with emphysema or IPF. Using reads aligned across splice junctions, we determined that alternative splicing of p53/hypoxia pathway-associated molecules NUMB and PDGFA occurred more frequently in IPF or emphysema compared with control and validated these findings by quantitative polymerase chain reaction and the nCounter Analysis System on an independent sample set (n = 193). Finally, by integrating parallel microRNA and mRNA-Seq data on the same samples, we identified MIR96 as a key novel regulatory hub in the p53/hypoxia gene-expression network and confirmed that modulation of MIR96 in vitro recapitulates the disease-associated gene-expression network. Our results suggest convergent transcriptional regulatory hubs in diseases as varied phenotypically as chronic obstructive pulmonary disease and IPF and suggest that these hubs may represent shared key responses of the lung to environmental stresses.
Directory of Open Access Journals (Sweden)
Mani Harika eVemula
2016-03-01
Full Text Available Conventionally, facultative intracellular pathogen, Mycobacterium tuberculosis (M.tb, the tuberculosis (TB causing bacilli in human is cleared by cell-mediated immunity (CMI with CD4+ T cells playing instrumental role in protective immunity, while antibody-mediated immunity (AMI is considered non-protective. This longstanding convention has been challenged with recent evidences of increased susceptibility of hosts with compromised AMI and monoclonal antibodies conferring passive protection against TB and other intracellular pathogens. Therefore, novel approaches towards vaccine development include strategies aiming at induction of humoral response along with CMI. This necessitates the identification of mycobacterial proteins with properties of immunomodulation and strong immunogenicity. In this study, we determined the immunogenic potential of M.tb Zinc metalloprotease-1 (Zmp1, a secretory protein essential for intracellular survival and pathogenesis of M.tb. We observed that Zmp1 was secreted by in vitro grown M.tb under granuloma-like stress conditions (acidic, oxidative, iron deficiency and nutrient deprivation and generated Th2 cytokine microenvironment upon exogenous treatment of Peripheral Blood Mononulear Cells (PBMCs with recombinant Zmp1 (rZmp1. This was supported by recording specific and robust humoral response in TB patients in a cohort of 295. The anti-Zmp1 titers were significantly higher in TB patients (n=121 as against healthy control (n=62, household contacts (n=89 and non-specific infection controls (n=23. A significant observation of the study is the presence of equally high titers of anti-Zmp1 antibodies in a range of patients with high bacilli load (sputum bacilli load of 300+ per mL to paucibacillary smear-negative pulmonary tuberculosis (PTB cases. This clearly indicated the potential of Zmp1 to evoke an effective humoral response independent of mycobacterial load. Such mycobacterial proteins can be explored as antigen
The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.
Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong
2018-04-01
Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes
Energy Technology Data Exchange (ETDEWEB)
Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao
2013-05-20
Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.
Assessing idiopathic pulmonary fibrosis (IPF) with bronchoscopic OCT (Conference Presentation)
Hariri, Lida P.; Adams, David C.; Colby, Thomas V.; Tager, Andrew M.; Suter, Melissa J.
2016-03-01
Idiopathic pulmonary fibrosis (IPF) is a progressive, fatal form of fibrotic lung disease, with a 3 year survival rate of 50%. Diagnostic certainty of IPF is essential to determine the most effective therapy for patients, but often requires surgery to resect lung tissue and look for microscopic honeycombing not seen on chest computed tomography (CT). Unfortunately, surgical lung resection has high risks of associated morbidity and mortality in this patient population. We aim to determine whether bronchoscopic optical coherence tomography (OCT) can serve as a novel, low-risk paradigm for in vivo IPF diagnosis without surgery or tissue removal. OCT provides rapid 3D visualization of large tissue volumes with microscopic resolutions well beyond the capabilities of CT. We have designed bronchoscopic OCT catheters to effectively and safely access the peripheral lung, and conducted in vivo peripheral lung imaging in patients, including those with pulmonary fibrosis. We utilized these OCT catheters to perform bronchoscopic imaging in lung tissue from patients with pulmonary fibrosis to determine if bronchoscopic OCT could successfully visualize features of IPF through the peripheral airways. OCT was able to visualize characteristic features of IPF through the airway, including microscopic honeycombing (< 1 mm diameter) not visible by CT, dense peripheral fibrosis, and spatial disease heterogeneity. These findings support the potential of bronchoscopic OCT as a minimally-invasive method for in vivo IPF diagnosis. However, future clinical studies are needed to validate these findings.
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The clinical presentation of pulmonary embolism
International Nuclear Information System (INIS)
Otto, A.C.; Dunn, M.; Van der Merwe, B.; Katz, M.
2004-01-01
Full text: Introduction: Pulmonary embolism is often misdiagnosed by many clinicians because of confusion with pulmonary infarction. According to present literature, the latter seldomly occurs, thus pleuritic pain and hemoptysis are usually absent. The purpose of our study was to re-evaluate the clinical presentation of pulmonary embolism with specific reference to the presence of pulmonary hypertension and pulmonary infarction. Materials and methods: Ethical committee approval was obtained to study fifteen patients with abnormal lung perfusion and high probability for pulmonary embolism retrospectively. Clinical data will be presented in table format. Appropriate symptoms and signs not mentioned was considered absent. Specific investigations not available was considered not done. Results: Will be displayed in table format. The main findings can be summarized as follows: 1. Dyspnea was present in all the patients; 2. Pleuritic pain and hemoptysis was absent in all the patients; 3. None of the patients had clinical signs of pulmonary hypertension or infarction; 4. The available special investigations confirmed the above mentioned findings. Conclusion: The absence of pulmonary infarction and pulmonary hypertension with submassive pulmonary embolism (<60% of pulmonary vascular bed occluded) was reconfirmed and should be emphasized more in clinical practice. (author)
TiGER: a database for tissue-specific gene expression and regulation.
Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang
2008-06-09
Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
TiGER: A database for tissue-specific gene expression and regulation
Directory of Open Access Journals (Sweden)
Zack Donald J
2008-06-01
Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.
DEFF Research Database (Denmark)
Olesen, R; Wejse, C; Velez, D R
2007-01-01
We investigated the role of DC-SIGN (CD209), long pentraxin 3 (PTX3) and vitamin D receptor (VDR) gene single nucleotide polymorphisms (SNPs) in susceptibility to pulmonary tuberculosis (TB) in 321 TB cases and 347 healthy controls from Guinea-Bissau. Five additional, functionally relevant SNPs...... within toll-like receptors (TLRs) 2, 4 and 9 were typed but found, when polymorphic, not to affect host vulnerability to pulmonary TB. We did not replicate an association between SNPs in the DC-SIGN promoter and TB. However, we found that two polymorphisms, one in DC-SIGN and one in VDR, were associated...
Directory of Open Access Journals (Sweden)
Wang Hehe
2012-08-01
Full Text Available Abstract Background Phytophthora sojae is the primary pathogen of soybeans that are grown on poorly drained soils. Race-specific resistance to P. sojae in soybean is gene-for-gene, although in many areas of the US and worldwide there are populations that have adapted to the most commonly deployed resistance to P. sojae ( Rps genes. Hence, this system has received increased attention towards identifying mechanisms and molecular markers associated with partial resistance to this pathogen. Several quantitative trait loci (QTL have been identified in the soybean cultivar ‘Conrad’ that contributes to the expression of partial resistance to multiple P. sojae isolates. Results In this study, two of the Conrad QTL on chromosome 19 were dissected through sequence and expression analysis of genes in both resistant (Conrad and susceptible (‘Sloan’ genotypes. There were 1025 single nucleotide polymorphisms (SNPs in 87 of 153 genes sequenced from Conrad and Sloan. There were 304 SNPs in 54 genes sequenced from Conrad compared to those from both Sloan and Williams 82, of which 11 genes had SNPs unique to Conrad. Eleven of 19 genes in these regions analyzed with qRT-PCR had significant differences in fold change of transcript abundance in response to infection with P. sojae in lines with QTL haplotype from the resistant parent compared to those with the susceptible parent haplotype. From these, 8 of the 11 genes had SNPs in the upstream, untranslated region, exon, intron, and/or downstream region. These 11 candidate genes encode proteins potentially involved in signal transduction, hormone-mediated pathways, plant cell structural modification, ubiquitination, and basal resistance. Conclusions These findings may indicate a complex defense network with multiple mechanisms underlying these two soybean QTL conferring resistance to P. sojae. SNP markers derived from these candidate genes can contribute to fine mapping of QTL and marker assisted breeding for
Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea.
Nakahara, Yoshiki; Sawabe, Shogo; Kainuma, Kenta; Katsuhara, Maki; Shibasaka, Mineo; Suzuki, Masanori; Yamamoto, Kosuke; Oguri, Suguru; Sakamoto, Hikaru
2015-01-01
Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1) a novel protein highly homologous to thaumatin-like proteins, (2) a novel coiled-coil protein of unknown function, and (3) a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.
Yeast functional screen to identify genes conferring salt stress tolerance in Salicornia europaea
Directory of Open Access Journals (Sweden)
Yoshiki eNakahara
2015-10-01
Full Text Available Salinity is a critical environmental factor that adversely affects crop productivity. Halophytes have evolved various mechanisms to adapt to saline environments. Salicornia europaea L. is one of the most salt-tolerant plant species. It does not have special salt-secreting structures like a salt gland or salt bladder, and is therefore a good model for studying the common mechanisms underlying plant salt tolerance. To identify candidate genes encoding key proteins in the mediation of salt tolerance in S. europaea, we performed a functional screen of a cDNA library in yeast. The library was screened for genes that allowed the yeast to grow in the presence of 1.3 M NaCl. We obtained three full-length S. europaea genes that confer salt tolerance. The genes are predicted to encode (1 a novel protein highly homologous to thaumatin-like proteins, (2 a novel coiled-coil protein of unknown function, and (3 a novel short peptide of 32 residues. Exogenous application of a synthetic peptide corresponding to the 32 residues improved salt tolerance of Arabidopsis. The approach described in this report provides a rapid assay system for large-scale screening of S. europaea genes involved in salt stress tolerance and supports the identification of genes responsible for such mechanisms. These genes may be useful candidates for improving crop salt tolerance by genetic transformation.
DePianto, Daryle J; Chandriani, Sanjay; Abbas, Alexander R; Jia, Guiquan; N'Diaye, Elsa N; Caplazi, Patrick; Kauder, Steven E; Biswas, Sabyasachi; Karnik, Satyajit K; Ha, Connie; Modrusan, Zora; Matthay, Michael A; Kukreja, Jasleen; Collard, Harold R; Egen, Jackson G; Wolters, Paul J; Arron, Joseph R
2015-01-01
There is microscopic spatial and temporal heterogeneity of pathological changes in idiopathic pulmonary fibrosis (IPF) lung tissue, which may relate to heterogeneity in pathophysiological mediators of disease and clinical progression. We assessed relationships between gene expression patterns, pathological features, and systemic biomarkers to identify biomarkers that reflect the aggregate disease burden in patients with IPF. Gene expression microarrays (N=40 IPF; 8 controls) and immunohistochemical analyses (N=22 IPF; 8 controls) of lung biopsies. Clinical characterisation and blood biomarker levels of MMP3 and CXCL13 in a separate cohort of patients with IPF (N=80). 2940 genes were significantly differentially expressed between IPF and control samples (|fold change| >1.5, p<0.05). Two clusters of co-regulated genes related to bronchiolar epithelium or lymphoid aggregates exhibited substantial heterogeneity within the IPF population. Gene expression in bronchiolar and lymphoid clusters corresponded to the extent of bronchiolisation and lymphoid aggregates determined by immunohistochemistry in adjacent tissue sections. Elevated serum levels of MMP3, encoded in the bronchiolar cluster, and CXCL13, encoded in the lymphoid cluster, corresponded to disease severity and shortened survival time (p<10(-7) for MMP3 and p<10(-5) for CXCL13; Cox proportional hazards model). Microscopic pathological heterogeneity in IPF lung tissue corresponds to specific gene expression patterns related to bronchiolisation and lymphoid aggregates. MMP3 and CXCL13 are systemic biomarkers that reflect the aggregate burden of these pathological features across total lung tissue. These biomarkers may have clinical utility as prognostic and/or surrogate biomarkers of disease activity in interventional studies in IPF. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Lin, F; Chen, X M
2007-05-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values
Henno, Priscilla; Grassin-Delyle, Stanislas; Belle, Emeline; Brollo, Marion; Naline, Emmanuel; Sage, Edouard; Devillier, Philippe; Israël-Biet, Dominique
2017-05-23
Tobacco-induced pulmonary vascular disease is partly driven by endothelial dysfunction. The Sonic hedgehog (SHH) pathway is involved in vascular physiology. We sought to establish whether the SHH pathway has a role in pulmonary endothelial dysfunction in smokers. The ex vivo endothelium-dependent relaxation of pulmonary artery rings in response to acetylcholine (Ach) was compared in 34 current or ex-smokers and 8 never-smokers. The results were expressed as a percentage of the contraction with phenylephrine. We tested the effects of SHH inhibitors (GANT61 and cyclopamine), an SHH activator (SAG) and recombinant VEGF on the Ach-induced relaxation. The level of VEGF protein in the pulmonary artery ring was measured in an ELISA. SHH pathway gene expression was quantified in reverse transcriptase-quantitative polymerase chain reactions. Ach-induced relaxation was much less intense in smokers than in never-smokers (respectively 24 ± 6% and 50 ± 7% with 10 -4 M Ach; p = 0.028). All SHH pathway genes were expressed in pulmonary artery rings from smokers. SHH inhibition by GANT61 reduced Ach-induced relaxation and VEGF gene expression in the pulmonary artery ring. Recombinant VEGF restored the ring's endothelial function. VEGF gene and protein expression levels in the pulmonary artery rings were positively correlated with the degree of Ach-induced relaxation and negatively correlated with the number of pack-years. SHH pathway genes and proteins are expressed in pulmonary artery rings from smokers, where they modulate endothelial function through VEGF.
Central role of T helper 17 cells in chronic hypoxia-induced pulmonary hypertension.
Maston, Levi D; Jones, David T; Giermakowska, Wieslawa; Howard, Tamara A; Cannon, Judy L; Wang, Wei; Wei, Yongyi; Xuan, Weimin; Resta, Thomas C; Gonzalez Bosc, Laura V
2017-05-01
Inflammation is a prominent pathological feature in pulmonary arterial hypertension, as demonstrated by pulmonary vascular infiltration of inflammatory cells, including T and B lymphocytes. However, the contribution of the adaptive immune system is not well characterized in pulmonary hypertension caused by chronic hypoxia. CD4 + T cells are required for initiating and maintaining inflammation, suggesting that these cells could play an important role in the pathogenesis of hypoxic pulmonary hypertension. Our objective was to test the hypothesis that CD4 + T cells, specifically the T helper 17 subset, contribute to chronic hypoxia-induced pulmonary hypertension. We compared indices of pulmonary hypertension resulting from chronic hypoxia (3 wk) in wild-type mice and recombination-activating gene 1 knockout mice (RAG1 -/- , lacking mature T and B cells). Separate sets of mice were adoptively transferred with CD4 + , CD8 + , or T helper 17 cells before normoxic or chronic hypoxic exposure to evaluate the involvement of specific T cell subsets. RAG1 -/- mice had diminished right ventricular systolic pressure and arterial remodeling compared with wild-type mice exposed to chronic hypoxia. Adoptive transfer of CD4 + but not CD8 + T cells restored the hypertensive phenotype in RAG1 -/- mice. Interestingly, RAG1 -/- mice receiving T helper 17 cells displayed evidence of pulmonary hypertension independent of chronic hypoxia. Supporting our hypothesis, depletion of CD4 + cells or treatment with SR1001, an inhibitor of T helper 17 cell development, prevented increased pressure and remodeling responses to chronic hypoxia. We conclude that T helper 17 cells play a key role in the development of chronic hypoxia-induced pulmonary hypertension. Copyright © 2017 the American Physiological Society.
Hepatocyte specific expression of human cloned genes
Energy Technology Data Exchange (ETDEWEB)
Cortese, R
1986-01-01
A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.
Energy Technology Data Exchange (ETDEWEB)
Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. (Washington Univ., St. Louis, MO (United States)); Colby, T.V. (Mayo Clinic, Rochester, MN (United States))
1991-08-01
Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.
Gorguet, B.J.M.; Schipper, E.H.; Heusden, van A.W.; Lindhout, P.
2006-01-01
Functional male sterility is an important trait for the production of hybrid seeds. Among the genes coding for functional male sterility in tomato is the positional sterility gene ps-2. ps-2 is monogenic recessive, confers non-dehiscent anthers and is the most suitable for practical uses. In order
Directory of Open Access Journals (Sweden)
Benjamin Mayne
2016-10-01
Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.
Exploring the potential relevance of human-specific genes to complex disease
Directory of Open Access Journals (Sweden)
Cooper David N
2011-01-01
Full Text Available Abstract Although human disease genes generally tend to be evolutionarily more ancient than non-disease genes, complex disease genes appear to be represented more frequently than Mendelian disease genes among genes of more recent evolutionary origin. It is therefore proposed that the analysis of human-specific genes might provide new insights into the genetics of complex disease. Cross-comparison with the Human Gene Mutation Database (http://www.hgmd.org revealed a number of examples of disease-causing and disease-associated mutations in putatively human-specific genes. A sizeable proportion of these were missense polymorphisms associated with complex disease. Since both human-specific genes and genes associated with complex disease have often experienced particularly rapid rates of evolutionary change, either due to weaker purifying selection or positive selection, it is proposed that a significant number of human-specific genes may play a role in complex disease.
Tissue-specific functional networks for prioritizing phenotype and disease genes.
Directory of Open Access Journals (Sweden)
Yuanfang Guan
Full Text Available Integrated analyses of functional genomics data have enormous potential for identifying phenotype-associated genes. Tissue-specificity is an important aspect of many genetic diseases, reflecting the potentially different roles of proteins and pathways in diverse cell lineages. Accounting for tissue specificity in global integration of functional genomics data is challenging, as "functionality" and "functional relationships" are often not resolved for specific tissue types. We address this challenge by generating tissue-specific functional networks, which can effectively represent the diversity of protein function for more accurate identification of phenotype-associated genes in the laboratory mouse. Specifically, we created 107 tissue-specific functional relationship networks through integration of genomic data utilizing knowledge of tissue-specific gene expression patterns. Cross-network comparison revealed significantly changed genes enriched for functions related to specific tissue development. We then utilized these tissue-specific networks to predict genes associated with different phenotypes. Our results demonstrate that prediction performance is significantly improved through using the tissue-specific networks as compared to the global functional network. We used a testis-specific functional relationship network to predict genes associated with male fertility and spermatogenesis phenotypes, and experimentally confirmed one top prediction, Mbyl1. We then focused on a less-common genetic disease, ataxia, and identified candidates uniquely predicted by the cerebellum network, which are supported by both literature and experimental evidence. Our systems-level, tissue-specific scheme advances over traditional global integration and analyses and establishes a prototype to address the tissue-specific effects of genetic perturbations, diseases and drugs.
The diversity of antimicrobial resistance genes among staphylococci of animal origin.
Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina
2013-08-01
Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Jenny Paola Jiménez
2016-07-01
Full Text Available Herbicide tolerance is one of the features most used in GM crops, which has shown positive results for farmers and the environment. The starting point is the development of expression cassettes that express the characteristic of interest, they are initially constructed by standard molecular biology techniques. Currently, by bioinformatics and synthetic biology tools, it is possible to design and test the construct in silico, and then hire their synthesis. This approach allows optimizing expression by modifying the codon usage. In this work there were designed and evaluated semi-synthetic versions of genes in Nicotiana benthamiana, these genes confer tolerance to the herbicide phosphinothricin. It was made an analysis of freedom to operate in order to ensure that the designed constructs not violate intellectual property in Colombia. There were obtained two expression cassettes with freedom to operate, which express versions of the bar gene.
Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao
2017-06-01
Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane
Genome-scale analysis of positional clustering of mouse testis-specific genes
Directory of Open Access Journals (Sweden)
Lee Bernett TK
2005-01-01
Full Text Available Abstract Background Genes are not randomly distributed on a chromosome as they were thought even after removal of tandem repeats. The positional clustering of co-expressed genes is known in prokaryotes and recently reported in several eukaryotic organisms such as Caenorhabditis elegans, Drosophila melanogaster, and Homo sapiens. In order to further investigate the mode of tissue-specific gene clustering in higher eukaryotes, we have performed a genome-scale analysis of positional clustering of the mouse testis-specific genes. Results Our computational analysis shows that a large proportion of testis-specific genes are clustered in groups of 2 to 5 genes in the mouse genome. The number of clusters is much higher than expected by chance even after removal of tandem repeats. Conclusion Our result suggests that testis-specific genes tend to cluster on the mouse chromosomes. This provides another piece of evidence for the hypothesis that clusters of tissue-specific genes do exist.
Design of chimeric expression elements that confer high-level gene activity in chromoplasts.
Caroca, Rodrigo; Howell, Katharine A; Hasse, Claudia; Ruf, Stephanie; Bock, Ralph
2013-02-01
Non-green plastids, such as chromoplasts, generally have much lower activity of gene expression than chloroplasts in photosynthetically active tissues. Suppression of plastid genes in non-green tissues occurs through a complex interplay of transcriptional and translational control, with the contribution of regulation of transcript abundance versus translational activity being highly variable between genes. Here, we have investigated whether the low expression of the plastid genome in chromoplasts results from inherent limitations in gene expression capacity, or can be overcome by designing appropriate combinations of promoters and translation initiation signals in the 5' untranslated region (5'-UTR). We constructed chimeric expression elements that combine promoters and 5'-UTRs from plastid genes, which are suppressed during chloroplast-to-chromoplast conversion in Solanum lycopersicum (tomato) fruit ripening, either just at the translational level or just at the level of mRNA accumulation. These chimeric expression elements were introduced into the tomato plastid genome by stable chloroplast transformation. We report the identification of promoter-UTR combinations that confer high-level gene expression in chromoplasts of ripe tomato fruits, resulting in the accumulation of reporter protein GFP to up to 1% of total cellular protein. Our work demonstrates that non-green plastids are capable of expressing genes to high levels. Moreover, the chimeric cis-elements for chromoplasts developed here are widely applicable in basic and applied research using transplastomic methods. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.
Nurse administered propofol sedation for pulmonary endoscopies requires a specific protocol
DEFF Research Database (Denmark)
Jensen, Jeppe Thue; Banning, Anne-Marie; Clementsen, Paul
2012-01-01
This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline".......This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline"....
The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...
Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.
Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian
2018-06-01
Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M
1990-01-01
The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158
Directory of Open Access Journals (Sweden)
Reverter Antonio
2008-09-01
Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing
13th Forum for Specification and Design Languages (FDL) conference
Morawiec, Adam; System Specification and Design Languages : Selected Contributions from FDL 2010
2012-01-01
This book brings together a selection of the best papers from the thirteenth edition of the Forum on specification and Design Languages Conference (FDL), which was held in Southampton, UK in September 2010. FDL is a well established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modelling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. Covers design verification, automatic synthesis and mechanized debug aids; Includes language-based modeling and design techniques for embedded systems; Covers design, modeling and verification of mixed physical domain and mixed signal systems that include significant analog parts in electrical and non-electrical domains; Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven E...
10. international mouse genome conference
Energy Technology Data Exchange (ETDEWEB)
Meisler, M.H.
1996-12-31
Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.
Directory of Open Access Journals (Sweden)
Andrew Williams
2015-12-01
Full Text Available Background: The presence of diverse types of nanomaterials (NMs in commerce is growing at an exponential pace. As a result, human exposure to these materials in the environment is inevitable, necessitating the need for rapid and reliable toxicity testing methods to accurately assess the potential hazards associated with NMs. In this study, we applied biclustering and gene set enrichment analysis methods to derive essential features of altered lung transcriptome following exposure to NMs that are associated with lung-specific diseases. Several datasets from public microarray repositories describing pulmonary diseases in mouse models following exposure to a variety of substances were examined and functionally related biclusters of genes showing similar expression profiles were identified. The identified biclusters were then used to conduct a gene set enrichment analysis on pulmonary gene expression profiles derived from mice exposed to nano-titanium dioxide (nano-TiO2, carbon black (CB or carbon nanotubes (CNTs to determine the disease significance of these data-driven gene sets.Results: Biclusters representing inflammation (chemokine activity, DNA binding, cell cycle, apoptosis, reactive oxygen species (ROS and fibrosis processes were identified. All of the NM studies were significant with respect to the bicluster related to chemokine activity (DAVID; FDR p-value = 0.032. The bicluster related to pulmonary fibrosis was enriched in studies where toxicity induced by CNT and CB studies was investigated, suggesting the potential for these materials to induce lung fibrosis. The pro-fibrogenic potential of CNTs is well established. Although CB has not been shown to induce fibrosis, it induces stronger inflammatory, oxidative stress and DNA damage responses than nano-TiO2 particles.Conclusion: The results of the analysis correctly identified all NMs to be inflammogenic and only CB and CNTs as potentially fibrogenic. In addition to identifying several
International Nuclear Information System (INIS)
Wang Jincheng; Mi Hongzhi; Wang Qian; Zhang Weijun; Lu Biao; Yang Hao; Ding Jian; Lu Yao
2001-01-01
Objective: To assess the value of ventilation-perfusion imaging in the diagnosis of pulmonary embolism (PE). Methods: Thirty consecutive patients with clinically suspected pulmonary embolism were studied, male: female 15:15, mean age was (36.2 +- 13.9) years. The chest radiograms were obtained in all 30 patients. All patients underwent radionuclide ventilation-perfusion imaging and pulmonary angiography. Results: Of the 30 patients, 22 with lobe, multiple segment or multi-subsegment perfusion defects and normal or nearly normal ventilation images were reported as PE. 20 of them were confirmed to be with PE by pulmonary angiography, 2 patients were not confirmed. Eight of 30 patients with multiple perfusion defects, ventilative abnormalities were reported as non-PE and the diagnoses were confirmed by pulmonary angiography. The sensitivity, specificity and accuracy of diagnosis of PE by ventilation-perfusion imaging was 100%, 80.0% and 93.3% respectively. Conclusions: (1) Ventilation-perfusion imaging is one of the most valuable methods in the diagnosis of PE. (2) The results suggest that pulmonary embolism can be diagnosed non-invasively in most patients on the basis of clinical manifestation, chest radiograms and ventilation-perfusion imaging findings. (3) Pulmonary angiography is required while clinical manifestation and ventilation-perfusion imaging findings are discordant with each other
Kokuho, Nariaki; Terasaki, Yasuhiro; Kunugi, Shinobu; Onda, Naomi; Urushiyama, Hirokazu; Terasaki, Mika; Hino, Mitsunori; Gemma, Akihiko; Hatori, Tsutomu; Shimizu, Akira
2017-07-01
Crystal-storing histiocytosis (CSH) is an uncommon finding in lymphoplasmacytic disorders that presents histiocytes with abnormal intralysosomal accumulations of immunoglobulin light chains as crystals of unknown etiology. A 38-year-old woman with antiphospholipid syndrome had a surgical lung biopsy because of multiple lung mass lesions. In a right middle lobe lesion, lymphoplasmacytic cells had a monocytoid appearance, destructive lymphoepithelial lesions, and positive immunoglobulin heavy chain (IGH) gene rearrangements. A right upper lobe lesion manifested proliferating rounded histiocytes with abundant, deeply eosinophilic cytoplasm and negative IGH gene rearrangements. Electron microscopy and mass spectrometry revealed a case of pulmonary CSH: abnormal proliferation of the immunoglobulin κ chain of a variable region that may be crystallized within plasma cells and histiocytes. We report a rare case of localized pulmonary CSH complicating pulmonary mucosa-associated lymphoid tissue lymphoma with multiple mass lesions. We demonstrate advances in the understanding of the pathogenesis of CSH by various analyses of these lesions. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Akkina Ramesh
2008-07-01
Full Text Available Abstract Background Thus far gene therapy strategies for HIV/AIDS have used either conventional retroviral vectors or lentiviral vectors for gene transfer. Although highly efficient, their use poses a certain degree of risk in terms of viral mediated oncogenesis. Sleeping Beauty (SB transposon system offers a non-viral method of gene transfer to avoid this possible risk. With respect to conferring HIV resistance, stable knock down of HIV-1 coreceptors CCR5 and CXCR4 by the use of lentiviral vector delivered siRNAs has proved to be a promising strategy to protect cells from HIV-1 infection. In the current studies our aim is to evaluate the utility of SB system for stable gene transfer of CCR5 and CXCR4 siRNA genes to derive HIV resistant cells as a first step towards using this system for gene therapy. Results Two well characterized siRNAs against the HIV-1 coreceptors CCR5 and CXCR4 were chosen based on their previous efficacy for the SB transposon gene delivery. The siRNA transgenes were incorporated individually into a modified SB transfer plasmid containing a FACS sortable red fluorescence protein (RFP reporter and a drug selectable neomycin resistance gene. Gene transfer was achieved by co-delivery with a construct expressing a hyperactive transposase (HSB5 into the GHOST-R3/X4/R5 cell line, which expresses the major HIV receptor CD4 and and the co-receptors CCR5 and CXCR4. SB constructs expressing CCR5 or CXCR4 siRNAs were also transfected into MAGI-CCR5 or MAGI-CXCR4 cell lines, respectively. Near complete downregulation of CCR5 and CXCR4 surface expression was observed in transfected cells. During viral challenge with X4-tropic (NL4.3 or R5-tropic (BaL HIV-1 strains, the respective transposed cells showed marked viral resistance. Conclusion SB transposon system can be used to deliver siRNA genes for stable gene transfer. The siRNA genes against HIV-1 coreceptors CCR5 and CXCR4 are able to downregulate the respective cell surface proteins
International Nuclear Information System (INIS)
Fedullo, P.F.; Shure, D.
1987-01-01
A wide range of pulmonary vascular imaging techniques are available for the diagnostic evaluation of patients with suspected pulmonary vascular disease. The characteristics of any ideal technique would include high sensitivity and specificity, safety, simplicity, and sequential applicability. To date, no single technique meets these ideal characteristics. Conventional pulmonary angiography remains the gold standard for the diagnosis of acute thromboembolic disease despite the introduction of newer techniques such as digital subtraction angiography and magnetic resonance imaging. Improved noninvasive lower extremity venous testing methods, particularly impedance plethysmography, and ventilation-perfusion scanning can play significant roles in the noninvasive diagnosis of acute pulmonary emboli when properly applied. Ventilation-perfusion scanning may also be useful as a screening test to differentiate possible primary pulmonary hypertension from chronic thromboembolic pulmonary hypertension. And, finally, angioscopy may be a useful adjunctive technique to detect chronic thromboembolic disease and determine operability. Optimal clinical decision-making, however, will continue to require the proper interpretation of adjunctive information obtained from the less-invasive techniques, applied with an understanding of the natural history of the various forms of pulmonary vascular disease and with a knowledge of the capabilities and shortcomings of the individual techniques
Yan, Z P; Tong, X; Liu, S T; Ma, Y; Peng, S F; Yang, X; Fan, H
2016-05-13
Meta-analyses have revealed many positive associations between gene variants and susceptibility to chronic obstructive pulmonary disease (COPD). However, some of those positive results may be false positives. Therefore, we investigated the genetic polymorphisms associated with COPD risk and determined their diagnostic value. We extracted the odds ratio (OR) and 95% confidence interval for each polymorphism from published meta-analyses concerning gene variants and COPD susceptibility in October 2014, subsequently we calculated false-positive report probabilities (FPRPs) for statistically significant associations (P value value of the true positive polymorphisms of COPD using the Meta-DiSc software. Twenty-five gene polymorphisms were significantly associated with COPD risk. The FPRP test results were as follows: 1) when the prior probability was 0.001 and the OR was 1.5, ADAM33 rs612709, CHRNA3/5 rs1051730, CHRNA3/5 rs8034191, CHRNA3/5 rs16969968, and TGFB1 rs1800470 were truly associated with COPD risk (FPRP value for COPD diagnosis.
Candidate genes for chronic obstructive pulmonary disease in two large data sets
DEFF Research Database (Denmark)
Bakke, P S; Zhu, G; Gulsvik, A
2011-01-01
Lack of reproducibility of findings has been a criticism of genetic association studies in complex diseases like chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationshipsto COPD and genotyped these variants in a case......-control study which included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post bronchodilator FEV1 in percent predicted and FEV1/FVC). The polymorphisms significantly associated...... to these phenotypes in this first study were tested in a second, family based, study that included 635 pedigrees with 1910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p
Pulmonary involvement of secondary syphilis.
Ogawa, Yoshihiko; Imai, Yuichiro; Yoshihara, Shingo; Fujikura, Hiroyuki; Hirai, Nobuyasu; Sato, Masatoshi; Ogawa, Taku; Uno, Kenji; Kasahara, Kei; Yano, Hisakazu; Mikasa, Keiichi
2018-01-01
Pulmonary involvement in secondary syphilis is considered a rare occurrence; however, the number of cases has increased in the 2000s. This is likely due to the increased use of computed tomography scans and molecular diagnostic testing. We report a case of an HIV-positive man with pleural chest pain and bilateral subpleural nodules on chest computed tomography. His rapid plasma reagin and Treponema pallidum hemagglutination tests were positive, and the specimen of one of the pulmonary nodules obtained by transthoracic biopsy was positive for the polA gene of Treponema pallidum. Since clinical manifestations of syphilis are highly variable, clinicians should bear in mind that pleural chest pain with bilateral subpleural nodules can be caused by pulmonary syphilis.
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
Antitrypsin and chronic obstructive pulmonary disease among Japanese-American men.
Roberts, A; Kagan, A; Rhoads, G G; Pierce, J A; Bruce, R M
1977-10-01
A total of 161 patients with chronic obstructive pulmonary disease (COPD) plus 100 control subjects (identified during a study of heart disease in 6,860 Japanese-American men aged 52 to 75 years who were residing in Hawaii) were analyzed for phenotype in search of the antitrypsin gene Z, which has been shown to be associated with pulmonary emphysema in other racial groups. No carriers of the Z gene were found, and the question of whether the rarity or absence of this gene relates to a low frequency of COPD among Japanese-Americans is reviewed.
MCP1 haplotypes associated with protection from pulmonary tuberculosis
Directory of Open Access Journals (Sweden)
Owusu-Dabo Ellis
2011-04-01
Full Text Available Abstract Background The monocyte chemoattractant protein 1 (MCP-1 is involved in the recruitment of lymphocytes and monocytes and their migration to sites of injury and cellular immune reactions. In a Ghanaian tuberculosis (TB case-control study group, associations of the MCP1 -362C and the MCP1 -2581G alleles with resistance to TB were recently described. The latter association was in contrast to genetic effects previously described in study groups originating from Mexico, Korea, Peru and Zambia. This inconsistency prompted us to further investigate the MCP1 gene in order to determine causal variants or haplotypes genetically and functionally. Results A 14 base-pair deletion in the first MCP1 intron, int1del554-567, was strongly associated with protection against pulmonary TB (OR = 0.84, CI 0.77-0.92, Pcorrected = 0.00098. Compared to the wildtype combination, a haplotype comprising the -2581G and -362C promoter variants and the intronic deletion conferred an even stronger protection than did the -362C variant alone (OR = 0.78, CI 0.69-0.87, Pnominal = 0.00002; adjusted Pglobal = 0.0028. In a luciferase reporter gene assay, a significant reduction of luciferase gene expression was observed in the two constructs carrying the MCP1 mutations -2581 A or G plus the combination -362C and int1del554-567 compared to the wildtype haplotype (P = 0.02 and P = 0.006. The associated variants, in particular the haplotypes composed of these latter variants, result in decreased MCP-1 expression and a decreased risk of pulmonary TB. Conclusions In addition to the results of the previous study of the Ghanaian TB case-control sample, we have now identified the haplotype combination -2581G/-362C/int1del554-567 that mediates considerably stronger protection than does the MCP1 -362C allele alone (OR = 0.78, CI 0.69-0.87 vs OR = 0.83, CI 0.76-0.91. Our findings in both the genetic analysis and the reporter gene study further indicate a largely negligible role of the
Genetic influences on chronic obstructive pulmonary disease - a twin study
DEFF Research Database (Denmark)
Sylvan Ingebrigtsen, Truls; Thomsen, Simon Francis; Vestbo, Jørgen
2010-01-01
Genes that contribute to the risk of developing Chronic Obstructive Pulmonary Disease (COPD) have been identified, but an attempt to accurately quantify the total genetic contribution to COPD has to our knowledge never been conducted.......Genes that contribute to the risk of developing Chronic Obstructive Pulmonary Disease (COPD) have been identified, but an attempt to accurately quantify the total genetic contribution to COPD has to our knowledge never been conducted....
Pulmonary microRNA profiling: implications in upper lobe predominant lung disease.
Armstrong, David A; Nymon, Amanda B; Ringelberg, Carol S; Lesseur, Corina; Hazlett, Haley F; Howard, Louisa; Marsit, Carmen J; Ashare, Alix
2017-01-01
Numerous pulmonary diseases manifest with upper lobe predominance including cystic fibrosis, smoking-related chronic obstructive pulmonary disease, and tuberculosis. Zonal hypoxia, characteristic of these pulmonary maladies, and oxygen stress in general is known to exert profound effects on various important aspects of cell biology. Lung macrophages are major participants in the pulmonary innate immune response and regional differences in macrophage responsiveness to hypoxia may contribute in the development of lung disease. MicroRNAs are ubiquitous regulators of human biology and emerging evidence indicates altered microRNA expression modulates respiratory disease processes. The objective of this study is to gain insight into the epigenetic and cellular mechanisms influencing regional differences in lung disease by investigating effect of hypoxia on regional microRNA expression in the lung. All studies were performed using primary alveolar macrophages ( n = 10) or bronchoalveolar lavage fluid ( n = 16) isolated from human subjects. MicroRNA was assayed via the NanoString nCounter microRNA assay. Divergent molecular patterns of microRNA expression were observed in alternate lung lobes, specifically noted was disparate expression of miR-93 and miR-4454 in alveolar macrophages along with altered expression of miR-451a and miR-663a in bronchoalveolar lavage fluid. Gene ontology was used to identify potential downstream targets of divergent microRNAs. Targets include cytokines and matrix metalloproteinases, molecules that could have a significant impact on pulmonary inflammation and fibrosis. Our findings show variant regional microRNA expression associated with hypoxia in alveolar macrophages and BAL fluid in the lung-upper vs lower lobe. Future studies should address whether these specific microRNAs may act intracellularly, in a paracrine/endocrine manner to direct the innate immune response or may ultimately be involved in pulmonary host-to-pathogen trans
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
Discovery of cancer common and specific driver gene sets
2017-01-01
Abstract Cancer is known as a disease mainly caused by gene alterations. Discovery of mutated driver pathways or gene sets is becoming an important step to understand molecular mechanisms of carcinogenesis. However, systematically investigating commonalities and specificities of driver gene sets among multiple cancer types is still a great challenge, but this investigation will undoubtedly benefit deciphering cancers and will be helpful for personalized therapy and precision medicine in cancer treatment. In this study, we propose two optimization models to de novo discover common driver gene sets among multiple cancer types (ComMDP) and specific driver gene sets of one certain or multiple cancer types to other cancers (SpeMDP), respectively. We first apply ComMDP and SpeMDP to simulated data to validate their efficiency. Then, we further apply these methods to 12 cancer types from The Cancer Genome Atlas (TCGA) and obtain several biologically meaningful driver pathways. As examples, we construct a common cancer pathway model for BRCA and OV, infer a complex driver pathway model for BRCA carcinogenesis based on common driver gene sets of BRCA with eight cancer types, and investigate specific driver pathways of the liquid cancer lymphoblastic acute myeloid leukemia (LAML) versus other solid cancer types. In these processes more candidate cancer genes are also found. PMID:28168295
Sunflower broomrape (Orobanche cumana Wallr.) is a root holoparasitic angiosperm considered as being one of the major constraints for sunflower production in Mediterranean areas. Breeding for resistance has been crucial for protecting sunflowers from broomrape damage. The Or5 gene, which confers re...
Pulmonary alveolar microlithiasis
International Nuclear Information System (INIS)
Vallejo, Franco Javier; Vallejo, Alejandro; Parra, Maximiliano
2007-01-01
Pulmonary alveolar microlithiasis (PAM) is a rare disease characterized by the diffuse and bilateral presence of calcium phosphate microlite in the alveolar spaces. The progression of this potentially lethal disease is show and most of the patients remain asymptomatic during years or decades, resulting in a show deterioration of the pulmonary function. The typical finding of the sand storm in the chest X-ray is characteristic of this entity. Mutations in the SLC34A2 gene that does the coding for the type II co-transporter of sodium phosphate were identified as responsible for this disease. Of the almost 600 cases, only 6 have been reported in Colombia. We are presenting a case of pulmonary alveolar microlite in a 27 year old man, with progressive respiratory distress whose diagnosis was made by the X-ray findings and confirmed by trans bronchial biopsy. In the 2 years follow-up, shows evolution towards deterioration of his respiratory function making him a candidate for lung transplantation.
Nilai Diagnostik Metode “Real Time” PCR GeneXpert pada TB Paru BTA Negatif
Directory of Open Access Journals (Sweden)
Eka Kurniawan
2016-09-01
description of TB and it’s depend on doctor's decision, so this can lead to under or over-diagnosis. Molecular examination with real time PCR method of GeneXpert is a breakthrough invention to diagnose TB quickly. The objective of this study was to assess the validity of GeneXpert in smear negative pulmonary TB and it’s compared with Loweinstein Jensen culture. Study design was diagnostic test with cross sectional study. Research conducted on 40 patients with smear negative pulmonary TB in public health centers around the city of Padang and the patients who were treated at the Internal Medicine department of dr. M. Djamil hospital Padang. Sputum examination conducted by GeneXpert compared with Loweinstein Jensen culture. Diagnostic value of GeneXpert for diagnosing smear negative pulmonary tuberculosis are sensitivity 83.33%, specificity 95.46%, positive predictive value 93.75%, negative predictive value 87.5% and accuracy 90%. Kappa value is 0.796. GeneXpert has a high sensitivity, specificity, positive predictive value, negative predictive value and accuracy on smear negative pulmonary tuberculosis.Keywords: diagnostic value, smear negative pulmonary tuberculosis, GeneXpert
Imaging features of diffuse pulmonary hemorrhage
International Nuclear Information System (INIS)
Schmit, M.; Vogel, W.; Horger, M.
2006-01-01
There are diverse etiologies of diffuse pulmonary hemorrhage, so specific diagnosis may be difficult. Conventional radiography tends to be misleading as hemoptysis may lacking in patients with hemorrhagic anemia. Diffuse pulmonary hemorrhage should be differentiated from focal pulmonary hemorrhage resulting from chronic bronchitis, bronchiectasis, active infection (tuberculosis) neoplasia, trauma, or embolism. (orig.)
Kim, John S.; McSweeney, Julia; Lee, Joanne; Ivy, Dunbar
2015-01-01
Objective Review the pharmacologic treatment options for pulmonary arterial hypertension (PAH) in the cardiac intensive care setting and summarize the most-recent literature supporting these therapies. Data Sources and Study Selection Literature search for prospective studies, retrospective analyses, and case reports evaluating the safety and efficacy of PAH therapies. Data Extraction Mechanisms of action and pharmacokinetics, treatment recommendations, safety considerations, and outcomes for specific medical therapies. Data Synthesis Specific targeted therapies developed for the treatment of adult patients with PAH have been applied for the benefit of children with PAH. With the exception of inhaled nitric oxide, there are no PAH medications approved for children in the US by the FDA. Unfortunately, data on treatment strategies in children with PAH are limited by the small number of randomized controlled clinical trials evaluating the safety and efficacy of specific treatments. The treatment options for PAH in children focus on endothelial-based pathways. Calcium channel blockers are recommended for use in a very small, select group of children who are responsive to vasoreactivity testing at cardiac catheterization. Phosphodiesterase type 5 inhibitor therapy is the most-commonly recommended oral treatment option in children with PAH. Prostacyclins provide adjunctive therapy for the treatment of PAH as infusions (intravenous and subcutaneous) and inhalation agents. Inhaled nitric oxide is the first line vasodilator therapy in persistent pulmonary hypertension of the newborn, and is commonly used in the treatment of PAH in the Intensive Care Unit (ICU). Endothelin receptor antagonists have been shown to improve exercise tolerance and survival in adult patients with PAH. Soluble Guanylate Cyclase Stimulators are the first drug class to be FDA approved for the treatment of chronic thromboembolic pulmonary hypertension. Conclusions Literature and data supporting the
Sharma, Pankaj; Sharma, Aditi; Vishwakarma, Achchhe Lal; Agnihotri, Promod Kumar; Sharma, Sharad; Srivastava, Mrigank
2016-04-01
Eosinophils play a central role in the pathogenesis of tropical pulmonary eosinophilia, a rare, but fatal, manifestation of filariasis. However, no exhaustive study has been done to identify the genes and proteins of eosinophils involved in the pathogenesis of tropical pulmonary eosinophilia. In the present study, we established a mouse model of tropical pulmonary eosinophilia that mimicked filarial manifestations of human tropical pulmonary eosinophilia pathogenesis and used flow cytometry-assisted cell sorting and real-time RT-PCR to study the gene expression profile of flow-sorted, lung eosinophils and lung macrophages during tropical pulmonary eosinophilia pathogenesis. Our results show that tropical pulmonary eosinophilia mice exhibited increased levels of IL-4, IL-5, CCL5, and CCL11 in the bronchoalveolar lavage fluid and lung parenchyma along with elevated titers of IgE and IgG subtypes in the serum. Alveolar macrophages from tropical pulmonary eosinophilia mice displayed decreased phagocytosis, attenuated nitric oxide production, and reduced T-cell proliferation capacity, and FACS-sorted lung eosinophils from tropical pulmonary eosinophilia mice upregulated transcript levels of ficolin A and anti-apoptotic gene Bcl2,but proapoptotic genes Bim and Bax were downregulated. Similarly, flow-sorted lung macrophages upregulated transcript levels of TLR-2, TLR-6, arginase-1, Ym-1, and FIZZ-1 but downregulated nitric oxide synthase-2 levels, signifying their alternative activation. Taken together, we show that the pathogenesis of tropical pulmonary eosinophilia is marked by functional impairment of alveolar macrophages, alternative activation of lung macrophages, and upregulation of anti-apoptotic genes by eosinophils. These events combine together to cause severe lung inflammation and compromised lung immunity. Therapeutic interventions that can boost host immune response in the lungs might thus provide relief to patients with tropical pulmonary eosinophilia.
Importance of polymerase chain reaction in diagnosis of pulmonary and extra-pulmonary tuberculosis
International Nuclear Information System (INIS)
Iqbal, S.; Ahmed, R.; Adhami, S.U.Z.
2011-01-01
Pakistan ranks eighth on the list of 22 high-burden tuberculosis (TB) countries in the world according to the World Health Organisation's (WHO) Global Tuberculosis Control 2009. Including other reasons the main cause is improper and late diagnosis of the disease. PCR may play an important role to control the disease with its rapid, sensitive and specific diagnosis. But in Pakistan due to lake of knowledge about this latest technique we are not using this technique appropriately. Clinicians still trust on conventional methods of TB diagnosis, which are time consuming or insensitive. The present study was arranged to highlight the importance of PCR in TB diagnosis in pulmonary and extra-pulmonary cases and its comparison with conventional methods. Methods: Samples obtained from 290 patients of suspected TB (pulmonary or extra-pulmonary) were subjected to ZN smear examination, LJ medium culture and PCR test by amplifying 541 bp fragment of Mycobacterium tuberculosis complex genome. The present prospective study is performed at Shalamar Hospital Lahore from November 2008 to November 2010. Results: A distinctly difference was observed in the test results done by PCR and other conventional techniques in pulmonary or extra-pulmonary tuberculosis samples (p<0.001). The sensitivity of different tests was 68.62% for PCR, 26.90% for LJ medium culture, and 14.14% for ZN smear examination (p<0.05). However, there was no significant difference between different tests as for as specificity was concerned. PCR test sensitivity in pulmonary and extra-pulmonary clinical samples was 78.34 and 61.76% respectively, being significantly higher (p<0.05) when compared with sensitivity of other tests. The mean detection time for M. tuberculosis was 25 days by LJ medium culture and less than 1 day by smear examination and PCR test. Conclusion: PCR test is more sensitive than ZN smear examination and LJ medium culture for the diagnosis of TB in pulmonary and extra-pulmonary clinical samples
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Directory of Open Access Journals (Sweden)
Medina-Coello Chaxiraxi
2011-10-01
Full Text Available Background TNF-α mediated inflammation is thought to play a key role in the respiratory and systemic features of Chronic Obstructive Pulmonary Disease. The aim of the present study was to replicate and extend recent findings in Taiwanese and Caucasian populations of associations between COPD susceptibility and variants of the TNFA gene in a Spanish cohort. Methods The 3 reported SNPs were complemented with nine tag single nucleotide polymorphisms (SNP of the TNFA and LTA genes and genotyped in 724 individuals (202 COPD patients, 90 smokers without COPD and 432 healthy controls. Pulmonary function parameters and serum inflammatory markers were also measured in COPD patients. Results The TNFA rs1800630 (-863C/A SNP was associated with a lower COPD susceptibility (ORadj = 0.50, 95% CI = 0.33-0.77, p = 0.001. The -863A allele was also associated with less severe forms of the disease (GOLD stages I and II (ORadj = 0.303, 95%CI = 0.14-0.65, p = 0.014 and with lower scores of the BODE index (1 percent predicted (p = 0.004 and a lower BODE index (p = 0.003 over a 2 yrs follow-up period. None of the TNFA or LTA gene variants correlated with the serum inflammatory markers in COPD patients (p > 0.05. Conclusions We replicated the previously reported association between the TNFA -863 SNP and COPD. TNFA -863A allele may confer a protective effect to the susceptibility to the disease in the Spanish population.
Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J
2013-05-01
FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.
Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.
Bandaranayake, Pradeepa C G; Yoder, John I
2013-05-01
Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene
Specific detection of Aspergillus fumigatus in sputum sample of ...
African Journals Online (AJOL)
We developed a two-step PCR assay that specifically amplifies a region of the 18S rRNA gene that is highly conserved in Aspergillus fumigatus. This assay allows direct and rapid detection of down to 10 fg of Aspergillus fumigatus DNA corresponding to 1 to 5 colony forming unit (CFU) per ml of sputum sample of pulmonary ...
Molecular Mechanisms of Nanosized Titanium Dioxide–Induced Pulmonary Injury in Mice
Sang, Xuezi; Cui, Yaling; Wang, Xiaochun; Gui, Suxin; Tan, Danlin; Zhu, Min; Zhao, Xiaoyang; Sheng, Lei; Wang, Ling; Hong, Fashui; Tang, Meng
2013-01-01
The pulmonary damage induced by nanosized titanium dioxide (nano-TiO2) is of great concern, but the mechanism of how this damage may be incurred has yet to be elucidated. Here, we examined how multiple genes may be affected by nano-TiO2 exposure to contribute to the observed damage. The results suggest that long-term exposure to nano-TiO2 led to significant increases in inflammatory cells, and levels of lactate dehydrogenase, alkaline phosphate, and total protein, and promoted production of reactive oxygen species and peroxidation of lipid, protein and DNA in mouse lung tissue. We also observed nano-TiO2 deposition in lung tissue via light and confocal Raman microscopy, which in turn led to severe pulmonary inflammation and pneumonocytic apoptosis in mice. Specifically, microarray analysis showed significant alterations in the expression of 847 genes in the nano-TiO2-exposed lung tissues. Of 521 genes with known functions, 361 were up-regulated and 160 down-regulated, which were associated with the immune/inflammatory responses, apoptosis, oxidative stress, the cell cycle, stress responses, cell proliferation, the cytoskeleton, signal transduction, and metabolic processes. Therefore, the application of nano-TiO2 should be carried out cautiously, especially in humans. PMID:23409001
Guizilini, Solange; Viceconte, Marcela; Esperança, Gabriel Tavares da M; Bolzan, Douglas W; Vidotto, Milena; Moreira, Rita Simone L; Câncio, Andréia Azevedo; Gomes, Walter J
2014-01-01
To evaluate the lung function and clinical outcome in severe chronic obstructive pulmonary disease in patients undergoing off-pump coronary artery bypass grafting with left internal thoracic artery graft, comparing the pleural drain insertion in the intercostal versus subxyphoid region. A randomized controlled trial. Chronic obstructive pulmonary disease patients were randomized into two groups according pleural drain site: II group (n=27) - pleural drain in intercostal space; SI group (n=29) - pleural drain in the subxyphoid region. Spirometry values (Forced Vital Capacity - and Forced expiratory volume in 1 second) were obtained on preoperative and 1, 3 and 5 postoperative days. Chest x-ray from preoperative until postoperative day 5 (POD5) was performed for monitoring respiratory events, such as atelectasis and pleural effusion. Pulmonary shunt fraction and pain score was evaluate preoperatively and on postoperative day 1. In both groups there was a significant decrease of the spirometry values (Forced Vital Capacity and Forced expiratory volume in 1 second) until POD5 (Ppleural drainage in severe Chronic obstructive pulmonary disease patients determined better preservation and recovery of pulmonary capacity and volumes with lower pulmonary shunt fraction and better clinical outcomes on early postoperative off-pump coronary artery bypass grafting.
Dissecting specific and global transcriptional regulation of bacterial gene expression
Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe
Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an
Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng
2017-09-01
Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Quarck Rozenn
2012-03-01
Full Text Available Abstract Background Chronic thromboembolic pulmonary hypertension (CTEPH is associated with proximal pulmonary artery obstruction and vascular remodeling. We hypothesized that pulmonary arterial smooth muscle (PASMC and endothelial cells (PAEC may actively contribute to remodeling of the proximal pulmonary vascular wall in CTEPH. Our present objective was to characterize PASMC and PAEC from large arteries of CTEPH patients and investigate their potential involvement in vascular remodeling. Methods Primary cultures of proximal PAEC and PASMC from patients with CTEPH, with non-thromboembolic pulmonary hypertension (PH and lung donors have been established. PAEC and PASMC have been characterized by immunofluorescence using specific markers. Expression of smooth muscle specific markers within the pulmonary vascular wall has been studied by immunofluorescence and Western blotting. Mitogenic activity and migratory capacity of PASMC and PAEC have been investigated in vitro. Results PAEC express CD31 on their surface, von Willebrand factor in Weibel-Palade bodies and take up acetylated LDL. PASMC express various differentiation markers including α-smooth muscle actin (α-SMA, desmin and smooth muscle myosin heavy chain (SMMHC. In vascular tissue from CTEPH and non-thromboembolic PH patients, expression of α-SMA and desmin is down-regulated compared to lung donors; desmin expression is also down-regulated in vascular tissue from CTEPH compared to non-thromboembolic PH patients. A low proportion of α-SMA positive cells express desmin and SMMHC in the neointima of proximal pulmonary arteries from CTEPH patients. Serum-induced mitogenic activity of PAEC and PASMC, as well as migratory capacity of PASMC, were increased in CTEPH only. Conclusions Modified proliferative and/or migratory responses of PASMC and PAEC in vitro, associated to a proliferative phenotype of PASMC suggest that PASMC and PAEC could contribute to proximal vascular remodeling in CTEPH.
Out of proportion pulmonary hypertension in obstructive lung diseases.
Chatterjee, Kshitij; Tarawneh, Ahmad R; Alam, Shoaib
2018-03-01
Pulmonary hypertension is common (25-90%) in chronic obstructive pulmonary diseases (COPDs). Severe pulmonary hypertension, however, is quite rare (1-3%). The term 'out of proportion' pulmonary hypertension is still widely used. New guidelines instead propose to use the term 'Severe pulmonary hypertension' if mean pulmonary arterial pressure at least 35 mmHg or cardiac index (CI) is less than 2.0 l/min/m on right heart catheterization (RHC). Why only a minority of COPD patients develop severe pulmonary hypertension is unclear. When present, severe pulmonary hypertension in COPD is associated with increased dyspnea and decreased survival and often does not closely correlate with degree of obstructive abnormality on pulmonary function testing. COPD patients with severe pulmonary hypertension experience circulatory limitation at maximum exercise, and not ventilatory limitation, which is typical for moderate-to-severe COPD patients with no or moderate pulmonary hypertension. There is no conclusive evidence to support or completely reject the possibility of the use of specific pulmonary arterial hypertension (PAH) therapies in pulmonary hypertension associated with COPD. In mild-to-moderate COPD patients who have severe and progressive symptoms, and have evidence of severe pulmonary hypertension on RHC, specific PAH therapies may be used similar to WHO group-I PAH guidelines.
Description of electrophoretic loci and tissue specific gene ...
African Journals Online (AJOL)
Protein electrophoresis was used to study the distributions and tissue specificity of gene expression of enzymes encoded by 42 loci in Rhinolophus clivosus and R. landeri, the genetically most divergent of the ten species of southern African horseshoe bats. No differences in gene expression were found between R.
Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.
Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy
2017-12-01
Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.
Directory of Open Access Journals (Sweden)
Clark Taane G
2010-04-01
Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes
Directory of Open Access Journals (Sweden)
Solange Guizilini
2014-12-01
Full Text Available Objective: To evaluate the lung function and clinical outcome in severe chronic obstructive pulmonary disease in patients undergoing off-pump coronary artery bypass grafting with left internal thoracic artery graft, comparing the pleural drain insertion in the intercostal versus subxyphoid region. Methods: A randomized controlled trial. Chronic obstructive pulmonary disease patients were randomized into two groups according pleural drain site: II group (n=27 - pleural drain in intercostal space; SI group (n=29 - pleural drain in the subxyphoid region. Spirometry values (Forced Vital Capacity - and Forced expiratory volume in 1 second were obtained on preoperative and 1, 3 and 5 postoperative days. Chest x-ray from preoperative until postoperative day 5 (POD5 was performed for monitoring respiratory events, such as atelectasis and pleural effusion. Pulmonary shunt fraction and pain score was evaluate preoperatively and on postoperative day 1. Results: In both groups there was a significant decrease of the spirometry values (Forced Vital Capacity and Forced expiratory volume in 1 second until POD5 (P<0.05. However, when compared, SI group presented less decrease in these parameters (P<0.05. Pulmonary shunt fraction was significantly lower in SI group (P<0.05. Respiratory events, pain score, orotracheal intubation time and postoperative length of hospital stay were lower in the SI group (P<0.05. Conclusion: Subxyphoid pleural drainage in severe Chronic obstructive pulmonary disease patients determined better preservation and recovery of pulmonary capacity and volumes with lower pulmonary shunt fraction and better clinical outcomes on early postoperative off-pump coronary artery bypass grafting.
Zhang, Zhiqiang; Wang, Yafang; Chang, Leqin; Zhang, Tong; An, Jie; Liu, Yushi; Cao, Yuman; Zhao, Xia; Sha, Xuyang; Hu, Tianming; Yang, Peizhi
2016-02-01
The zeaxanthin epoxidase gene ( MsZEP ) was cloned and characterized from alfalfa and validated for its function of tolerance toward drought and salt stresses by heterologous expression in Nicotiana tabacum. Zeaxanthin epoxidase (ZEP) plays important roles in plant response to various environment stresses due to its functions in ABA biosynthetic and the xanthophyll cycle. To understand the expression characteristics and the biological functions of ZEP in alfalfa (Medicago sativa), a novel gene, designated as MsZEP (KM044311), was cloned, characterized and overexpressed in Nicotiana tabacum. The open reading frame of MsZEP contains 1992 bp nucleotides and encodes a 663-amino acid polypeptide. Amino acid sequence alignment indicated that deduced MsZEP protein was highly homologous to other plant ZEP sequences. Phylogenetic analysis showed that MsZEP was grouped into a branch with other legume plants. Real-time quantitative PCR revealed that MsZEP gene expression was clearly tissue-specific, and the expression levels were higher in green tissues (leaves and stems) than in roots. MsZEP expression decreased in shoots under drought, cold, heat and ABA treatment, while the expression levels in roots showed different trends. Besides, the results showed that nodules could up-regulate the MsZEP expression under non-stressful conditions and in the earlier stage of different abiotic stress. Heterologous expression of the MsZEP gene in N. tabacum could confer tolerance to drought and salt stress by affecting various physiological pathways, ABA levels and stress-responsive genes expression. Taken together, these results suggested that the MsZEP gene may be involved in alfalfa responses to different abiotic stresses and nodules, and could enhance drought and salt tolerance of transgenic tobacco by heterologous expression.
Directory of Open Access Journals (Sweden)
Leslie A. Blair
2016-10-01
Full Text Available Abstract Background Microparticles (MPs stimulate inflammatory adhesion molecule expression in systemic vascular diseases, however it is unknown whether circulating MPs stimulate localized ICAM-1 expression in the heterogeneically distinct pulmonary endothelium during pulmonary arterial hypertension (PAH. Pulmonary vascular lesions with infiltrating inflammatory cells in PAH form in the pulmonary arteries and arterioles, but not the microcirculation. Therefore, we sought to determine whether circulating MPs from PAH stimulate pulmonary artery endothelial cell-selective ICAM-1 expression. Results Pulmonary artery endothelial cells (PAECs were exposed to MPs isolated from the circulation of a rat model of severe PAH. During late-stage (8-weeks PAH, but not early-stage (3-weeks, an increase in ICAM-1 was observed. To determine whether PAH MP-induced ICAM-1 was selective for a specific segment of the pulmonary circulation, pulmonary microvascular endothelial cells (PMVECs were exposed to late-stage PAH MPs and no increase in ICAM-1 was detected. A select population of circulating MPs, the late-stage endoglin + MPs, were used to assess their ability to stimulate ICAM-1 and it was determined that the endoglin + MPs were sufficient to promote ICAM-1 increases in the whole cell, but not surface only expression. Conclusions Late-stage, but not early-stage, MPs in a model of severe PAH selectively induce ICAM-1 in pulmonary artery endothelium, but not pulmonary microcirculation. Further, the selected endoglin + PAH MPs, but not endoglin + MPs from control, are sufficient to promote whole cell ICAM-1 in PAECs. The implications of this work are that MPs in late-stage PAH are capable of inducing ICAM-1 expression selectively in the pulmonary artery. ICAM-1 likely plays a significant role in the observed inflammatory cell recruitment, specifically to vascular lesions in the pulmonary artery and not the pulmonary microcirculation.
Evolutionary constraints shape caste-specific gene expression across 15 ant species.
Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki
2017-05-01
Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.
Garate, Zita; Davis, Brian R; Quintana-Bustamante, Oscar; Segovia, Jose C
2013-06-01
Advances in cell and gene therapy are opening up new avenues for regenerative medicine. Because of their acquired pluripotency, human induced pluripotent stem cells (hiPSCs) are a promising source of autologous cells for regenerative medicine. They show unlimited self-renewal while retaining the ability, in principle, to differentiate into any cell type of the human body. Since Yamanaka and colleagues first reported the generation of hiPSCs in 2007, significant efforts have been made to understand the reprogramming process and to generate hiPSCs with potential for clinical use. On the other hand, the development of gene-editing platforms to increase homologous recombination efficiency, namely DNA nucleases (zinc finger nucleases, TAL effector nucleases, and meganucleases), is making the application of locus-specific gene therapy in human cells an achievable goal. The generation of patient-specific hiPSC, together with gene correction by homologous recombination, will potentially allow for their clinical application in the near future. In fact, reports have shown targeted gene correction through DNA-Nucleases in patient-specific hiPSCs. Various technologies have been described to reprogram patient cells and to correct these patient hiPSCs. However, no approach has been clearly more efficient and safer than the others. In addition, there are still significant challenges for the clinical application of these technologies, such as inefficient differentiation protocols, genetic instability resulting from the reprogramming process and hiPSC culture itself, the efficacy and specificity of the engineered DNA nucleases, and the overall homologous recombination efficiency. To summarize advances in the generation of gene corrected patient-specific hiPSCs, this review focuses on the available technological platforms, including their strengths and limitations regarding future therapeutic use of gene-corrected hiPSCs.
Comparative gene expression profiling of multiple tissues from rat strains with genetic predisposition to diverse cardiovascular diseases (CVD) can help decode the transcriptional program that governs organ-specific functions. We examined expressions of CVD genes in the lungs of ...
International Nuclear Information System (INIS)
Huang Xiaoyong; Du Jing; Zhang Zhaoqi; Guo Xi; Yan Zixu; Jiang Hong; Wang Wei
2005-01-01
Objective: This study was designed to investigate the sensitivity and specificity of magnetic resonance pulmonary perfusion imaging (MRPP) in diagnosing pulmonary embolism (PE) compared with enhanced magnetic resonance pulmonary angiography (MRPA) and pulmonary radionuclide perfusion imaging. Methods: Fourteen patients were definitely diagnosed as PE, whose ages were from 19 to 71 years old and mean 45.5 ± 19.8 years old. All patients under went MRPA and MRPP and 3 patients were examined again after thrombolytic treatment. Five patients underwent pulmonary radionuclide perfusion imaging. Setting ROI in top, middle, bottom of lung area and abnormal area respectively, we detected signal intensity and time-signal curve to obtain the transformation rate of signal (TROS) during perfusion peak value. Results: In 14 pulmonary embolism patients, MRPA found 62 branches of pulmonary artery obstruction. Fifty-five abnormal pulmonary perfusion zones were found by MRPP, and the above results were very alike. The coincidence was 88.71%. In 14 cases, MRPP could show 25 subsegments lesion below segments. In 5 patients who had both results Of MRPP and ECT at the same time. MRPP shows 33 perfusion defect zones and 37 segments were found by ECT, the sensitivity was 89.19%. After thrombolytic treatment, both the status of the affected pulmonary artery improved markedly and perfusion defect zones reduced obviously in 3 cases by MRPP and MRPA. TROS in normal perfusion zones perfusion defect zones and low perfusion zones had significant difference (t=22.882, P<0.01). Conclusion: Contrast enhanced MR pulmonary perfusion can show both perfusion defect zones and low perfusion zones in pulmonary embolism. Time-signal curve can show the period of maximum no perfusion zones in pulmonary artery embolism zones. And the amplitude of fluctuation is small with miminum TROS. MRPP has significant values especially in showing pulmonary artery embolism in segments and subsegments. Using both MRPP and
Safdar, Basmah; Greenberg, Marna R
2014-12-01
With the goal of reducing inequalities in patient care, the 2014 Academic Emergency Medicine (AEM) consensus conference, "Gender-Specific Research in Emergency Care: Investigate, Understand, and Translate How Gender Affects Patient Outcomes," convened a diverse group of researchers, clinicians, health care providers, patients, and representatives of federal agencies and policy-makers in Dallas, Texas, in May 2014. The executive and steering committees identified seven clinical domains as key to gender-specific emergency care: cardiovascular, neurological, trauma/injury, substance abuse, pain, mental health, and diagnostic imaging. The main aims of the conference were to: 1) summarize and consolidate current data related to sex- and gender-specific research for acute care and identify critical gender-related gaps in knowledge to inform an EM research agenda; 2) create a consensus-driven research agenda that advances sex- and gender-specific research in the prevention, diagnosis, and management of acute diseases and identify strategies to investigate them; and 3) build a multinational interdisciplinary consortium to disseminate and study the sex and gender medicine of acute conditions. Over a 2-year period, this collaborative network of stakeholders identified key areas where sex- and gender-specific research is most likely to improve clinical care and ultimately patient outcomes. The iterative consensus process culminated in a daylong conference on May 13, 2014, with a total of 133 registrants, with the majority being between ages 31 and 50 years (57%), females (71%), and whites (79%). Content experts led the consensus-building workshops at the conference and used the nominal group technique to consolidate consensus recommendations for priority research. In addition, panel sessions addressed funding mechanisms for gender-specific research as well as gender-specific regulatory challenges to product development and approval. This special issue of AEM reports the
Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9.
Bai, Meizhu; Liang, Dan; Wang, Yinghua; Li, Qing; Wu, Yuxuan; Li, Jinsong
2016-05-20
Tissue-specific knockout technology enables the analysis of the gene function in specific tissues in adult mammals. However, conventional strategy for producing tissue-specific knockout mice is a time- and labor-consuming process, restricting rapid study of the gene function in vivo. CRISPR-Cas9 system from bacteria is a simple and efficient gene-editing technique, which has enabled rapid generation of gene knockout lines in mouse by direct injection of CRISPR-Cas9 into zygotes. Here, we demonstrate CRISPR-Cas9-mediated spermatogenic cell-specific disruption of Scp3 gene in testes in one step. We first generated transgenic mice by pronuclear injection of a plasmid containing Hspa2 promoter driving Cas9 expression and showed Cas9 specific expression in spermatogenic cells. We then produced transgenic mice carrying Hspa2 promoter driven Cas9 and constitutive expressed sgRNA targeting Scp3 gene. Male founders were infertile due to developmental arrest of spermatogenic cells while female founders could produce progeny normally. Consistently, male progeny from female founders were infertile and females could transmit the transgenes to the next generation. Our study establishes a CRISPR-Cas9-based one-step strategy to analyze the gene function in adult tissues by a temporal-spatial pattern. Copyright © 2016 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.
Identification of the two rotavirus genes determining neutralization specificities
International Nuclear Information System (INIS)
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities
Identification of the two rotavirus genes determining neutralization specificities
Energy Technology Data Exchange (ETDEWEB)
Offit, P.A.; Blavat, G.
1986-01-01
Bovine rotavirus NCDV and simian rotavirus SA-11 represent two distinct rotavirus serotypes. A genetic approach was used to determine which viral gene segments segregated with serotype-specific viral neutralization. There were 16 reassortant rotarviruses derived by coinfection of MA-104 cells in vitro with the SA-11 and NCDV strains. The parental origin of reassortant rotavirus double-stranded RNA segments was determined by gene segment mobility in polyacrylamide gels and by hybridization with radioactively labeled parental viral transcripts. The authors found that two rotavirus gene segments found previously to code for outer capsid proteins vp3 and vp7 cosegreated with virus neutralization specificities.
Directory of Open Access Journals (Sweden)
Rong-Ping Zhang
Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only
Pulmonary Hypertension in the Intensive Care Unit.
Jentzer, Jacob C; Mathier, Michael A
2016-07-01
Pulmonary hypertension occurs as the result of disease processes increasing pressure within the pulmonary circulation, eventually leading to right ventricular failure. Patients may become critically ill from complications of pulmonary hypertension and right ventricular failure or may develop pulmonary hypertension as the result of critical illness. Diagnostic testing should evaluate for common causes such as left heart failure, hypoxemic lung disease and pulmonary embolism. Relatively few patients with pulmonary hypertension encountered in clinical practice require specific pharmacologic treatment of pulmonary hypertension targeting the pulmonary vasculature. Management of right ventricular failure involves optimization of preload, maintenance of systemic blood pressure and augmentation of inotropy to restore systemic perfusion. Selected patients may require pharmacologic therapy to reduce right ventricular afterload by directly targeting the pulmonary vasculature, but only after excluding elevated left heart filling pressures and confirming increased pulmonary vascular resistance. Critically-ill patients with pulmonary hypertension remain at high risk of adverse outcomes, requiring a diligent and thoughtful approach to diagnosis and treatment. © The Author(s) 2015.
Study on Fusion Protein and Its gene in Baculovirus Specificity
International Nuclear Information System (INIS)
Nemr, W.A.H.
2012-01-01
Baculoviruses are subdivided into two groups depending on the type of budded virus envelop fusion protein; group I utilized gp64 which include the most of nucleopolyhedroviruses (NPVs), group II utilized F protein which include the remnants of NPVs and all Granuloviruses (GVs). Recent studies reported the viral F protein coding gene as a host cellular sourced gene and may evolutionary acquired from the host genome referring to phylogeny analysis of fusion proteins. Thus, it was deduced that F protein coding gene is species- specific nucleotide sequence related to the type of the specific host and if virus could infect an unexpected host, the resulted virus may encode a vary F gene. In this regard, the present study utilized the mentioned properties of F gene in an attempt to produce a model of specific and more economic wider range granulovirus bio- pesticide able to infect both Spodoptera littoralis and Phthorimaea operculella larvae. Multiple sequence alignment and phylogeny analysis were performed on six members of group II baculovirus, novel universal PCR primers were manually designed from the conserved regions in the alignment graph, targeted to amplify species- specific sequence entire F gene open reading frame (ORF) which is useful in molecular identification of baculovirus in unknown samples. So, the PCR product of SpliGV used to prepare a specific probe for the F gene of this type of virus. Results reflected that it is possible to infect S. littoralis larvae by PhopGV if injected into larval haemocoel, the resulted virus of this infection showed by using DNA hybridization technique to be encode to F gene homologous with the F gene of Spli GV, which is revealed that the resulted virus acquired this F gene sequence from the host genome after infection. Consequently, these results may infer that if genetic aberrations occur in the host genome, this may affect in baculoviral infectivity. So, this study aimed to investigate the effect of gamma radiation at
9. international mouse genome conference
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-12-31
This conference was held November 12--16, 1995 in Ann Arbor, Michigan. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on genetic mapping in mice. This report contains abstracts of presentations, focusing on the following areas: mutation identification; comparative mapping; informatics and complex traits; mutagenesis; gene identification and new technology; and genetic and physical mapping.
Flavonoids such as anthocyanins possess significant health benefits to humans and play important physiological roles in plants. An interesting Purple gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving intense purple color in very young leaves, curds, and see...
Wai, T; Grumet, R
1995-09-01
The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Pulmonary hypertension associated with left-sided heart disease.
Maeder, Micha Tobias; Schoch, Otto D; Kleiner, Rebekka; Joerg, Lucas; Weilenmann, Daniel; Swiss Society For Pulmonary Hypertension
2017-01-19
Pulmonary hypertension associated with left-sided heart disease (PH-LHD) is the most common type of pulmonary hypertension. In patients with left-sided heart disease, the presence of pulmonary hypertension is typically a marker of more advanced disease, more severe symptoms, and worse prognosis. In contrast to pulmonary arterial hypertension, PH-LHD is characterised by an elevated pulmonary artery wedge pressure (postcapillary pulmonary hypertension) without or with an additional precapillary component (isolated postcapillary versus combined postcapillary and precapillary pulmonary hypertension). Transthoracic echocardiography is the primary nonin-vasive imaging tool to estimate the probability of pulmonary hypertension and to establish a working diagnosis on the mechanism of pulmonary hyperten-sion. However, right heart catheterisation is always required if significant pulmonary hypertension is sus-pected and exact knowledge of the haemodynamic constellation is necessary. The haemodynamic con-stellation (mean pulmonary artery pressure, mean pulmonary artery wedge pressure, left ventricular end-diastolic pressure) in combination with clinical infor-mation and imaging findings (mainly echocardiog-raphy, coronary angiography and cardiac magnetic resonance imaging) will usually allow the exact mech-anism underlying PH-LHD to be defined, which is a prerequisite for appropriate treatment. The general principle for the management of PH-LHD is to treat the underlying left-sided heart disease in an optimal man-ner using drugs and/or interventional or surgical ther-apy. There is currently no established indication for pulmonary arterial hypertension-specific therapies in PH-LHD, and specific therapies may even cause harm in patients with PH-LHD.
Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu
2013-12-01
Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.
Gallo, Mary C; Kirkham, Charmaine; Eng, Samantha; Bebawee, Remon S; Kong, Yong; Pettigrew, Melinda M; Tettelin, Hervé; Murphy, Timothy F
2018-05-14
Nontypeable Haemophilus influenzae (NTHi) is an exclusively human pathobiont that plays a critical role in the course and pathogenesis of chronic obstructive pulmonary disease (COPD). NTHi causes acute exacerbations of COPD and also causes persistent infection of the lower airways. NTHi expresses four IgA protease variants (A1, A2, B1, and B2) that play different roles in virulence. Expression of IgA proteases varies among NTHi strains, but little is known about the frequency and mechanisms by which NTHi modulates IgA protease expression during infection in COPD. To assess expression of IgA protease during natural infection in COPD, we studied IgA protease expression of 101 persistent strains (median duration of persistence 161 days, range 2 to 1422) collected longitudinally from patients enrolled in a 20-year study of COPD upon initial acquisition and immediately before clearance from the host. Upon acquisition, 89 (88%) expressed IgA protease. A total of 16 of 101 (16%) strains of NTHi altered expression of IgA protease during persistence. Indels and slipped-strand mispairing of mononucleotide repeats conferred changes in expression of igaA1, igaA2, and igaB1 Strains with igaB2 underwent frequent changes in expression of IgA protease B2 during persistence, mediated by slipped-strand mispairing of a 7-nucleotide repeat, TCAAAAT, within the open reading frame of igaB2 We conclude that changes in iga gene sequences result in changes in expression of IgA proteases by NTHi during persistent infection in the respiratory tract of patients with COPD. Copyright © 2018 American Society for Microbiology.
Cerebral Venous Thrombosis and Pulmonary Embolism with Prothrombin G20210A Gene Mutation
Dagli, Canan Eren; Koksal, Nurhan; Guler, Selma; Gelen, Mehmet Emin; Atilla, Nurhan; Tuncel, Deniz
2010-01-01
A 25-year-old man presented with symptoms of syncope, cough, headache and hemoptysis. Cranial MR and venography showed thrombus formation in the right transverse sinus and superior sagittal sinus. Computed tomographic pulmonary angiography (CTPA) showed an embolic thrombus in the right pulmonary truncus and lung abscess. The patient was young, and there were no signs of lower extremity deep venous thrombosis or other major risk factors for pulmonary embolism (PE) including cardiac anomaly. Th...
Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N
2016-03-12
Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex
Age-specific association between percent body fat and pulmonary ...
African Journals Online (AJOL)
This study describes the association between percent body fat and pulmonary function among apparently normal twenty male children tidal volume aged 4 years and twenty male children aged 10 years in Ogbomoso. The mean functional residual capacity of the lung in male children aged 10 years was significantly higher ...
Pulmonary embolism and nuclear medicine
International Nuclear Information System (INIS)
Peltier, P.; Planchon, B.; Faucal, P. de; Touze, M.D.; Dupas, B.
1988-01-01
Risks related to pulmonary embolism require use of diagnostic procedures with good sensitivity, and the potential complications of effective anticoagulant therapy require procedures with good specificity. Clinical signs are not more accurate for diagnosis of pulmonary than are ECG, blood gas and chest X ray examinations. Perfusion-ventilation scintigraphy has good diagnostic accuracy approaching that of pulmonary angiography which remains the gold standard. Since pulmonary embolism is usually a complication of deep venous thrombosis, distal clot detection should be associated with lung explorations. Plethysmography, ultrasonography, doppler studies and scintigraphy of the lower limbs could provide data supplementing those of contrast venography. The value and role of these examinations are analyzed and discussed in terms of different clinical situations [fr
miR-30c is specifically repressed in patients with active pulmonary tuberculosis.
Spinelli, Silvana V; Fernández, Rocío Del V; Zoff, Luciana; Bongiovanni, Bettina; Díaz, Ariana; D'Attilio, Luciano; Santucci, Natalia; Alvarez, Tomás; Marchesini, Marcela M; Bogue, Cristina; Bay, Maria L; Bottasso, Oscar A
2017-07-01
Tuberculous pleurisy (PLTB) is a common form of extrapulmonary tuberculosis. It often resolves without chemotherapy being hence considered a rather benign manifestation of the disease. Patients with PLTB mount an effective anti-mycobacterial response, unlike those with active pulmonary TB (pTB) that were shown to present an imbalance in plasma immune and endocrine mediators. In this work, we explored whether expression of the active isoform of the glucocorticoid receptor (hGRα) in the context of the inflammatory-anti-inflammatory responses of TB patients may be associated to microRNA levels. As expected, the inflammatory response triggered in patients coexists with increased circulating cortisol and altered hGRα levels in the peripheral blood mononuclear cells. However, while hGRα expression is significantly downregulated in PLTB, its levels in pTB patients are higher within the control values. These results point out to the existence of an additional mechanism tending to preserve hGRα levels probably to deal with the chronic inflammation observed in pTB. In this regard, we found that miR-30c is strongly downregulated in mononuclear cells of pTB patients compared to PLTB cases, showing an expression profile opposite to that seen with hGRα. Interestingly, low levels of miR-30c are specific for this active form of TB, as its expression is not altered in mononuclear cells from either healthy controls or patients with tuberculous or non-tuberculous pleurisy. Moreover, miR-30c and hGRα also showed an inverse expression pattern in M. tuberculosis-stimulated THP-1 macrophage cultures. In sum, our studies identify miR-30c as a specific correlate of pulmonary manifestations of TB, potentially involved in the altered glucocorticoid sensitivity observed in these patients. Copyright © 2017 Elsevier Ltd. All rights reserved.
Luzina, Irina G; Lockatell, Virginia; Hyun, Sang W; Kopach, Pavel; Kang, Phillip H; Noor, Zahid; Liu, Anguo; Lillehoj, Erik P; Lee, Chunsik; Miranda-Ribera, Alba; Todd, Nevins W; Goldblum, Simeon E; Atamas, Sergei P
2016-05-15
Idiopathic pulmonary fibrosis (IPF) poses challenges to understanding its underlying cellular and molecular mechanisms and the development of better therapies. Previous studies suggest a pathophysiological role for neuraminidase 1 (NEU1), an enzyme that removes terminal sialic acid from glycoproteins. We observed increased NEU1 expression in epithelial and endothelial cells, as well as fibroblasts, in the lungs of patients with IPF compared with healthy control lungs. Recombinant adenovirus-mediated gene delivery of NEU1 to cultured primary human cells elicited profound changes in cellular phenotypes. Small airway epithelial cell migration was impaired in wounding assays, whereas, in pulmonary microvascular endothelial cells, NEU1 overexpression strongly impacted global gene expression, increased T cell adhesion to endothelial monolayers, and disrupted endothelial capillary-like tube formation. NEU1 overexpression in fibroblasts provoked increased levels of collagen types I and III, substantial changes in global gene expression, and accelerated degradation of matrix metalloproteinase-14. Intratracheal instillation of NEU1 encoding, but not control adenovirus, induced lymphocyte accumulation in bronchoalveolar lavage samples and lung tissues and elevations of pulmonary transforming growth factor-β and collagen. The lymphocytes were predominantly T cells, with CD8(+) cells exceeding CD4(+) cells by nearly twofold. These combined data indicate that elevated NEU1 expression alters functional activities of distinct lung cell types in vitro and recapitulates lymphocytic infiltration and collagen accumulation in vivo, consistent with mechanisms implicated in lung fibrosis.
Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris
Directory of Open Access Journals (Sweden)
Harindra E. Amarasinghe
2015-07-01
Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.
Epigenetic repression of male gametophyte-specific genes in the Arabidopsis sporophyte
DEFF Research Database (Denmark)
Hoffmann, Robert D; Palmgren, Michael Broberg
2013-01-01
Tissue formation, the identity of cells, and the functions they fulfill, are results of gene regulation. The male gametophyte of plants, pollen, is outstanding in this respect as several hundred genes expressed in pollen are not expressed in the sporophyte. How pollen-specific genes are down......-regulated in the sporophyte has yet to be established. In this study, we have performed a bioinformatics analysis of publicly available genome-wide epigenetics data of several sporophytic tissues. By combining this analysis with DNase I footprinting data, we assessed means by which the repression of pollen-specific genes...
Medapati, Rooth Vasantha; Suvvari, Sridevi; Godi, Sudhakar; Gangisetti, Paddaiah
2017-06-05
The aim of the present study was to evaluate the association of NRAMP1 -3'UTR, 274-CT,VDR- Fok1 VDR-Taq1 Polymorphisms with the risk of pulmonary tuberculosis. A case -control study was conducted on Andhra Pradesh Population of India. Analysis of gene polymorphisms of NRAMP1 gene (3'UTR, 274CT) and VDR gene (Fok1 and Taq1) was done by using Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in Tuberculosis (TB) patients and healthy controls. The obtained results were observed using 2% Agarose Gel electrophoresis and analysed statistically using Chi-square test and Odds Ratio. Statistical significance was observed between the patients and the controls in the NRAMP1-3'UTR (P = 0.005; OR = 2.997; 95% CI = 1.019-8.813) and VDR-Taq1 (P 0.05). 3'UTR-NRAMP1 gene and VDR-Taq1 gene Polymorphisms are statistically associated with the susceptibility of TB in Andhra Pradesh Population in India.
Kim, Suk-Man; Sohn, Jae-Keun
2005-08-31
This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.
Momper, L. M.; Magnabosco, C.; Amend, J.; Osburn, M. R.; Fournier, G. P.
2017-12-01
The marine and terrestrial subsurface biospheres represent quite likely the largest reservoirs for life on Earth, directly impacting surface processes and global cycles throughout Earth's history. In the deep subsurface biosphere (DSB) organic carbon and energy are often extremely scarce. However, archaea and bacteria are able to persist in the DSB to at least 3.5 km below surface [1]. Understanding how they persist, and by what metabolisms they subsist, are key questions in this biosphere. To address these questions we investigated 5 global DSB environments: one legacy mine in South Dakota, USA, 3 mines in South Africa and marine fluids circulating beneath the Juan de Fuca Ridge. Boreholes within these mines provided access to fluids buried beneath the earth's surface and sampled depths down to 3.1 km. Geochemical data were collected concomitantly with DNA for metagenomic sequencing. We examined genomes of the ancient and deeply branching Chloroflexi for metabolic capabilities and interrogated the geochemical drivers behind those metabolisms with in situ thermodynamic modeling of reaction energetics. In total, 23 Chloroflexi genomes were identified and analyzed from the 5 subsurface sites. Genes for nitrate reduction (nar) and sulfite reduction (dsr) were found in many of the South Africa Chloroflexi but were absent from genomes collected in South Dakota. Indeed, nitrate reduction was among the most energetically favorable reactions in South African fluids (10-14 kJ cell-1 sec -1 per mol of reactant) and sulfur reduction with Fe2+ or H2 was also exergonic [2]. Conversely, genes for nitrite and nitrous oxide reduction (nrf, nir and nos) were found in genomes collected in South Dakota and Juan de Fuca, but not South Africa. We examined the origin of genes conferring these metabolisms in the Chloroflexi genomes. We discovered evidence for horizontal gene transfer (HGT) for all of these putative metabolisms. Retention of these genes in Chloroflexi lineages indicates
Le Page, Yann; Menuet, Arnaud; Kah, Olivier; Pakdel, Farzad
2008-10-01
The cytochrome P450 Aromatase is the key enzyme catalyzing the conversion of androgens into estrogens. In zebrafish, the brain aromatase is encoded by cyp19b. Expression of cyp19b is restricted to radial glial cells bordering forebrain ventricles and is strongly stimulated by estrogens during development. At the promoter level, we have previously shown that an estrogen responsive element (ERE) is required for induction by estrogens. Here, we investigated the role of ERE flanking regions in the control of cell-specific expression. First, we show that a 20 bp length motif, named G x RE (glial x responsive element), acts in synergy with the ERE to mediate the estrogenic induction specifically in glial cells. Second, we demonstrate that, in vitro, this sequence binds factors exclusively present in glial or neuro-glial cells and is able to confer a glial specificity to an artificial estrogen-dependent gene. Taken together, these results contribute to the understanding of the molecular mechanisms allowing cyp19b regulation by estrogens and allowed to identify a promoter sequence involved in the strong estrogen inducibility of cyp19b which is specific for glial cells. The exceptional aromatase activity measured in the brain of teleost fish could rely on such mechanisms.
Directory of Open Access Journals (Sweden)
Gregory J Fox
Full Text Available Tuberculosis (TB is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results.To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam.Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451 under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860 and one with extra-pulmonary TB (rs10498244.SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection.
Fox, Gregory J; Sy, Dinh Ngoc; Nhung, Nguyen Viet; Yu, Bing; Ellis, Magda K; Van Hung, Nguyen; Cuong, Nguyen Kim; Thi Lien, Luu; Marks, Guy B; Saunders, Bernadette M; Britton, Warwick J
2014-01-01
Tuberculosis (TB) is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results. To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam. Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451) under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860) and one with extra-pulmonary TB (rs10498244). SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection.
Fox, Gregory J.; Sy, Dinh Ngoc; Nhung, Nguyen Viet; Yu, Bing; Ellis, Magda K.; Van Hung, Nguyen; Cuong, Nguyen Kim; Thi Lien, Luu; Marks, Guy B.; Saunders, Bernadette M.; Britton, Warwick J.
2014-01-01
Background Tuberculosis (TB) is an infectious disease that remains a major cause of morbidity and mortality worldwide, yet the reasons why only 10% of people infected with Mycobacterium tuberculosis go on to develop clinical disease are poorly understood. Genetically determined variation in the host immune response is one factor influencing the response to M. tuberculosis. SP110 is an interferon-responsive nuclear body protein with critical roles in cell cycling, apoptosis and immunity to infection. However association studies of the gene with clinical TB in different populations have produced conflicting results. Methods To examine the importance of the SP110 gene in immunity to TB in the Vietnamese we conducted a case-control genetic association study of 24 SP110 variants, in 663 patients with microbiologically proven TB and 566 unaffected control subjects from three tertiary hospitals in northern Vietnam. Results Five SNPs within SP110 were associated with all forms of TB, including four SNPs at the C terminus (rs10208770, rs10498244, rs16826860, rs11678451) under a dominant model and one SNP under a recessive model, rs7601176. Two of these SNPs were associated with pulmonary TB (rs10208770 and rs16826860) and one with extra-pulmonary TB (rs10498244). Conclusion SP110 variants were associated with increased susceptibility to both pulmonary and extra-pulmonary TB in the Vietnamese. Genetic variants in SP110 may influence macrophage signaling responses and apoptosis during M. tuberculosis infection, however further research is required to establish the mechanism by which SP110 influences immunity to tuberculosis infection. PMID:25006821
Pulmonary hypertension CT imaging
International Nuclear Information System (INIS)
Nedevska, A.
2013-01-01
Full text: The right heart catheterization is the gold standard in the diagnosis and determines the severity of pulmonary hypertension. The significant technical progress of noninvasive diagnostic imaging methods significantly improves the pixel density and spatial resolution in the study of cardiovascular structures, thus changes their role and place in the overall diagnostic plan. Learning points: What is the etiology, clinical manifestation and general pathophysiological disorders in pulmonary hypertension. What are the established diagnostic methods in the diagnosis and follow-up of patients with pulmonary hypertension. What is the recommended protocol for CT scanning for patients with clinically suspected or documented pulmonary hypertension. What are the important diagnostic findings in CT scan of a patient with pulmonary hypertension. Discussion: The prospect of instantaneous complex - anatomical and functional cardiopulmonary and vascular diagnostics seems extremely attractive. The contrast enhanced multislice computed (CT ) and magnetic resonance imaging are very suitable methods for imaging the structures of the right heart, with the possibility of obtaining multiple projections and three-dimensional imaging reconstructions . There are specific morphological features that, if carefully analyzed, provide diagnostic information. Thus, it is possible to avoid or at least reduce the frequency of use of invasive diagnostic cardiac catheterization in patients with pulmonary hypertension. Conclusion: This review focuses on the use of contrast-enhanced CT for comprehensive evaluation of patients with pulmonary hypertension and presents the observed characteristic changes in the chest, lung parenchyma , the structures of the right half of the heart and pulmonary vessels
Energy Technology Data Exchange (ETDEWEB)
Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)
1991-06-19
This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.
Heritable and lineage-specific gene knockdown in zebrafish embryo.
Directory of Open Access Journals (Sweden)
Mei Dong
Full Text Available BACKGROUND: Reduced expression of developmentally important genes and tumor suppressors due to haploinsufficiency or epigenetic suppression has been shown to contribute to the pathogenesis of various malignancies. However, methodology that allows spatio-temporally knockdown of gene expression in various model organisms such as zebrafish has not been well established, which largely limits the potential of zebrafish as a vertebrate model of human malignant disorders. PRINCIPAL FINDING: Here, we report that multiple copies of small hairpin RNA (shRNA are expressed from a single transcript that mimics the natural microRNA-30e precursor (mir-shRNA. The mir-shRNA, when microinjected into zebrafish embryos, induced an efficient knockdown of two developmentally essential genes chordin and alpha-catenin in a dose-controllable fashion. Furthermore, we designed a novel cassette vector to simultaneously express an intronic mir-shRNA and a chimeric red fluorescent protein driven by lineage-specific promoter, which efficiently reduced the expression of a chromosomally integrated reporter gene and an endogenously expressed gata-1 gene in the developing erythroid progenitors and hemangioblasts, respectively. SIGNIFICANCE: This methodology provides an invaluable tool to knockdown developmental important genes in a tissue-specific manner or to establish animal models, in which the gene dosage is critically important in the pathogenesis of human disorders. The strategy should be also applicable to other model organisms.
Li, Fangwei; Shi, Wenhua; Wan, Yixin; Wang, Qingting; Feng, Wei; Yan, Xin; Wang, Jian; Chai, Limin; Zhang, Qianqian; Li, Manxiang
2017-12-01
The expression of microRNA (miR)-140-5p is known to be reduced in both pulmonary arterial hypertension (PAH) patients and monocrotaline-induced PAH models in rat. Identification of target genes for miR-140-5p with bioinformatics analysis may reveal new pathways and connections in PAH. This study aimed to explore downstream target genes and relevant signaling pathways regulated by miR-140-5p to provide theoretical evidences for further researches on role of miR-140-5p in PAH. Multiple downstream target genes and upstream transcription factors (TFs) of miR-140-5p were predicted in the analysis. Gene ontology (GO) enrichment analysis indicated that downstream target genes of miR-140-5p were enriched in many biological processes, such as biological regulation, signal transduction, response to chemical stimulus, stem cell proliferation, cell surface receptor signaling pathways. Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis found that downstream target genes were mainly located in Notch, TGF-beta, PI3K/Akt, and Hippo signaling pathway. According to TF-miRNA-mRNA network, the important downstream target genes of miR-140-5p were PPI, TGF-betaR1, smad4, JAG1, ADAM10, FGF9, PDGFRA, VEGFA, LAMC1, TLR4, and CREB. After thoroughly reviewing published literature, we found that 23 target genes and seven signaling pathways were truly inhibited by miR-140-5p in various tissues or cells; most of these verified targets were in accordance with our present prediction. Other predicted targets still need further verification in vivo and in vitro .
The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.
Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans
2017-11-01
The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
18th edition of the Forum on specification and Design Languages Conference
Wille, Robert
2016-01-01
This book brings together a selection of the best papers from the eighteenth edition of the Forum on specification and Design Languages Conference (FDL), which took place on September 14-16, 2015, in Barcelona, Spain. FDL is a well-established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modeling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. Covers Assertion Based Design, Verification & Debug; Includes language-based modeling and design techniques for embedded systems; Covers design, modeling and verification of mixed physical domain and mixed signal systems that include significant analog parts in electrical and non-electrical domains; Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven Engineering...
17th edition of the Forum on specification and Design Languages Conference
Pasaje, Julio
2016-01-01
This book brings together a selection of the best papers from the seventeenth edition of the Forum on specification and Design Languages Conference (FDL), which took place on October 14-16, 2014, in Munich, Germany. FDL is a well-established international forum devoted to dissemination of research results, practical experiences and new ideas in the application of specification, design and verification languages to the design, modeling and verification of integrated circuits, complex hardware/software embedded systems, and mixed-technology systems. •Covers Assertion Based Design, Verification & Debug; •Includes language-based modeling and design techniques for embedded systems; •Covers design, modeling and verification of mixed physical domain and mixed signal systems; •Includes formal and semi-formal system level design methods for complex embedded systems based on the Unified Modelling Language (UML) and Model Driven Engineering (MDE); •Covers parallel architectures – both as platforms f...
Pulmonary thromboembolism in children
Energy Technology Data Exchange (ETDEWEB)
Babyn, Paul S.; Gahunia, Harpal K. [Hospital for Sick Children, Department of Pediatric Diagnostic Imaging, Toronto, ON (Canada); Massicotte, Patricia [Stollery Children' s Hospital and University of Alberta, Departments of Pediatric Hematology and Cardiology, Edmonton, AB (Canada)
2005-03-01
Pulmonary thromboembolism (PTE) is uncommonly diagnosed in the pediatric patient, and indeed often only discovered on autopsy. The incidence of pediatric PTE depends upon the associated underlying disease, diagnostic tests used, and index of suspicion. Multiple risk factors can be found including: peripartum asphyxia, dyspnea, haemoptysis, chest pain, dehydration, septicemia, central venous lines (CVLs), trauma, surgery, ongoing hemolysis, vascular lesions, malignancy, renal disease, foreign bodies or, uncommonly, intracranial venous sinus thrombosis, burns, or nonbacterial thrombotic endocarditis. Other types of embolism can occur uncommonly in childhood and need to be recognized, as the required treatment will vary. These include pulmonary cytolytic thrombi, foreign bodies, tumor and septic emboli, and post-traumatic fat emboli. No single noninvasive test for pulmonary embolism is both sensitive and specific. A combination of diagnostic procedures must be used to identify suspect or confirmed cases of PTE. This article reviews the risk factors, clinical presentation and treatment of pulmonary embolism in children. It also highlights the current diagnostic tools and protocols used to evaluate pulmonary embolism in pediatric patients. (orig.)
Pulmonary thromboembolism in children
International Nuclear Information System (INIS)
Babyn, Paul S.; Gahunia, Harpal K.; Massicotte, Patricia
2005-01-01
Pulmonary thromboembolism (PTE) is uncommonly diagnosed in the pediatric patient, and indeed often only discovered on autopsy. The incidence of pediatric PTE depends upon the associated underlying disease, diagnostic tests used, and index of suspicion. Multiple risk factors can be found including: peripartum asphyxia, dyspnea, haemoptysis, chest pain, dehydration, septicemia, central venous lines (CVLs), trauma, surgery, ongoing hemolysis, vascular lesions, malignancy, renal disease, foreign bodies or, uncommonly, intracranial venous sinus thrombosis, burns, or nonbacterial thrombotic endocarditis. Other types of embolism can occur uncommonly in childhood and need to be recognized, as the required treatment will vary. These include pulmonary cytolytic thrombi, foreign bodies, tumor and septic emboli, and post-traumatic fat emboli. No single noninvasive test for pulmonary embolism is both sensitive and specific. A combination of diagnostic procedures must be used to identify suspect or confirmed cases of PTE. This article reviews the risk factors, clinical presentation and treatment of pulmonary embolism in children. It also highlights the current diagnostic tools and protocols used to evaluate pulmonary embolism in pediatric patients. (orig.)
Park, Chang-Jin; Wei, Tong; Sharma, Rita; Ronald, Pamela C
2017-12-01
The rice immune receptor XA21 confers resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo). To elucidate the mechanism of XA21-mediated immunity, we previously performed a yeast two-hybrid screening for XA21 interactors and identified XA21 binding protein 21 (XB21). Here, we report that XB21 is an auxilin-like protein predicted to function in clathrin-mediated endocytosis. We demonstrate an XA21/XB21 in vivo interaction using co-immunoprecipitation in rice. Overexpression of XB21 in rice variety Kitaake and a Kitaake transgenic line expressing XA21 confers a necrotic lesion phenotype and enhances resistance to Xoo. RNA sequencing reveals that XB21 overexpression results in the differential expression of 8735 genes (4939 genes up- and 3846 genes down-regulated) (≥2-folds, FDR ≤0.01). The up-regulated genes include those predicted to be involved in 'cell death' and 'vesicle-mediated transport'. These results indicate that XB21 plays a role in the plant immune response and in regulation of cell death. The up-regulation of genes controlling 'vesicle-mediated transport' in XB21 overexpression lines is consistent with a functional role for XB21 as an auxilin.
International Nuclear Information System (INIS)
Anon.
1990-01-01
To determine the sensitivities and specificities of ventilation/perfusion lung scans for acute pulmonary embolism, a random sample of 933 of 1,493 patients was studied prospectively. Nine hundred thirty-one underwent scintigraphy and 755 underwent pulmonary angiography; 251 (33%) of 755 demonstrated pulmonary embolism. Almost all patients with pulmonary embolism had abnormal scans of high, intermediate, or low probability, but so did most without pulmonary embolism. Of 116 patients with high-probability scans and definitive angiograms, 102 (88%) had pulmonary embolism, but only a minority with pulmonary embolism had high-probability scans. Of 322 with intermediate-probability scans and definitive angiograms, 105 (33%) had pulmonary embolism. Follow-up and angiography together suggest pulmonary embolism occurred among 12% of patients with low-probability scans. Clinical assessment combined with the ventilation/perfusion scan established the diagnosis or exclusion of pulmonary embolism only for a minority of patients--those with clear and concordant clinical and ventilation/perfusion scan findings
Pulmonary Hypertension and Pulmonary Vasodilators.
Keller, Roberta L
2016-03-01
Pulmonary hypertension in the perinatal period can present acutely (persistent pulmonary hypertension of the newborn) or chronically. Clinical and echocardiographic diagnosis of acute pulmonary hypertension is well accepted but there are no broadly validated criteria for echocardiographic diagnosis of pulmonary hypertension later in the clinical course, although there are significant populations of infants with lung disease at risk for this diagnosis. Contributing cardiovascular comorbidities are common in infants with pulmonary hypertension and lung disease. It is not clear who should be treated without confirmation of pulmonary vascular disease by cardiac catheterization, with concurrent evaluation of any contributing cardiovascular comorbidities. Copyright © 2016 Elsevier Inc. All rights reserved.
Mondejar-Parreño, Gema; Callejo, María; Barreira, Bianca; Morales-Cano, Daniel; Esquivel-Ruiz, Sergio; Moreno, Laura; Cogolludo, Angel; Perez-Vizcaino, Francisco
2018-05-02
■The expression of miR-1 is increased in lungs from the Hyp/Su5416 PAH rat model. ■PASMC from this animal model are more depolarised and show decreased expression and activity of Kv1.5. ■miR-1 directly targets Kv1.5 channels, reduces Kv1.5 activity and induces membrane depolarization. ■Antagomir-1 prevents Kv1.5 channel downregulation and the depolarization induced by hypoxia/Su5416 exposition. Impairment of voltage-dependent potassium channel (Kv) plays a central role in the development of cardiovascular diseases, including pulmonary arterial hypertension (PAH). MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the 3'-UTR region of specific mRNAs. The aim of this study was to analyze the effects of miR-1 on Kv channel function in pulmonary arteries (PA). Kv channel activity was studied in PA from healthy animals transfected with miR-1 or scrambled-miR. Kv currents were studied using the whole-cell configuration of patch-clamp technique. The characterization of the Kv1.5 currents was performed with the selective inhibitor DPO-1. miR-1 expression was increased and Kv1.5 channels were decreased in lungs from a rat model of PAH induced by hypoxia and Su5416. miR-1 transfection increased cell capacitance, reduced Kv1.5 currents and induced membrane depolarization in isolated pulmonary artery smooth muscle cells (PASMCs). Luciferase reporter assay indicated that KCNA5, which encodes Kv1.5 channels, is a direct target gene of miR-1. Incubation of PA with Su5416 and hypoxia (3% O 2 ) increased miR-1 and induced a decline in Kv1.5 currents, which was prevented by antagomiR-1. In conclusion, these data indicate that miR-1 induces PASMC hypertrophy and reduces the activity and expression of Kv channels, suggesting a pathophysiological role in PAH. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Bromley, Susan; Vizcaya, David
2017-05-01
Childhood interstitial lung disease (chILD) comprises a wide heterogeneous group of rare parenchymal lung disorders associated with substantial morbidity and mortality. Pulmonary hypertension is a common comorbidity in adults with interstitial lung disease (ILD) and associated with poor survival. We aimed to systematically review the literature regarding the occurrence of pulmonary hypertension (PH) in chILD, its effect on prognosis and healthcare use, and its treatment in clinical practice. Searches of PubMed and EMBASE databases (up to February 2016), and American Thoracic Society conference abstracts (2009-2015) were conducted using relevant keywords. References from selected articles and review papers were scanned to identify further relevant articles. A total of 20 articles were included; estimates of PH in chILD ranged from 1% to 64% with estimates among specific chILD entities ranging from 0% to 43%. Comparisons between studies were limited by differences in the study populations, including the size, age range, and heterogeneous composition of the ILD case series in terms of the nature and severity of the clinical entities, and also the methods used to diagnose PH. Three studies found that among patients with chILD, those with PH had a significantly higher risk (up to sevenfold) of death compared with those without PH. Information on the treatment of pulmonary hypertension in chILD or the effect of PH on healthcare use was not available. Data on the use and effectiveness of treatments for pulmonary hypertension in chILD are required to address this area of unmet need. Pediatr Pulmonol. 2017;52:689-698. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Bloom, Chloe I; Graham, Christine M; Berry, Matthew P R; Rozakeas, Fotini; Redford, Paul S; Wang, Yuanyuan; Xu, Zhaohui; Wilkinson, Katalin A; Wilkinson, Robert J; Kendrick, Yvonne; Devouassoux, Gilles; Ferry, Tristan; Miyara, Makoto; Bouvry, Diane; Valeyre, Dominique; Dominique, Valeyre; Gorochov, Guy; Blankenship, Derek; Saadatian, Mitra; Vanhems, Phillip; Beynon, Huw; Vancheeswaran, Rama; Wickremasinghe, Melissa; Chaussabel, Damien; Banchereau, Jacques; Pascual, Virginia; Ho, Ling-Pei; Lipman, Marc; O'Garra, Anne
2013-01-01
New approaches to define factors underlying the immunopathogenesis of pulmonary diseases including sarcoidosis and tuberculosis are needed to develop new treatments and biomarkers. Comparing the blood transcriptional response of tuberculosis to other similar pulmonary diseases will advance knowledge of disease pathways and help distinguish diseases with similar clinical presentations. To determine the factors underlying the immunopathogenesis of the granulomatous diseases, sarcoidosis and tuberculosis, by comparing the blood transcriptional responses in these and other pulmonary diseases. We compared whole blood genome-wide transcriptional profiles in pulmonary sarcoidosis, pulmonary tuberculosis, to community acquired pneumonia and primary lung cancer and healthy controls, before and after treatment, and in purified leucocyte populations. An Interferon-inducible neutrophil-driven blood transcriptional signature was present in both sarcoidosis and tuberculosis, with a higher abundance and expression in tuberculosis. Heterogeneity of the sarcoidosis signature correlated significantly with disease activity. Transcriptional profiles in pneumonia and lung cancer revealed an over-abundance of inflammatory transcripts. After successful treatment the transcriptional activity in tuberculosis and pneumonia patients was significantly reduced. However the glucocorticoid-responsive sarcoidosis patients showed a significant increase in transcriptional activity. 144-blood transcripts were able to distinguish tuberculosis from other lung diseases and controls. Tuberculosis and sarcoidosis revealed similar blood transcriptional profiles, dominated by interferon-inducible transcripts, while pneumonia and lung cancer showed distinct signatures, dominated by inflammatory genes. There were also significant differences between tuberculosis and sarcoidosis in the degree of their transcriptional activity, the heterogeneity of their profiles and their transcriptional response to treatment.
A gene regulatory network armature for T-lymphocyte specification
Energy Technology Data Exchange (ETDEWEB)
Fung, Elizabeth-sharon [Los Alamos National Laboratory
2008-01-01
Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through which T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Directory of Open Access Journals (Sweden)
Kozmin Stanislav G
2005-06-01
Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.
Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard
2007-09-01
The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.
Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L
1996-12-01
The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.
MicroRNA mimicry blocks pulmonary fibrosis
Montgomery, Rusty L; Yu, Guoying; Latimer, Paul A; Stack, Christianna; Robinson, Kathryn; Dalby, Christina M; Kaminski, Naftali; van Rooij, Eva
2014-01-01
Over the last decade, great enthusiasm has evolved for microRNA (miRNA) therapeutics. Part of the excitement stems from the fact that a miRNA often regulates numerous related mRNAs. As such, modulation of a single miRNA allows for parallel regulation of multiple genes involved in a particular disease. While many studies have shown therapeutic efficacy using miRNA inhibitors, efforts to restore or increase the function of a miRNA have been lagging behind. The miR-29 family has gained a lot of attention for its clear function in tissue fibrosis. This fibroblast-enriched miRNA family is downregulated in fibrotic diseases which induces a coordinate increase of many extracellular matrix genes. Here, we show that intravenous injection of synthetic RNA duplexes can increase miR-29 levels in vivo for several days. Moreover, therapeutic delivery of these miR-29 mimics during bleomycin-induced pulmonary fibrosis restores endogenous miR-29 function whereby decreasing collagen expression and blocking and reversing pulmonary fibrosis. Our data support the feasibility of using miRNA mimics to therapeutically increase miRNAs and indicate miR-29 to be a potent therapeutic miRNA for treating pulmonary fibrosis. PMID:25239947
Amiodarone pulmonary toxicity: Case report
Directory of Open Access Journals (Sweden)
Vasić Nada
2014-01-01
Full Text Available Introduction. Amiodarone, an antiarrhythmic drug, which contains iodine compound, has a tendency to accumulate in some organs including the lungs. This is age, drug dosage and therapy duration dependent. Case Outline. We present a case of a 73-year-old man, a smoker, who was admitted as emergency case due to severe dyspnea, tachypnea with signs of cyanosis and respiratory insufficiency. Chest x-ray revealed bilateral diffuse pulmonary shadows in the middle and upper parts of the lungs, similar to those in tuberculosis. His illness history showed chronic obstructive pulmonary disease, arterial hypertension, and atrial fibrillation which has been treated with amiodarone for six years. Sputum smears were negative for mycobacteria, and by the diagnostic elimination method for specific, non-specific and malignant disease the diagnosis of amiodarone pulmonary toxicity was made. Fiberoptic bronchoscopy and pathohistological findings of bronchiolitis obliterans organizing pneumonia confirmed the diagnosis. As the first therapeutic approach, amiodarone therapy was stopped. Then, systemic therapy with methylprednisolone 21 (sodium succinate 40 mg i.v. daily during the first two weeks was initiated and continued with daily dose of methylprednisolone 30 mg orally during the next three months. The patient showed a marked subjective improvement during the first week, which was followed by the improvement of respiratory function and withdrawal of pulmonary changes with complete radiographic and CT resolution after eight months. Conclusion. Amiodarone pulmonary toxicity should be taken into consideration, especially in elderly patients with respiratory symptoms and pulmonary changes, even if only a low dose of amiodarone is administred over a longer time period.
Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.
2018-01-01
Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441
Gene expression in cardiac tissues from infants with idiopathic conotruncal defects
Directory of Open Access Journals (Sweden)
Lofland Gary K
2011-01-01
Full Text Available Abstract Background Tetralogy of Fallot (TOF is the most commonly observed conotruncal congenital heart defect. Treatment of these patients has evolved dramatically in the last few decades, yet a genetic explanation is lacking for the failure of cardiac development for the majority of children with TOF. Our goal was to perform genome wide analyses and characterize expression patterns in cardiovascular tissue (right ventricle, pulmonary valve and pulmonary artery obtained at the time of reconstructive surgery from 19 children with tetralogy of Fallot. Methods We employed genome wide gene expression microarrays to characterize cardiovascular tissue (right ventricle, pulmonary valve and pulmonary artery obtained at the time of reconstructive surgery from 19 children with TOF (16 idiopathic and three with 22q11.2 deletions and compared gene expression patterns to normally developing subjects. Results We detected a signal from approximately 26,000 probes reflecting expression from about half of all genes, ranging from 35% to 49% of array probes in the three tissues. More than 1,000 genes had a 2-fold change in expression in the right ventricle (RV of children with TOF as compared to the RV from matched control infants. Most of these genes were involved in compensatory functions (e.g., hypertrophy, cardiac fibrosis and cardiac dilation. However, two canonical pathways involved in spatial and temporal cell differentiation (WNT, p = 0.017 and Notch, p = 0.003 appeared to be generally suppressed. Conclusions The suppression of developmental networks may represent a remnant of a broad malfunction of regulatory pathways leading to inaccurate boundary formation and improper structural development in the embryonic heart. We suggest that small tissue specific genomic and/or epigenetic fluctuations could be cumulative, leading to regulatory network disruption and failure of proper cardiac development.
Institute of Scientific and Technical Information of China (English)
Hong-Jing Li; Xiang-Hua Li; Jing-Hua Xiao; Rod A. Wing; Shi-Ping Wang
2012-01-01
The rice disease resistance (R) gene Xa3/Xa26 (having also been named Xa3 and Xa26) against Xanthomonas oryzae pv.oryzae (Xoo),which causes bacterial blight disease,belongs to a multiple gene family clustered in chromosome 11 and is from an AA genome rice cultivar (Oryza sativa L.).This family encodes leucine-rich repeat (LRR) receptor kinasetype proteins.Here,we show that the orthologs (alleles) of Xa3/Xa26,Xa3/Xa26-2,and Xa3/Xa26-3,from wild Oryza species O.officinalis (CC genome) and O.minuta (BBCC genome),respectively,were also R genes against Xoo.Xa3/Xa26-2 and Xa3/Xa26-3 conferred resistance to 16 of the 18 Xoo strains examined.Comparative sequence analysis of the Xa3/Xa26 families in the two wild Oryza species showed that Xa3/Xa26-3 appeared to have originated from the CC genome of O.minuta.The predicted proteins encoded by Xa3/Xa26,Xa3/Xa26-2,and Xa3/Xa26-3 share 91-99% sequence identity and 94-99% sequence similarity.Transgenic plants carrying a single copy of Xa3/Xa26,Xa3/Xa26-2,or Xa3/Xa26-3,in the same genetic background,showed a similar resistance spectrum to a set of Xoo strains,although plants carrying Xa3/Xa26-2 or Xa3/Xa26-3 showed lower resistance levels than the plants carrying Xa3/Xa26.These results suggest that the Xa3/Xa26 locus predates the speciation of A and C genome,which is approximately 7.5 million years ago.Thus,the resistance specificity of this locus has been conserved for a long time.
Mechanisms of right heart disease in pulmonary hypertension (2017 Grover Conference Series).
Asosingh, Kewal; Erzurum, Serpil
2018-01-01
Current dogma is that pathological hypertrophy of the right ventricle is a direct consequence of pulmonary vascular remodeling. However, progression of right ventricle dysfunction is not always lung-dependent. Increased afterload caused by pulmonary vascular remodeling initiates the right ventricle hypertrophy, but determinants leading to adaptive or maladaptive hypertrophy and failure remain unknown. Ischemia in a hypertrophic right ventricle may directly contribute to right heart failure. Rapidly enlarging cardiomyocytes switch from aerobic to anaerobic energy generation resulting in cell growth under relatively hypoxic conditions. Cardiac muscle reacts to an increased afterload by over-activation of the sympathetic system and uncoupling and downregulation of β-adrenergic receptors. Recent studies suggest that β blocker therapy in PH is safe, well tolerated, and preserves right ventricle function and cardiac output by reducing right ventricular glycolysis. Fibrosis, an evolutionary conserved process in host defense and wound healing, is dysregulated in maladaptive cardiac tissue contributing directly to right ventricle failure. Despite several mechanisms having been suggested in right heart disease, the causes of maladaptive cardiac remodeling remain unknown and require further research.
International Nuclear Information System (INIS)
Skroch, P.
1987-05-01
In the first part of my thesis I show that the DNA element conferring glucocorticoid inducibility to the Mouse Mammary Tumor Virus (HRE) has enhancer properties. It activates a heterologous promoter - that of the β-globin gene, independently of distance, position and orientation. These properties however have to be regarded in relation to the remaining regulatory elements of the activated gene as the recombinants between HRE and the TK gene have demonstrated. In the second part of my thesis I investigated the biological significance of certain sequence motifs of the HRE, which are remarkable by their interaction with transacting factors or sequence homologies with other regulatory DNA elements. I could confirm the generally postulated modular structure of enhancers for the HRE and bring the relevance of the single subdomains for the function of the element into relationship. (orig.) [de
Directory of Open Access Journals (Sweden)
Hettne Kristina M
2013-01-01
Full Text Available Abstract Background Availability of chemical response-specific lists of genes (gene sets for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM, and that these can be used with gene set analysis (GSA methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human and 588 (mouse gene sets from the Comparative Toxicogenomics Database (CTD. We tested for significant differential expression (SDE (false discovery rate -corrected p-values Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the triazoles. We confirmed embryotoxic effects, and discriminated triazoles from other chemicals. Conclusions Gene set analysis with next-gen TM-derived chemical response-specific gene sets is a scalable method for identifying similarities in gene responses to other chemicals, from which one may infer potential mode of action and/or toxic effect.
Directory of Open Access Journals (Sweden)
Bingfu eGuo
2015-10-01
Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.
DEFF Research Database (Denmark)
Hansen, Kasper Lage; Hansen, Niclas Tue; Karlberg, Erik, Olof, Linnart
2008-01-01
to be overexpressed in the normal tissues where defects cause pathology. In contrast, cancer genes and complexes were not overexpressed in the tissues from which the tumors emanate. We specifically identified a complex involved in XY sex reversal that is testis-specific and down-regulated in ovaries. We also......Heritable diseases are caused by germ-line mutations that, despite tissuewide presence, often lead to tissue-specific pathology. Here, we make a systematic analysis of the link between tissue-specific gene expression and pathological manifestations in many human diseases and cancers. Diseases were...
Gene program-specific regulation of PGC-1{alpha} activity
DEFF Research Database (Denmark)
Schmidt, Søren F; Mandrup, Susanne
2011-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) coactivator 1 α (PGC-1α) activation coordinates induction of the hepatic fasting response through coactivation of numerous transcription factors and gene programs. In the June 15, 2011, issue of Genes & Development, Lustig and colleagues (pp....... 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...
Multidimensional fatigue in pulmonary hypertension: prevalence, severity and predictors
Tartavoulle, Todd M.; Karpinski, Aryn C.; Aubin, Andrew; Kluger, Benzi M.; Distler, Oliver; Saketkoo, Lesley Ann
2018-01-01
Pulmonary hypertension is a potentially fatal disease. Despite pharmacological advances in pulmonary hypertension, fatigue remains common in patients with pulmonary hypertension. A convenience sample of 120 participants at an international patient conference completed the Multidimensional Fatigue Inventory (MFI)-20 scale. Data on New York Heart Association Functional Class, body mass index, oxygen use and medication type/use were also collected. There was a high prevalence of “severe” to “very severe” fatigue for each dimension: General Fatigue (60%), Physical Fatigue (55.8%), Reduced Activity (41.7%), Reduced Motivation (32.5%) and Mental Fatigue (27.5%). The mean±sd overall MFI-20 score was 58±5.1. Dimensions with the highest averaged levels were General Fatigue (13.40±3.61), Physical Fatigue (13.23±3.67) and Reduced Activity (11.33±4.16). Body mass index correlated with higher fatigue scores. Phosphodiesterase inhibitor plus endothelin receptor antagonist combination negatively predicted General Fatigue, Physical Fatigue, Reduced Motivation and Reduced Activity. Triple therapy was a significant predictor of General Fatigue, Physical Fatigue and Reduced Activity. There were no significant predictors of Mental Fatigue. Multidimensional fatigue is common and severe in patients with pulmonary hypertension. Phosphodiesterase inhibitor plus endothelin receptor antagonist combination resulted in lower scores in most fatigue dimensions. Comprehensive assessment of fatigue should be considered in the clinical care of patients with pulmonary hypertension and clinical research to develop formal interventions that target this disabling symptom. PMID:29577043
Ovine model for studying pulmonary immune responses
International Nuclear Information System (INIS)
Joel, D.D.; Chanana, A.D.
1984-01-01
Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables
Ovine model for studying pulmonary immune responses
Energy Technology Data Exchange (ETDEWEB)
Joel, D.D.; Chanana, A.D.
1984-11-25
Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.
Acrolein - a pulmonary hazard.
Bein, Kiflai; Leikauf, George D
2011-09-01
Acrolein is a respiratory irritant that can be generated during cooking and is in environmental tobacco smoke. More plentiful in cigarette smoke than polycyclic aromatic hydrocarbons (PAH), acrolein can adduct tumor suppressor p53 (TP53) DNA and may contribute to TP53-mutations in lung cancer. Acrolein is also generated endogenously at sites of injury, and excessive breath levels (sufficient to activate metalloproteinases and increase mucin transcripts) have been detected in asthma and chronic obstructive pulmonary disease (COPD). Because of its reactivity with respiratory-lining fluid or cellular macromolecules, acrolein alters gene regulation, inflammation, mucociliary transport, and alveolar-capillary barrier integrity. In laboratory animals, acute exposures have lead to acute lung injury and pulmonary edema similar to that produced by smoke inhalation whereas lower concentrations have produced bronchial hyperreactivity, excessive mucus production, and alveolar enlargement. Susceptibility to acrolein exposure is associated with differential regulation of cell surface receptor, transcription factor, and ubiquitin-proteasome genes. Consequent to its pathophysiological impact, acrolein contributes to the morbidly and mortality associated with acute lung injury and COPD, and possibly asthma and lung cancer. Copyright © 2011 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
Panzenboeck, Adelheid; Winter, Max P; Schubert, Uwe; Voswinckel, Robert; Frey, Maria K; Jakowitsch, Johannes; Alimohammadi, Arman; Hobohm, Lukas; Mangold, Andreas; Bergmeister, Helga; Sibilia, Maria; Wagner, Erwin F; Mayer, Eckhard; Klepetko, Walter; Hoelzenbein, Thomas J; Preissner, Klaus T; Lang, Irene M
2015-01-01
Objective Restoration of patency is a natural target of vascular remodeling following venous thrombosis that involves vascular endothelial cells and smooth muscle cells as well as leukocytes. Acute pulmonary emboli usually resolve within six months. However, in some instances, thrombi transform into fibrous vascular obstructions, resulting in occlusion of the deep veins, or in chronic thromboembolic pulmonary hypertension (CTEPH). We proposed that dysregulated thrombus angiogenesis may contribute to thrombus persistence. Approach and Results Mice with an endothelial-cell-specific conditional deletion of vascular endothelial growth factor receptor 2/kinase insert domain protein receptor (VEGF-R2/Kdr) were utilized in a model of stagnant flow venous thrombosis closely resembling human deep vein thrombosis. Biochemical and functional analyses were performed on pulmonary endarterectomy specimens from patients with CTEPH, a human model of non-resolving venous thromboembolism. Endothelial cell-specific deletion of Kdr and subsequent ablation of thrombus vascularization delayed thrombus resolution. In accordance with these findings, organized human CTEPH thrombi were largely devoid of vascular structures. Several vessel-specific genes such as KDR, vascular endothelial cadherin and podoplanin were expressed at lower levels in white CTEPH thrombi than in organizing deep vein thrombi and organizing thrombi from aortic aneurysms. In addition, red CTEPH thrombi attenuated the angiogenic response induced by VEGF. Conclusions In the present work, we propose a mechanism of thrombus non-resolution demonstrating that endothelial cell-specific deletion of Kdr abates thrombus vessel formation, misguiding thrombus resolution. Medical conditions associated with the development of CTEPH may be compromising early thrombus angiogenesis. PMID:24526692
Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan
2013-12-01
Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.
Differential gene expression during Trypanosoma cruzi metacyclogenesis
Directory of Open Access Journals (Sweden)
Marco Aurelio Krieger
1999-09-01
Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.
Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas
2015-01-01
In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600
Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang
2018-01-01
The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
DEFF Research Database (Denmark)
Hersh, Craig P; Pillai, Sreekumar G; Zhu, Guohua
2010-01-01
to the identification of chronic obstructive pulmonary disease (COPD) susceptibility genes on chromosome 2q. METHODS: Within the chromosome 2q linkage region, 2,843 SNPs were genotyped in 806 COPD cases and 779 control subjects from Norway, and 2,484 SNPs were genotyped in 309 patients with severe COPD from...... the National Emphysema Treatment Trial and 330 community control subjects. Significant associations from the combined results across the two case-control studies were followed up in 1,839 individuals from 603 families from the International COPD Genetics Network (ICGN) and in 949 individuals from 127 families...
The genetics of chronic obstructive pulmonary disease
Directory of Open Access Journals (Sweden)
Silverman Edwin K
2001-01-01
Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a significant cause of global morbidity and mortality. Previous studies have shown that COPD aggregates in families, suggesting a genetic predisposition to airflow obstruction. Many candidate genes have been assessed, but the data are often conflicting. We review the genetic factors that predispose smokers to COPD and highlight the future role of genomic scans in identifying novel susceptibility genes.
Hettne, K.M.; Boorsma, A.; Dartel, D.A. van; Goeman, J.J.; Jong, E. de; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
BACKGROUND: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Hettne, K.M.; Boorsma, A.; Dartel, van D.A.M.; Goeman, J.J.; Jong, de E.; Piersma, A.H.; Stierum, R.H.; Kleinjans, J.C.; Kors, J.A.
2013-01-01
Background: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set
Candidate genes for COPD: current evidence and research
Directory of Open Access Journals (Sweden)
Kim WJ
2015-10-01
Full Text Available Woo Jin Kim,1 Sang Do Lee2 1Department of Internal Medicine and Environmental Health Center, Kangwon National University, Chuncheon, 2Department of Pulmonary and Critical Care Medicine, Clinical Research Center for Chronic Obstructive Airway Diseases, Asan Medical Center, University of Ulsan College of Medicine, Seoul, South Korea Abstract: COPD is a common complex disease characterized by progressive airflow limitation. Several genome-wide association studies (GWASs have discovered genes that are associated with COPD. Recently, candidate genes for COPD identified by GWASs include CHRNA3/5 (cholinergic nicotine receptor alpha 3/5, IREB2 (iron regulatory binding protein 2, HHIP (hedgehog-interacting protein, FAM13A (family with sequence similarity 13, member A, and AGER (advanced glycosylation end product–specific receptor. Their association with COPD susceptibility has been replicated in multiple populations. Since these candidate genes have not been considered in COPD, their pathological roles are still largely unknown. Herein, we review some evidences that they can be effective drug targets or serve as biomarkers for diagnosis or subtyping. However, more study is required to understand the functional roles of these candidate genes. Future research is needed to characterize the effect of genetic variants, validate gene function in humans and model systems, and elucidate the genes’ transcriptional and posttranscriptional regulatory mechanisms. Keywords: chronic obstructive pulmonary disease, genetics, genome-wide association study
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
A perpetual cascade of cytokines postirradiation leads to pulmonary fibrosis
International Nuclear Information System (INIS)
Rubin, Philip; Johnston, Carl J.; Williams, Jacqueline P.; McDonald, Sandra; Finkelstein, Jacob N.
1995-01-01
: These studies clearly demonstrate the early and persistent elevation of cytokine production following pulmonary irradiation. The temporal relationship between the elevation of specific cytokines and the histological and biochemical evidence of fibrosis serves to illustrate the continuum of response, which, we believe, underlies pulmonary radiation reactions and supports the concept of a perpetual cascade of cytokines produced immediately after irradiation, prompting collagen genes to turn on, and persisting until the expression of late effects becomes apparent pathologically and clinically
Radiographic findings in pulmonary hypertension from unresolved embolism
Energy Technology Data Exchange (ETDEWEB)
Woodruff, W.W. III; Hoeck, B.E.; Chitwood, W.R. Jr.; Lyerly, H.K.; Sabiston, D.C. Jr.; Chen, J.T.T.
1985-04-01
Pulmonary artery hypertension with chronic pulmonary embolism is an uncommon entity that is potentially treatable with pulmonary embolectomy. Although the classic radiographic features have been described, several recent investigators report a significant percentage of these patients with normal chest radiographs. In a series of 22 patients, no normal radiographs were seen. Findings included cardiomegaly (86.4%) with right-sided enlargement (68.4%), right descending pulmonary artery enlargement (54.5%), azygos vein enlargement (27.3%), mosaic oligemia (68.2%), chronic volume loss (27.3%), atelectasis and/or effusion (22.7%), and pleural thickening (13.6%). Good correlation with specific areas of diminished vascularity was seen on chest radiographs compared with pulmonary angiograms.
Radiographic findings in pulmonary hypertension from unresolved embolism
International Nuclear Information System (INIS)
Woodruff, W.W. III; Hoeck, B.E.; Chitwood, W.R. Jr.; Lyerly, H.K.; Sabiston, D.C. Jr.; Chen, J.T.T.
1985-01-01
Pulmonary artery hypertension with chronic pulmonary embolism is an uncommon entity that is potentially treatable with pulmonary embolectomy. Although the classic radiographic features have been described, several recent investigators report a significant percentage of these patients with normal chest radiographs. In a series of 22 patients, no normal radiographs were seen. Findings included cardiomegaly (86.4%) with right-sided enlargement (68.4%), right descending pulmonary artery enlargement (54.5%), azygos vein enlargement (27.3%), mosaic oligemia (68.2%), chronic volume loss (27.3%), atelectasis and/or effusion (22.7%), and pleural thickening (13.6%). Good correlation with specific areas of diminished vascularity was seen on chest radiographs compared with pulmonary angiograms
International Nuclear Information System (INIS)
Wallenborn, J. Grace; Schladweiler, Mette J.; Richards, Judy H.; Kodavanti, Urmila P.
2009-01-01
Biological mechanisms underlying the association between particulate matter (PM) exposure and increased cardiovascular health effects are under investigation. Water-soluble metals reaching systemic circulation following pulmonary exposure are likely exerting a direct effect. However, it is unclear whether specific PM-associated metals may be driving this. We hypothesized that exposure to equimolar amounts of five individual PM-associated metals would cause differential pulmonary and cardiac effects. We exposed male WKY rats (14 weeks old) via a single intratracheal instillation (IT) to saline or 1 μmol/kg body weight of zinc, nickel, vanadium, copper, or iron in sulfate form. Responses were analyzed 4, 24, 48, or 96 h after exposure. Pulmonary effects were assessed by bronchoalveolar lavage fluid levels of total cells, macrophages, neutrophils, protein, albumin, and activities of lactate dehydrogenase, γ-glutamyl transferase, and n-acetyl glucosaminidase. Copper induced earlier pulmonary injury/inflammation, while zinc and nickel produced later effects. Vanadium or iron exposure induced minimal pulmonary injury/inflammation. Zinc, nickel, or copper increased serum cholesterol, red blood cells, and white blood cells at different time points. IT of nickel and copper increased expression of metallothionein-1 (MT-1) in the lung. Zinc, nickel, vanadium, and iron increased hepatic MT-1 expression. No significant changes in zinc transporter-1 (ZnT-1) expression were noted in the lung or liver; however, zinc increased cardiac ZnT-1 at 24 h, indicating a possible zinc-specific cardiac effect. Nickel exposure induced an increase in cardiac ferritin 96 h after IT. This data set demonstrating metal-specific cardiotoxicity is important in linking metal-enriched anthropogenic PM sources with adverse health effects.
Bronchus-associated lymphoid tissue in pulmonary hypertension produces pathologic autoantibodies.
Colvin, Kelley L; Cripe, Patrick J; Ivy, D Dunbar; Stenmark, Kurt R; Yeager, Michael E
2013-11-01
Autoimmunity has long been associated with pulmonary hypertension. Bronchus-associated lymphoid tissue plays important roles in antigen sampling and self-tolerance during infection and inflammation. We reasoned that activated bronchus-associated lymphoid tissue would be evident in rats with pulmonary hypertension, and that loss of self-tolerance would result in production of pathologic autoantibodies that drive vascular remodeling. We used animal models, histology, and gene expression assays to evaluate the role of bronchus-associated lymphoid tissue in pulmonary hypertension. Bronchus-associated lymphoid tissue was more numerous, larger, and more active in pulmonary hypertension compared with control animals. We found dendritic cells in and around lymphoid tissue, which were composed of CD3(+) T cells over a core of CD45RA(+) B cells. Antirat IgG and plasma from rats with pulmonary hypertension decorated B cells in lymphoid tissue, resistance vessels, and adventitia of large vessels. Lymphoid tissue in diseased rats was vascularized by aquaporin-1(+) high endothelial venules and vascular cell adhesion molecule-positive vessels. Autoantibodies are produced in bronchus-associated lymphoid tissue and, when bound to pulmonary adventitial fibroblasts, change their phenotype to one that may promote inflammation. Passive transfer of autoantibodies into rats caused pulmonary vascular remodeling and pulmonary hypertension. Diminution of lymphoid tissue reversed pulmonary hypertension, whereas immunologic blockade of CCR7 worsened pulmonary hypertension and hastened its onset. Bronchus-associated lymphoid tissue expands in pulmonary hypertension and is autoimmunologically active. Loss of self-tolerance contributes to pulmonary vascular remodeling and pulmonary hypertension. Lymphoid tissue-directed therapies may be beneficial in treating pulmonary hypertension.
Directory of Open Access Journals (Sweden)
Pileggi Marcos
2001-01-01
Full Text Available An efficient method for constructing transgenic lettuce cultivars by Agrobacterium tumefaciens was described by Torres et al., 1993. In the present work, an improvement of the above procedure is described and applied to transform the cultivar Grand Rapids with a mutated P5CS gene. The major modifications were concerned with turning more practical the transformation and regeneration protocols. Also we tried to improve transformation steps by increasing injured area in explants and prolonging co-cultivation with Agrobacteria (in larger concentration. A more significant selective pressure was used against non-transformed plants and bacteria. In these work we were concerned to obtain T1 and T2 seeds. The P5CS gene codes for a delta¹-pyrroline-5-carboxylate synthetase, a bifunctional enzyme that catalyzes two steps of proline biosynthesis in plants (Zhang et al., 1995; Peng et al., 1996, while the mutated gene is insensitive to feedback inhibition by proline. The potential benefit of this gene is to confer water stress resistance (drought, salt, cold due to increased intracellular levels of proline that works like an osmoprotectant. In this work could obtain and characterize transgenic lettuce lineages which are resistant to freezing temperature.
Feng, Xue; Orellana, Gardenia; Myers, James; Karasev, Alexander V
2018-04-12
Recessive resistance to Bean common mosaic virus (BCMV) in common bean (Phaseolus vulgaris L.) is governed by four genes that include one strain-nonspecific helper gene bc-u, and three strain-specific genes bc-1, bc-2, and bc-3. The bc-3 gene was identified as an eIF4E translation initiation factor gene mediating resistance through disruption of the interaction between this protein and the VPg protein of the virus. The mode of action of bc-1 and bc-2 in expression of BCMV resistance is unknown, although bc-1 gene was found to affect systemic spread of a related potyvirus, Bean common mosaic necrosis virus. To investigate the possible role of both bc-1 and bc-2 genes in replication, cell-to-cell, and long distance movement of BCMV in P. vulgaris, we tested virus spread of eight BCMV isolates representing pathogroups I, IV, VI, VII, and VIII, in a set of bean differentials expressing different combinations of six resistance alleles including bc-u, bc-1, bc-1 2 , bc-2, bc-2 2 , and bc-3. All studied BCMV isolates were able to replicate and spread in inoculated leaves of bean cultivars harboring bc-u, bc-1, bc-1 2 , bc-2, and bc-2 2 alleles and their combinations, while no BCMV replication was found in inoculated leaves of 'IVT7214' carrying the bc-u, bc-2 and bc-3 genes, except for isolate 1755a capable of overcoming the resistance conferred by bc-2 and bc-3. In contrast, the systemic spread of all BCMV isolates from pathogroups I, IV,VI, VII, and VIII was impaired in common bean cultivars carrying bc-1, bc-1 2 , bc-2, and bc-2 2 alleles. The data suggest that bc-1 and bc-2 recessive resistance genes have no effect on the replication and cell-to-cell movement of BCMV, but affect systemic spread of BCMV in common bean. The BCMV resistance conferred by bc-1 and bc-2 and affecting systemic spread was found only partially effective when these two genes were expressed singly. The efficiency of the restriction of the systemic spread of the virus was greatly enhanced when
International Nuclear Information System (INIS)
Tiwari, Kirti Kumar; Chu, Chun; Couroucli, Xanthi; Moorthy, Bhagavatula; Lingappan, Krithika
2014-01-01
Highlights: • Caffeine at 0.05 mM decreases oxidative stress in hyperoxia. • Caffeine at 1 mM decreases cell viability, increases oxidative stress in hyperoxia. • Caffeine at 1 but not 0.05 mM, abrogates hyperoxia-induced G2/M arrest. - Abstract: Caffeine is used to prevent bronchopulmonary dysplasia (BPD) in premature neonates. Hyperoxia contributes to the development of BPD, inhibits cell proliferation and decreases cell survival. The mechanisms responsible for the protective effect of caffeine in pulmonary oxygen toxicity remain largely unknown. A549 and MLE 12 pulmonary epithelial cells were exposed to hyperoxia or maintained in room air, in the presence of different concentrations (0, 0.05, 0.1 and 1 mM) of caffeine. Caffeine had a differential concentration-specific effect on cell cycle progression, oxidative stress and viability, with 1 mM concentration being deleterious and 0.05 mM being protective. Reactive oxygen species (ROS) generation during hyperoxia was modulated by caffeine in a similar concentration-specific manner. Caffeine at 1 mM, but not at the 0.05 mM concentration decreased the G2 arrest in these cells. Taken together this study shows the novel funding that caffeine has a concentration-specific effect on cell cycle regulation, ROS generation, and cell survival in hyperoxic conditions
Energy Technology Data Exchange (ETDEWEB)
Tiwari, Kirti Kumar; Chu, Chun; Couroucli, Xanthi; Moorthy, Bhagavatula; Lingappan, Krithika, E-mail: lingappa@bcm.edu
2014-08-08
Highlights: • Caffeine at 0.05 mM decreases oxidative stress in hyperoxia. • Caffeine at 1 mM decreases cell viability, increases oxidative stress in hyperoxia. • Caffeine at 1 but not 0.05 mM, abrogates hyperoxia-induced G2/M arrest. - Abstract: Caffeine is used to prevent bronchopulmonary dysplasia (BPD) in premature neonates. Hyperoxia contributes to the development of BPD, inhibits cell proliferation and decreases cell survival. The mechanisms responsible for the protective effect of caffeine in pulmonary oxygen toxicity remain largely unknown. A549 and MLE 12 pulmonary epithelial cells were exposed to hyperoxia or maintained in room air, in the presence of different concentrations (0, 0.05, 0.1 and 1 mM) of caffeine. Caffeine had a differential concentration-specific effect on cell cycle progression, oxidative stress and viability, with 1 mM concentration being deleterious and 0.05 mM being protective. Reactive oxygen species (ROS) generation during hyperoxia was modulated by caffeine in a similar concentration-specific manner. Caffeine at 1 mM, but not at the 0.05 mM concentration decreased the G2 arrest in these cells. Taken together this study shows the novel funding that caffeine has a concentration-specific effect on cell cycle regulation, ROS generation, and cell survival in hyperoxic conditions.
Conservation and sex-specific splicing of the doublesex gene
Indian Academy of Sciences (India)
Genetic control of sex determination in insects has been best characterized in Drosophila melanogaster, where the master gene Sxl codes for RNA that is sex specifically spliced to produce a functional protein only in females. SXL regulates the sex-specific splicing of transformer (tra) RNA which, in turn, regulates the ...
Freedom of expression: cell-type-specific gene profiling.
Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H
2014-01-01
Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.
International conference on string theory
2017-01-01
The Strings 2017 conference is part of the "Strings" series of annual conferences, that bring the entire string theory community together. It will include reviews of major developments in the field, and specialized talks on specific topics. There will also be several public lectures given by conference participants, a pre-Strings school at the Technion, and a post-Strings workshop at the Weizmann Institute.
Directory of Open Access Journals (Sweden)
Vaiman Daniel
2005-05-01
Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological
2013-01-01
Background Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with gene set analysis (GSA) methods for chemical treatment identification, for pharmacological mechanism elucidation, and for comparing compound toxicity profiles. Methods We created 30,211 chemical response-specific gene sets for human and mouse by next-gen TM, and derived 1,189 (human) and 588 (mouse) gene sets from the Comparative Toxicogenomics Database (CTD). We tested for significant differential expression (SDE) (false discovery rate -corrected p-values sets and the CTD-derived gene sets in gene expression (GE) data sets of five chemicals (from experimental models). We tested for SDE of gene sets for six fibrates in a peroxisome proliferator-activated receptor alpha (PPARA) knock-out GE dataset and compared to results from the Connectivity Map. We tested for SDE of 319 next-gen TM-derived gene sets for environmental toxicants in three GE data sets of triazoles, and tested for SDE of 442 gene sets associated with embryonic structures. We compared the gene sets to triazole effects seen in the Whole Embryo Culture (WEC), and used principal component analysis (PCA) to discriminate triazoles from other chemicals. Results Next-gen TM-derived gene sets matching the chemical treatment were significantly altered in three GE data sets, and the corresponding CTD-derived gene sets were significantly altered in five GE data sets. Six next-gen TM-derived and four CTD-derived fibrate gene sets were significantly altered in the PPARA knock-out GE dataset. None of the fibrate signatures in cMap scored significant against the PPARA GE signature. 33 environmental toxicant gene sets were significantly altered in the triazole GE data sets. 21 of these toxicants had a similar toxicity pattern as the
Directory of Open Access Journals (Sweden)
Masaki Takahashi
2015-01-01
Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.
Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q
2014-01-01
Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.
Towards the identification of flower-specific genes in Citrus spp
Directory of Open Access Journals (Sweden)
Marcelo Carnier Dornelas
2007-01-01
Full Text Available Citrus sinensis is a perennial woody species, for which genetic approaches to the study of reproductive development are not readily amenable. Here, the usefulness of the CitEST Expressed Sequence Tag (EST database is demonstrated as a reliable new resource for identifying novel genes exclusively related to Citrus reproductive biology. We performed the analysis of an EST dataset of the CitEST Project containing 4,330 flower-derived cDNA sequences. Relying on bioinformatics tools, sequences exclusively present in this flower-derived sequence collection were selected and used for the identification of Citrus putative flower-specific genes. Our analysis revealed several Citrus sequences showing significant similarity to conserved genes known to have flower-specific expression and possessing functions related to flower metabolism and/or reproductive development in diverse plant species. Comparison of the Citrus flower-specific sequences with all available plant peptide sequences unraveled 247 unique transcripts not identified elsewhere within the plant kingdom. Additionally, 49 transcripts, for which no biological function could be attributed by means of sequence comparisons, were found to be conserved among plant species. These results allow further gene expression analysis and possibly novel approaches to the understanding of reproductive development in Citrus.
Analysis of cell-type-specific gene expression during mouse spermatogenesis
DEFF Research Database (Denmark)
Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser
2004-01-01
In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...
Do market participants learn from conference calls?
Roelofsen, E.; Verbeeten, F.; Mertens, G.
2014-01-01
We examine whether market participants learn from the information that is disseminated during the Q-and-A section of conference calls. Specifically, we investigate whether stock prices react to information on intangible assets provided during conference calls, and whether conference calls
Taroni, Jaclyn N; Greene, Casey S; Martyanov, Viktor; Wood, Tammara A; Christmann, Romy B; Farber, Harrison W; Lafyatis, Robert A; Denton, Christopher P; Hinchcliff, Monique E; Pioli, Patricia A; Mahoney, J Matthew; Whitfield, Michael L
2017-03-23
Systemic sclerosis (SSc) is a multi-organ autoimmune disease characterized by skin fibrosis. Internal organ involvement is heterogeneous. It is unknown whether disease mechanisms are common across all involved affected tissues or if each manifestation has a distinct underlying pathology. We used consensus clustering to compare gene expression profiles of biopsies from four SSc-affected tissues (skin, lung, esophagus, and peripheral blood) from patients with SSc, and the related conditions pulmonary fibrosis (PF) and pulmonary arterial hypertension, and derived a consensus disease-associate signature across all tissues. We used this signature to query tissue-specific functional genomic networks. We performed novel network analyses to contrast the skin and lung microenvironments and to assess the functional role of the inflammatory and fibrotic genes in each organ. Lastly, we tested the expression of macrophage activation state-associated gene sets for enrichment in skin and lung using a Wilcoxon rank sum test. We identified a common pathogenic gene expression signature-an immune-fibrotic axis-indicative of pro-fibrotic macrophages (MØs) in multiple tissues (skin, lung, esophagus, and peripheral blood mononuclear cells) affected by SSc. While the co-expression of these genes is common to all tissues, the functional consequences of this upregulation differ by organ. We used this disease-associated signature to query tissue-specific functional genomic networks to identify common and tissue-specific pathologies of SSc and related conditions. In contrast to skin, in the lung-specific functional network we identify a distinct lung-resident MØ signature associated with lipid stimulation and alternative activation. In keeping with our network results, we find distinct MØ alternative activation transcriptional programs in SSc-associated PF lung and in the skin of patients with an "inflammatory" SSc gene expression signature. Our results suggest that the innate immune
Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru
2017-12-01
The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.
Specific gene mutations induced by heavy ions
International Nuclear Information System (INIS)
Freeling, M.; Karoly, C.W.; Cheng, D.S.K.
1980-01-01
This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens
Directory of Open Access Journals (Sweden)
А. В. Богачев-Прокофьев
2016-01-01
Full Text Available Objective. Pulmonary hypertension impairs the mitral valve and often leads to more severe symptoms of heart failure, low exercise tolerance and thus higher rates of morbidity and mortality. The purpose of this study is to evaluate the safety and efficacy of simultaneous radiofrequency ablation of ganglionated plexi of the pulmonary artery in patients with high pulmonary hypertension during mitral valve surgery.Methods. The inclusion criteria were based on patients’ echocardiography/right heart catheterization data. The main criteria were mean pulmonary artery pressure ≥40 mm Hg at rest and a positive reactive test with nitric oxide inhalation. From January 2014 to May 2015, 14 patients underwent radiofrequency denervation of the pulmonary artery in addition to planned mitral valve surgery. Mean patient age was 53.4±7.8 years, with 57.1% of patients being females.Results. Mean cardiopulmonary bypass time was 116±12 minutes, mean cross-clamp time was 95±13 minutes, and mean ablation time amounted to 9.5±3.1 minutes. Pulmonary artery pressure decreased significantly from a mean of 56.5±9.8 mmHg to 32.0±7.3 mmHg immediately after the operation (p<0.001, and to 28.4±5.2 mmHg and 29.7±4.4 mmHg on the first and third days at ICU respectively. Mean ICU stay was 3.1±1.2 days. There were neither early deaths nor specific complications.Conclusions. Simultaneous radiofrequency ablation of pulmonary artery ganglionated plexi when performing mitral valve surgery in patients with pulmonary hypertension is a safe and effective procedure. Further research and long-term follow-up would help to determine whether a decrease in the mean pressure of the pulmonary artery can be interpreted as a clinical advantage.
International Nuclear Information System (INIS)
Hodson, J.; Graham, A.; Hughes, J.M.B.; Gibbs, J.S.R.; Jackson, J.E.
2006-01-01
AIM: To describe direct pulmonary artery-to-pulmonary artery anastomoses seen at pulmonary angiography in patients with chronic thromboembolic pulmonary hypertension and discuss their possible significance. MATERIALS AND METHODS: Between 1 August 2000 and 31 July 2004 43 patients (male-to-female ratio 25:18) with a diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH) underwent selective pulmonary angiography to assess the extent of disease and suitability for surgical pulmonary endarterectomy. The mean pulmonary artery pressure ranged from 27-84 mmHg (average of 51 mmHg). Selective bilateral digital subtraction pulmonary angiograms performed in all individuals were reviewed for the presence of intrapulmonary collaterals. RESULTS: In 15 of the 43 patients (male-to-female ratio =7:8) definite (n=12) or probable (n=3) pulmonary artery-to-pulmonary artery anastomoses were demonstrated. Of the remaining 28 patients in whom intrapulmonary collaterals were not seen it was felt that in 16 the angiograms were of insufficient diagnostic quality (grades 4-5) to exclude their presence. Twelve patients, eight of whom had angiograms of sufficient diagnostic quality (grades 1-3), demonstrated one or more areas of luxury perfusion but intrapulmonary collaterals were not seen. CONCLUSION: Direct pulmonary artery-to-pulmonary artery anastomoses were demonstrated in patients with chronic thromboembolic pulmonary hypertension, which to our knowledge have not been previously described. The importance of these collateral vessels is unclear but they may play a role in the maintenance of pulmonary parenchymal viability in patients with chronic pulmonary embolic disease. The rate of development of these collaterals and their prognostic significance in patients with chronic thromboembolic pulmonary hypertension are areas worthy of further study
Energy Technology Data Exchange (ETDEWEB)
Hodson, J. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Graham, A. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Hughes, J.M.B. [Department of Respiratory Medicine, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Gibbs, J.S.R. [Department of Cardiology, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom); Jackson, J.E. [Department of Imaging, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London (United Kingdom)]. E-mail: jejackson@hhnt.org
2006-03-15
AIM: To describe direct pulmonary artery-to-pulmonary artery anastomoses seen at pulmonary angiography in patients with chronic thromboembolic pulmonary hypertension and discuss their possible significance. MATERIALS AND METHODS: Between 1 August 2000 and 31 July 2004 43 patients (male-to-female ratio 25:18) with a diagnosis of chronic thromboembolic pulmonary hypertension (CTEPH) underwent selective pulmonary angiography to assess the extent of disease and suitability for surgical pulmonary endarterectomy. The mean pulmonary artery pressure ranged from 27-84 mmHg (average of 51 mmHg). Selective bilateral digital subtraction pulmonary angiograms performed in all individuals were reviewed for the presence of intrapulmonary collaterals. RESULTS: In 15 of the 43 patients (male-to-female ratio =7:8) definite (n=12) or probable (n=3) pulmonary artery-to-pulmonary artery anastomoses were demonstrated. Of the remaining 28 patients in whom intrapulmonary collaterals were not seen it was felt that in 16 the angiograms were of insufficient diagnostic quality (grades 4-5) to exclude their presence. Twelve patients, eight of whom had angiograms of sufficient diagnostic quality (grades 1-3), demonstrated one or more areas of luxury perfusion but intrapulmonary collaterals were not seen. CONCLUSION: Direct pulmonary artery-to-pulmonary artery anastomoses were demonstrated in patients with chronic thromboembolic pulmonary hypertension, which to our knowledge have not been previously described. The importance of these collateral vessels is unclear but they may play a role in the maintenance of pulmonary parenchymal viability in patients with chronic pulmonary embolic disease. The rate of development of these collaterals and their prognostic significance in patients with chronic thromboembolic pulmonary hypertension are areas worthy of further study.
SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.
Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan
2013-04-30
The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.
Injury, inflammation and the emergence of human specific genes
2016-07-12
genes in circulating and resident human immune cells can be studied in mice after the transplantation and engraft- ment of human hemato- lymphoid immune...Martinek J, Strowig T, Gearty SV, Teichmann LL, et al. Development and function of human innate immune cells in a humanized mouse model. Nat Bio...normal wound repair and regeneration, we hypothesize that the preponderance of human-specific genes expressed in human inflammatory cells is commensurate
Acrolein effects in pulmonary cells: relevance to chronic obstructive pulmonary disease.
Moretto, Nadia; Volpi, Giorgia; Pastore, Fiorella; Facchinetti, Fabrizio
2012-07-01
Acrolein (2-propenal) is a highly reactive α,β-unsaturated aldehyde and a respiratory irritant that is ubiquitously present in the environment but that can also be generated endogenously at sites of inflammation. Acrolein is abundant in tobacco smoke, which is the major environmental risk factor for chronic obstructive pulmonary disease (COPD), and elevated levels of acrolein are found in the lung fluids of COPD patients. Its high electrophilicity makes acrolein notorious for its facile reaction with biological nucleophiles, leading to the modification of proteins and DNA and depletion of antioxidant defenses. As a consequence, acrolein results in oxidative stress as well as altered intracellular signaling and gene transcription/translation. In pulmonary cells, acrolein, at subtoxic concentrations, can activate intracellular stress kinases, alter the production of inflammatory mediators and proteases, modify innate immune response, induce mucus hypersecretion, and damage airway epithelium. A better comprehension of the mechanisms underlying acrolein effects in the airways may suggest novel treatment strategies in COPD. © 2012 New York Academy of Sciences.
International Nuclear Information System (INIS)
Moss, R.B.; Hsu, Y.P.; Lewiston, N.J.
1981-01-01
We studied the incidence and levels of circulating immune complexes by the 125 I-Clq-binding assay in patients with cystic fibrosis in relation to clinical respiratory status and specific IgG and IgE antibodies to Pseudomonas aeruginosa. Staphylococcus aureus, Aspergillus fumigatus, and Candida albicans. Overall prevalence of CIC was 43%, but 86% of serially studied patients had evidence of CIC at some time. Patients with acute respiratory exacerbations and deteriorating pulmonary function had a higher incidence of CIC (76%) as compared to stable patients (36%, P less than 0.01), as well as significantly higher levels of CIC. Acute exacerbations were also associated with significant increases in IgG antibody to Pseudomonas (P less than 0.005) but not in other antibodies. CIC did not correlate with Pseudomonas-specific IgG nor with any other specific antibody studied. A variety of age-related differences in specific antibody levels were seen. The episodic appearance of CIC is common in CF and is usually associated with exacerbation of lung disease
Fibroblast growth factor 10 haploinsufficiency causes chronic obstructive pulmonary disease.
Klar, Joakim; Blomstrand, Peter; Brunmark, Charlott; Badhai, Jitendra; Håkansson, Hanna Falk; Brange, Charlotte Sollie; Bergendal, Birgitta; Dahl, Niklas
2011-10-01
Genetic factors influencing lung function may predispose to chronic obstructive pulmonary disease (COPD). The fibroblast growth factor 10 (FGF10) signalling pathway is critical for lung development and lung epithelial renewal. The hypothesis behind this study was that constitutive FGF10 insufficiency may lead to pulmonary disorder. Therefore investigation of the pulmonary functions of patients heterozygous for loss of function mutations in the FGF10 gene was performed. The spirometric measures of lung function from patients and non-carrier siblings were compared and both groups were related to matched reference data for normal human lung function. The patients show a significant decrease in lung function parameters when compared to control values. The average FEV1/IVC quota (FEV1%) for the patients is 0.65 (80% of predicted) and reversibility test using Terbutalin resulted in a 3.7% increase in FEV1. Patients with FGF10 haploinsufficiency have lung function parameters indicating COPD. A modest response to Terbutalin confirms an irreversible obstructive lung disease. These findings support the idea that genetic variants affecting the FGF10 signalling pathway are important determinants of lung function that may ultimately contribute to COPD. Specifically, the results show that FGF10 haploinsufficiency affects lung function measures providing a model for a dosage sensitive effect of FGF10 in the development of COPD.
Radiation-induced pulmonary gene expression changes are attenuated by the CTGF antibody Pamrevlumab.
Sternlicht, Mark D; Wirkner, Ute; Bickelhaupt, Sebastian; Lopez Perez, Ramon; Tietz, Alexandra; Lipson, Kenneth E; Seeley, Todd W; Huber, Peter E
2018-01-18
Fibrosis is a delayed side effect of radiation therapy (RT). Connective tissue growth factor (CTGF) promotes the development of fibrosis in multiple settings, including pulmonary radiation injury. To better understand the cellular interactions involved in RT-induced lung injury and the role of CTGF in these responses, microarray expression profiling was performed on lungs of irradiated and non-irradiated mice, including mice treated with the anti-CTGF antibody pamrevlumab (FG-3019). Between group comparisons (Welch's t-tests) and principal components analyses were performed in Genespring. At the mRNA level, the ability of pamrevlumab to prolong survival and ameliorate RT-induced radiologic, histologic and functional lung deficits was correlated with the reversal of a clear enrichment in mast cell, macrophage, dendritic cell and mesenchymal gene signatures. Cytokine, growth factor and matrix remodeling genes that are likely to contribute to RT pneumonitis and fibrosis were elevated by RT and attenuated by pamrevlumab, and likely contribute to the cross-talk between enriched cell-types in injured lung. CTGF inhibition had a normalizing effect on select cell-types, including immune cells not typically regarded as being regulated by CTGF. These results suggest that interactions between RT-recruited cell-types are critical to maintaining the injured state; that CTGF plays a key role in this process; and that pamrevlumab can ameliorate RT-induced lung injury in mice and may provide therapeutic benefit in other immune and fibrotic disorders.
K.M. Hettne (Kristina); J. Boorsma (Jeffrey); D.A.M. van Dartel (Dorien A M); J.J. Goeman (Jelle); E.C. de Jong (Esther); A.H. Piersma (Aldert); R.H. Stierum (Rob); J. Kleinjans (Jos); J.A. Kors (Jan)
2013-01-01
textabstractBackground: Availability of chemical response-specific lists of genes (gene sets) for pharmacological and/or toxic effect prediction for compounds is limited. We hypothesize that more gene sets can be created by next-generation text mining (next-gen TM), and that these can be used with
Role of nuclear medicine in pulmonary neoplastic processes
International Nuclear Information System (INIS)
Waxman, A.D.
1986-01-01
It has been demonstrated that the single most important factor in determining survival in patients with bronchogenic carcinoma is the extent of spread of metastasis from the primary lesion. This explains the extensive efforts in developing accurate staging tests for pulmonary tumors, both primary and metastatic, with special emphasis on the determination of pulmonary hilar and mediastinal spread of disease. Continued improvements in nuclear medicine instrumentation along with the development of tumor specific radiopharmaceuticals, as well as agents that have the capability of tracking tumor viability, have changed the orientation of scintigraphic techniques in the evaluation of pulmonary neoplastic processes. Gallium scintigraphy is no longer considered as a primary imaging modality in the staging of pulmonary tumors, and in most institutions has been replaced by computed tomography (CT) for this purpose. It has been demonstrated that gallium, relative to other imaging modalities, is a sensitive indicator of hilar spread of tumor. However, because of the normally high background activity within the sternum and spine, mediastinal abnormalities are poorly detected. Since most pulmonary tumors metastasize via regional nodes to the pulmonary hilum and then to the mediastinum, the high sensitivity for the detection of pulmonary hilar abnormalities and the high specificity for mediastinal lesion detection suggest that gallium scintigraphy is a valuable adjunctive test when used appropriately. Thallium 201 as a tumor agent is being studied by several institutions. Preliminary results indicate a high degree of sensitivity for the detection of pulmonary hilar and mediastinal lesions and there are early indications that thallium is a promising agent to evaluate tumor viability. 52 references
Heterozygous RTEL1 mutations are associated with familial pulmonary fibrosis.
Kannengiesser, Caroline; Borie, Raphael; Ménard, Christelle; Réocreux, Marion; Nitschké, Patrick; Gazal, Steven; Mal, Hervé; Taillé, Camille; Cadranel, Jacques; Nunes, Hilario; Valeyre, Dominique; Cordier, Jean François; Callebaut, Isabelle; Boileau, Catherine; Cottin, Vincent; Grandchamp, Bernard; Revy, Patrick; Crestani, Bruno
2015-08-01
Pulmonary fibrosis is a fatal disease with progressive loss of respiratory function. Defective telomere maintenance leading to telomere shortening is a cause of pulmonary fibrosis, as mutations in the telomerase component genes TERT (reverse transcriptase) and TERC (RNA component) are found in 15% of familial pulmonary fibrosis (FPF) cases. However, so far, about 85% of FPF remain genetically uncharacterised.Here, in order to identify new genetic causes of FPF, we performed whole-exome sequencing, with a candidate-gene approach, of 47 affected subjects from 35 families with FPF without TERT and TERC mutations.We identified heterozygous mutations in regulator of telomere elongation helicase 1 (RTEL1) in four families. RTEL1 is a DNA helicase with roles in DNA replication, genome stability, DNA repair and telomere maintenance. The heterozygous RTEL1 mutations segregated as an autosomal dominant trait in FPF, and were predicted by structural analyses to severely affect the function and/or stability of RTEL1. In agreement with this, RTEL1-mutated patients exhibited short telomeres in comparison with age-matched controls.Our results provide evidence that heterozygous RTEL1 mutations are responsible for FPF and, thereby, extend the clinical spectrum of RTEL1 deficiency. Thus, RTEL1 enlarges the number of telomere-associated genes implicated in FPF. Copyright ©ERS 2015.
Pulmonary alveolar microlithiasis. A review including ultrastructural and pulmonary function studies
International Nuclear Information System (INIS)
Prakash, U.B.; Barham, S.S.; Rosenow, E.C.; Brown, M.L.; Payne, W.S.
1983-01-01
Pulmonary alveolar microlithiasis is a rare disease of unknown cause in which calcium phosphate microliths are deposited throughout the lungs. These deposits are of sufficient density to be almost diagnostic on chest roentgenograms. The Mayo Clinic experience with 8 patients is added to the approximately 120 cases reported in the world literature. The age range of all patients is from newborn to 80 years, with a mean age at diagnosis of about 35 years. No sexual predominance has been noted, but in about half of the reported cases a familial pattern has been found. The progression of the disease is generally very slow, some patients having been followed up for more than 30 years without evidence of change. No specific treatment is available. Pulmonary function studies demonstrate a tendency toward a restrictive pattern. Technetium-99m scanning and scanning and transmission electron microscopy are useful procedures for analysis of pulmonary alveolar microliths
Ahmad, Aftab; Niwa, Yasuo; Goto, Shingo; Ogawa, Takeshi; Shimizu, Masanori; Suzuki, Akane; Kobayashi, Kyoko; Kobayashi, Hirokazu
2015-01-01
An activation-tagging methodology was applied to dedifferentiated calli of Arabidopsis to identify new genes involved in salt tolerance. This identified salt tolerant callus 8 (stc8) as a gene encoding the basic helix-loop-helix transcription factor bHLH106. bHLH106-knockout (KO) lines were more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. Back-transformation of the KO line rescued its phenotype, and over-expression (OX) of bHLH106 in differentiated plants exhibited tolerance to NaCl. Green fluorescent protein (GFP) fused with bHLH106 revealed that it was localized to the nucleus. Prepared bHLH106 protein was subjected to electrophoresis mobility shift assays against E-box sequences (5'-CANNTG-3'). The G-box sequence 5'-CACGTG-3' had the strongest interaction with bHLH106. bHLH106-OX lines were transcriptomically analyzed, and resultant up- and down-regulated genes selected on the criterion of presence of a G-box sequence. There were 198 genes positively regulated by bHLH106 and 36 genes negatively regulated; these genes possessed one or more G-box sequences in their promoter regions. Many of these genes are known to be involved in abiotic stress response. It is concluded that bHLH106 locates at a branching point in the abiotic stress response network by interacting directly to the G-box in genes conferring salt tolerance on plants.
Walsh, Thomas J; Wissel, Mark C; Grantham, Kevin J; Petraitiene, Ruta; Petraitis, Vidmantas; Kasai, Miki; Francesconi, Andrea; Cotton, Margaret P; Hughes, Johanna E; Greene, Lora; Bacher, John D; Manna, Pradip; Salomoni, Martin; Kleiboeker, Steven B; Reddy, Sushruth K
2011-12-01
Diagnosis of invasive pulmonary aspergillosis (IPA) remains a major challenge to clinical microbiology laboratories. We developed rapid and sensitive quantitative PCR (qPCR) assays for genus- and species-specific identification of Aspergillus infections by use of TaqMan technology. In order to validate these assays and understand their potential diagnostic utility, we then performed a blinded study of bronchoalveolar lavage (BAL) fluid specimens from well-characterized models of IPA with the four medically important species. A set of real-time qPCR primers and probes was developed by utilizing unique ITS1 regions for genus- and species-specific detection of the four most common medically important Aspergillus species (Aspergillus fumigatus, A. flavus, A. niger, and A. terreus). Pan-Aspergillus and species-specific qPCRs with BAL fluid were more sensitive than culture for detection of IPA caused by A. fumigatus in untreated (P < 0.0007) and treated (P ≤ 0.008) animals, respectively. For infections caused by A. terreus and A. niger, culture and PCR amplification from BAL fluid yielded similar sensitivities for untreated and treated animals. Pan-Aspergillus PCR was more sensitive than culture for detection of A. flavus in treated animals (P = 0.002). BAL fluid pan-Aspergillus and species-specific PCRs were comparable in sensitivity to BAL fluid galactomannan (GM) assay. The copy numbers from the qPCR assays correlated with quantitative cultures to determine the pulmonary residual fungal burdens in lung tissue. Pan-Aspergillus and species-specific qPCR assays may improve the rapid and accurate identification of IPA in immunocompromised patients.
2012 Gordon Research Conference, Mitochondria and Chloroplasts, July 29 - Aug 3 2012
Energy Technology Data Exchange (ETDEWEB)
Barkan, Alice [Univ. of Oregon, Eugene, OR (United States)
2012-08-03
The 2012 Gordon Research Conference on Mitochondria and Chloroplasts will assemble an international group of scientists investigating fundamental properties of these organelles, and their integration into broader physiological processes. The conference will emphasize the many commonalities between mitochondria and chloroplasts: their evolution from bacterial endosymbionts, their genomes and gene expression systems, their energy transducing membranes whose proteins derive from both nuclear and organellar genes, the challenge of maintaining organelle integrity in the presence of the reactive oxygen species that are generated during energy transduction, their incorporation into organismal signaling pathways, and more. The conference will bring together investigators working in animal, plant, fungal and protozoan systems who specialize in cell biology, genetics, biochemistry, physiology, proteomics, genomics, and structural biology. As such, this conference will provide a unique forum that engenders cross-disciplinary discussions concerning the biogenesis, dynamics, and regulation of these key cellular structures. By fostering interactions among mammalian, fungal and plant organellar biologists, this conference also provides a conduit for the transmission of mechanistic insights obtained in model organisms to applications in medicine and agriculture. The 2012 conference will highlight areas that are moving rapidly and emerging themes. These include new insights into the ultrastructure and organization of the energy transducing membranes, the coupling of organellar gene expression with the assembly of photosynthetic and respiratory complexes, the regulatory networks that couple organelle biogenesis with developmental and physiological signals, the signaling events through which organellar physiology influences nuclear gene expression, and the roles of organelles in disease and development.
Energy Technology Data Exchange (ETDEWEB)
Schmit, M.; Vogel, W.; Horger, M.
2006-09-15
There are diverse etiologies of diffuse pulmonary hemorrhage, so specific diagnosis may be difficult. Conventional radiography tends to be misleading as hemoptysis may lacking in patients with hemorrhagic anemia. Diffuse pulmonary hemorrhage should be differentiated from focal pulmonary hemorrhage resulting from chronic bronchitis, bronchiectasis, active infection (tuberculosis) neoplasia, trauma, or embolism. (orig.)
ACR Appropriateness Criteria® Suspected Pulmonary Hypertension.
Sirajuddin, Arlene; Donnelly, Edwin F; Crabtree, Traves P; Henry, Travis S; Iannettoni, Mark D; Johnson, Geoffrey B; Kazerooni, Ella A; Maldonado, Fabien; Olsen, Kathryn M; Wu, Carol C; Mohammed, Tan-Lucien; Kanne, Jeffrey P
2017-05-01
Pulmonary hypertension may be idiopathic or related to a large variety of diseases. Various imaging examinations that may be helpful in diagnosing and determining the etiology of pulmonary hypertension are discussed. Imaging examinations that may aid in the diagnosis of pulmonary hypertension include chest radiography, ultrasound echocardiography, ventilation/perfusion scans, CT, MRI, right heart catheterization, pulmonary angiography, and fluorine-18-2-fluoro-2-deoxy-d-glucose PET/CT. The American College of Radiology Appropriateness Criteria are evidence-based guidelines for specific clinical conditions that are reviewed annually by a multidisciplinary expert panel. The guideline development and revision include an extensive analysis of current medical literature from peer reviewed journals and the application of well-established methodologies (RAND/UCLA Appropriateness Method and Grading of Recommendations Assessment, Development, and Evaluation or GRADE) to rate the appropriateness of imaging and treatment procedures for specific clinical scenarios. In those instances where evidence is lacking or equivocal, expert opinion may supplement the available evidence to recommend imaging or treatment. Copyright © 2017 American College of Radiology. Published by Elsevier Inc. All rights reserved.
The Writing Conference as Performance.
Newkirk, Thomas
1995-01-01
Provides an overview of the conversational roles taken on by students and teachers during college-level writing conferences. Uses the performative theory of Erving Goffman to analyze these role patterns. Illuminates the specific performative demands presented by writing conferences on both students and teachers. (HB)
Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie
2013-12-01
Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Qi, Feng-jie; Zhang, Xiu-wei; Zhang, Yong-xing; Dai, Shun-dong; Wang, En-hua
2006-05-01
To study the clonality of polygonal cells and surface cuboidal cells in the so-called pulmonary sclerosing hemangioma (PSH). 17 female surgically resected PSH were found. The polygonal cells and surface cuboidal cells of the 17 PSH cases were microdissected from routine hematoxylin and eosin-stained sections. Genomic DNA was extracted, pretreated through incubation with methylation-sensitive restrictive endonuclease HhaI or HpaII, and amplified by nested polymerase chain reaction for X chromosome-linked androgen receptor (AR) and phosphoglycerate kinase (PGK) genes. The length polymorphism of AR gene was demonstrated by denaturing polyacrylamide gel electrophoresis and silver staining. The PGK gene products were treated with Bst XI and resolved on agarose gel. Amongst the 17 female cases of PSH, 15 samples were successfully amplified for AR and PGK genes. The rates of polymorphism were 53% (8/15) and 27% (4/15) for AR and PGK genes respectively. Polygonal cells and surface cuboidal cells of 10 cases which were suitable for clonality study, showed the same loss of alleles (clonality ratio = 0) or unbalanced methylation pattern (clonality ratio < 0.25). The polygonal cells and surface cuboidal cells in PSH demonstrate patterns of monoclonal proliferation, indicating that both represent true neoplastic cells.
Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.
Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis
2017-06-08
A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.
The Critical Role of Pulmonary Arterial Compliance in Pulmonary Hypertension
Prins, Kurt W.; Pritzker, Marc R.; Scandurra, John; Volmers, Karl; Weir, E. Kenneth
2016-01-01
The normal pulmonary circulation is a low-pressure, high-compliance system. Pulmonary arterial compliance decreases in the presence of pulmonary hypertension because of increased extracellular matrix/collagen deposition in the pulmonary arteries. Loss of pulmonary arterial compliance has been consistently shown to be a predictor of increased mortality in patients with pulmonary hypertension, even more so than pulmonary vascular resistance in some studies. Decreased pulmonary arterial compliance causes premature reflection of waves from the distal pulmonary vasculature, leading to increased pulsatile right ventricular afterload and eventually right ventricular failure. Evidence suggests that decreased pulmonary arterial compliance is a cause rather than a consequence of distal small vessel proliferative vasculopathy. Pulmonary arterial compliance decreases early in the disease process even when pulmonary artery pressure and pulmonary vascular resistance are normal, potentially enabling early diagnosis of pulmonary vascular disease, especially in high-risk populations. With the recognition of the prognostic importance of pulmonary arterial compliance, its impact on right ventricular function, and its contributory role in the development and progression of distal small-vessel proliferative vasculopathy, pulmonary arterial compliance is an attractive target for the treatment of pulmonary hypertension. PMID:26848601
Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel
2013-08-01
Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to
Hominoid-specific de novo protein-coding genes originating from long non-coding RNAs.
Directory of Open Access Journals (Sweden)
Chen Xie
2012-09-01
Full Text Available Tinkering with pre-existing genes has long been known as a major way to create new genes. Recently, however, motherless protein-coding genes have been found to have emerged de novo from ancestral non-coding DNAs. How these genes originated is not well addressed to date. Here we identified 24 hominoid-specific de novo protein-coding genes with precise origination timing in vertebrate phylogeny. Strand-specific RNA-Seq analyses were performed in five rhesus macaque tissues (liver, prefrontal cortex, skeletal muscle, adipose, and testis, which were then integrated with public transcriptome data from human, chimpanzee, and rhesus macaque. On the basis of comparing the RNA expression profiles in the three species, we found that most of the hominoid-specific de novo protein-coding genes encoded polyadenylated non-coding RNAs in rhesus macaque or chimpanzee with a similar transcript structure and correlated tissue expression profile. According to the rule of parsimony, the majority of these hominoid-specific de novo protein-coding genes appear to have acquired a regulated transcript structure and expression profile before acquiring coding potential. Interestingly, although the expression profile was largely correlated, the coding genes in human often showed higher transcriptional abundance than their non-coding counterparts in rhesus macaque. The major findings we report in this manuscript are robust and insensitive to the parameters used in the identification and analysis of de novo genes. Our results suggest that at least a portion of long non-coding RNAs, especially those with active and regulated transcription, may serve as a birth pool for protein-coding genes, which are then further optimized at the transcriptional level.
Capparelli, Ignacio; Fernandez, Martín; Saadia Otero, Marcela; Steimberg, Jimena; Brassesco, María; Campobasso, Ana; Palacios, Sandra; Caro, Fabian; Alberti, María Laura; Rabinovich, Roberto A; Paulin, Francisco
2018-02-01
Interstitial lung disease (ILD) is associated with low exercise tolerance, dyspnea, and decreased health-related quality of life (HRQL). Idiopathic pulmonary fibrosis (IPF) is one of the most prevalent in the group. A specific version of the Saint George's questionnaire (SGRQ-I) has been developed to quantify the HRQL of IPF patients. However, this tool is not currently validated in the Spanish language. The objective was to translate into Spanish and validate the specific Saint George's Respiratory Questionnaire for idiopathic pulmonary fibrosis (SGRQ-I). The repeatability, internal consistency and construct validity of the SGRQ-I in Spanish were analyzed after a backtranslation process. In total, 23 outpatients with IPF completed the translated SGRQ-I twice, 7 days apart. Repeatability was studied, revealing good concordance in test-retest with an ICC (interclass correlation coefficient) of 0.96 (P<.001). Internal consistency was good for different questionnaire items (Cronbach's alpha of 0.9 including and 0.81 excluding the total value) (P<.001). The total score of the questionnaire showed good correlation with forced vital capacity FVC% (r=-0.44; P=.033), diffusing capacity of the lungs for carbon monoxide (DL CO %) (r=-0.55; P=.011), partial pressure of oxygen in arterial blood PaO 2 (r=-0.44; P=.036), Medical Research Council Dyspnea scale (r=-0.65; P<.001), and number of steps taken in 24hours (r=-0.47; P=.024). The Spanish version of SGRQ-Ideveloped by our group shows good internal consistency, reproducibility and validity, so it can be used for the evaluation of quality of life (QOL) in IPF patients. Copyright © 2017 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.
Directory of Open Access Journals (Sweden)
Audrey S Chang
2010-10-01
Full Text Available The Bateson-Dobzhansky-Muller model posits that hybrid incompatibilities result from genetic changes that accumulate during population divergence. Indeed, much effort in recent years has been devoted to identifying genes associated with hybrid incompatibilities, often with limited success, suggesting that hybrid sterility and inviability are frequently caused by complex interactions between multiple loci and not by single or a small number of gene pairs. Our previous study showed that the nature of epistasis between sterility-conferring QTL in the Drosophila persimilis-D. pseudoobscura bogotana species pair is highly specific. Here, we further dissect one of the three QTL underlying hybrid male sterility between these species and provide evidence for multiple factors within this QTL. This result indicates that the number of loci thought to contribute to hybrid dysfunction may have been underestimated, and we discuss how linkage and complex epistasis may be characteristic of the genetics of hybrid incompatibilities. We further pinpoint the location of one locus that confers hybrid male sterility when homozygous, dubbed "mule-like", to roughly 250 kilobases.
Chang, Audrey S; Bennett, Sarah M; Noor, Mohamed A F
2010-10-27
The Bateson-Dobzhansky-Muller model posits that hybrid incompatibilities result from genetic changes that accumulate during population divergence. Indeed, much effort in recent years has been devoted to identifying genes associated with hybrid incompatibilities, often with limited success, suggesting that hybrid sterility and inviability are frequently caused by complex interactions between multiple loci and not by single or a small number of gene pairs. Our previous study showed that the nature of epistasis between sterility-conferring QTL in the Drosophila persimilis-D. pseudoobscura bogotana species pair is highly specific. Here, we further dissect one of the three QTL underlying hybrid male sterility between these species and provide evidence for multiple factors within this QTL. This result indicates that the number of loci thought to contribute to hybrid dysfunction may have been underestimated, and we discuss how linkage and complex epistasis may be characteristic of the genetics of hybrid incompatibilities. We further pinpoint the location of one locus that confers hybrid male sterility when homozygous, dubbed "mule-like", to roughly 250 kilobases.
Isolation of two tissue-specific Drosophila paired box genes, Pox meso and Pox neuro.
Bopp, D; Jamet, E; Baumgartner, S; Burri, M; Noll, M
1989-01-01
Two new paired domain genes of Drosophila, Pox meso and Pox neuro, are described. In contrast to the previously isolated paired domain genes, paired and gooseberry, which contain both a paired and a homeo-domain (PHox genes), Pox meso and Pox neuro possess no homeodomain. Evidence suggesting that the new genes encode tissue-specific transcriptional factors and belong to the same regulatory cascade as the other paired domain genes includes (i) tissue-specific expression of Pox meso in the soma...
Directory of Open Access Journals (Sweden)
Lijuan Guo
Full Text Available Chronic thromboembolic pulmonary hypertension (CTEPH is a progressive disease characterized by misguided thrombolysis and remodeling of pulmonary arteries. MicroRNAs are small non-coding RNAs involved in multiple cell processes and functions. During CTEPH, circulating microRNA profile endued with characteristics of diseased cells could be identified as a biomarker, and might help in recognition of pathogenesis. Thus, in this study, we compared the differentially expressed microRNAs in plasma of CTEPH patients and healthy controls and investigated their potential functions. Microarray was used to identify microRNA expression profile and qRT-PCR for validation. The targets of differentially expressed microRNAs were identified in silico, and the Gene Ontology database and Kyoto Encyclopedia of Genes and Genomes pathway database were used for functional investigation of target gene profile. Targets of let-7b were validated by fluorescence reporter assay. Protein expression of target genes was determined by ELISA or western blotting. Cell migration was evaluated by wound healing assay. The results showed that 1 thirty five microRNAs were differentially expressed in CTEPH patients, among which, a signature of 17 microRNAs, which was shown to be related to the disease pathogenesis by in silico analysis, gave diagnostic efficacy of both sensitivity and specificity >0.9. 2 Let-7b, one of the down-regulated anti-oncogenic microRNAs in the signature, was validated to decrease to about 0.25 fold in CTEPH patients. 3 ET-1 and TGFBR1 were direct targets of let-7b. Altering let-7b level influenced ET-1 and TGFBR1 expression in pulmonary arterial endothelial cells (PAECs as well as the migration of PAECs and pulmonary arterial smooth muscle cells (PASMCs. These results suggested that CTEPH patients had aberrant microRNA signature which might provide some clue for pathogenesis study and biomarker screening. Reduced let-7b might be involved in the pathogenesis of
Guo, Lijuan; Yang, Yuanhua; Liu, Jie; Wang, Lei; Li, Jifeng; Wang, Ying; Liu, Yan; Gu, Song; Gan, Huili; Cai, Jun; Yuan, Jason X.-J.; Wang, Jun; Wang, Chen
2014-01-01
Chronic thromboembolic pulmonary hypertension (CTEPH) is a progressive disease characterized by misguided thrombolysis and remodeling of pulmonary arteries. MicroRNAs are small non-coding RNAs involved in multiple cell processes and functions. During CTEPH, circulating microRNA profile endued with characteristics of diseased cells could be identified as a biomarker, and might help in recognition of pathogenesis. Thus, in this study, we compared the differentially expressed microRNAs in plasma of CTEPH patients and healthy controls and investigated their potential functions. Microarray was used to identify microRNA expression profile and qRT-PCR for validation. The targets of differentially expressed microRNAs were identified in silico, and the Gene Ontology database and Kyoto Encyclopedia of Genes and Genomes pathway database were used for functional investigation of target gene profile. Targets of let-7b were validated by fluorescence reporter assay. Protein expression of target genes was determined by ELISA or western blotting. Cell migration was evaluated by wound healing assay. The results showed that 1) thirty five microRNAs were differentially expressed in CTEPH patients, among which, a signature of 17 microRNAs, which was shown to be related to the disease pathogenesis by in silico analysis, gave diagnostic efficacy of both sensitivity and specificity >0.9. 2) Let-7b, one of the down-regulated anti-oncogenic microRNAs in the signature, was validated to decrease to about 0.25 fold in CTEPH patients. 3) ET-1 and TGFBR1 were direct targets of let-7b. Altering let-7b level influenced ET-1 and TGFBR1 expression in pulmonary arterial endothelial cells (PAECs) as well as the migration of PAECs and pulmonary arterial smooth muscle cells (PASMCs). These results suggested that CTEPH patients had aberrant microRNA signature which might provide some clue for pathogenesis study and biomarker screening. Reduced let-7b might be involved in the pathogenesis of CTEPH by
Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.
Directory of Open Access Journals (Sweden)
Quan Li
Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.
Ferreira, Juan José; Campa, Ana; Pérez-Vega, Elena; Rodríguez-Suárez, Cristina; Giraldez, Ramón
2012-03-01
Anthracnose and bean common mosaic (BCM) are considered major diseases in common bean crop causing severe yield losses worldwide. This work describes the introgression and pyramiding of genes conferring genetic resistance to BCM and anthracnose local races into line A25, a bean genotype classified as market class fabada. Resistant plants were selected using resistance tests or combining resistance tests and marker-assisted selection. Lines A252, A321, A493, Sanilac BC6-Are, and BRB130 were used as resistance sources. Resistance genes to anthracnose (Co-2 ( C ), Co-2 ( A252 ) and Co-3/9) and/or BCM (I and bc-3) were introgressed in line A25 through six parallel backcrossing programs, and six breeding lines showing a fabada seed phenotype were obtained after six backcross generations: line A1258 from A252; A1231 from A321; A1220 from A493; A1183 and A1878 from Sanilac BC6-Are; and line A2418 from BRB130. Pyramiding of different genes were developed using the pedigree method from a single cross between lines obtained in the introgression step: line A1699 (derived from cross A1258 × A1220), A2438 (A1220 × A1183), A2806 (A1878 × A2418), and A3308 (A1699 × A2806). A characterization based on eight morpho-agronomic traits revealed a limited differentiation among the obtained breeding lines and the recurrent line A25. However, using a set of seven molecular markers linked to the loci used in the breeding programs it was possible to differentiate the 11 fabada lines. Considering the genetic control of the resistance in resistant donor lines, the observed segregations in the last backcrossing generation, the reaction against the pathogens, and the expression of the molecular markers it was also possible to infer the genotype conferring resistance in the ten fabada breeding lines obtained. As a result of these breeding programs, genetic resistance to three anthracnose races controlled by genes included in clusters Co-2 and Co-3/9, and genetic resistance to BCM controlled
Kano, Akihito; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Satoh, Masaru; Fukumoto, Takeshi; Ohtani, Kouhei; Tajima, Shigeyuki; Izumori, Ken; Tanaka, Keiji; Ishida, Yutaka; Tada, Yasuomi; Nishizawa, Yoko; Akimitsu, Kazuya
2010-01-01
We investigated responses of rice plant to three rare sugars, d-altrose, d-sorbose, and d-allose, due to establishment of mass production methods for these rare sugars. Root growth and shoot growth were significantly inhibited by d-allose but not by the other rare sugars. A large-scale gene expression analysis using a rice microarray revealed that d-allose treatment causes a high upregulation of many defense-related, pathogenesis-related (PR) protein genes in rice. The PR protein genes were not upregulated by other rare sugars. Furthermore, d-allose treatment of rice plants conferred limited resistance of the rice against the pathogen Xanthomonas oryzae pv. oryzae but the other tested sugars did not. These results indicate that d-allose has a growth inhibitory effect but might prove to be a candidate elicitor for reducing disease development in rice.
Conferences as a Dramaturgical Learning Space
DEFF Research Database (Denmark)
Hansen, Nicoline Jacoby
Arguing that conferences are an important but under-researched and under-developed dimension of continuing education, the paper proposes a notion of conferences as a dramatic learning space. Using the design-based research methodology, a theoretical framework drawing on adult learning theories...... and dramaturgy is developed, consisting of four design principles: rhythm, reflection, involvement and interaction. These are sought implemented in a specific conference program, the case of the ECCI X conference, and the final program is explained and discussed....
Pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis
Energy Technology Data Exchange (ETDEWEB)
Chung, Myung Jin; Goo, Jin Mo E-mail: jmgoo@plaza.snu.ac.kr; Im, Jung-Gi
2004-11-01
Objectives: Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk of pulmonary tuberculosis. However, detecting pulmonary tuberculosis may be difficult due to the underlying fibrosis. The aim of this report is to describe the radiological and clinical findings of pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis. Materials and methods: We reviewed 143 consecutive patients in whom IPF was diagnosed by either the histological or radio-clinical criteria. Among them, nine patients were histologically (n=2) or bacteriologically (n=7) confirmed to have active pulmonary tuberculosis. The location and patterns of pulmonary tuberculosis were examined on a thin section CT scan. Results: The most common thin section CT findings were subpleural nodules (n=6; mean diameter, 3.2 cm) and a lobar or segmental consolidation (n=3). The lesions were located most commonly in the right lower lobe (n=4). The incidence of tuberculosis in patients with idiopathic pulmonary fibrosis was more than five times higher than that of the general population. Conclusion: The atypical manifestation of pulmonary tuberculosis is common in patients with idiopathic pulmonary fibrosis, which may mimic lung cancer or bacterial pneumonia.
Pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis
International Nuclear Information System (INIS)
Chung, Myung Jin; Goo, Jin Mo; Im, Jung-Gi
2004-01-01
Objectives: Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk of pulmonary tuberculosis. However, detecting pulmonary tuberculosis may be difficult due to the underlying fibrosis. The aim of this report is to describe the radiological and clinical findings of pulmonary tuberculosis in patients with idiopathic pulmonary fibrosis. Materials and methods: We reviewed 143 consecutive patients in whom IPF was diagnosed by either the histological or radio-clinical criteria. Among them, nine patients were histologically (n=2) or bacteriologically (n=7) confirmed to have active pulmonary tuberculosis. The location and patterns of pulmonary tuberculosis were examined on a thin section CT scan. Results: The most common thin section CT findings were subpleural nodules (n=6; mean diameter, 3.2 cm) and a lobar or segmental consolidation (n=3). The lesions were located most commonly in the right lower lobe (n=4). The incidence of tuberculosis in patients with idiopathic pulmonary fibrosis was more than five times higher than that of the general population. Conclusion: The atypical manifestation of pulmonary tuberculosis is common in patients with idiopathic pulmonary fibrosis, which may mimic lung cancer or bacterial pneumonia
Evans, Christopher M.; Fingerlin, Tasha E.; Schwarz, Marvin I.; Lynch, David; Kurche, Jonathan; Warg, Laura; Yang, Ivana V.; Schwartz, David A.
2016-01-01
Idiopathic pulmonary fibrosis (IPF) is an incurable complex genetic disorder that is associated with sequence changes in 7 genes (MUC5B, TERT, TERC, RTEL1, PARN, SFTPC, and SFTPA2) and with variants in at least 11 novel loci. We have previously found that 1) a common gain-of-function promoter variant in MUC5B rs35705950 is the strongest risk factor (genetic and otherwise), accounting for 30-35% of the risk of developing IPF, a disease that was previously considered idiopathic; 2) the MUC5B promoter variant can potentially be used to identify individuals with preclinical pulmonary fibrosis and is predictive of radiologic progression of preclinical pulmonary fibrosis; and 3) MUC5B may be involved in the pathogenesis of pulmonary fibrosis with MUC5B message and protein expressed in bronchiolo-alveolar epithelia of IPF and the characteristic IPF honeycomb cysts. Based on these considerations, we hypothesize that excessive production of MUC5B either enhances injury due to reduced mucociliary clearance or impedes repair consequent to disruption of normal regenerative mechanisms in the distal lung. In aggregate, these novel considerations should have broad impact, resulting in specific etiologic targets, early detection of disease, and novel biologic pathways for use in the design of future intervention, prevention, and mechanistic studies of IPF. PMID:27630174
Evolving Concepts of Pulmonary Hypertension Secondary to Left Heart Disease.
Ramu, Bhavadharini; Thenappan, Thenappan
2016-04-01
Pulmonary hypertension associated with left heart disease is the most common form of pulmonary hypertension. Although its pathophysiology remains incompletely understood, it is now well recognized that the presence of pulmonary hypertension is associated with a worse prognosis. Right ventricular failure has independent and additive prognostic value over pulmonary hypertension for adverse outcomes in left heart disease. Recently, several new terminologies have been introduced to better define and characterize the nature and severity of pulmonary hypertension. Several new treatment options including the use of pulmonary arterial hypertension specific therapies are being considered, but there is lack of evidence. Here, we review the recent advances in this field and summarize the diagnostic and therapeutic modalities of use in the management of pulmonary hypertension associated with left heart disease.
Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi
2017-01-01
Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or
Allele-specific gene expression in a wild nonhuman primate population
Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.
2015-01-01
Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779
Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong
2014-01-01
Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.
Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B
2017-11-24
Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.
Directory of Open Access Journals (Sweden)
Yushin Yazaki
2015-04-01
Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.
Kassir, Yona
2017-01-01
Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.
Humphry, M.; Reinstädler, A.; Ivanov, S.; Bisseling, T.; Panstruga, R.
2011-01-01
Loss-of-function alleles of plant-specific MLO (Mildew Resistance Locus O) genes confer broad-spectrum powdery mildew resistance in monocot (barley) and dicot (Arabidopsis thaliana, tomato) plants. Recessively inherited powdery mildew resistance in pea (Pisum sativum) er1 plants is, in many aspects,
CERN automatic audio-conference service
Sierra Moral, R
2009-01-01
Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first Euro...
CERN automatic audio-conference service
Sierra Moral, R
2010-01-01
Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first Euro...
Update on chronic thromboembolic pulmonary hypertension.
Robbins, Ivan M; Pugh, Meredith E; Hemnes, Anna R
2017-01-01
Chronic, unresolved thromboemboli are an important cause of pulmonary hypertension (PH) with specific treatment strategies differing from other types of PH. Chronic thromboembolic pulmonary hypertension (CTEPH) is classified as group 4 PH by the World Health Organization. It is a rare, but underdiagnosed, complication of acute pulmonary embolism that does not resolve and results in occlusion of large pulmonary arteries with a fibro-thrombotic material. The etiology of CTEPH remains uncertain, and it is unknown why certain patients with acute pulmonary embolism develop this disorder. The evaluation for CTEPH is an important part of the evaluation for PH in general, and it is crucial not to overlook this diagnosis, as it is the only form of PH that is potentially curable. Patients diagnosed with CTEPH should be referred to an expert center for consideration of pulmonary endarterectomy, and surgical removal of the chronic thromboembolic material. Not all patients with CTEPH are surgical candidates, however, and there are emerging treatments-medical therapy and balloon pulmonary angioplasty-that have shown benefit in this patient population. Without treatment, CTEPH can lead to progressive pulmonary vascular obstruction, right heart failure, and death. Thus, it is important for clinicians to recognize this subtype of PH. In this review, we provide an overview of current understanding of the pathogenesis of CTEPH and highlight recommendations and recent advances in the evaluation and treatment of CTEPH. Copyright © 2016 Elsevier Inc. All rights reserved.
The radiographic findings in diagnosis of pulmonary lymphoma
International Nuclear Information System (INIS)
Song Wei; Wang Li; Yan Hongzhen
2001-01-01
Objective: To study the radiographic findings in the diagnosis of pulmonary lymphoma and pseudo lymphoma. Methods: Eight patients with pulmonary lymphoma and 2 with pseudo lymphoma were examined by X-ray film, tomography, and CT. Results: Single or multiple nodules or masses were observed in 8 patients with pulmonary lymphoma, shaggy borders or halo of ground-glass attenuation in 7 patients, 2 patients had multiple patchy infiltrates bilaterally, 2 had diffuse interstitial infiltrates and 1 had miliary nodules. Multiple consolidations with air bronchogram and without hilar and mediastinal lymphadenopathy were observed in 2 patients with pulmonary pseudo lymphoma. Conclusion: Radiographic findings of pulmonary lymphoma were varied, the most common findings were the nodules or masses with shaggy borders or halo of ground-glass attenuation. The specific findings of pulmonary pseudo lymphoma were multiple consolidations with air bronchogram and without hilar and mediastinal lymphadenopathy. The final diagnosis relied on pathology
Effect of collagen type IV, MMPs and TIMPs on remodeling of radiation pulmonary injury
International Nuclear Information System (INIS)
Diao Ruiying; Song Liangwen; Wang Shaoxia; Yin Jiye
2007-01-01
Objective: To explore the effect of collagen type IV, matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs(TIMPs) on early remodeling after radiation pulmonary injury. Methods: Right lungs of rats were irradiated by 60 Co γ-rays at a dose of 20 Gy to induce radiation pulmonary injury, and the lung specimens were taken at weeks 1, 2, 4 after irradiation. Quantitative analysis was performed on pulmonary collagen type IV, MMP-2, MMP-9, TIMP-2, TIMP-1 at the level of gene expression and protein synthesis using real-time PCR or immunohistochemistry. Results: Gene detection using real-time PCR: gene expression of collagen type IV increased at week 1 and decreased at week 2 after irradiation; MMP-2 reached peak at week 2 in which an opposed alteration trend was displayed; MMP-9 appeared a significant trend of elevation, then decrease and elevation again which was similar to those of collagen type IV; expression of TIMP-1 was lower, and there was no marked difference among all time points; TIMP-2 displayed a trend of slight elevation, then decrease and elevation again, which was opposed to MMP-2. Immunohistochemistry-image analysis: Pulmonary collagen type IV obviously increased at week 1, and began to decrease at week 2; MMP-2 decreased at week 2 and then increased; an opposed alteration trend to that of collagen type IV was displayed; alteration trend of MMP-9 was similar to that of collagen type IV but the extent was higher; gene expression of TIMP-1 slightly increased at 2 week and an opposed trend to of MMP-9 was displayed. Conclusions: Collagen type IV, MMP-2, MMP-9 and their tissue inhibitors were involved in ineffective remodeling in the early radiation pulmonary injury; MMP-2 and MMP-9 play an important role in degradation of collagen type IV; Disturbance of collagen type IV degradation might have relationship with the initiation of pulmonary fibrosis. (authors)
Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah
2012-06-01
Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.
Inference of cancer-specific gene regulatory networks using soft computing rules.
Wang, Xiaosheng; Gotoh, Osamu
2010-03-24
Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Pulmonary capillary haemangiomatosis: a rare cause of pulmonary hypertension.
Babu, K Anand; Supraja, K; Singh, Raj B
2014-01-01
Pulmonary capillary haemangiomatosis (PCH) is a rare disorder of unknown aetiology, characterised by proliferating capillaries that invade the pulmonary interstitium, alveolar septae and the pulmonary vasculature. It is often mis-diagnosed as primary pulmonary hypertension and pulmonary veno-occlusive disease. Pulmonary capillary haemangiomatosis is a locally aggressive benign vascular neoplasm of the lung. We report the case of a 19-year-old female who was referred to us in the early post-partum period with severe pulmonary artery hypertension, which was diagnosed as PCH by open lung biopsy.
[Role of MRI for detection and characterization of pulmonary nodules].
Sommer, G; Koenigkam-Santos, M; Biederer, J; Puderbach, M
2014-05-01
Due to physical and technical limitations, magnetic resonance imaging (MRI) has hitherto played only a minor role in image-based diagnostics of the lungs. However, as a consequence of important methodological developments during recent years, MRI has developed into a technically mature and clinically well-proven method for specific pulmonary questions. The purpose of this article is to provide an overview on the currently available sequences and techniques for assessment of pulmonary nodules and analyzes the clinical significance according to the current literature. The main focus is on the detection of lung metastases, the detection of primary pulmonary malignancies in high-risk individuals and the differentiation between pulmonary nodules of benign and malignant character. The MRI technique has a sensitivity of approximately 80 % for detection of malignant pulmonary nodules compared to the reference standard low-dose computed tomography (CT) and is thus somewhat inferior to CT. Advantages of MRI on the other hand are a higher specificity in differentiating malignant and benign pulmonary nodules and the absence of ionizing radiation exposure. A systematic use of MRI as a primary tool for detection and characterization of pulmonary nodules is currently not recommended due to insufficient data. The diagnostic potential of MRI for early detection and staging of malignant pulmonary diseases, however, seems promising. Therefore, further evaluation of MRI as a secondary imaging modality in clinical trials is highly warranted.
The α and Δ isoforms of CREB1 are required to maintain normal pulmonary vascular resistance.
Directory of Open Access Journals (Sweden)
Lili Li
Full Text Available Chronic hypoxia causes pulmonary hypertension associated with structural alterations in pulmonary vessels and sustained vasoconstriction. The transcriptional mechanisms responsible for these distinctive changes are unclear. We have previously reported that CREB1 is activated in the lung in response to alveolar hypoxia but not in other organs. To directly investigate the role of α and Δ isoforms of CREB1 in the regulation of pulmonary vascular resistance we examined the responses of mice in which these isoforms of CREB1 had been inactivated by gene mutation, leaving only the β isoform intact (CREB(αΔ mice. Here we report that expression of CREB regulated genes was altered in the lungs of CREB(αΔ mice. CREB(αΔ mice had greater pulmonary vascular resistance than wild types, both basally in normoxia and following exposure to hypoxic conditions for three weeks. There was no difference in rho kinase mediated vasoconstriction between CREB(αΔ and wild type mice. Stereological analysis of pulmonary vascular structure showed characteristic wall thickening and lumen reduction in hypoxic wild-type mice, with similar changes observed in CREB(αΔ. CREB(αΔ mice had larger lungs with reduced epithelial surface density suggesting increased pulmonary compliance. These findings show that α and Δ isoforms of CREB1 regulate homeostatic gene expression in the lung and that normal activity of these isoforms is essential to maintain low pulmonary vascular resistance in both normoxic and hypoxic conditions and to maintain the normal alveolar structure. Interventions that enhance the actions of α and Δ isoforms of CREB1 warrant further investigation in hypoxic lung diseases.
Indeterminate Pulmonary Nodules at Colorectal Cancer Staging
DEFF Research Database (Denmark)
Nordholm-Carstensen, Andreas; Wille-Jørgensen, Peer A; Jorgensen, Lars N
2013-01-01
This study aimed to estimate the prevalence of indeterminate pulmonary nodules and specific radiological and clinical characteristics that predict malignancy of these at initial staging chest computed tomography (CT) in patients with colorectal cancer. A considerable number of indeterminate...... pulmonary nodules, which cannot readily be classified as either benign or malignant, are detected at initial staging chest CT in colorectal cancer patients....
Directory of Open Access Journals (Sweden)
Weissmann Norbert
2005-11-01
Full Text Available Abstract Background The aim of the study was to assess the chronic effects of combined phosphodiesterase 3/4 inhibitor tolafentrine, administered by inhalation, during monocrotaline-induced pulmonary arterial hypertension (PAH in rats. Methods CD rats were given a single subcutaneous injection of monocrotaline to induce PAH. Four weeks after, rats were subjected to inhalation of tolafentrine or sham nebulization in an unrestrained, whole body aerosol exposure system. In these animals (i the acute pulmonary vasodilatory efficacy of inhaled tolafentrine (ii the anti-remodeling effect of long-term inhalation of tolafentrine (iii the effects of tolafentrine on the expression profile of 96 genes encoding cell adhesion and extracellular matrix regulation were examined. In addition, the inhibitory effect of tolafentrine on ex vivo isolated pulmonary artery SMC cell migration was also investigated. Results Monocrotaline injection provoked severe PAH (right ventricular systolic pressure increased from 25.9 ± 4.0 to 68.9 ± 3.2 after 4 weeks and 74.9 ± 5.1 mmHg after 6 weeks, cardiac output depression and right heart hypertrophy. The media thickness of the pulmonary arteries and the proportion of muscularization of small precapillary resistance vessels increased dramatically, and the migratory response of ex-vivo isolated pulmonary artery smooth muscle cells (PASMC was increased. Micro-arrays and subsequent confirmation with real time PCR demonstrated upregulation of several extracellular matrix regulation and adhesion genes, such as matrixmetalloproteases (MMP 2, 8, 9, 10, 11, 12, 20, Icam, Itgax, Plat and serpinb2. When chronically nebulized from day 28 to 42 (12 daily aerosol maneuvers, after full establishment of severe pulmonary hypertension, tolafentrine reversed about 60% of all hemodynamic abnormalities, right heart hypertrophy and monocrotaline-induced structural lung vascular changes, including the proportion of pulmonary artery
Gomez, F J; Allendoerfer, R; Deepe, G S
1995-07-01
HIS-62 is a glycoprotein that has been isolated from the cell wall and cell membrane fraction of the pathogenic fungus Histoplasma capsulatum. It is a target of the cellular immune response to this fungus, and it protects mice against a lethal intravenous inoculum of H. capsulatum yeast cells. In this study, we cloned the gene encoding this antigen to reveal its biological nature and studied the immunological activity of recombinant antigen. The amino acid sequences of the NH2 terminus and internal peptides were obtained by Edman degradation. Degenerate oligonucleotides were used to isolate a gene fragment of HIS-62 by PCR. One 680-bp segment that corresponded to the known peptide sequence was amplified from H. capsulatum DNA. This DNA was used to screen a genomic library, and the full-length gene was isolated and sequenced. The deduced amino acid sequence of the gene demonstrated approximately 70 and approximately 50% identity to heat shock protein 60 (hsp 60) from Saccharomyces cerevisiae and hsp 60 from Escherichia coli, respectively. A cDNA was synthesized by reverse transcription PCR and was expressed in E. coli. Recombinant protein reacted with a monospecific polyclonal rabbit antiserum raised against native HIS-62, with monoclonal HIS-62-reactive T cells, and with splenocytes from mice immunized with viable yeast cells. Moreover, vaccination with the recombinant protein conferred protection in mice against a lethal intranasal inoculation with yeast cells. Thus, HIS-62 is a member of the hsp 60 family, and the recombinant hsp 60 is protective against pulmonary histoplasmosis in mice.
Influences of the disease resistance conferred by the individual ...
African Journals Online (AJOL)
To research possible influences of the disease resistance conferred by different trans-resistance genes on the transgenic rice plants in their yields and grain quality, three transgenic rice lines, including two with the resistance genes Pi-d2 and Pi-d3, respectively, for rice blast, and one with the resistance gene Xa21 for rice ...
Hedner, Charlotta; Sundgren, Pia C; Kelly, Aine Marie
2013-09-01
The purpose of this study was to assess if the presence of information including the pretest probability (Wells score), other known risk factors, and symptoms given on referrals for computed tomography (CT) pulmonary angiography correlated with prevalence rates for pulmonary embolism (PE). Also, to evaluate for differences between a university and a regional hospital setting regarding patient characteristics, amount of relevant information provided on referrals, and prevalence rates for pulmonary embolism. Retrospective review of all consecutive referrals (emergency room, inpatient, and outpatient) for CT performed on children and adults for suspected PE from two sites: a tertiary (university) hospital (site 1) and a secondary (regional) hospital (site 2) over a 5-year period. The overall prevalence rate was 510/3641 or 14% of all referrals. Significantly higher number of males had a positive CT compared to women (18% versus 12%, P relevant information on the referral and the probability for positive finding existed, a slight trend was noted (P = .09). In two categories, "hypoxia" and "signs of deep vein thrombosis," the presence of this information conferred a higher probability for pulmonary embolism, P information conferred a higher probability for pulmonary embolism. The amount of relevant clinical information on the request did not correlate with prevalence rates, which may reflect a lack of documentation on the part of emergency physicians who may use a "gestalt" approach. Request forms likely did not capture all relevant patient risks and many factors may interact with each other, both positively and negatively. Pretest probability estimations were rarely performed, despite their inclusion in major society guidelines. Copyright © 2013 AUR. Published by Elsevier Inc. All rights reserved.
Variations in CCL3L gene cluster sequence and non-specific gene copy numbers
Directory of Open Access Journals (Sweden)
Edberg Jeffrey C
2010-03-01
Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.
Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.
Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin
2016-10-15
Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author
Annual International DIC Society Conference and SEM Fall Conference
Reu, Phillip
2017-01-01
This collection represents a single volume of technical papers presented at the Annual International DIC Society Conference and SEM Fall Conference organized by the Society for Experimental Mechanics and Sandia National Laboratories and held in Philadelphia, PA, November 7-10, 2016. The volume presents early findings from experimental, standards development and various other investigations concerning digital image correlation - an important area within Experimental Mechanics. The area of Digital Image Correlation has been an integral track within the SEM Annual Conference spearheaded by Professor Michael Sutton from the University of South Carolina. In 2016, the SEM and Sandia joined their collaborative strengths to launch a standing fall meeting focusing specifically on developments in the area of Digital Image Correlation. The contributed papers within this volume span numerous technical aspects of DIC including standards development for the industry. .
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
Occupational chronic obstructive pulmonary disease
DEFF Research Database (Denmark)
Omland, Oyvind; Würtz, Else Toft; Aasen, Tor Børvig
2014-01-01
Occupational-attributable chronic obstructive pulmonary disease (COPD) presents a substantial health challenge. Focusing on spirometric criteria for airflow obstruction, this review of occupational COPD includes both population-wide and industry-specific exposures....
Conferring specificity in redox pathways by enzymatic thiol/disulfide exchange reactions.
Netto, Luis Eduardo S; de Oliveira, Marcos Antonio; Tairum, Carlos A; da Silva Neto, José Freire
2016-01-01
Thiol-disulfide exchange reactions are highly reversible, displaying nucleophilic substitutions mechanism (S(N)2 type). For aliphatic, low molecular thiols, these reactions are slow, but can attain million times faster rates in enzymatic processes. Thioredoxin (Trx) proteins were the first enzymes described to accelerate thiol-disulfide exchange reactions and their high reactivity is related to the high nucleophilicity of the attacking thiol. Substrate specificity in Trx is achieved by several factors, including polar, hydrophobic, and topological interactions through a groove in the active site. Glutaredoxin (Grx) enzymes also contain the Trx fold, but they do not share amino acid sequence similarity with Trx. A conserved glutathione binding site is a typical feature of Grx that can reduce substrates by two mechanisms (mono and dithiol). The high reactivity of Grx enzymes is related to the very acid pK(a) values of reactive Cys that plays roles as good leaving groups. Therefore, although distinct oxidoreductases catalyze similar thiol–disulfide exchange reactions, their enzymatic mechanisms vary. PDI and DsbA are two other oxidoreductases, but they are involved in disulfide bond formation, instead of disulfide reduction, which is related to the oxidative environment where they are found. PDI enzymes and DsbC are endowed with disulfide isomerase activity, which is related with their tetra-domain architecture. As illustrative description of specificity in thiol-disulfide exchange, redox aspects of transcription activation in bacteria, yeast, and mammals are presented in an evolutionary perspective. Therefore, thiol-disulfide exchange reactions play important roles in conferring specificity to pathways, a required feature for signaling.
Pulmonary endarterectomy outputs in chronic thromboembolic pulmonary hypertension.
López Gude, María Jesús; Pérez de la Sota, Enrique; Pérez Vela, Jose Luís; Centeno Rodríguez, Jorge; Muñoz Guijosa, Christian; Velázquez, María Teresa; Alonso Chaterina, Sergio; Hernández González, Ignacio; Escribano Subías, Pilar; Cortina Romero, José María
2017-07-07
Pulmonary thromboendarterectomy surgery is the treatment of choice for patients with chronic thromboembolic pulmonary hypertension; extremely high pulmonary vascular resistance constitutes a risk factor for hospital mortality. The objective of this study was to analyze the immediate and long-term results of the surgical treatment of chronic thromboembolic pulmonary hypertension in patients with very severe pulmonary hypertension. Since February 1996, we performed 160 pulmonary thromboendarterectomies. We divided the patient population in 2 groups: group 1, which included 40 patients with pulmonary vascular resistance≥1090dyn/sec/cm -5 , and group 2, which included the remaining 120 patients. Hospital mortality (15 vs. 2.5%), reperfusion pulmonary edema (33 vs. 14%) and heart failure (23 vs. 3.3%) were all higher in group 1; however, after one year of follow-up, there were no significant differences in the clinical, hemodynamic and echocardiographic conditions of both groups. Survival rate after 5 years was 77% in group 1 and 92% in group 2 (P=.033). After the learning curve including the 46 first patients, there was no difference in hospital mortality (3.8 vs. 2.3%) or survival rate after 5 years (96.2% in group 1 and 96.2% in group 2). Pulmonary thromboendarterectomy is linked to significantly higher morbidity and mortality rates in patients with severe chronic thromboembolic pulmonary hypertension. Nevertheless, these patients benefit the same from the procedure in the mid-/long-term. In our experience, after the learning curve, this surgery is safe in severe pulmonary hypertension and no level of pulmonary vascular resistance should be an absolute counter-indication for this surgery. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.
Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS
Directory of Open Access Journals (Sweden)
Scott Jewell
2012-08-01
Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.
Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.
Directory of Open Access Journals (Sweden)
Erin C Macaulay
Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.
Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.
LENUS (Irish Health Repository)
Vacic, Vladimir
2011-03-24
Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.
The antibiotic resistome: gene flow in environments, animals and human beings.
Hu, Yongfei; Gao, George F; Zhu, Baoli
2017-06-01
The antibiotic resistance is natural in bacteria and predates the human use of antibiotics. Numerous antibiotic resistance genes (ARGs) have been discovered to confer resistance to a wide range of antibiotics. The ARGs in natural environments are highly integrated and tightly regulated in specific bacterial metabolic networks. However, the antibiotic selection pressure conferred by the use of antibiotics in both human medicine and agriculture practice leads to a significant increase of antibiotic resistance and a steady accumulation of ARGs in bacteria. In this review, we summarized, with an emphasis on an ecological point of view, the important research progress regarding the collective ARGs (antibiotic resistome) in bacterial communities of natural environments, human and animals, i.e., in the one health settings.We propose that the resistance gene flow in nature is "from the natural environments" and "to the natural environments"; human and animals, as intermediate recipients and disseminators, contribute greatly to such a resistance gene "circulation."
X-linked Hyper IgM Syndrome Presenting as Pulmonary Alveolar Proteinosis.
Gallagher, Joel; Adams, Juan; Hintermeyer, Mary; Torgerson, Troy R; Lopez-Guisa, Jesus; Ochs, Hans D; Szabo, Sara; Salib, Mina; Verbsky, James; Routes, John
2016-08-01
X-linked hyper IgM syndrome (XHIGM) is a combined immunodeficiency caused by mutations in the CD40 ligand (CD40L) gene that typically results in decreased or absent CD40L expression on activated T cells, leading to defective class switching and somatic hypermutation. We describe an infant who presented with respiratory failure due to pulmonary alveolar proteinosis (PAP) with a novel damaging missense mutation in the CD40L gene. Whole exome sequencing (WES) was used to identify a mutation in the CD40L gene. CD40L expression and function were determined by flow cytometry. A 5-month-old previously-healthy male presented with respiratory failure and diffuse pulmonary ground glass opacities on CT scan of the chest. Laboratory evaluation revealed an undetectable IgG, normal IgA, and elevated IgM. A bronchoalveolar lavage demonstrated pulmonary alveolar proteinosis. WES demonstrated a c.608G > C mutation in the CD40L gene resulting in p.R203T. Flow cytometry demonstrated normal CD40L expression on activated T cells but absent binding of CD40-Ig to CD40L on activated patient T cells. The clinical manifestations of XHIGM in our patient had several unique features, including the presentation with PAP, normal serum IgA, and expression of non-functional CD40L on activated T cells. To our knowledge, this is the first published case of PAP in a patient with XHIGM.
The zinc transporter ZIP12 regulates the pulmonary vascular response to chronic hypoxia.
Zhao, Lan; Oliver, Eduardo; Maratou, Klio; Atanur, Santosh S; Dubois, Olivier D; Cotroneo, Emanuele; Chen, Chien-Nien; Wang, Lei; Arce, Cristina; Chabosseau, Pauline L; Ponsa-Cobas, Joan; Frid, Maria G; Moyon, Benjamin; Webster, Zoe; Aldashev, Almaz; Ferrer, Jorge; Rutter, Guy A; Stenmark, Kurt R; Aitman, Timothy J; Wilkins, Martin R
2015-08-20
The typical response of the adult mammalian pulmonary circulation to a low oxygen environment is vasoconstriction and structural remodelling of pulmonary arterioles, leading to chronic elevation of pulmonary artery pressure (pulmonary hypertension) and right ventricular hypertrophy. Some mammals, however, exhibit genetic resistance to hypoxia-induced pulmonary hypertension. We used a congenic breeding program and comparative genomics to exploit this variation in the rat and identified the gene Slc39a12 as a major regulator of hypoxia-induced pulmonary vascular remodelling. Slc39a12 encodes the zinc transporter ZIP12. Here we report that ZIP12 expression is increased in many cell types, including endothelial, smooth muscle and interstitial cells, in the remodelled pulmonary arterioles of rats, cows and humans susceptible to hypoxia-induced pulmonary hypertension. We show that ZIP12 expression in pulmonary vascular smooth muscle cells is hypoxia dependent and that targeted inhibition of ZIP12 inhibits the rise in intracellular labile zinc in hypoxia-exposed pulmonary vascular smooth muscle cells and their proliferation in culture. We demonstrate that genetic disruption of ZIP12 expression attenuates the development of pulmonary hypertension in rats housed in a hypoxic atmosphere. This new and unexpected insight into the fundamental role of a zinc transporter in mammalian pulmonary vascular homeostasis suggests a new drug target for the pharmacological management of pulmonary hypertension.
Directory of Open Access Journals (Sweden)
Assaf Gottlieb
2017-11-01
Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort
Generation of Elf5-Cre knockin mouse strain for trophoblast-specific gene manipulation.
Kong, Shuangbo; Liang, Guixian; Tu, Zhaowei; Chen, Dunjin; Wang, Haibin; Lu, Jinhua
2018-04-01
Placental development is a complex and highly controlled process during which trophoblast stem cells differentiate to various trophoblast subtypes. The early embryonic death of systemic gene knockout models hampers the investigation of these genes that might play important roles during placentation. A trophoblast specific Cre mouse model would be of great help for dissecting out the potential roles of these genes during placental development. For this purpose, we generate a transgenic mouse with the Cre recombinase inserted into the endogenous locus of Elf5 gene that is expressed specifically in placental trophoblast cells. To analyze the specificity and efficiency of Cre recombinase activity in Elf5-Cre mice, we mated Elf5-Cre mice with Rosa26 mT/mG reporter mice, and found that Elf5-Cre transgene is expressed specifically in the trophoectoderm as early as embryonic day 4.5 (E4.5). By E12.5, the activity of Elf5-Cre transgene was detected exclusively in all derivatives of trophoblast lineages, including spongiotrophoblast, giant cells, and labyrinth trophoblasts. In addition, Elf5-Cre transgene was also active during spermatogenesis, from spermatids to mature sperms, which is consistent with the endogenous Elf5 expression in testis. Collectively, our results provide a unique tool to delete specific genes selectively and efficiently in trophoblast lineage during placentation. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Peltier, P.; Cesbron, J.P.; Dupas, B.; Crochet, D.; Delhumeau, J.
1984-01-01
Fourty-six patients suspected clinically of having a pulmonary embolism (PE) were investigated by angiopneumography (AGP) and perfusion (99m-Tc aggregates) and ventilation (99m-Tc colloid) scintigraohy (SPV Tc). Findings were assessed under blind conditions. A positive diagnosis of pulmonary embolism was made in 19 patients. The SPV Tc was considered as positive if perfusional deficiencies were greater than ventilatory defects, and this was evaluated as such in 23 cases (19 true and 4 false positives). False negatives were not observed. The 4 false positive results corresponded to scintigraphic anomalies suggestive of pulmonary emboli subsegmental in size; true positives were either subsegmental (8), segmental (6) or lobar (5). Sensitivity of the SPV Tc was therefore 100 %; its specificity, all results considered was 76 %, but was 100 % if only images of lobar or segmental lesions are considered [fr
The management of neonatal pulmonary hypertension.
Dhillon, Rami
2012-05-01
Most neonates with clinically significant pulmonary hypertension (PH) will have either persistent PH of the newborn (PPHN) or bronchopulmonary dysplasia. Cyanotic congenital heart disease must be actively ruled out as part of the differential diagnosis of PPHN. The maintenance of ductal patency with prostaglandins E1 or E2 in cases of doubt is safe and potentially beneficial given their pulmonary vasorelaxant properties. Specific tools in the treatment of PPHN include modern ventilatory strategies, inhaled nitric oxide, sildenafil, prostacyclin and extracorporeal membrane oxygenation. Rarely will a cardiac lesion be primarily responsible for neonatal PH although pulmonary vein stenosis and the persistence of an arterial duct must be considered, particularly in the older preterm baby with bronchopulmonary dysplasia.
A human-specific de novo protein-coding gene associated with human brain functions.
Directory of Open Access Journals (Sweden)
Chuan-Yun Li
2010-03-01
Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.
Ellwanger, Daniel Christian; Leonhardt, Jörn Florian; Mewes, Hans-Werner
2014-12-01
Understanding how regulatory networks globally coordinate the response of a cell to changing conditions, such as perturbations by shifting environments, is an elementary challenge in systems biology which has yet to be met. Genome-wide gene expression measurements are high dimensional as these are reflecting the condition-specific interplay of thousands of cellular components. The integration of prior biological knowledge into the modeling process of systems-wide gene regulation enables the large-scale interpretation of gene expression signals in the context of known regulatory relations. We developed COGERE (http://mips.helmholtz-muenchen.de/cogere), a method for the inference of condition-specific gene regulatory networks in human and mouse. We integrated existing knowledge of regulatory interactions from multiple sources to a comprehensive model of prior information. COGERE infers condition-specific regulation by evaluating the mutual dependency between regulator (transcription factor or miRNA) and target gene expression using prior information. This dependency is scored by the non-parametric, nonlinear correlation coefficient η(2) (eta squared) that is derived by a two-way analysis of variance. We show that COGERE significantly outperforms alternative methods in predicting condition-specific gene regulatory networks on simulated data sets. Furthermore, by inferring the cancer-specific gene regulatory network from the NCI-60 expression study, we demonstrate the utility of COGERE to promote hypothesis-driven clinical research. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Using a periclinal chimera to unravel layer-specific gene expression in plants.
Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J
2013-09-01
Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.
Partial anomalous pulmonary venous return in patients with pulmonary hypertension
International Nuclear Information System (INIS)
Sung, Won-kyung; Au, Virginia; Rose, Anand
2012-01-01
Anomalous pulmonary venous return is an uncommon congenital malformation, and may be partial or total. Partial anomalous pulmonary venous return (PAPVR) is more common than total anomalous pulmonary venous return, and is often associated with other congenital cardiac anomalies. Whilst many patients with PAPVR remain asymptomatic, some may present in later age with symptoms related to left-to-right shunt, right heart failure and pulmonary hypertension. We report two cases of PAPVR detected on Computed Tomography Pulmonary Angiogram (CTPA) for the work up of pulmonary hypertension. The cases demonstrate that, although uncommon, partial anomalous pulmonary venous return can be a contributing factor to pulmonary hypertension and pulmonary veins should be carefully examined when reading a CTPA study.
Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter
Directory of Open Access Journals (Sweden)
Wolfgang Boecker
2004-04-01
Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.
Li, Shufeng; Li, Hongli; Mingyan, E; Yu, Bo
2009-02-01
The development of pulmonary vein stenosis has recently been described after radiofrequency ablation (RF) to treat atrial fibrillation (AF). The purpose of this study was to examine expression of TGFbeta1 in pulmonary vein stenosis after radiofrequency ablation in chronic atrial fibrillation of dogs. About 28 mongrel dogs were randomly assigned to the sham-operated group (n = 7), the AF group (n = 7), AF + RF group (n = 7), and RF group (n = 7). In AF or AF + RF groups, dogs underwent chronic pulmonary vein (PV) pacing to induce sustained AF. RF application was applied around the PVs until electrical activity was eliminated. Histological assessment of pulmonary veins was performed using hematoxylin and eosin staining; TGFbeta1 gene expression in pulmonary veins was examined by RT-PCR analysis; expression of TGFbeta1 protein in pulmonary veins was assessed by Western blot analysis. Rapid pacing from the left superior pulmonary vein (LSPV) induced sustained AF in AF group and AF + RF group. Pulmonary vein ablation terminated the chronic atrial fibrillation in dogs. Histological examination revealed necrotic tissues in various stages of collagen replacement, intimal thickening, and cartilaginous metaplasia with chondroblasts and chondroclasts. Compared with sham-operated and AF group, TGFbeta1 gene and protein expressions was increased in AF + RF or RF groups. It was concluded that TGFbeta1 might be associated with pulmonary vein stenosis after radiofrequency ablation in chronic atrial fibrillation of dogs.
International Nuclear Information System (INIS)
Guo Dajing; Miao Jingtao; Lu Wusheng; Bai Hongli
2003-01-01
Objective: To study CT features of pulmonary hypoperfusion in lung cancer with cancerous invasion of central pulmonary artery (CICPA) and the diagnostic value of CT. Methods: The pre-operative pulmonary DSA and contrast-enhanced spiral CT (including HRCT) findings in 20 cases of lung cancer with CICPA were carried out prospectively and comparatively. On DSA and CT, the distribution and quantitative variation of subpleural terminal pulmonary arterioles (pulmonary vessel signs), the filling degree of lung capillary, the post-contrast density changes of lung parenchyma, and the fluctuations of the time-density curve (pulmonary parenchymal signs) were blindly observed. The CT and DSA findings and their consistence were analyzed statistically. The diagnostic values of CT in secondary pulmonary hypoperfusion in lung cancer with CICPA were evaluated. Results: There were 30 lobar arteries with cancerous invasion among the 20 cases and 90% (27/30) of them presented pulmonary hypoperfusion on DSA. For diagnosing pulmonary hypoperfusion, CT had a sensitivity of 78%(21/27), a specificity of 100% (3/3), and an accuracy of 80%(24/30). There were no statistical correlation between pulmonary hypoperfusion and the degree of central pulmonary artery (CPA) stenosis (r s =0.40, P=0.073). Pulmonary vessel signs on CT had a good consistence with that on DSA (Kappa=0.69, P<0.001), while that of pulmonary parenchymal signs was lower (Kappa=0.37, P=0.011). Conclusion: Pulmonary hypoperfusion is one of the common findings in lung cancer with CICPA. CT is of great value in qualitative diagnosis on it, while for quantitative diagnosis, its value is limited to a certain degree
Characterization of a novel autophagy-specific gene, ATG29
International Nuclear Information System (INIS)
Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori
2005-01-01
Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins
Pulmonary biomarkers in chronic obstructive pulmonary disease
Barnes, Peter J.; Chowdhury, Badrul; Kharitonov, Sergei A.; Magnussen, Helgo; Page, Clive P.; Postma, Dirkje; Saetta, Marina
2006-01-01
There has been increasing interest in using pulmonary biomarkers to understand and monitor the inflammation in the respiratory tract of patients with chronic obstructive pulmonary disease (COPD). In this Pulmonary Perspective we discuss the merits of the various approaches by reviewing the current
Endothelial nanomedicine for the treatment of pulmonary disease.
Brenner, Jacob S; Greineder, Colin; Shuvaev, Vladimir; Muzykantov, Vladimir
2015-02-01
Even though pulmonary diseases are among the leading causes of morbidity and mortality in the world, exceedingly few life-prolonging therapies have been developed for these maladies. Relief may finally come from nanomedicine and targeted drug delivery. Here, we focus on four conditions for which the pulmonary endothelium plays a pivotal role: acute respiratory distress syndrome, primary graft dysfunction occurring immediately after lung transplantation, pulmonary arterial hypertension and pulmonary embolism. For each of these diseases, we first evaluate the targeted drug delivery approaches that have been tested in animals. Then we suggest a 'need specification' for each disease: a list of criteria (e.g., macroscale delivery method, stability, etc.) that nanomedicine agents must meet in order to warrant human clinical trials and investment from industry. For the diseases profiled here, numerous nanomedicine agents have shown promise in animal models. However, to maximize the chances of creating products that reach patients, nanomedicine engineers and clinicians must work together and use each disease's need specification to guide the design of practical and effective nanomedicine agents.
Cutis laxa and fatal pulmonary hypertension: a newly recognized syndrome?
Brunetti-Pierri, Nicola; Piccolo, Pasquale; Morava, Eva; Wevers, Ron A.; McGuirk, Megan; Johnson, Yvette R.; Urban, Zsolt; Dishop, Megan K.; Potocki, Lorraine
2015-01-01
Cutis laxa is a connective tissue disorder with distinctive lax, redundant, and inelastic skin. It is a genetically heterogenous disorder with autosomal dominant and recessive patterns of inheritance. We report a patient with cutis laxa supported by clinical, microscopic, and ultrastructural findings. Molecular analysis of fibulin-4 and -5, of the α2 subunit of the V-type H+ ATPase, and of the component of the oligomeric Golgi complex 7 (COG7) genes excluded the type I and type II autosomal recessive forms of cutis laxa, and congenital disorders of glycosylation associated with cutis laxa. Remarkably, our patient also presented severe and lethal pulmonary hypertension as a newborn. This case with cutis laxa, severe pulmonary hypertension, and no detectable mutations in fibulin-4 and -5 genes may represent a previously unrecognized syndrome. PMID:21285876
Chronic obstructive pulmonary disease
International Nuclear Information System (INIS)
Karabulut, N.
2012-01-01
Full text: Chronic obstructive pulmonary diseases (COPD) denote progressive lung diseases characterized by airway obstruction. COPD exhibits specific morphologic changes in the lung parenchyma, central and peripheral airways and pulmonary vasculature. A person with COPD may have either emphysema or chronic bronchitis, but most have both. Some people with COPD may also have an asthma-like or reactive component. Imaging modalities play important role in the detection or exclusion of COPD, distribution and extent of disease processes. Combined inspiratory and expiratory high resolution CT allows phenotyping of COPD (emphysema predominant, airway predominant, or mixed) and quantification of severity. Magnetic resonance imaging enables functional evaluation and demonstrates ventilation defects correlating closely with pulmonary function tests. Imaging techniques are also helpful in guiding the treatment, such as bullectomy in patients with bullous emphysema, lung volume reduction surgery or endoscopic interventions in those with severe emphysema, and smoking cessation and medical treatment designed to stop lung destruction in patients with mild or moderate emphysema or bronchiectasis.
Inference of Cancer-specific Gene Regulatory Networks Using Soft Computing Rules
Directory of Open Access Journals (Sweden)
Xiaosheng Wang
2010-03-01
Full Text Available Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.
Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression
International Nuclear Information System (INIS)
Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe
2005-01-01
We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells
Bossé, Yohan
2012-01-01
A genetic contribution to develop chronic obstructive pulmonary disease (COPD) is well established. However, the specific genes responsible for enhanced risk or host differences in susceptibility to smoke exposure remain poorly understood. The goal of this review is to provide a comprehensive literature overview on the genetics of COPD, highlight the most promising findings during the last few years, and ultimately provide an updated COPD gene list. Candidate gene studies on COPD and related phenotypes indexed in PubMed before January 5, 2012 are tabulated. An exhaustive list of publications for any given gene was looked for. This well-documented COPD candidate-gene list is expected to serve many purposes for future replication studies and meta-analyses as well as for reanalyzing collected genomic data in the field. In addition, this review summarizes recent genetic loci identified by genome-wide association studies on COPD, lung function, and related complications. Assembling resources, integrative genomic approaches, and large sample sizes of well-phenotyped subjects is part of the path forward to elucidate the genetic basis of this debilitating disease. PMID:23055711
DEFF Research Database (Denmark)
Andersen, Kasper Hasseriis; Andersen, Claus Bøgelund; Gustafsson, Finn
2017-01-01
Pulmonary vascular arterial remodeling is an integral and well-understood component of pulmonary hypertension (PH). In contrast, morphological alterations of pulmonary veins in PH are scarcely described. Explanted lungs (n = 101) from transplant recipients with advanced chronic obstructive...... pulmonary disease (COPD) and idiopathic pulmonary arterial hypertension (IPAH) were analyzed for venous vascular involvement according to a pre-specified, semi-quantitative grading scheme, which categorizes the intensity of venous remodeling in three groups of incremental severity: venous hypertensive (VH......) grade 0 = characterized by an absence of venous vascular remodeling; VH grade 1 = defined by a dominance of either arterialization or intimal fibrosis; and VH grade 2 = a substantial composite of arterialization and intimal fibrosis. Patients were grouped according to clinical and hemodynamic...
Directory of Open Access Journals (Sweden)
Suegene Noh
2016-02-01
Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of
Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues
Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.
2010-01-01
MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...
International Nuclear Information System (INIS)
Wollmer, P.; Rozcovek, A.; Rhodes, C.G.; Allan, R.M.; Maseri, A.
1984-01-01
The effects of chronic increase in pulmonary blood flow and chronic pulmonary hypertension on regional pulmonary blood volume was measured in two groups of patients. One group of patients had intracardiac, left-to-right shunts without appreciable pulmonary hypertension, and the other consisted of patients with Eisenmenger's syndrome or primary pulmonary hypertension, i.e. patients with normal or reduced blood flow and severe pulmonary hypertension. A technique based on positron tomography was used to measure lung density (by transmission scanning) and regional pulmonary blood volume (after inhalation of /sup 11/CO). The distribution of pulmonary blood volume was more uniform in patients with chronic increase in pulmonary blood flow than in normal subjects. There were also indications of an absolute increase in intrapulmonary blood volume by about 15%. In patients with chronic pulmonary arterial hypertension, the distribution of pulmonary blood volume was also abnormally uniform. There was, however, no indication that overall intrapulmonary blood volume was substantially different from normal subjects. The abnormally uniform distribution of pulmonary blood volume can be explained by recruitment and/or dilatation of vascular beds. Intrapulmonary blood volume appears to be increased in patients with intracardiac, left-to-right shunts. With the development of pulmonary hypertension, intrapulmonary blood volume falls, which may be explained by reactive changes in the vasculature and/or obliteration of capillaries
Directory of Open Access Journals (Sweden)
Nargiz Muganlinskaya
2015-12-01
Full Text Available Arterial leiomyosarcomas account for up to 21% of vascular leiomyosarcomas, with 56% of arterial leiomyosarcomas occurring in the pulmonary artery. While isolated cases of primary pulmonary artery leiomyosarcoma document survival up to 36 months after treatment, these uncommon, aggressive tumors are highly lethal, with 1-year survival estimated at 20% from the onset of symptoms. We discuss a rare case of a pulmonary artery leiomyosarcoma that was originally diagnosed as a pulmonary embolism (PE. A 72-year-old Caucasian female was initially diagnosed with ‘saddle pulmonary embolism’ based on computerized tomographic angiography of the chest 2 months prior to admission and placed on anticoagulation. Dyspnea escalated, and serial computed tomography scans showed cardiomegaly with pulmonary emboli involving the right and left main pulmonary arteries with extension into the right and left upper and lower lobe branches. An echocardiogram on admission showed severe pulmonary hypertension with a pulmonary artery pressure of 82.9 mm Hg, and a severely enlarged right ventricle. Respiratory distress and multiorgan failure developed and, unfortunately, the patient expired. Autopsy showed a lobulated, yellow mass throughout the main pulmonary arteries measuring 13 cm in diameter. The mass extended into the parenchyma of the right upper lobe. On microscopy, the mass was consistent with a high-grade primary pulmonary artery leiomyosarcoma. Median survival of patients with primary pulmonary artery leiomyosarcoma without surgery is one and a half months, and mortality is usually due to right-sided heart failure. Pulmonary artery leiomyosarcoma is a rare but highly lethal disease commonly mistaken for PE. Thus, we recommend clinicians to suspect this malignancy when anticoagulation fails to relieve initial symptoms. In conclusion, early detection and suspicion of pulmonary artery leiomyosarcoma should be considered in patients refractory to anticoagulation
Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.
Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro
2018-05-03
Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.
Biothechnology conferences held in Cuba. Cuba no biotechnology gakkai ni sankashite
Energy Technology Data Exchange (ETDEWEB)
Murata, M. (Ajinomoto Co. Inc., Tokyo, (Japan))
1990-04-25
Three biotechnology conferences including Cuba International Interferon Conference were held at Havana in April 1989, and the author participated in them. The number of participants was about 3,000. Most of them were from the Middle and the Central America, but there were also those from Europe, the USSR and the USA. The three conferences were composed of 16 symposiums and they covered a wide range of field such as medical science, agriculture and industry. High leveled reports were read in the conferences: on the application of interferons to medical treatments, curing effects of infections caused by herpes virus and B type hepatitis virus, anti-tumor effects, and anti-virus effects against AIDS virus; on the production of protein and vaccini by gene engineering, large quantity production of interleukin and epithelium cell multiplication genes. Especially impressing were the efforts the whole nation of Cuba makes to promote biotechnology and its modern facilities. 3 figs.
Gong, Li; Wei, Long-Xiao; Huang, Gao-Sheng; Zhang, Wen-Dong; Wang, Lu; Zhu, Shao-Jun; Han, Xiu-Juan; Yao, Li; Lan, Miao; Li, Yan-Hong; Zhang, Wei
2013-08-19
Extranodal natural killer (NK)/T-cell lymphoma, nasal type, is an uncommon lymphoma associated with the Epstein-Barr virus (EBV). It most commonly involves the nasal cavity and upper respiratory tract. Primary pulmonary NK/T cell lymphoma is extremely rare. If a patient with a NK or T-cell tumor has an unusual reaction to treatment or an unusual prognosis, it is wise to differentiate NK from T-cell tumors. The clinicopathologic characteristics, immunophenotype, EBV in situ hybridization, and T cell receptor (TCR) gene rearrangement of primary pulmonary NK cell lymphoma from a 73-year-old Chinese woman were investigated and the clonal status was determined using female X-chromosomal inactivation mosaicism and polymorphisms at the phosphoglycerate kinase (PGK) gene. The lesion showed the typical histopathologic characteristics and immunohistochemical features of NK/T cell lymphoma. However, the sample was negative for TCR gene rearrangement. A clonality assay demonstrated that the lesion was monoclonal. It is concluded that this is the first recorded case of genuine primary pulmonary NK cell lymphoma. The purpose of the present work is to recommend that pathologists carefully investigate the whole lesion to reduce the likelihood that primary pulmonary NK cell lymphoma will be misdiagnosed as an infectious lesion. In addition, TCR gene rearrangement and clonal analysis, which is based on female X-chromosomal inactivation mosaicism and polymorphisms at PGK and androgen receptor (AR) loci, were found to play important roles in differentiating NK cell lymphoma from T cell lymphoma. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5205300349457729.
Directory of Open Access Journals (Sweden)
David Haase
Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.
International Nuclear Information System (INIS)
Konstam, M.A.; Strauss, H.W.; Alpert, N.M.; Miller, S.W.; Murphy, R.X.; Greene, R.E.; McKusick, K.A.
1979-01-01
To determine whether a correlation exists between pulmonary arterial (PA) pressure (P/sub a/) and the distribution of pulmonary blood flow, this distribution was measured in four upright dogs in the control state and during intravenous infusions of epinephrine or prostaglandin F/sub 2α/. During suspension of respiration, 15 mCi of Xe-133 were injected intravenously, and perfusion and equilibration lung images were recorded with a scintillation camera. The procedure was performed several times on each dog, with and without pharmacological elevation of PA pressure by 5 to 50 cm H 2 O. For each scintigram, the relative blood flow per unit ventilated lung volume (F) was plotted against centimeters above the hilum (h). Pulmonary arterial pressure was derived from each curve, assuming the relation F = B(P/sub a/ - hD) 2 , where B = constant and D = specific gravity of blood. Calculated PA pressure correlated strongly (r = 0.83) with measured PA pressure, suggesting a possible means of noninvasive estimation of PA pressure
CERN automatic audio-conference service
International Nuclear Information System (INIS)
Sierra Moral, Rodrigo
2010-01-01
Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first European pilot and several improvements (such as billing, security, redundancy...) were implemented based on CERN's recommendations. The new automatic conference system has been operational since the second half of 2006. It is very popular for the users and has doubled the number of conferences in the past two years.
CERN automatic audio-conference service
Energy Technology Data Exchange (ETDEWEB)
Sierra Moral, Rodrigo, E-mail: Rodrigo.Sierra@cern.c [CERN, IT Department 1211 Geneva-23 (Switzerland)
2010-04-01
Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first European pilot and several improvements (such as billing, security, redundancy...) were implemented based on CERN's recommendations. The new automatic conference system has been operational since the second half of 2006. It is very popular for the users and has doubled the number of conferences in the past two years.
CERN automatic audio-conference service
Sierra Moral, Rodrigo
2010-04-01
Scientists from all over the world need to collaborate with CERN on a daily basis. They must be able to communicate effectively on their joint projects at any time; as a result telephone conferences have become indispensable and widely used. Managed by 6 operators, CERN already has more than 20000 hours and 5700 audio-conferences per year. However, the traditional telephone based audio-conference system needed to be modernized in three ways. Firstly, to provide the participants with more autonomy in the organization of their conferences; secondly, to eliminate the constraints of manual intervention by operators; and thirdly, to integrate the audio-conferences into a collaborative working framework. The large number, and hence cost, of the conferences prohibited externalization and so the CERN telecommunications team drew up a specification to implement a new system. It was decided to use a new commercial collaborative audio-conference solution based on the SIP protocol. The system was tested as the first European pilot and several improvements (such as billing, security, redundancy...) were implemented based on CERN's recommendations. The new automatic conference system has been operational since the second half of 2006. It is very popular for the users and has doubled the number of conferences in the past two years.
International Nuclear Information System (INIS)
Erdogan, Ezgi Basak; Buyukpinarbasili, Nur; Ziyade, Sedat; Akman, Tolga; Turk, Haci Mehmet; Aydin, Mehmet
2005-01-01
A 71-year-old male patient with solitary pulmonary nodule underwent fluorodeoxyglucose positron emission tomography/computed tomography (FDG PET/CT) showing slightly increased FDG uptake in this nodule. In addition, PET/CT detected hypermetabolic sclerotic bone lesions in the right second rib and 7 th thoracic vertebrae, which were interpreted as possible metastases, and mildly increased FDG uptake in the prostate gland highly suspicious of malignancy. The patient's prostate-specific antigen (PSA) level was within normal range (3.8 ng/dL). The histopathological examination of the lung nodule and right second rib lesion proved metastases from prostate cancer, then the prostate biopsy-confirmed prostate adenocarcinoma. The unique feature of this case is to emphasize the importance of performing PET/CT for solitary pulmonary nodule in detecting PSA-negative metastatic prostate cancer. This case indicated that it should be kept in mind that, even if the PSA is negative, a lung metastasis of prostate cancer may be an underlying cause in patients evaluated for solitary pulmonary nodule by FDG PET/CT
Pulmonary histiocytosis X - imaging aspects of pulmonary involvement
International Nuclear Information System (INIS)
Sabedotti, Ismail Fernando; Maeda, Lucimara; Ferreira, Daniel Miranda; Montandon, Cristiano; Marins, Jose Luiz C.
1999-01-01
Pulmonary histiocytosis X is an idiopathic disease which is and uncommon but important cause of pulmonary fibrosis in young adults. Chest radiographs and high resolution computed tomographic (HRCT) scans of the lungs of 7 patients diagnosed as pulmonary histiocytosis X were examined retrospectively. The authors reviewed the pathologic, clinical and radiographic features of pulmonary histiocytosis X, focusing on differential diagnosis and disease progression. Pulmonary histiocytosis X can be suspected on the basis of chest radiographic findings; predominantly upper lobe nodules and cysts present an increased sensitivity and are virtually pathognomonic of this disorder. Chest HRCT allows good assessment of the evolution of pulmonary histiocytosis X and is also valuable in distinguishing histiocytosis from other disorders that produces nodules or cysts. (author)
Schinagl, Carina; Melum, Guro Reinholt; Rødningen, Olaug Kristin; Bjørgo, Kathrine; Andresen, Jannicke Hanne
2017-08-17
Persistent pulmonary hypertension is a well-known disease of the newborn that in most cases responds well to treatment with nitric oxide and treatment of any underlying causes. Genetic causes of persistent pulmonary hypertension of the newborn are rare. The TWIST1 gene is involved in morphogenetics, and deletions are known to cause Saethre-Chotzen syndrome. Deletions of PHF14 have never been reported in neonates, but animal studies have shown a link between severe defects in lung development and deletions of this gene. There have not, to the best of our knowledge, been any publications of a link between the genes TWIST1 and PHF14 and persistent pulmonary hypertension of the newborn, making this a novel finding. We describe a white male neonate born at term to non-consanguineous white parents; he presented with dysmorphic features and a therapy-refractory persistent pulmonary hypertension. Array-based comparative genomic hybridization revealed the presence of a 14.7 Mb interstitial deletion on chromosome 7, encompassing the genes TWIST1 and PHF14. The TWIST1 gene can explain our patient's dysmorphic features. His severe persistent pulmonary hypertension has, however, not been described before in conjunction with the TWIST1 gene, but could be explained by involvement of PHF14, consistent with findings in animal experiments showing lethal respiratory failure with depletion of PHF14. These findings are novel and of importance for the clinical management and diagnostic workup of neonates with severe persistent pulmonary hypertension of the newborn and dysmorphic features.
Directory of Open Access Journals (Sweden)
Amra Macić-Džanković
2006-11-01
Full Text Available We evaluated electrocardiographic and echocardiographic changes of 40 patients with pulmonary thrombo-embolism proved by perfusion scintigrams. ECG-changes included sinus tachycardia or absolute tachyarrhythmia de novo, changes type Q1S3T3 and changes in right precordial leads. Analyses of echocardiography included hyperkinesis and then dilatation and apical hypokinesis of right ventricule and tricuspid regurgitation with maximal transvalvular gradients. We emphasize such a sensibility of echocardiographic changes in early estimation of pulmonary thrombo-embolism severity and necessity for echocardiography as early as possible in suspected patients.
Directory of Open Access Journals (Sweden)
M Ghasemi
2017-05-01
Full Text Available Introduction: Salmonellosis is an infection caused by eating contaminated food with Salmonella, and it can occur in humans and other animals. Salmonella has acquired the ability to create the infection due to the presence of several virulence genes. One of the virulence genes of salmonella is sipC gene that coding the SipC protein. The aim of this study was creating the gene cassette to genetically engineered Salmonella enteritidis in the specific region of the sipC gene. Methods: In this study, after DNA extraction from Salmonella, the upstream and downstream regions of the sipC gene was amplified based on PCR method. The PCR products were cloned with T/A cloning method and they were inserted into the pGEM vector. In order to generate the final gene cassette, each of the upstream and downstream regions of the sipC gene was subcloned into the pET32 vector, and cloning accuracy was assessed by PCR and enzyme digestion methods. Results: Amplification of the 320 bp upstream and 206 bp downstream of sipC gene was successful by PCR method. T/A cloning of these fragments were caused the formation of two pGEM-up and pGEM-down recombinant vectors. Results that were confirmed the sub-cloning accuracy indicate the formation of the final pET32-up-down gene cassette. Conclusion: The generated gene cassette in this study was considered as a multi-purpose cassette that is able to specific gene manipulation of Salmonella sipC gene by homologous recombination matched. This gene cassette has the necessary potential for sipC gene deletion or insertion of any useful gene instead of sipC gene.
Directory of Open Access Journals (Sweden)
Chen TX
2018-01-01
Full Text Available Tian-Xiang Chen,1 Bigyan Pudasaini,1 Jian Guo,2 Su-Gang Gong,1 Rong Jiang,1 Lan Wang,1 Qin-Hua Zhao,1 Wen-Hui Wu,1 Ping Yuan,1 Jin-Ming Liu1 1Department of Cardio-Pulmonary Circulation, Shanghai Pulmonary Hospital, Tongji University, Shanghai, People’s Republic of China; 2Department of Pulmonary Function Test, Shanghai Pulmonary Hospital, Tongji University, Shanghai, People’s Republic of China Background: Sex differences in chronic thromboembolic pulmonary hypertension (CTEPH have been revealed in few studies. Although right heart catheterization (RHC is the gold standard for clinical diagnosis and assessment of prognosis in pulmonary hypertension (PH, cardiopulmonary exercise testing (CPET has been a more widely used assessment of functional capacity, disease severity, prognosis, and treatment response in PH. We hypothesized that the “sex-specific” CPET indices could estimate the severity of inoperable CTEPH.Methods: Data were retrieved for 33 male (age, mean ± standard deviation [SD] =62.5±13.4 years and 40 female (age, mean ± SD =56.3±11.8 years patients with stable CTEPH who underwent both RHC and CPET at Shanghai Pulmonary Hospital from February 2010 to February 2016. Univariate and forward/backward multiple stepwise regression analysis was performed to assess the predictive value of CPET indices to hemodynamic parameters. Event-free survival was estimated using the Kaplan–Meier method and analyzed with the log-rank test. Cox proportional hazards models were performed to determine the independent event-free survival predictors.Results: Numerous CPET parameters were different between male and female patients with CTEPH and the control group. There were no significant differences in both clinical variables and RHC parameters between male and female patients with CTEPH. O2 pulse, workload, minute ventilation (VE, and end-tidal partial pressure of O2 (PETO2 at anaerobic threshold, as well as peak O2 pulse, workload, VE, and nadir
Knietsch, Anja; Waschkowitz, Tanja; Bowien, Susanne; Henne, Anke; Daniel, Rolf
2003-01-01
Metagenomic DNA libraries from three different soil samples (meadow, sugar beet field, cropland) were constructed. The three unamplified libraries comprised approximately 1267000 independent clones and harbored approximately 4.05 Gbp of environmental DNA. Approximately 300000 recombinant Escherichia coli strains of each library per test substrate were screened for the production of carbonyls from short-chain (C2 to C4) polyols such as 1,2-ethanediol, 2,3-butanediol, and a mixture of glycerol and 1,2-propanediol on indicator agar. Twenty-four positive E. COLI clones were obtained during the initial screen. Fifteen of them contained recombinant plasmids, designated pAK201-215, which conferred a stable carbonyl-forming phenotype on E. coli Sequencing revealed that the inserts of pAK201-215 encoded 26 complete and 14 incomplete predicted protein-encoding genes. Most of these genes were similar to genes with unknown functions from other microorganisms or unrelated to any other known gene. The further analysis was focused on the 7 plasmids (pAK204, pAK206, pAK208, and pAK210-213) recovered from the positive clones, which exhibited an NAD(H)-dependent alcohol oxidoreductase activity with polyols or the correlating carbonyls as substrates in crude extracts. Three genes (ORF6, ORF24, and ORF25) conferring this activity were identified during subcloning of the inserts of pAK204, pAK211, and pAK212. The sequences of the three deduced gene products revealed no significant similarities to known alcohol oxidoreductases, but contained putative glycine-rich regions, which are characteristic for binding of nicotinamide cofactors. Copyright 2003 S. Karger AG, Basel
Novel Genes Involved in Controlling Specification of Drosophila FMRFamide Neuropeptide Cells.
Bivik, Caroline; Bahrampour, Shahrzad; Ulvklo, Carina; Nilsson, Patrik; Angel, Anna; Fransson, Fredrik; Lundin, Erika; Renhorn, Jakob; Thor, Stefan
2015-08-01
The expression of neuropeptides is often extremely restricted in the nervous system, making them powerful markers for addressing cell specification . In the developing Drosophila ventral nerve cord, only six cells, the Ap4 neurons, of some 10,000 neurons, express the neuropeptide FMRFamide (FMRFa). Each Ap4/FMRFa neuron is the last-born cell generated by an identifiable and well-studied progenitor cell, neuroblast 5-6 (NB5-6T). The restricted expression of FMRFa and the wealth of information regarding its gene regulation and Ap4 neuron specification makes FMRFa a valuable readout for addressing many aspects of neural development, i.e., spatial and temporal patterning cues, cell cycle control, cell specification, axon transport, and retrograde signaling. To this end, we have conducted a forward genetic screen utilizing an Ap4-specific FMRFa-eGFP transgenic reporter as our readout. A total of 9781 EMS-mutated chromosomes were screened for perturbations in FMRFa-eGFP expression, and 611 mutants were identified. Seventy-nine of the strongest mutants were mapped down to the affected gene by deficiency mapping or whole-genome sequencing. We isolated novel alleles for previously known FMRFa regulators, confirming the validity of the screen. In addition, we identified novel essential genes, including several with previously undefined functions in neural development. Our identification of genes affecting most major steps required for successful terminal differentiation of Ap4 neurons provides a comprehensive view of the genetic flow controlling the generation of highly unique neuronal cell types in the developing nervous system. Copyright © 2015 by the Genetics Society of America.
Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish
Directory of Open Access Journals (Sweden)
Atsuo Kawahara
2016-05-01
Full Text Available The zebrafish (Danio rerio is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs, transcription activator-like effector nucleases (TALENs and the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR associated protein 9 (Cas9 system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.
Directory of Open Access Journals (Sweden)
Naito K
2017-07-01
Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The
Hypoxia, leukocytes, and the pulmonary circulation.
Stenmark, Kurt R; Davie, Neil J; Reeves, John T; Frid, Maria G
2005-02-01
Data are rapidly accumulating in support of the idea that circulating monocytes and/or mononuclear fibrocytes are recruited to the pulmonary circulation of chronically hypoxic animals and that these cells play an important role in the pulmonary hypertensive process. Hypoxic induction of monocyte chemoattractant protein-1, stromal cell-derived factor-1, vascular endothelial growth factor-A, endothelin-1, and tumor growth factor-beta(1) in pulmonary vessel wall cells, either directly or indirectly via signals from hypoxic lung epithelial cells, may be a critical first step in the recruitment of circulating leukocytes to the pulmonary circulation. In addition, hypoxic stress appears to induce release of increased numbers of monocytic progenitor cells from the bone marrow, and these cells may have upregulated expression of receptors for the chemokines produced by the lung circulation, which thus facilitates their specific recruitment to the pulmonary site. Once present, macrophages/fibrocytes may exert paracrine effects on resident pulmonary vessel wall cells stimulating proliferation, phenotypic modulation, and migration of resident fibroblasts and smooth muscle cells. They may also contribute directly to the remodeling process through increased production of collagen and/or differentiation into myofibroblasts. In addition, they could play a critical role in initiating and/or supporting neovascularization of the pulmonary artery vasa vasorum. The expanded vasa network may then act as a conduit for further delivery of circulating mononuclear cells to the pulmonary arterial wall, creating a feedforward loop of pathological remodeling. Future studies will need to determine the mechanisms that selectively induce leukocyte/fibrocyte recruitment to the lung circulation under hypoxic conditions, their direct role in the remodeling process via production of extracellular matrix and/or differentiation into myofibroblasts, their impact on the phenotype of resident smooth muscle
International Nuclear Information System (INIS)
Kobayashi, Junjiro; Hirose, Hajime; Nakano, Susumu
1985-01-01
Pulmonary arteriography was performed by digital subtraction angiographic (DSA) method in 10 patients with cyanotic heart disease associated with pulmonary stenosis or pulmonary atresia. Ten patients consisted of five patients with tetralogy of Fallot, three with single ventricle and pulmonary stenosis, and two with pseudotruncus arteriosus. Hepato-clavicular position was taken in four patients. Pulmonary artery and its main branches were opacified and recognized clearly, and their diameter could be measured accurately with a small amount of contrast medium. There was a good correlation between the diameter of pulmonary artery measured by DSA and that measured by conventional pulmonary arteriography. DSA is a useful method for evaluating the size and the stenosis of pulmonary artery especially in small cyanotic infants. (author)
Directory of Open Access Journals (Sweden)
S. Buldeo
2012-01-01
Full Text Available There is a paucity of data on the pulmonary immune-compartment interferon gamma (IFNγ response to M. tuberculosis, particularly in settings of high tuberculosis (TB prevalence and in HIV-coinfected individuals. This data is necessary to understand the diagnostic potential of commercially available interferon gamma release assays (IGRAs in both the pulmonary immune-compartment and peripheral blood. We used intracellular cytokine staining by flow cytometry to assess the IFNγ response to purified protein derivative (PPD and early secretory antigen 6 (ESAT6 in induced sputa (ISp and blood samples from HIV-infected, smear-negative, TB suspects. We found that individuals with active TB disease produced significantly less IFNγ in response to PPD in their induced sputa samples than individuals with non-active TB (control group. This difference was not reflected in the peripheral blood, even within the CD27− CD4+ memory T lymphocyte population. These findings suggest that progression to active TB disease may be associated with the loss of IFNγ secretion at the site of primary infection. Our findings highlight the importance of studying pulmonary immune-compartment M. tuberculosis specific responses to elucidate IFNγ secretion across the spectrum of TB disease.
Directory of Open Access Journals (Sweden)
Yuan Xin Goay
2016-01-01
Full Text Available Salmonella Typhi (S. Typhi causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S. Typhi with other enteric pathogens was performed, and 6 S. Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico. Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro. The diagnostic sensitivities and specificities of each assay were determined using 39 S. Typhi, 62 non-Typhi Salmonella, and 10 non-Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39 and 100% specificity (0/72. The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien
2016-01-01
Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Inflammasome genetics contributes to the development and control of active pulmonary tuberculosis.
Souza de Lima, D; Ogusku, M M; Sadahiro, A; Pontillo, A
2016-07-01
Tuberculosis (TB) continues to be a major public health problem. An estimated one-third of the world's population is infected with Mycobacterium tuberculosis (Mtb) but remains asymptomatic (latent TB) and only 5% to 10% of these latent individuals will develop active pulmonary TB. Factors affecting the balance between latent and active TB are mostly unknown, even if host genome has been shown to contribute to the outcome of Mtb response. Acute inflammation and Th1 response are important in the early clearance of the bacteria as it was emphasized by the association between immune genes (i.e.: HLA, IFNG, TNF, NRPAM1, IL10) variants and the development of active pulmonary TB. Recently, the role of the inflammasome in experimental TB has been demonstrated, however, to our knowledge, no data still exist about the contribution of inflammasome genetics to Mtb susceptibility and/or to the development of active TB. For this reason, selected polymorphisms in inflammasome genes were analysed in a case/control cohort of individuals with active pulmonary TB from an endemic area of Brazil Amazon. Our data evidence the novel association between polymorphisms in NLRP3-inflammasome encoding genes and active pulmonary TB, and replicated the association between P2X7 and TB observed in other populations. These results emphasize the role of NLRP3-inflammasome also in human TB, and contribute to our knowledge about pathways involved in the development of active TB, even if deeper investigation are needed to fully elucidate the role of the complex in Mtb infection. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Manish Sharma
Full Text Available BACKGROUND: High altitude pulmonary edema (HAPE is a life-threatening form of non-cardiogenic edema which occurs in unacclimatized but otherwise normal individuals within two to four days after rapid ascent to altitude beyond 3000 m. The precise pathoetiology and inciting mechanisms regulating HAPE remain unclear. METHODOLOGY/PRINCIPLE FINDINGS: We performed global gene expression profiling in individuals with established HAPE compared to acclimatized individuals. Our data suggests concurrent modulation of multiple pathways which regulate vascular homeostasis and consequently lung fluid dynamics. These pathways included those which regulate vasoconstriction through smooth muscle contraction, cellular actin cytoskeleton rearrangements and endothelial permeability/dysfunction. Some notable genes within these pathways included MYLK; rho family members ARGEF11, ARHGAP24; cell adhesion molecules such as CLDN6, CLDN23, PXN and VCAM1 besides other signaling intermediates. Further, several important regulators of systemic/pulmonary hypertension including ADRA1D, ECE1, and EDNRA were upregulated in HAPE. We also observed significant upregulation of genes involved in paracrine signaling through chemokines and lymphocyte activation pathways during HAPE represented by transcripts of TNF, JAK2, MAP2K2, MAP2K7, MAPK10, PLCB1, ARAF, SOS1, PAK3 and RELA amongst others. Perturbation of such pathways can potentially skew vascular homeostatic equilibrium towards altered vascular permeability. Additionally, differential regulation of hypoxia-sensing, hypoxia-response and OXPHOS pathway genes in individuals with HAPE were also observed. CONCLUSIONS/SIGNIFICANCE: Our data reveals specific components of the complex molecular circuitry underlying HAPE. We show concurrent perturbation of multiple pathways regulating vascular homeostasis and suggest multi-genic nature of regulation of HAPE.
Directory of Open Access Journals (Sweden)
Dasgupta Dipayan
2005-05-01
Full Text Available Abstract Background Global regulatory mechanisms involving chromatin assembly and remodelling in the promoter regions of genes is implicated in eukaryotic transcription control especially for genes subjected to spatial and temporal regulation. The potential to utilise global regulatory mechanisms for controlling gene expression might depend upon the architecture of the chromatin in and around the gene. In-silico analysis can yield important insights into this aspect, facilitating comparison of two or more classes of genes comprising of a large number of genes within each group. Results In the present study, we carried out a comparative analysis of chromatin characteristics in terms of the scaffold/matrix attachment regions, nucleosome formation potential and the occurrence of repetitive sequences, in the upstream regulatory regions of housekeeping and tissue specific genes. Our data show that putative scaffold/matrix attachment regions are more abundant and nucleosome formation potential is higher in the 5' regions of tissue specific genes as compared to the housekeeping genes. Conclusion The differences in the chromatin features between the two groups of genes indicate the involvement of chromatin organisation in the control of gene expression. The presence of global regulatory mechanisms mediated through chromatin organisation can decrease the burden of invoking gene specific regulators for maintenance of the active/silenced state of gene expression. This could partially explain the lower number of genes estimated in the human genome.
Directory of Open Access Journals (Sweden)
Leon French
2017-05-01
Full Text Available Genome-wide expression profiling of the human brain has revealed genes that are differentially expressed across the lifespan. Characterizing these genes adds to our understanding of both normal functions and pathological conditions. Additionally, the specific cell-types that contribute to the motor, sensory and cognitive declines during aging are unclear. Here we test if age-related genes show higher expression in specific neural cell types. Our study leverages data from two sources of murine single-cell expression data and two sources of age-associations from large gene expression studies of postmortem human brain. We used nonparametric gene set analysis to test for age-related enrichment of genes associated with specific cell-types; we also restricted our analyses to specific gene ontology groups. Our analyses focused on a primary pair of single-cell expression data from the mouse visual cortex and age-related human post-mortem gene expression information from the orbitofrontal cortex. Additional pairings that used data from the hippocampus, prefrontal cortex, somatosensory cortex and blood were used to validate and test specificity of our findings. We found robust age-related up-regulation of genes that are highly expressed in oligodendrocytes and astrocytes, while genes highly expressed in layer 2/3 glutamatergic neurons were down-regulated across age. Genes not specific to any neural cell type were also down-regulated, possibly due to the bulk tissue source of the age-related genes. A gene ontology-driven dissection of the cell-type enriched genes highlighted the strong down-regulation of genes involved in synaptic transmission and cell-cell signaling in the Somatostatin (Sst neuron subtype that expresses the cyclin dependent kinase 6 (Cdk6 and in the vasoactive intestinal peptide (Vip neuron subtype expressing myosin binding protein C, slow type (Mybpc1. These findings provide new insights into cell specific susceptibility to normal aging
eap Gene as novel target for specific identification of Staphylococcus aureus.
Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten
2008-02-01
The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.
International Nuclear Information System (INIS)
Bredow, Sebastian; Falgout, Melanie M.; March, Thomas H.; Yingling, Christin M.; Malkoski, Stephen P.; Aden, James; Bedrick, Edward J.; Lewis, Johnnye L.; Divine, Kevin K.
2007-01-01
Although the lung constitutes the major exposure route for airborne manganese (Mn), little is known about the potential pulmonary effects and the underlying molecular mechanisms. Transition metals can mimic a hypoxia-like response, activating the hypoxia inducible factor-1 (HIF-1) transcription factor family. Through binding to the hypoxia-response element (HRE), these factors regulate expression of many genes, including vascular endothelial growth factor (VEGF). Increases in VEGF, an important biomarker of angiogenesis, have been linked to respiratory diseases, including pulmonary hypertension. The objective of this study was to evaluate pulmonary hypoxia-associated angiogenic gene expression in response to exposure of soluble Mn(II) and to assess the genes' role as intermediaries of potential pulmonary Mn toxicity. In vitro, 0.25 mM Mn(II) altered morphology and slowed the growth of human pulmonary epithelial cell lines. Acute doses between 0.05 and 1 mM stimulated VEGF promoter activity up to 3.7-fold in transient transfection assays. Deletion of the HRE within the promoter had no effect on Mn(II)-induced VEGF expression but decreased cobalt [Co(II)]-induced activity 2-fold, suggesting that HIF-1 may not be involved in Mn(II)-induced VEGF gene transcription. Nose-only inhalation to 2 mg Mn(II)/m 3 for 5 days at 6 h/day produced no significant pulmonary inflammation but induced a 2-fold increase in pulmonary VEGF mRNA levels in adult mice and significantly altered expression of genes associated with murine angiogenesis. These findings suggest that even short-term exposures to soluble, occupationally relevant Mn(II) concentrations may alter pulmonary gene expression in pathways that ultimately could affect the lungs' susceptibility to respiratory disease
Additional mechanisms conferring genetic susceptibility to Alzheimer's disease
Directory of Open Access Journals (Sweden)
Miguel eCalero
2015-04-01
Full Text Available Familial Alzheimer's disease (AD, mostly associated with early onset, is caused by mutations in three genes (APP, PSEN1 and PSEN2 involved in the production of the amyloid peptide. In contrast, the molecular mechanisms that trigger the most common late onset sporadic AD remain largely unknown. With the implementation of an increasing number of case-control studies and the upcoming of large-scale genome-wide association studies (GWAS there is a mounting list of genetic risk factors associated to common genetic variants that have been associated to sporadic AD. Besides APOE, that presents a strong association with the disease (OR~4, the rest of these genes have moderate or low degrees of association, with OR ranging from 0.88 to 1.23. Taking together, these genes may account only for a fraction of the attributable AD risk and therefore, rare variants and epistastic gene interactions should be taken into account in order to get the full picture of the genetic risks associated to AD. Here, we review recent whole-exome studies looking for rare variants, somatic brain mutations with a strong association to the disease, and several studies dealing with epistasis as additional mechanisms conferring genetic susceptibility to AD. Altogether, recent evidence underlines the importance of defining molecular and genetic pathways and networks rather than the contribution of specific genes.
Digital sorting of complex tissues for cell type-specific gene expression profiles.
Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong
2013-03-07
Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.
Directory of Open Access Journals (Sweden)
L Rupa
2016-01-01
Full Text Available Context: Two novel proteins/genes Rv0679c and Rv0180c of Mycobacterium tuberculosis (MTB H37Rv were classified as a hypothetical membrane and transmembrane proteins which might have a role in the invasion. Molecular analysis of these genes in human clinical isolates of pulmonary tuberculosis (PTB patients was not well characterised. Aims: To assess the molecular diversity of Rv0679c and Rv0180c genes of MTB from clinical isolates of PTB patients. Settings and Design: DNA from 97 clinical isolates was extracted and subjected to amplification using selective primers by polymerase chain reaction (PCR. The PCR product obtained was sequenced commercially. Patients and Methods: Clinical isolates obtained from tuberculosis patients were investigated for polymorphisms in the Rv0679c and Rv0180c genes by PCR and DNA sequencing. Genomic DNA isolated by cetyltrimethylammonium bromide method was used for amplification of genes. Results: Rv0679c gene was highly conserved in 61 out of 65 clinical isolates assessed for sequence homology with wild-type H37Rv gene and was identical using ClustalW. Fifty-five out of 78 (70.5% clinical isolates assessed for Rv0180c were positive for single nucleotide polymorphism (SNP at 258th position where the nucleotide G was replaced with T (G to T. In clinical isolates of untreated cases, the frequency was 54.5% for SNP at 258th position which is low compared to cases undergoing treatment where the frequency was 73.1%. Conclusions: Molecular analysis of Rv0180c in clinical isolates of PTB assessed in this study was the first report, where an SNP at 258th position G to T was identified within the gene. Rv0679c gene was highly conserved (94%, within Indian clinical isolates as compared to reports from other nations.
Pulmonary capillary pressure in pulmonary hypertension.
Souza, Rogerio; Amato, Marcelo Britto Passos; Demarzo, Sergio Eduardo; Deheinzelin, Daniel; Barbas, Carmen Silvia Valente; Schettino, Guilherme Paula Pinto; Carvalho, Carlos Roberto Ribeiro
2005-04-01
Pulmonary capillary pressure (PCP), together with the time constants of the various vascular compartments, define the dynamics of the pulmonary vascular system. Our objective in the present study was to estimate PCPs and time constants of the vascular system in patients with idiopathic pulmonary arterial hypertension (IPAH), and compare them with these measures in patients with acute respiratory distress syndrome (ARDS). We conducted the study in two groups of patients with pulmonary hypertension: 12 patients with IPAH and 11 with ARDS. Four methods were used to estimate the PCP based on monoexponential and biexponential fitting of pulmonary artery pressure decay curves. PCPs in the IPAH group were considerably greater than those in the ARDS group. The PCPs measured using the four methods also differed significantly, suggesting that each method measures the pressure at a different site in the pulmonary circulation. The time constant for the slow component of the biexponential fit in the IPAH group was significantly longer than that in the ARDS group. The PCP in IPAH patients is greater than normal but methodological limitations related to the occlusion technique may limit interpretation of these data in isolation. Different disease processes may result in different times for arterial emptying, with resulting implications for the methods available for estimating PCP.
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene.
Pharo, Elizabeth A; De Leo, Alison A; Renfree, Marilyn B; Thomson, Peter C; Lefèvre, Christophe M; Nicholas, Kevin R
2012-06-08
The marsupial early lactation protein (ELP) gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A). Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI) protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI)-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1) and early lactation (Phase 2A). The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI), spleen trypsin inhibitor (STI) and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5) genes. Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
38 CFR 3.370 - Pulmonary tuberculosis shown by X-ray in active service.
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Pulmonary tuberculosis... Rating Considerations Relative to Specific Diseases § 3.370 Pulmonary tuberculosis shown by X-ray in... connection for pulmonary tuberculosis. When under consideration, all available service department films and...
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD
Directory of Open Access Journals (Sweden)
Chen Xiaoheng
2017-01-01
Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.
Controlling nuclear JAKs and STATs for specific gene activation by IFNγ
International Nuclear Information System (INIS)
Noon-Song, Ezra N.; Ahmed, Chulbul M.; Dabelic, Rea; Canton, Johnathan; Johnson, Howard M.
2011-01-01
Highlights: → Gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interact with the promoter region of IFNγ-associated genes along with transcription factor STAT1α. → We show that activated Janus kinases pJAK2 and pJAK1 also associate with IFNGR1 in the nucleus. → The activated Janus kinases are responsible for phosphorylation of tyrosine 41 on histone H3, an important epigenetic event for specific gene activation. -- Abstract: We previously showed that gamma interferon (IFNγ) and its receptor subunit, IFNGR1, interacted with the promoter region of IFNγ-activated genes along with transcription factor STAT1α. Recent studies have suggested that activated Janus kinases pJAK2 and pJAK1 also played a role in gene activation by phosphorylation of histone H3 on tyrosine 41. This study addresses the question of the role of activated JAKs in specific gene activation by IFNγ. We carried out chromatin immunoprecipitation (ChIP) followed by PCR in IFNγ treated WISH cells and showed association of pJAK1, pJAK2, IFNGR1, and STAT1 on the same DNA sequence of the IRF-1 gene promoter. The β-actin gene, which is not activated by IFNγ, did not show this association. The movement of activated JAK to the nucleus and the IRF-1 promoter was confirmed by the combination of nuclear fractionation, confocal microscopy and DNA precipitation analysis using the biotinylated GAS promoter. Activated JAKs in the nucleus was associated with phosphorylated tyrosine 41 on histone H3 in the region of the GAS promoter. Unphosphorylated JAK2 was found to be constitutively present in the nucleus and was capable of undergoing activation in IFNγ treated cells, most likely via nuclear IFNGR1. Association of pJAK2 and IFNGR1 with histone H3 in IFNγ treated cells was demonstrated by histone H3 immunoprecipitation. Unphosphorylated STAT1 protein was associated with histone H3 of untreated cells. IFNγ treatment resulted in its disassociation and then re-association as pSTAT1. The
Walsh, Jennifer; Mills, Simon
2013-01-01
The fourth annual European Paediatric Formulation Initiative (EuPFI) conference on Formulating Better Medicines for Children was held on 19-20 September 2012 at the Institute of Molecular Genetics Congress Centre, Prague, Czech Republic. The 2-day conference concentrated on the latest advances, challenges and opportunities for developing medicinal products and administration devices for pediatric use, both from European and US perspectives. It was aimed specifically at providing exposure to emerging practical applications, and for illustrating remedies utilized by pediatric drug-development teams to overcome hurdles faced in developing medicines for pediatric patients. The conference format included plenary talks, focus sessions on each of the EuPFI work streams (extemporaneous preparations, excipients, pediatric administration devices, taste masking and taste assessment, age-appropriate formulations), case studies, soapbox sessions and a parallel poster display. This conference report summarizes the keynote lectures and also gives a flavor of other presentations and posters from the conference.
Use of toxicogenomics for identifying genetic markers of pulmonary oedema
International Nuclear Information System (INIS)
Balharry, Dominique; Oreffo, Victor; Richards, Roy
2005-01-01
This study was undertaken primarily to identify genetic markers of oedema and inflammation. Mild pulmonary injury was induced following the instillation of the oedema-producing agent, bleomycin (0.5 units). Oedema was then confirmed by conventional toxicology (lavage protein levels, free cell counts and lung/body weight ratios) and histology 3 days post-bleomycin instillation.The expression profile of 1176 mRNA species was determined for bleomycin-exposed lung (Clontech Atlas macroarray, n = 9). To obtain pertinent results from these data, it was necessary to develop a simple, effective method for bioinformatic analysis of altered gene expression. Data were log 10 transformed followed by global normalisation. Differential gene expression was accepted if: (a) genes were statistically significant (P ≤ 0.05) from a two-tailed t test; (b) genes were consistently outside a two standard deviation (SD) range from control levels. A combination of these techniques identified 31 mRNA transcripts (approximately 3%) which were significantly altered in bleomycin treated tissue. Of these genes, 26 were down-regulated whilst only five were up-regulated. Two distinct clusters were identified, with 17 genes classified as encoding hormone receptors, and nine as encoding ion channels. Both these clusters were consistently down-regulated.The magnitude of the changes in gene expression were quantified and confirmed by Q-PCR (n = 6), validating the macroarray data and the bioinformatic analysis employed.In conclusion, this study has developed a suitable macroarray analysis procedure and provides the basis for a better understanding of the gene expression changes occurring during the early phase of drug-induced pulmonary oedema
... congestion; Lung water; Pulmonary congestion; Heart failure - pulmonary edema ... Pulmonary edema is often caused by congestive heart failure . When the heart is not able to pump efficiently, blood ...
Recent advances in chitosan-based nanoparticulate pulmonary drug delivery
Islam, Nazrul; Ferro, Vito
2016-07-01
The advent of biodegradable polymer-encapsulated drug nanoparticles has made the pulmonary route of administration an exciting area of drug delivery research. Chitosan, a natural biodegradable and biocompatible polysaccharide has received enormous attention as a carrier for drug delivery. Recently, nanoparticles of chitosan (CS) and its synthetic derivatives have been investigated for the encapsulation and delivery of many drugs with improved targeting and controlled release. Herein, recent advances in the preparation and use of micro-/nanoparticles of chitosan and its derivatives for pulmonary delivery of various therapeutic agents (drugs, genes, vaccines) are reviewed. Although chitosan has wide applications in terms of formulations and routes of drug delivery, this review is focused on pulmonary delivery of drug-encapsulated nanoparticles of chitosan and its derivatives. In addition, the controversial toxicological effects of chitosan nanoparticles for lung delivery will also be discussed.
Reversal of reflex pulmonary vasoconstriction induced by main pulmonary arterial distension.
Juratsch, C E; Grover, R F; Rose, C E; Reeves, J T; Walby, W F; Laks, M M
1985-04-01
Distension of the main pulmonary artery (MPA) induces pulmonary hypertension, most probably by neurogenic reflex pulmonary vasoconstriction, although constriction of the pulmonary vessels has not actually been demonstrated. In previous studies in dogs with increased pulmonary vascular resistance produced by airway hypoxia, exogenous arachidonic acid has led to the production of pulmonary vasodilator prostaglandins. Hence, in the present study, we investigated the effect of arachidonic acid in seven intact anesthetized dogs after pulmonary vascular resistance was increased by MPA distention. After steady-state pulmonary hypertension was established, arachidonic acid (1.0 mg/min) was infused into the right ventricle for 16 min; 15-20 min later a 16-mg bolus of arachidonic acid was injected. MPA distension was maintained throughout the study. Although the infusion of arachidonic acid significantly lowered the elevated pulmonary vascular resistance induced by MPA distension, the pulmonary vascular resistance returned to control levels only after the bolus injection of arachidonic acid. Notably, the bolus injection caused a biphasic response which first increased the pulmonary vascular resistance transiently before lowering it to control levels. In dogs with resting levels of pulmonary vascular resistance, administration of arachidonic acid in the same manner did not alter the pulmonary vascular resistance. It is concluded that MPA distension does indeed cause reflex pulmonary vasoconstriction which can be reversed by vasodilator metabolites of arachidonic acid. Even though this reflex may help maintain high pulmonary vascular resistance in the fetus, its function in the adult is obscure.
The role of microRNA-155/liver X receptor pathway in experimental and idiopathic pulmonary fibrosis.
Kurowska-Stolarska, Mariola; Hasoo, Manhl K; Welsh, David J; Stewart, Lynn; McIntyre, Donna; Morton, Brian E; Johnstone, Steven; Miller, Ashley M; Asquith, Darren L; Millar, Neal L; Millar, Ann B; Feghali-Bostwick, Carol A; Hirani, Nikhil; Crick, Peter J; Wang, Yuqin; Griffiths, William J; McInnes, Iain B; McSharry, Charles
2017-06-01
Idiopathic pulmonary fibrosis (IPF) is progressive and rapidly fatal. Improved understanding of pathogenesis is required to prosper novel therapeutics. Epigenetic changes contribute to IPF; therefore, microRNAs may reveal novel pathogenic pathways. We sought to determine the regulatory role of microRNA (miR)-155 in the profibrotic function of murine lung macrophages and fibroblasts, IPF lung fibroblasts, and its contribution to experimental pulmonary fibrosis. Bleomycin-induced lung fibrosis in wild-type and miR-155 -/- mice was analyzed by histology, collagen, and profibrotic gene expression. Mechanisms were identified by in silico and molecular approaches and validated in mouse lung fibroblasts and macrophages, and in IPF lung fibroblasts, using loss-and-gain of function assays, and in vivo using specific inhibitors. miR-155 -/- mice developed exacerbated lung fibrosis, increased collagen deposition, collagen 1 and 3 mRNA expression, TGF-β production, and activation of alternatively activated macrophages, contributed by deregulation of the miR-155 target gene the liver X receptor (LXR)α in lung fibroblasts and macrophages. Inhibition of LXRα in experimental lung fibrosis and in IPF lung fibroblasts reduced the exacerbated fibrotic response. Similarly, enforced expression of miR-155 reduced the profibrotic phenotype of IPF and miR-155 -/- fibroblasts. We describe herein a molecular pathway comprising miR-155 and its epigenetic LXRα target that when deregulated enables pathogenic pulmonary fibrosis. Manipulation of the miR-155/LXR pathway may have therapeutic potential for IPF. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
TB; Tuberculosis - pulmonary; Mycobacterium - pulmonary ... Pulmonary TB is caused by the bacterium Mycobacterium tuberculosis (M tuberculosis) . TB is contagious. This means the bacteria is easily spread from an infected person ...
We have recently demonstrated that PM containing water-soluble zinc may cause cardiac injury following pulmonary exposure. To investigate if pulmonary zinc exposure causes systemic metal imbalance and direct cardiac effects, we intratracheally (IT) instilled male Wistar Kyoto (WK...
Lineage-specific enhancers activate self-renewal genes in macrophages and embryonic stem cells.
Soucie, Erinn L; Weng, Ziming; Geirsdóttir, Laufey; Molawi, Kaaweh; Maurizio, Julien; Fenouil, Romain; Mossadegh-Keller, Noushine; Gimenez, Gregory; VanHille, Laurent; Beniazza, Meryam; Favret, Jeremy; Berruyer, Carole; Perrin, Pierre; Hacohen, Nir; Andrau, J-C; Ferrier, Pierre; Dubreuil, Patrice; Sidow, Arend; Sieweke, Michael H
2016-02-12
Differentiated macrophages can self-renew in tissues and expand long term in culture, but the gene regulatory mechanisms that accomplish self-renewal in the differentiated state have remained unknown. Here we show that in mice, the transcription factors MafB and c-Maf repress a macrophage-specific enhancer repertoire associated with a gene network that controls self-renewal. Single-cell analysis revealed that, in vivo, proliferating resident macrophages can access this network by transient down-regulation of Maf transcription factors. The network also controls embryonic stem cell self-renewal but is associated with distinct embryonic stem cell-specific enhancers. This indicates that distinct lineage-specific enhancer platforms regulate a shared network of genes that control self-renewal potential in both stem and mature cells. Copyright © 2016, American Association for the Advancement of Science.
Carlsbecker, Annelie; Sundström, Jens; Tandre, Karolina; Englund, Marie; Kvarnheden, Anders; Johanson, Urban; Engström, Peter
2003-01-01
Transcription factors encoded by different members of the MADS-box gene family have evolved central roles in the regulation of reproductive organ development in the flowering plants, the angiosperms. Development of the stamens and carpels, the pollen- and seed-bearing organs, involves the B- and C-organ-identity MADS-box genes. B- and C-type gene orthologs with activities specifically in developing pollen- and seed-bearing organs are also present in the distantly related gymnosperms: the conifers and the gnetophytes. We now report on the characterization of DAL10, a novel MADS-box gene from the conifer Norway spruce, which unlike the B- and C-type conifer genes shows no distinct orthology relationship to any angiosperm gene or clade in phylogenetic analyses. Like the B- and C-type genes, it is active specifically in developing pollen cones and seed cones. In situ RNA localization experiments show DAL10 to be expressed in the cone axis, which carry the microsporophylls of the young pollen cone. In contrast, in the seed cone it is expressed both in the cone axis and in the bracts, which subtend the ovuliferous scales. Expression data and the phenotype of transgenic Arabidopsis plants expressing DAL10 suggest that the gene may act upstream to or in concert with the B- and C-type genes in the establishment of reproductive identity of developing cones.
Transgenic strategies to confer resistance against viruses in rice plants
Directory of Open Access Journals (Sweden)
Takahide eSasaya
2014-01-01
Full Text Available Rice (Oryza sativa L. is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. In an effort to improve control, many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA-interference (RNAi, also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral Achilles’ heel gene to target for RNAi attack when engineering plants.
Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane
2004-04-01
The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cell-type-specific gene delivery into neuronal cells in vitro and in vivo
International Nuclear Information System (INIS)
Parveen, Zahida; Mukhtar, Muhammad; Rafi, Mohammed; Wenger, David A.; Siddiqui, Khwaja M.; Siler, Catherine A.; Dietzschold, Bernhard; Pomerantz, Roger J.; Schnell, Matthias J.; Dornburg, Ralph
2003-01-01
The avian retroviruses reticuloendotheliosis virus strain A (REV-A) and spleen necrosis virus (SNV) are not naturally infectious in human cells. However, REV-A-derived viral vectors efficiently infect human cells when they are pseudotyped with envelope proteins displaying targeting ligands specific for human cell-surface receptors. Here we report that vectors containing the gag region of REV-A and pol of SNV can be pseudotyped with the envelope protein of vesicular stomatitis virus (VSV) and the glycoproteins of different rabies virus (RV) strains. Vectors pseudotyped with the envelope protein of the highly neurotropic RV strain CVS-N2c facilitated cell type-specific gene delivery into mouse and human neurons, but did not infect other human cell types. Moreover, when such vector particles were injected into the brain of newborn mice, only neuronal cells were infected in vivo. Cell-type-specific gene delivery into neurons may present quite specific gene therapy approaches for many degenerative diseases of the brain
Genetically increased antioxidative protection and decreased chronic obstructive pulmonary disease
DEFF Research Database (Denmark)
Juul, Klaus; Tybjærg-Hansen, Anne; Marklund, Stefan
2006-01-01
RATIONALE: Increased oxidative stress is involved in chronic obstructive pulmonary disease (COPD); however, plasma and bronchial lining fluid contains the antioxidant extracellular superoxide dismutase. Approximately 2% of white individuals carry the R213G polymorphism in the gene encoding extrac...
Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile
2011-07-01
Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the
Directory of Open Access Journals (Sweden)
Philippe Ganot
2011-07-01
Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both
Pulmonary Hyalinizing Granuloma Associated with Idiopathic Thrombocytopenic Purpura
Directory of Open Access Journals (Sweden)
Christopher Coleman
2014-01-01
Full Text Available Pulmonary hyalinizing granuloma (PHG is a rare, benign lung disease of unknown etiology. It manifests as discrete, rounded nodules within the lung parenchyma. A 39-year-old woman presented for investigation after pulmonary nodules were found incidentally. Chest computed tomography showed multiple, discrete, non-enhancing pulmonary nodules bilaterally. Positron emission tomography (PET was negative. Biopsy demonstrated a non-specific lymphoplasmacytic infiltrate. Open resection yielded two nodules consistent with hyalinizing granulomas. The differential for multiple pulmonary nodules is broad. PET scan can help rule out metastatic disease, although some cancers are not hypermetabolic on PET. Furthermore, some non-malignant conditions, including hyalinizing granuloma, can show increased activity on PET. PHG should be included in the differential of multiple pulmonary nodules, especially if nodule stability can be demonstrated and/or needle biopsies are non-diagnostic. Associated immune-mediated conditions, such as idiopathic thrombocytopenic purpura (ITP in our patient, may also favor HG. In this case report we find an association between PHG and ITP.
Specific genetic modifications of domestic animals by gene targeting and animal cloning
Directory of Open Access Journals (Sweden)
Zhou Jiangfeng
2003-11-01
Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.
Energy Technology Data Exchange (ETDEWEB)
Wu, Dan, E-mail: danw@bjmu.edu.cn [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Liu, Jing; Wu, Baiyan [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Tu, Bo; Zhu, Weiguo [Department of Biochemistry and Molecular Biology, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Luo, Jianyuan, E-mail: jluo@som.umaryland.edu [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Department of Medical and Research Technology, School of Medicine, University of Maryland, Baltimore 21201 (United States)
2014-04-25
Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration.
International Nuclear Information System (INIS)
Wu, Dan; Liu, Jing; Wu, Baiyan; Tu, Bo; Zhu, Weiguo; Luo, Jianyuan
2014-01-01
Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration
International Nuclear Information System (INIS)
Zychowski, Katherine E.; Lucas, Selita N.; Sanchez, Bethany; Herbert, Guy; Campen, Matthew J.
2016-01-01
Ozone (O 3 )-related cardiorespiratory effects are a growing public health concern. Ground level O 3 can exacerbate pre-existing respiratory conditions; however, research regarding therapeutic interventions to reduce O 3 -induced lung injury is limited. In patients with chronic obstructive pulmonary disease, hypoxia-associated pulmonary hypertension (HPH) is a frequent comorbidity that is difficult to treat clinically, yet associated with increased mortality and frequency of exacerbations. In this study, we hypothesized that established HPH would confer vulnerability to acute O 3 pulmonary toxicity. Additionally, we tested whether improvement of pulmonary endothelial barrier integrity via rho-kinase inhibition could mitigate pulmonary inflammation and injury. To determine if O 3 exacerbated HPH, male C57BL/6 mice were subject to either 3 weeks continuous normoxia (20.9% O 2 ) or hypoxia (10.0% O 2 ), followed by a 4-h exposure to either 1 ppm O 3 or filtered air (FA). As an additional experimental intervention fasudil (20 mg/kg) was administered intraperitoneally prior to and after O 3 exposures. As expected, hypoxia significantly increased right ventricular pressure and hypertrophy. O 3 exposure in normoxic mice caused lung inflammation but not injury, as indicated by increased cellularity and edema in the lung. However, in hypoxic mice, O 3 exposure led to increased inflammation and edema, along with a profound increase in airway hyperresponsiveness to methacholine. Fasudil administration resulted in reduced O 3 -induced lung injury via the enhancement of pulmonary endothelial barrier integrity. These results indicate that increased pulmonary vascular pressure may enhance lung injury, inflammation and edema when exposed to pollutants, and that enhancement of pulmonary endothelial barrier integrity may alleviate such vulnerability. - Highlights: • Environmental exposures can exacerbate chronic obstructive pulmonary disease (COPD). • It is unknown if comorbid
Directory of Open Access Journals (Sweden)
Xia Wang
Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.
Wu, Mengmeng; Lin, Zhixiang; Ma, Shining; Chen, Ting; Jiang, Rui; Wong, Wing Hung
2017-12-01
Although genome-wide association studies (GWAS) have successfully identified thousands of genomic loci associated with hundreds of complex traits in the past decade, the debate about such problems as missing heritability and weak interpretability has been appealing for effective computational methods to facilitate the advanced analysis of the vast volume of existing and anticipated genetic data. Towards this goal, gene-level integrative GWAS analysis with the assumption that genes associated with a phenotype tend to be enriched in biological gene sets or gene networks has recently attracted much attention, due to such advantages as straightforward interpretation, less multiple testing burdens, and robustness across studies. However, existing methods in this category usually exploit non-tissue-specific gene networks and thus lack the ability to utilize informative tissue-specific characteristics. To overcome this limitation, we proposed a Bayesian approach called SIGNET (Simultaneously Inference of GeNEs and Tissues) to integrate GWAS data and multiple tissue-specific gene networks for the simultaneous inference of phenotype-associated genes and relevant tissues. Through extensive simulation studies, we showed the effectiveness of our method in finding both associated genes and relevant tissues for a phenotype. In applications to real GWAS data of 14 complex phenotypes, we demonstrated the power of our method in both deciphering genetic basis and discovering biological insights of a phenotype. With this understanding, we expect to see SIGNET as a valuable tool for integrative GWAS analysis, thereby boosting the prevention, diagnosis, and treatment of human inherited diseases and eventually facilitating precision medicine.
Rivers-Bowerman, Michael D; Zener, Rebecca; Jaberi, Arash; de Perrot, Marc; Granton, John; Moriarty, John M; Tan, Kong T
2017-09-01
Chronic thromboembolic pulmonary hypertension (CTEPH) is an underdiagnosed potential complication of acute or recurrent pulmonary thromboembolic disease. Multiple studies suggest that up to 5% of patients with acute pulmonary thromboembolic disease go on to develop CTEPH. The prognosis of untreated CTEPH is poor, but advances in medical and surgical treatments over the past few decades have improved patient outcomes. The gold standard and curative treatment for CTEPH is pulmonary endarterectomy; however, some patients are inoperable and others who have undergone pulmonary endarterectomy experience persistent or recurrent pulmonary hypertension despite medical therapy. In recent years, balloon pulmonary angioplasty has emerged as a primary and adjunctive treatment for these CTEPH patients at expert or specialized centers. This review outlines an approach to balloon pulmonary angioplasty for CTEPH, including clinical presentation and evaluation; patient selection and indications; treatment planning; equipment and technique; overcoming technical challenges; recognition and management of complications; postprocedural care and clinical follow-up; and expected outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.
Glass, Edmund R; Dozmorov, Mikhail G
2016-10-06
The goal of many human disease-oriented studies is to detect molecular mechanisms different between healthy controls and patients. Yet, commonly used gene expression measurements from blood samples suffer from variability of cell composition. This variability hinders the detection of differentially expressed genes and is often ignored. Combined with cell counts, heterogeneous gene expression may provide deeper insights into the gene expression differences on the cell type-specific level. Published computational methods use linear regression to estimate cell type-specific differential expression, and a global cutoff to judge significance, such as False Discovery Rate (FDR). Yet, they do not consider many artifacts hidden in high-dimensional gene expression data that may negatively affect linear regression. In this paper we quantify the parameter space affecting the performance of linear regression (sensitivity of cell type-specific differential expression detection) on a per-gene basis. We evaluated the effect of sample sizes, cell type-specific proportion variability, and mean squared error on sensitivity of cell type-specific differential expression detection using linear regression. Each parameter affected variability of cell type-specific expression estimates and, subsequently, the sensitivity of differential expression detection. We provide the R package, LRCDE, which performs linear regression-based cell type-specific differential expression (deconvolution) detection on a gene-by-gene basis. Accounting for variability around cell type-specific gene expression estimates, it computes per-gene t-statistics of differential detection, p-values, t-statistic-based sensitivity, group-specific mean squared error, and several gene-specific diagnostic metrics. The sensitivity of linear regression-based cell type-specific differential expression detection differed for each gene as a function of mean squared error, per group sample sizes, and variability of the proportions
International Nuclear Information System (INIS)
Lee, Young Rahn; Kang, Eun Young; Lee, Nam Joon; Suh, Won Hyuck
1991-01-01
Pulmonary lymphangioleiomyomatosis is a very rare disease mainly arising in reproductive-aged women. Pulmonary lymphangioleiomyomatosis as a pulmonary involvement of tuberous sclerosis is found in only 1 out of 100 patients. Pulmonary involvement in pulmonary lymphangioleiomyomatosis itself and that as a pulmonary manifestation of tuberous sclerosis has been considered very similar with regard to clinical, radiologic, and pathologic manifestations. We report 1 case of pulmonary lymphangioleiomyomatosis as a pulmonary manifestation of tuberous sclerosis in a 39-year-old Korean woman
National Research Council Canada - National Science Library
Curiel, David T; Siegal, Gene; Wang, Minghui
2007-01-01
...) to achieve efficient and selective gene transfer to target tumor cells. Proposed herein is a strategy to modify one candidate vector, recombinant adenovirus, such that it embodies the requisite properties of efficacy and specificity...
Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C
2016-08-01
Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Preliminary studies of pulmonary perfusion scanning in patients with pulmonary hypertension
International Nuclear Information System (INIS)
Shi Rongfang; Liu Xiujie; Wang Yanqun
1986-01-01
A comparative analysis of pulmonary perfusion scanning through cardiac catheterization of 57 patients including 32 patients with congenital heart disease, 8 patients with chronic pulmonary thromboembolism and 7 patients with primary pulmonary hypertension is reported. The lung scintigram obtained with In-113m or Tc-99m-MAA represents the distribution of pulmonary blood. It has been found that the lung scintigram was abnormal in patients of congenital heart disease with pulmonary hypertension (i. e. pulmonary artery pressure between 41-80 mmHg) and the extent of radoiactive regional defects is proportional to the level of pulmonary hypertension. The results of the analysis indicated that pulmonary perfusion scanning being a noninvasive technique would be a useful method in evaluating the level of pulmonary hypertension in patients with left to right shunt before and after surgical operation
Energy Technology Data Exchange (ETDEWEB)
Yildiz, O.A.; Gulbay, B.E.; Saryal, S.; Karabiylkoglu, G. [Ankara University, Ankara (Turkey). School of Medicine
2007-05-15
The aim of this study was to investigate the effect of the radiological evidence of emphysema, and the extent of interstitial involvement, on lung function and pulmonary arterial pressure (PAP) in patients with coal workers' pneumoconiosis (CWP). All patients showed a mild decrease in FEV1/FVC and a mild increase in FRC. Forty-four per cent of patients developed mild to moderate pulmonary hypertension. Emphysema scores correlated significantly with airflow rates, including FEV1%, FEV1/FVC and FEF25-75%, and with carbon monoxide diffusing capacity (DLCO)% predicted as well as FRC% predicted and the ratio RV/TLC, which are indices of air trapping. Additionally, profusion and global profusion scores showed significant correlation with FEV1/FVC, DLCO% predicted, specific airway conductance and smoking. Mean PAP showed a significant negative correlation with FEF50% predicted, DLCO% predicted and profusion score. The impairment of pulmonary function (mainly disturbance in airflow rates and air trapping) and pulmonary hypertension may be present, even in a simple form of CWP. The pulmonary function impairment in patients with CWP is likely to be attributable to the occurrence of emphysema. However, pulmonary hypertension was directly related to the profusion of pneumoconiotic nodules, which may result in obliteration of the vascular bed.
Directory of Open Access Journals (Sweden)
Lee Hoyong
2006-12-01
Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
Wang, Jun; Zeng, Xuan; Tian, Dongsheng; Yang, Xiaobei; Wang, Lanlan; Yin, Zhongchao
2018-03-30
Transcription activator-like effector (TALE)-dependent dominant disease resistance (R) genes in plants, also referred to as executor R genes, are induced on infection by phytopathogenic bacteria of the genus Xanthomonas harbouring the corresponding TALE genes. Unlike the traditional R proteins, the executor R proteins do not determine the resistance specificity and may function broadly in different plant species. The executor R gene Bs4C-R in the resistant genotype PI 235047 of the pepper species Capsicum pubescens (CpBs4C-R) confers disease resistance to Xanthomonas campestris pv. vesicatoria (Xcv) harbouring the TALE genes avrBsP/avrBs4. In this study, the synthetic genes of CpBs4C-R and two other Bs4C-like genes, the susceptible allele in the genotype PI585270 of C. pubescens (CpBs4C-S) and the CaBs4C-R homologue gene in the cultivar 'CM334' of Capsicum annum (CaBs4C), were characterized in tobacco (Nicotiana benthamiana) and rice (Oryza sativa). The Bs4C genes induced cell death in N. benthamiana. The functional Bs4C-eCFP fusion proteins were localized to the endoplasmic reticulum (ER) membrane in the leaf epidermal cells of N. benthamiana. The Xa10 promoter-Bs4C fusion genes in transgenic rice conferred strain-specific disease resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of bacterial blight in rice, and were specifically induced by the Xa10-incompatible Xoo strain PXO99 A (pHM1avrXa10). The results indicate that the Bs4C proteins from pepper species function broadly in rice and the Bs4C protein-mediated cell death from the ER is conserved between dicotyledonous and monocotyledonous plants, which can be utilized to engineer novel and enhanced disease resistance in heterologous plants. © 2018 TEMASEK LIFE SCIENCES LABORATORY. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.
Mercier, Sandra; Küry, Sébastien; Salort-Campana, Emmanuelle; Magot, Armelle; Agbim, Uchenna; Besnard, Thomas; Bodak, Nathalie; Bou-Hanna, Chantal; Bréhéret, Flora; Brunelle, Perrine; Caillon, Florence; Chabrol, Brigitte; Cormier-Daire, Valérie; David, Albert; Eymard, Bruno; Faivre, Laurence; Figarella-Branger, Dominique; Fleurence, Emmanuelle; Ganapathi, Mythily; Gherardi, Romain; Goldenberg, Alice; Hamel, Antoine; Igual, Jeanine; Irvine, Alan D; Israël-Biet, Dominique; Kannengiesser, Caroline; Laboisse, Christian; Le Caignec, Cédric; Mahé, Jean-Yves; Mallet, Stéphanie; MacGowan, Stuart; McAleer, Maeve A; McLean, Irwin; Méni, Cécile; Munnich, Arnold; Mussini, Jean-Marie; Nagy, Peter L; Odel, Jeffrey; O'Regan, Grainne M; Péréon, Yann; Perrier, Julie; Piard, Juliette; Puzenat, Eve; Sampson, Jacinda B; Smith, Frances; Soufir, Nadem; Tanji, Kurenai; Thauvin, Christel; Ulane, Christina; Watson, Rosemarie M; Khumalo, Nonhlanhla P; Mayosi, Bongani M; Barbarot, Sébastien; Bézieau, Stéphane
2015-10-15
Hereditary Fibrosing Poikiloderma (HFP) with tendon contractures, myopathy and pulmonary fibrosis (POIKTMP [MIM 615704]) is a very recently described entity of syndromic inherited poikiloderma. Previously by using whole exome sequencing in five families, we identified the causative gene, FAM111B (NM_198947.3), the function of which is still unknown. Our objective in this study was to better define the specific features of POIKTMP through a larger series of patients. Clinical and molecular data of two families and eight independent sporadic cases, including six new cases, were collected. Key features consist of: (i) early-onset poikiloderma, hypotrichosis and hypohidrosis; (ii) multiple contractures, in particular triceps surae muscle contractures; (iii) diffuse progressive muscular weakness; (iv) pulmonary fibrosis in adulthood and (v) other features including exocrine pancreatic insufficiency, liver impairment and growth retardation. Muscle magnetic resonance imaging was informative and showed muscle atrophy and fatty infiltration. Histological examination of skeletal muscle revealed extensive fibroadipose tissue infiltration. Microscopy of the skin showed a scleroderma-like aspect with fibrosis and alterations of the elastic network. FAM111B gene analysis identified five different missense variants (two recurrent mutations were found respectively in three and four independent families). All the mutations were predicted to localize in the trypsin-like cysteine/serine peptidase domain of the protein. We suggest gain-of-function or dominant-negative mutations resulting in FAM111B enzymatic activity changes. HFP with tendon contractures, myopathy and pulmonary fibrosis, is a multisystemic disorder due to autosomal dominant FAM111B mutations. Future functional studies will help in understanding the specific pathological process of this fibrosing disorder.
Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc
2016-01-01
Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611
Pathogenetics of alveolar capillary dysplasia with misalignment of pulmonary veins
Szafranski, P.; Gambin, T.; Dharmadhikari, A.V.; Akdemir, K.C.; Jhangiani, S.N.; Schuette, J.; Godiwala, N.; Yatsenko, S.A.; Sebastian, J.; Madan-Khetarpal, S.; Surti, U.; Abellar, R.G.; Bateman, D.A.; Wilson, A.L.; Markham, M.H.; Slamon, J.; Santos-Simarro, F.; Palomares, M.; Nevado, J.; Lapunzina, P.; Chung, B.H.; Wong, W.L.; Chu, Y.W.; Mok, G.T.; Kerem, E.; Reiter, J.; Ambalavanan, N.; Anderson, S.A.; Kelly, D.R.; Shieh, J.; Rosenthal, T.C.; Scheible, K.; Steiner, L.; Iqbal, M.A.; McKinnon, M.L.; Hamilton, S.J.; Schlade-Bartusiak, K.; English, D.; Hendson, G.; Roeder, E.R.; DeNapoli, T.S.; Littlejohn, R.O.; Wolff, D.J.; Wagner, C.L.; Yeung, A.; Francis, D.; Fiorino, E.K.; Edelman, M.; Fox, J.; Hayes, D.A.; Janssens, S.; Baere, E. De; Menten, B.; Loccufier, A.; Vanwalleghem, L.; Moerman, P.; Sznajer, Y.; Lay, A.S.; Kussmann, J.L.; Chawla, J.; Payton, D.J.; Phillips, G.E.; Brosens, E.; Tibboel, D.; Klein, A.; Maystadt, I.; Fisher, R.; Sebire, N.; Male, A.; Chopra, M.; Pinner, J.; Malcolm, G.; Peters, G.; Arbuckle, S.; Lees, M.; Mead, Z.; Quarrell, O.; Sayers, R.; Owens, M.; Shaw-Smith, C.; Lioy, J.; McKay, E.; Leeuw, N. de; Feenstra, I.; Spruijt, L.; Elmslie, F.; Thiruchelvam, T.; Bacino, C.A.; Langston, C.; Lupski, J.R.; Sen, P.; Popek, E.; Stankiewicz, P.
2016-01-01
Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes
Directory of Open Access Journals (Sweden)
Simon H Apte
Full Text Available Vaccines against many pathogens for which conventional approaches have failed remain an unmet public health priority. Synthetic peptide-based vaccines offer an attractive alternative to whole protein and whole organism vaccines, particularly for complex pathogens that cause chronic infection. Previously, we have reported a promising lipid core peptide (LCP vaccine delivery system that incorporates the antigen, carrier, and adjuvant in a single molecular entity. LCP vaccines have been used to deliver several peptide subunit-based vaccine candidates and induced high titre functional antibodies and protected against Group A streptococcus in mice. Herein, we have evaluated whether LCP constructs incorporating defined CD4(+ and/or CD8(+ T cell epitopes could induce epitope-specific T cell responses and protect against pathogen challenge in a rodent malaria model. We show that LCP vaccines failed to induce an expansion of antigen-specific CD8(+ T cells following primary immunization or by boosting. We further demonstrated that the LCP vaccines induced a non-specific type 2 polarized cytokine response, rather than an epitope-specific canonical CD8(+ T cell type 1 response. Cytotoxic responses of unknown specificity were also induced. These non-specific responses were able to protect against parasite challenge. These data demonstrate that vaccination with lipid core peptides fails to induce canonical epitope-specific T cell responses, at least in our rodent model, but can nonetheless confer non-specific protective immunity against Plasmodium parasite challenge.
Solitary pulmonary nodule by pulmonary hematoma under warfarin therapy
International Nuclear Information System (INIS)
Scheppach, W.; Kulke, H.; Liebau, G.; Braun, H.; Wuerzburg Univ.
1983-01-01
Pulmonary hematoma is a rare cause of a pulmonary nodule. Mostly it results from penetrating or blunt chest injuries. The case of a patient is reported, whose chest X-ray showed a pulmonary nodule suspected of malignancy. This patient was maintained permanently on anticoagulants (warfarin derivates) after cardiac valve replacement with a prosthesis. A definite diagnosis could not be established by non-invasive methods. A needle biopsy of the lung was impracticable because of the location of the pulmonary lesion; an exploratory thoracotomy could not be carried out due to a general indication of nonoperability. Control examinations showed that the pulmonary nodule had vanished completely within four months. In consideration of the patient's clinical situation it can be concluded that the pulmonary lesion was caused by a hematoma of the lung. (orig.) [de
Solitary pulmonary nodule by pulmonary hematoma under warfarin therapy
Energy Technology Data Exchange (ETDEWEB)
Scheppach, W.; Kulke, H.; Liebau, G.; Braun, H.
1983-06-01
Pulmonary hematoma is a rare cause of a pulmonary nodule. Mostly it results from penetrating or blunt chest injuries. The case of a patient is reported, whose chest X-ray showed a pulmonary nodule suspected of malignancy. This patient was maintained permanently on anticoagulants (warfarin derivates) after cardiac valve replacement with a prosthesis. A definite diagnosis could not be established by non-invasive methods. A needle biopsy of the lung was impracticable because of the location of the pulmonary lesion; an exploratory thoracotomy could not be carried out due to a general indication of nonoperability. Control examinations showed that the pulmonary nodule had vanished completely within four months. In consideration of the patient's clinical situation it can be concluded that the pulmonary lesion was caused by a hematoma of the lung.
DEFF Research Database (Denmark)
Milani, Lili; Lundmark, Anders; Nordlund, Jessica
2008-01-01
To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...
The mammary gland-specific marsupial ELP and eutherian CTI share a common ancestral gene
Directory of Open Access Journals (Sweden)
Pharo Elizabeth A
2012-06-01
Full Text Available Abstract Background The marsupial early lactation protein (ELP gene is expressed in the mammary gland and the protein is secreted into milk during early lactation (Phase 2A. Mature ELP shares approximately 55.4% similarity with the colostrum-specific bovine colostrum trypsin inhibitor (CTI protein. Although ELP and CTI both have a single bovine pancreatic trypsin inhibitor (BPTI-Kunitz domain and are secreted only during the early lactation phases, their evolutionary history is yet to be investigated. Results Tammar ELP was isolated from a genomic library and the fat-tailed dunnart and Southern koala ELP genes cloned from genomic DNA. The tammar ELP gene was expressed only in the mammary gland during late pregnancy (Phase 1 and early lactation (Phase 2A. The opossum and fat-tailed dunnart ELP and cow CTI transcripts were cloned from RNA isolated from the mammary gland and dog CTI from cells in colostrum. The putative mature ELP and CTI peptides shared 44.6%-62.2% similarity. In silico analyses identified the ELP and CTI genes in the other species examined and provided compelling evidence that they evolved from a common ancestral gene. In addition, whilst the eutherian CTI gene was conserved in the Laurasiatherian orders Carnivora and Cetartiodactyla, it had become a pseudogene in others. These data suggest that bovine CTI may be the ancestral gene of the Artiodactyla-specific, rapidly evolving chromosome 13 pancreatic trypsin inhibitor (PTI, spleen trypsin inhibitor (STI and the five placenta-specific trophoblast Kunitz domain protein (TKDP1-5 genes. Conclusions Marsupial ELP and eutherian CTI evolved from an ancestral therian mammal gene before the divergence of marsupials and eutherians between 130 and 160 million years ago. The retention of the ELP gene in marsupials suggests that this early lactation-specific milk protein may have an important role in the immunologically naïve young of these species.
Elkington, Paul T G; Nuttall, Robert K; Boyle, Joseph J; O'Kane, Cecilia M; Horncastle, Donna E; Edwards, Dylan R; Friedland, Jon S
2005-12-15
Pulmonary cavitation is fundamental to the global success of Mycobacterium tuberculosis. However, the mechanisms of this lung destruction are poorly understood. The biochemistry of lung matrix predicts matrix metalloproteinase (MMP) involvement in immunopathology. We investigated gene expression of all MMPs, proteins with a disintegrin and metalloproteinase domain, and tissue inhibitors of metalloproteinases in M. tuberculosis-infected human macrophages by real-time polymerase chain reaction. MMP secretion was measured by zymography and Western analysis, and expression in patients with pulmonary tuberculosis was localized by immunohistochemistry. MMP-1 and MMP-7 gene expression and secretion are potently upregulated by M. tuberculosis, and no increase in tissue inhibitor of metalloproteinase expression occurs to oppose their activity. Dexamethasone completely suppresses MMP-1 but not MMP-7 gene expression and secretion. In patients with active tuberculosis, macrophages express MMP-1 and MMP-7 adjacent to areas of tissue destruction. MMP-1 but not MMP-7 expression and secretion are relatively M. tuberculosis specific, are not upregulated by tuberculosis-associated cytokines, and are prostaglandin dependent. In contrast, the vaccine M. bovis bacillus Calmette-Guérin (BCG) does not stimulate MMP-1 secretion from human macrophages, although M. tuberculosis and BCG do upregulate MMP-7 equally. BCG-infected macrophages secrete reduced prostaglandin E2 concentrations compared with M. tuberculosis-infected macrophages, and prostaglandin pathway supplementation augments MMP-1 secretion from BCG-infected cells. M. tuberculosis specifically upregulates MMP-1 in a cellular model of human infection and in patients with tuberculosis. In contrast, vaccine BCG, which does not cause lung cavitation, does not upregulate prostaglandin E2-dependent MMP-1 secretion.
Introduction to Pulmonary Fibrosis
... page: Introduction to Pulmonary Fibrosis What Is Pulmonary Fibrosis? Pulmonary fibrosis is a disease where there is scarring ... of pulmonary fibrosis. Learn more How Is Pulmonary Fibrosis Diagnosed? Pulmonary fibrosis can be difficult to diagnose, so it ...
International Conference on Intelligence and Learning
Das, J; O’Connor, Neil
1981-01-01
This volume contains the Proceedings of an International Conference on Intelligence and Learning held at York University, England, on July 16-20, 1979. The conference was made possible with the support and assistance of the following agencies: NAT 0 Scientific Division, specifically the Human Factors panel, was the major sponsor of the conference. Special thanks are due to Dr. B. A. Bayraktar, who helped organize the conference. Special appreciation is also expressed for the support of the University of York where the conference was held, the University of Alberta, the University of California, Los Angeles, the Medical Research Council, especially its Developmental Psychology Research U nit in London, and the British Council. The conference was jointly directed by J. P. Das and N. 0' Connor. The directors appreciate the assistance in administrative matters of Patricia Chobater and Emma Collins of the University of Alberta. The Editors of the Proceedings acknowledge and appreciate the following individuals who...
Specific Gene Loci of Clinical Pseudomonas putida Isolates.
Directory of Open Access Journals (Sweden)
Lázaro Molina
Full Text Available Pseudomonas putida are ubiquitous inhabitants of soils and clinical isolates of this species have been seldom described. Clinical isolates show significant variability in their ability to cause damage to hosts because some of them are able to modulate the host's immune response. In the current study, comparisons between the genomes of different clinical and environmental strains of P. putida were done to identify genetic clusters shared by clinical isolates that are not present in environmental isolates. We show that in clinical strains specific genes are mostly present on transposons, and that this set of genes exhibit high identity with genes found in pathogens and opportunistic pathogens. The set of genes prevalent in P. putida clinical isolates, and absent in environmental isolates, are related with survival under oxidative stress conditions, resistance against biocides, amino acid metabolism and toxin/antitoxin (TA systems. This set of functions have influence in colonization and survival within human tissues, since they avoid host immune response or enhance stress resistance. An in depth bioinformatic analysis was also carried out to identify genetic clusters that are exclusive to each of the clinical isolates and that correlate with phenotypical differences between them, a secretion system type III-like was found in one of these clinical strains, a determinant of pathogenicity in Gram-negative bacteria.
Directory of Open Access Journals (Sweden)
Edmund M T Lau
Full Text Available BACKGROUND: There is increasing recognition that pulmonary artery stiffness is an important determinant of right ventricular (RV afterload in pulmonary arterial hypertension (PAH. We used intravascular ultrasound (IVUS to evaluate the mechanical properties of the elastic pulmonary arteries (PA in subjects with PAH, and assessed the effects of PAH-specific therapy on indices of arterial stiffness. METHOD: Using IVUS and simultaneous right heart catheterisation, 20 pulmonary segments in 8 PAH subjects and 12 pulmonary segments in 8 controls were studied to determine their compliance, distensibility, elastic modulus and stiffness index β. PAH subjects underwent repeat IVUS examinations after 6-months of bosentan therapy. RESULTS: AT BASELINE, PAH SUBJECTS DEMONSTRATED GREATER STIFFNESS IN ALL MEASURED INDICES COMPARED TO CONTROLS: compliance (1.50±0.11×10(-2 mm(2/mmHg vs 4.49±0.43×10(-2 mm(2/mmHg, p<0.0001, distensibility (0.32±0.03%/mmHg vs 1.18±0.13%/mmHg, p<0.0001, elastic modulus (720±64 mmHg vs 198±19 mmHg, p<0.0001, and stiffness index β (15.0±1.4 vs 11.0±0.7, p = 0.046. Strong inverse exponential associations existed between mean pulmonary artery pressure and compliance (r(2 = 0.82, p<0.0001, and also between mean PAP and distensibility (r(2 = 0.79, p = 0.002. Bosentan therapy, for 6-months, was not associated with any significant changes in all indices of PA stiffness. CONCLUSION: Increased stiffness occurs in the proximal elastic PA in patients with PAH and contributes to the pathogenesis RV failure. Bosentan therapy may not be effective at improving PA stiffness.
Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature.
Directory of Open Access Journals (Sweden)
Samantha M Thomas
2015-05-01
Full Text Available Renewable in vitro cell cultures, such as lymphoblastoid cell lines (LCLs, have facilitated studies that contributed to our understanding of genetic influence on human traits. However, the degree to which cell lines faithfully maintain differences in donor-specific phenotypes is still debated. We have previously reported that standard cell line maintenance practice results in a loss of donor-specific gene expression signatures in LCLs. An alternative to the LCL model is the induced pluripotent stem cell (iPSC system, which carries the potential to model tissue-specific physiology through the use of differentiation protocols. Still, existing LCL banks represent an important source of starting material for iPSC generation, and it is possible that the disruptions in gene regulation associated with long-term LCL maintenance could persist through the reprogramming process. To address this concern, we studied the effect of reprogramming mature LCL cultures from six unrelated donors to iPSCs on the ensuing gene expression patterns within and between individuals. We show that the reprogramming process results in a recovery of donor-specific gene regulatory signatures, increasing the number of genes with a detectable donor effect by an order of magnitude. The proportion of variation in gene expression statistically attributed to donor increases from 6.9% in LCLs to 24.5% in iPSCs (P < 10-15. Since environmental contributions are unlikely to be a source of individual variation in our system of highly passaged cultured cell lines, our observations suggest that the effect of genotype on gene regulation is more pronounced in iPSCs than in LCLs. Our findings indicate that iPSCs can be a powerful model system for studies of phenotypic variation across individuals in general, and the genetic association with variation in gene regulation in particular. We further conclude that LCLs are an appropriate starting material for iPSC generation.
Familial Interstitial Pulmonary Fibrosis: A Large Family with Atypical Clinical Features
Directory of Open Access Journals (Sweden)
Ranji Chibbar
2010-01-01
Full Text Available A large kindred of familial pulmonary fibrosis is reported. Six members from the first two generations of this particular kindred were described more than 40 years previously; six more individuals from the third and fourth generations have also been evaluated. The proband, now 23 years of age, has mild disease; the other 11 documented affected family members all died from their disease at an average age of 37 years (range 25 to 50 years. The pathology was that of usual interstitial pneumonia, as is typical in idiopathic pulmonary fibrosis. However, the initial radiographic pattern in many of these individuals was upper lobe and nodular and, along with the young age, was atypical for idiopathic pulmonary fibrosis. Several genetic abnormalities have been associated with familial pulmonary fibrosis. The present study examined the genes coding for surfactant protein-C, ATP-binding cassette protein A3 and telomerase, and found no abnormalities.
International Nuclear Information System (INIS)
Park, In-Sam; Mizukami, Ayumi; Tomimatsu, Hirofumi; Kondou, Chisato; Nakanishi, Toshio; Nakazawa, Makoto; Momma, Kazuo
1998-01-01
We measured the distribution of blood flow to the right (R) and left lung (L) by means of pulmonary perfusion imaging and calculated pulmonary vascular resistance (Rp) in 13 patients, whose right and left pulmonary artery pressures were different by 2 to 9 mmHg due to pulmonary arterial distortion (5 interruption, 8 stenosis). The right lung/left lung blood flow ratio was determined and from the ratio and the total pulmonary blood flow, which was determined using the Fick's principle, the absolute values of right and left pulmonary blood flow were calculated. Using the right and left pulmonary blood flow and the right and left pulmonary arterial pressures, right and left pulmonary vascular resistance were calculated, separately. Vascular resistance of the whole lung (Rp) was then calculated using the following equation. 1/(Rp of total lung)=1/(Rp of right lung)+1/(Rp of left lung). Rp calculated from this equation was 1.8+/-0.8 U·m 2 and all values were less than 3 U·m 2 (range 0.3-2.8). Rp estimated from the conventional method using the total pulmonary blood flow and pulmonary arterial pressures, without using the right/left blood flow ratio, ranging from 0.4 to 3.8 U·m 2 and 5 of 13 patients showed Rp>3 U·m 2 . All patients underwent Fontan operation successfully. These data indicated that this method is useful to estimate Rp and to determine the indication of Fontan operation in patients with pulmonary arterial distortions. (author)
... submissions. MORE We Imagine a World Without Pulmonary Fibrosis The Pulmonary Fibrosis Foundation mobilizes people and resources to provide ... its battle against the deadly lung disease, pulmonary fibrosis (PF). PULMONARY FIBROSIS WALK SURPASSES PARTICIPATION AND FUNDRAISING GOALS Nearly ...
International Nuclear Information System (INIS)
Kang, Ki-Woon; Chang, Hyuk-Jae; Kim, Young-Jin; Choi, Byoung-Wook; Yang, Woo-In; Shim, Chi-Young; Ha, Jongwon; Chung, Namsik; Lee, Hye-Sun
2011-01-01
Increased stiffness of the pulmonary vascular bed is known to increase mortality in patients with pulmonary arterial hypertension (PAH); and pulmonary artery (PA) stiffness is also thought to be associated with exercise capacity. The purpose of the present study was to investigate whether cardiac magnetic resonance imaging (CMRI)-derived PA distensibility index correlates with PA stiffness estimated on right heart catheterization (RHC) and predicts functional capacity (FC) in patients with PAH. Thirty-five consecutive PAH patients (23% male, mean age, 44±13 years; 69% idiopathic) underwent CMRI, RHC, and 6-min walk test (6MWT). PA distensibility indices were derived from cross-sectional area change (%) in the transverse view, perpendicular to the axis of the main PA, on CMRI [(maximum area-minimum area)/minimum area during cardiac cycle]. Among the PA stiffness indices, pulmonary vascular resistance (PVR) and PA capacitance were calculated using hemodynamic dataset from RHC. CMRI-derived PA distensibility was inversely correlated with PVR (R 2 =0.34, P 2 =0.35, P 2 =0.61, P<0.001). Furthermore, PA distensibility <20% predicted poor FC (<400 m in 6MWT) with a sensitivity of 82% and a specificity of 94%. Non-invasive CMRI-derived PA distensibility index correlates with PA stiffness and can predict FC in patients with PAH. (author)
Directory of Open Access Journals (Sweden)
Paula Paulo
2012-07-01
Full Text Available This work aimed to evaluate whether ETS transcription factors frequently involved in rearrangements in prostate carcinomas (PCa, namely ERG and ETV1, regulate specific or shared target genes. We performed differential expression analysis on nine normal prostate tissues and 50 PCa enriched for different ETS rearrangements using exon-level expression microarrays, followed by in vitro validation using cell line models. We found specific deregulation of 57 genes in ERG-positive PCa and 15 genes in ETV1-positive PCa, whereas deregulation of 27 genes was shared in both tumor subtypes. We further showed that the expression of seven tumor-associated ERG target genes (PLA1A, CACNA1D, ATP8A2, HLA-DMB, PDE3B, TDRD1, and TMBIM1 and two tumor-associated ETV1 target genes (FKBP10 and GLYATL2 was significantly affected by specific ETS silencing in VCaP and LNCaP cell line models, respectively, whereas the expression of three candidate ERG and ETV1 shared targets (GRPR, KCNH8, and TMEM45B was significantly affected by silencing of either ETS. Interestingly, we demonstrate that the expression of TDRD1, the topmost overexpressed gene of our list of ERG-specific candidate targets, is inversely correlated with the methylation levels of a CpG island found at -66 bp of the transcription start site in PCa and that TDRD1 expression is regulated by direct binding of ERG to the CpG island in VCaP cells. We conclude that ETS transcription factors regulate specific and shared target genes and that TDRD1, FKBP10, and GRPR are promising therapeutic targets and can serve as diagnostic markers for molecular subtypes of PCa harboring specific fusion gene rearrangements.
Interfacing microbiology and biotechnology. Conference abstracts
Energy Technology Data Exchange (ETDEWEB)
Maupin, Julia A.
2001-05-19
The Interfacing Microbiology and Biotechnology Conference was attended by over 100 faculty, post-docs, students, and research scientists from the US, Europe, and Latin America. The conference successfully stimulated communication and the dissemination of knowledge among scientists involved in basic and applied research. The focus of the conference was on microbial physiology and genetics and included sessions on C1 metabolism, archaeal metabolism, proteases and chaperones, gene arrays, and metabolic engineering. The meeting provided the setting for in-depth discussions between scientists who are internationally recognized for their research in these fields. The following objectives were met: (1) The promotion of interaction and future collaborative projects among scientists involved in basic and applied research which incorporates microbial physiology, genetics, and biochemistry; (2) the facilitation of communication of new research findings through seminars, posters, and abstracts; (3 ) the stimulation of enthusiasm and education among participants including graduate and undergraduate students.
Mlak, Radosław; Homa-Mlak, Iwona; Powrózek, Tomasz; Mackiewicz, Barbara; Michnar, Marek; Krawczyk, Paweł; Dziedzic, Marcin; Rubinsztajn, Renata; Chazan, Ryszarda; Milanowski, Janusz; Małecka-Massalska, Teresa
2016-04-01
Chronic obstructive pulmonary disease (COPD) affects more than 10% of the world's population over 40 years of age. The main exogenous risk factor is cigarette smoking; however, only 20% of smokers develop COPD, indicating that some other factors, e.g. genetic, may play an important role in the disease pathogenesis. Recent research indicates that ACE (angiotensin-converting enzyme) may be a susceptibility gene for asthma or COPD. The aim of our study was to determine the influence of I/D (insertion/deletion) polymorphism of the ACE gene (AluYa5, rs4646994) on the risk and course of COPD. We investigated ACE I/D polymorphism in 206 COPD and 165 healthy Caucasian subjects. In the generalized linear model (GLZ) analysis of the influence of selected factors on presence of COPD we found a significant independent effect for male sex (repeatedly increases the risk of COPD, OR = 7.7, p = 0.049), as well as smoking or lower body mass index, but only in combination with older age (OR = 0.96, p = 0.003 and OR = 1.005, p = 0.04 respectively). Interestingly, analysis of factors which may influence the risk of a higher number of exacerbations demonstrated that occurrence of DD genotype, but only in men, is associated with a lower risk (OR = 0.7, p = 0.03) of this complication. We suggest that ACE may not be a susceptibility gene for the origin of COPD but a disease-modifying gene. Since the impact of I/D polymorphism of the ACE gene on COPD risk is moderate or negligible, other molecular changes, that will help predict the development of this disease, should still be sought.
Oyola, Mercedes; Pontificia Universidad Javeriana; Gordillo, Gisel; Pontificia Universidad Javeriana; García, Carlos A.; Pontificia Universidad Javeriana; Torres, David; Pontificia Universidad Javeriana
2009-01-01
Pulmonary agenesis is an infrequent pathology which occurs predominantly among females with no lateral preference. We report on the case of a newborn male diagnosed with prenatal diaphragm hernia though at birth seemed more likely either to be a congenital cystic adenomatoid malformation (congenital pulmonary airway malformation) or pulmonary agenesis. The patient died six days after birth and necropsy confirmed pulmonary agenesis. La agenesia pulmonar es una alteración poco frecuente, con...
Therapeutic strategies in pulmonary hypertension
Directory of Open Access Journals (Sweden)
Leonello eFuso
2011-04-01
Full Text Available Pulmonary hypertension (PH is a life-threatening condition characterized by elevated pulmonary arterial pressure. It is clinically classified into five groups: patients in the first group are considered to have pulmonary arterial hypertension (PAH whereas patients of the other groups have PH that is due to cardiopulmonary or other systemic diseases. The management of patients with PH has advanced rapidly over the last decade and the introduction of specific treatments especially for PAH has lead to an improved outcome. However, despite the progress in the treatment, the functional limitation and the survival of these patients remain unsatisfactory and there is no cure for PAH. Therefore the search for an ideal therapy still goes on. At present, two levels of treatment can be identified: primary and specific therapy. Primary therapy is directed at the underlying cause of the PH. It also includes a supportive therapy consisting in oxygen supplementation, diuretics, and anticoagulation which should be considered in all patients with PH. Specific therapy is directed at the PH itself and includes treatment with vasodilatators such as calcium channel blockers and with vasodilatator and pathogenetic drugs such as prostanoids, endothelin receptor antagonists and phosphodiesterase type-5 inhibitors. These drugs act in several pathogenetic mechanisms of the PH and are specific for PAH although they might be used also in the other groups of PH. Finally, atrial septostomy and lung transplantation are reserved for patients refractory to medical therapy. Different therapeutic approaches can be considered in the management of patients with PH. Therapy can be established on the basis of both the clinical classification and the functional class. It is also possible to adopt a goal-oriented therapy in which the timing of treatment escalation is determined by inadequate response to known prognostic indicators.
Pulmonary Artery Dissection: A Fatal Complication of Pulmonary Hypertension
Directory of Open Access Journals (Sweden)
Chuanchen Zhang
2016-01-01
Full Text Available Pulmonary artery dissection is extremely rare but it is a really life-threatening condition when it happens. Most patients die suddenly from major bleeding or tamponade caused by direct rupture into mediastinum or retrograde into the pericardial sac. What we are reporting is a rare case of a 46-year-old female patient whose pulmonary artery dissection involves both the pulmonary valve and right pulmonary artery. The patient had acute chest pain and severe dyspnea, and the diagnosis of pulmonary artery dissection was confirmed by ultrasonography and CT angiography. Moreover, its etiology, clinical manifestations, and management are also discussed in this article.
Heart disease in patients with pulmonary embolism.
Pesavento, Raffaele; Piovella, Chiara; Prandoni, Paolo
2010-09-01
Several heart diseases are promoters of left-side cardiac thrombosis and could lead to arterial embolism. The same mechanism may be responsible for right-side cardiac thrombosis and therefore be a direct source of pulmonary embolism. Yasuoka et al. showed a higher incidence of perfusion defects in lung scan in patients with spontaneous echocontrast in the right atrium than in those without it (40% and 7% respectively; P=0.006). We recently assessed the prevalence of heart diseases in 11.236 consecutive patients older than 60 years discharged from Venetian hospitals with a diagnosis of pulmonary embolism. We observed a higher prevalence of all-cause heart diseases (odds ratio 1.26; 95% confidence interval, 1.13-1.40) in patients with a diagnosis of pulmonary embolism alone (secondary or unprovoked) compared with those discharged with a diagnosis of pulmonary embolism associated with deep vein thrombosis, generating the hypothesis that some specific heart diseases in older patients could themselves be a possible source of pulmonary emboli. Further prospective studies are required to confirm these findings, which have the potential to open new horizons for the interpretation and management of venous thromboembolic disease.
Directory of Open Access Journals (Sweden)
Caroline Claude
Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.
Renteria, L S; Cruz, E; Ibe, B O
2013-12-01
Platelet-activating factor (PAF) is a phospholipid with a wide range of biological activities. We studied PAF metabolism and PAF receptor (PAFR) signaling in perinatal ovine lungs to understand PAF's role in transition of the perinatal pulmonary hemodynamics and pathophysiology of persistent pulmonary hypertension of the newborn. We hypothesized that downregulation of PAF synthesis with upregulation of PAF catabolism by acetylhydrolase (PAF-Ah) in the newborn lung is needed for fetus-to-newborn pulmonary adaptation. Studies were conducted on fetal and newborn lamb pulmonary arteries (PA), veins (PV) and smooth muscle cells (SMC). PAF metabolism, PAFR binding and cell proliferation were studied by cell culture; gene expression was studied by qPCR. Fetal lungs synthesized 60% more PAF than newborn lungs. Compared with the fetal PVs and SMCs, PAF-Ah activity in newborn was 40-60% greater. PAF-Ah mRNA expression in newborn vessels was different from the expression by fetal PA. PAF-Ah gene clone activity confirmed deletion of hypoxia-sensitive site. PAFR mRNA expression by the PVs and SMC-PV of the fetus and newborn was greater than by corresponding PAs and SMC-PA. Q-PCR study of PAFR expression by the SMC-PV of both groups was greater than SMC-PA. Fetal SMCs bound more PAF than the newborn SMCs. PAFR antagonist, CV-3988, inhibited PAFR binding and DNA synthesis by the fetal SMCs, but augmented binding and DNA synthesis by newborn cells. We show different PAF-PAFR mediated effects in perinatal lungs, suggesting both transcriptional and translational regulation of PAF-Ah and PAFR expression in the perinatal lamb lungs. These indicate that the downregulation of PAF-mediated effects postnatally protects against persistent pulmonary hypertension of the newborn.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
International Nuclear Information System (INIS)
Johnston, C.J.; Piedboeuf, B.; Finkelstein, J.N.; Baggs, R.; Rubin, P.
1995-01-01
Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The purpose of this study was to determine if extracellular matrix protein and transforming growth factor β mRNA expression are altered late in the course of pulmonary fibrosis after irradiation, and then to determine if these changes differ between two strains of mice which vary in their sensitivity to radiation. Radiation-sensitive (C57BL/6) and radiation-resistant (C3H/HeJ) mice were irradiated with a single dose of 5 or 12.5 Gy to the thorax. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabeled cDNA probes for collagens I, III and IV, fibronectin, and transforming growth factor β 1 and β 3 . Autoradiographic data were quantified by video densitometry and results normalized to a control probe encoding for glyceralde-hyde-3-phosphate dehydrogenase. Alterations in mRNA abundance were observed in the sensitive mice at all times, while levels in the resistant mice were unaffected until 26 weeks after irradiation. The relationship between extracellular matrix protein per se and increased mRNA abundance suggests that late matrix protein accumulation may be a function of gene expression. Differences in levels of transforming growth factor βmRNA may lead to strain-dependent variation in fibrotic response and may also contribute to the radiation-induced component of pulmonary fibrosis. 32 refs., 5 figs
Directory of Open Access Journals (Sweden)
Maria Luisa Lorusso
2014-03-01
Full Text Available A Consensus Conference on Specific Learning Disorders has been promoted by the Italian National Institute of Health (Istituto Superiore di Sanità, ISS. The Consensus Conference consisted in a systematic review of the international literature addressing the issues of diagnosis, risk factors and prognosis, treatment, service delivery and organizational models for Specific Learning Disorders (reading, spelling/writing, calculation. Selected papers were examined by a group of Evaluators and then discussed by a Scientific and Technical Committee, whose conclusions were examined and approved by a Jury Panel. The part on diagnostic issues is presented here, encompassing a systematic discussion of the use and appropriateness of diagnostic criteria, parameters, tasks and psychometric indexes as illustrated in the literature, and providing recommendations for clinical practice. Special attention has been devoted to the collection, analysis and discussion of published data concerning languages with transparent orthography. Controversial issues such as discrepancy criteria, role of reading comprehension and importance of accuracy and fluency are discussed.
Biodegradable polymeric nanocarriers for pulmonary drug delivery.
Rytting, Erik; Nguyen, Juliane; Wang, Xiaoying; Kissel, Thomas
2008-06-01
Pulmonary drug delivery is attractive for both local and systemic drug delivery as a non-invasive route that provides a large surface area, thin epithelial barrier, high blood flow and the avoidance of first-pass metabolism. Nanoparticles can be designed to have several advantages for controlled and targeted drug delivery, including controlled deposition, sustained release, reduced dosing frequency, as well as an appropriate size for avoiding alveolar macrophage clearance or promoting transepithelial transport. This review focuses on the development and application of biodegradable polymers to nanocarrier-based strategies for the delivery of drugs, peptides, proteins, genes, siRNA and vaccines by the pulmonary route. The selection of natural or synthetic materials is important in designing particles or nanoparticle clusters with the desired characteristics, such as biocompatibility, size, charge, drug release and polymer degradation rate.
Retrograde pulmonary arteriography
International Nuclear Information System (INIS)
Calcaterra, G.; Lam, J.; Losekoot, T.G.
1984-01-01
The authors performed retrograde pulmonary arteriography by means of a pulmonary venous wedge injection in 10 patients with no demonstrable intrapericardial pulmonary arteries by 'conventional' angiographic techniques. In all cases but one, the procedure demonstrated the feasibility of a further operation. No complications were observed. Retrograde pulmonary arteriography is an important additional method for determining the existence of surgically accessible pulmonary arteries when other techniques have failed. (Auth.)
Genetics and Early Detection in Idiopathic Pulmonary Fibrosis
Putman, Rachel K.; Rosas, Ivan O.
2014-01-01
Genetic studies hold promise in helping to identify patients with early idiopathic pulmonary fibrosis (IPF). Recent studies using chest computed tomograms (CTs) in smokers and in the general population have demonstrated that imaging abnormalities suggestive of an early stage of pulmonary fibrosis are not uncommon and are associated with respiratory symptoms, physical examination abnormalities, and physiologic decrements expected, but less severe than those noted in patients with IPF. Similarly, recent genetic studies have demonstrated strong and replicable associations between a common promoter polymorphism in the mucin 5B gene (MUC5B) and both IPF and the presence of abnormal imaging findings in the general population. Despite these findings, it is important to note that the definition of early-stage IPF remains unclear, limited data exist to definitively connect abnormal imaging findings to IPF, and genetic studies assessing early-stage pulmonary fibrosis remain in their infancy. In this perspective we provide updated information on interstitial lung abnormalities and their connection to IPF. We summarize information on the genetics of pulmonary fibrosis by focusing on the recent genetic findings of MUC5B. Finally, we discuss the implications of these findings and suggest a roadmap for the use of genetics in the detection of early IPF. PMID:24547893
Lin, Wen-Hsien; Liu, Wei-Chung; Hwang, Ming-Jing
2009-03-11
Human cells of various tissue types differ greatly in morphology despite having the same set of genetic information. Some genes are expressed in all cell types to perform house-keeping functions, while some are selectively expressed to perform tissue-specific functions. In this study, we wished to elucidate how proteins encoded by human house-keeping genes and tissue-specific genes are organized in human protein-protein interaction networks. We constructed protein-protein interaction networks for different tissue types using two gene expression datasets and one protein-protein interaction database. We then calculated three network indices of topological importance, the degree, closeness, and betweenness centralities, to measure the network position of proteins encoded by house-keeping and tissue-specific genes, and quantified their local connectivity structure. Compared to a random selection of proteins, house-keeping gene-encoded proteins tended to have a greater number of directly interacting neighbors and occupy network positions in several shortest paths of interaction between protein pairs, whereas tissue-specific gene-encoded proteins did not. In addition, house-keeping gene-encoded proteins tended to connect with other house-keeping gene-encoded proteins in all tissue types, whereas tissue-specific gene-encoded proteins also tended to connect with other tissue-specific gene-encoded proteins, but only in approximately half of the tissue types examined. Our analysis showed that house-keeping gene-encoded proteins tend to occupy important network positions, while those encoded by tissue-specific genes do not. The biological implications of our findings were discussed and we proposed a hypothesis regarding how cells organize their protein tools in protein-protein interaction networks. Our results led us to speculate that house-keeping gene-encoded proteins might form a core in human protein-protein interaction networks, while clusters of tissue-specific gene
Kim, John S; McSweeney, Julia; Lee, Joanne; Ivy, Dunbar
2016-03-01
To review the pharmacologic treatment options for pulmonary arterial hypertension in the cardiac intensive care setting and summarize the most-recent literature supporting these therapies. Literature search for prospective studies, retrospective analyses, and case reports evaluating the safety and efficacy of pulmonary arterial hypertension therapies. Mechanisms of action and pharmacokinetics, treatment recommendations, safety considerations, and outcomes for specific medical therapies. Specific targeted therapies developed for the treatment of adult patients with pulmonary arterial hypertension have been applied for the benefit of children with pulmonary arterial hypertension. With the exception of inhaled nitric oxide, there are no pulmonary arterial hypertension medications approved for children in the United States by the Food and Drug Administration. Unfortunately, data on treatment strategies in children with pulmonary arterial hypertension are limited by the small number of randomized controlled clinical trials evaluating the safety and efficacy of specific treatments. The treatment options for pulmonary arterial hypertension in children focus on endothelial-based pathways. Calcium channel blockers are recommended for use in a very small, select group of children who are responsive to vasoreactivity testing at cardiac catheterization. Phosphodiesterase type 5 inhibitor therapy is the most-commonly recommended oral treatment option in children with pulmonary arterial hypertension. Prostacyclins provide adjunctive therapy for the treatment of pulmonary arterial hypertension as infusions (IV and subcutaneous) and inhalation agents. Inhaled nitric oxide is the first-line vasodilator therapy in persistent pulmonary hypertension of the newborn and is commonly used in the treatment of pulmonary arterial hypertension in the ICU. Endothelin receptor antagonists have been shown to improve exercise tolerance and survival in adult patients with pulmonary arterial
Evaluation of pulmonary artery flow in acute massive pulmonary thromboembolism with MRI
International Nuclear Information System (INIS)
Li Yongzhong; Li Kuncheng; Zhao Xigang; Zhao Hong
2004-01-01
Objective: To probe into the value of MR imaging in evaluating the pulmonary artery hemodynamics and pulmonary artery pressure in acute massive pulmonary embolism. Methods: MR studies were performed in 21 patients with acute massive pulmonary embolism (diagnosed by contrast enhanced MR pulmonary angiography) and 20 healthy volunteers. The pulmonary artery hemodynamic parameters, such as the diameters of main and right pulmonary artery, peak velocity, average velocity, flow volume, flow patterns, and ejection acceleration time in main pulmonary artery were measured. The findings in patients and volunteers were compared. The hemodynamic parameters in patients were correlated with mean pulmonary artery pressure acquired with right heart catheterization. Results: The diameters of main pulmonary artery (2.93 vs 2.52 cm) and right pulmonary artery (2.49 vs 1.92 cm) in patients and volunteers showed significant differences (t=3.55, P<0.01 and t=4.19, P<0.01, respectively); Peak velocity (85.29 vs 100.63 cm/s), average velocity (11.00 vs 17.12 cm/s), flow volume (89.15 vs 98.96 ml/s), and ejection acceleration time (105.09 vs 163.85 ms) in main pulmonary artery were significantly different between patients and volunteers (t values were 2.89, 6.37, 2.21, and 9.46, respectively; P values were 0.01, <0.01, 0.03, and <0.01, respectively). The peak velocity-time curve of main pulmonary artery acquired with velocity encoded cine of MR in patients demonstrated earlier and lower peak velocity as well as abnormal retrograde flow. In addition, linear correlations were seen between the mean pulmonary pressure and the diameter of main pulmonary artery (r=0.62, P=0.001), diameter of right pulmonary artery (r=0.63, P=0.001), and ejection acceleration time (r=-0.55, P=0.005). Conclusion: MR imaging is a promising technique not only for the detection of pulmonary thromboemboli but also for the evaluation of hemodynamic parameters in pulmonary hypertension. (author)
International Nuclear Information System (INIS)
Bowen, Joanne M.; Tsykin, Anna; Stringer, Andrea M.; Logan, Richard M.; Gibson, Rachel J.; Keefe, Dorothy M.K.
2010-01-01
Gastrointestinal toxicity remains a significant and dose-limiting complication of cancer treatment. While the pathophysiology is becoming clearer, considerable gaps in the knowledge remain surrounding the timing and site-specific gene changes which occur in response to insult. As such, this study aimed to assess gene expression profiles in a number of regions along the gastrointestinal tract following treatment with the chemotherapy agent, irinotecan, and correlate them with markers of cell death and tissue damage. Data analysis of microarray results found that genes involved in apoptosis, mitogen activated kinase (MAPK) signalling and inflammation were upregulated within 6 h, while genes involved in cell proliferation, wound healing and blood vessel formation were upregulated at later time points up to 72 h. Cell death was significantly increased at 6 and 24 h, and the stomach showed the lowest severity of overt tissue damage. Real time PCR of MAPK signalling pathway genes found that the jejunum and colon had significantly increased expression in a number of genes at 72 h, where as the stomach was unchanged. These results indicate that overall severity of tissue damage may be determined by precisely timed target gene responses specific to each region. Therapeutic targeting of key gene responses at the appropriate time point may prove to be effective for prevention of chemotherapy-induced gastrointestinal damage.
Update on diagnostic strategies of pulmonary embolism
International Nuclear Information System (INIS)
Kauczor, H.U.; Heussel, C.P.; Thelen, M.
1999-01-01
Acute pulmonary embolism is a frequent disease with non-specific findings, high mortality, and multiple therapeutic options. A definitive diagnosis must be established by accurate, non-invasive, easily performed, cost-effective, and widely available imaging modalities. Conventional diagnostic strategies have relied on ventilation-perfusion scintigraphy complemented by venous imaging. If the results are inconclusive, pulmonary angiography, which is regarded as the gold standard, is to be performed. Recently, marked improvements in CT and MRI and shortcomings of scintigraphy led to an update of the diagnostic strategy. Spiral CT is successfully employed as a second-line procedure to clarify indeterminate scintigraphic results avoiding pulmonary angiography. It can also be used as a first-line screening tool if service and expertise is provided. Venous imaging is indicated if CT is inconclusive. The MRI technique can be applied as an alternative second-line test if spiral CT is not available or is contraindicated. It has the greatest potential for further developments and refinements. Echocardiography should be used as a first-line bedside examination in critical patients. If inconclusive stabilized patients undergo spiral CT, unstable patients should be referred for pulmonary angiography. Chronic thromboembolic pulmonary hypertension is a rare sequela of acute pulmonary embolism which can be cured surgically. Morphology, complications, and differential diagnoses are better illustrated by spiral CT and MRA, whereas invasive acquisition of hemodynamic data is the sole advantage of angiography. (orig.)
Diagnosis, Evaluation and Treatment of Pulmonary Arterial Hypertension in Children
Frank, Benjamin S.
2018-01-01
Pulmonary Hypertension (PH), the syndrome of elevated pressure in the pulmonary arteries, is associated with significant morbidity and mortality for affected children. PH is associated with a wide variety of potential underlying causes, including cardiac, pulmonary, hematologic and rheumatologic abnormalities. Regardless of the cause, for many patients the natural history of PH involves progressive elevation in pulmonary arterial resistance and pressure, right ventricular dysfunction, and eventually heart failure. In recent years, a number of pulmonary arterial hypertension (PAH)-targeted therapies have become available to reduce pulmonary artery pressure and improve outcome. A growing body of evidence in both the adult and pediatric literature demonstrates enhanced quality of life, functional status, and survival among treated patients. This review provides a description of select etiologies of PH seen in pediatrics and an update on the most recent data pertaining to evaluation and management of children with PH/PAH. The available evidence for specific classes of PAH-targeted therapies in pediatrics is additionally discussed. PMID:29570688
Directory of Open Access Journals (Sweden)
Tetsuro Yasui
2017-06-01
Full Text Available Human neural precursor cells (hNPCs derived from pluripotent stem cells display a high propensity for neuronal differentiation, but they require long-term culturing to differentiate efficiently into astrocytes. The mechanisms underlying this biased fate specification of hNPCs remain elusive. Here, we show that hypoxia confers astrocytic differentiation potential on hNPCs through epigenetic gene regulation, and that this was achieved by cooperation between hypoxia-inducible factor 1α and Notch signaling, accompanied by a reduction of DNA methylation level in the promoter region of a typical astrocyte-specific gene, Glial fibrillary acidic protein. Furthermore, we found that this hypoxic culture condition could be applied to rapid generation of astrocytes from Rett syndrome patient-derived hNPCs, and that these astrocytes impaired neuronal development. Thus, our findings shed further light on the molecular mechanisms regulating hNPC differentiation and provide attractive tools for the development of therapeutic strategies for treating astrocyte-mediated neurological disorders.
Li, Min; Zhang, Jiayi; Liu, Qing; Wang, Jianxin; Wu, Fang-Xiang
2014-01-01
Predicting disease-related genes is one of the most important tasks in bioinformatics and systems biology. With the advances in high-throughput techniques, a large number of protein-protein interactions are available, which make it possible to identify disease-related genes at the network level. However, network-based identification of disease-related genes is still a challenge as the considerable false-positives are still existed in the current available protein interaction networks (PIN). Considering the fact that the majority of genetic disorders tend to manifest only in a single or a few tissues, we constructed tissue-specific networks (TSN) by integrating PIN and tissue-specific data. We further weighed the constructed tissue-specific network (WTSN) by using DNA methylation as it plays an irreplaceable role in the development of complex diseases. A PageRank-based method was developed to identify disease-related genes from the constructed networks. To validate the effectiveness of the proposed method, we constructed PIN, weighted PIN (WPIN), TSN, WTSN for colon cancer and leukemia, respectively. The experimental results on colon cancer and leukemia show that the combination of tissue-specific data and DNA methylation can help to identify disease-related genes more accurately. Moreover, the PageRank-based method was effective to predict disease-related genes on the case studies of colon cancer and leukemia. Tissue-specific data and DNA methylation are two important factors to the study of human diseases. The same method implemented on the WTSN can achieve better results compared to those being implemented on original PIN, WPIN, or TSN. The PageRank-based method outperforms degree centrality-based method for identifying disease-related genes from WTSN.
LENUS (Irish Health Repository)
McKeown, Peter C
2011-08-12
Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was
Directory of Open Access Journals (Sweden)
Wennblom Trevor J
2011-08-01
Full Text Available Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination. We identified these MEGs by developing a bioinformatics tool (GenFrag which can directly determine the identities of transcript-derived fragments from (i their size and (ii which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1
DEFF Research Database (Denmark)
Halappanavar, Sabina; Jackson, Petra; Williams, Andrew
2011-01-01
with acute phase, inflammation and immune response 5 days post exposure with concomitant changes in several miRNAs. The role of these miRNAs in pulmonary response to inhaled particles is unknown and warrants further research. Environ. Mol. Mutagen., 2011. © 2011 Wiley‐Liss, Inc....... in increased levels of mRNA for acute phase markers serum amyloid A‐1 (Saa1) and serum amyloid A‐3 (Saa3), several C‐X‐C and C‐C motif chemokines, and cytokine tumor necrosis factor genes. Protein analysis of Saa1 and 3 showed selective upregulation of Saa3 in lung tissues. Sixteen miRNAs were induced by more...... than 1.2‐fold (adjusted P‐value changes in the expression of genes associated...
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Postoperative management of pulmonary endarterectomy and outcome
Directory of Open Access Journals (Sweden)
Narayana Iyengar Ramakrishna
2010-01-01
Full Text Available Pulmonary artery thromboendarterectomy (PTE has been regarded as a promising, potentially curative surgical procedure. However, PTE is associated with specific postoperative complications, such as reperfusion pulmonary edema and right heart failure leading to a considerable mortality of 7-24%. Despite its limitations PTE is a better surgical alternative to lung transplantation which carries high morbidity and mortality. The aim of the study is to analyze the efficacy, safety, morbidity and survival associated in the postoperative period and quality of life after six months of PTE in Indian patients. Forty-one patients with surgically correctable chronic thromboembolic pulmonary hypertension underwent pulmonary endarterectomy. All patients were in New York Heart Association (NYHA Class II, III or IV. Preoperative mean pulmonary artery pressure was 40.98 ± 9.29 mmHg and mean pulmonary vascular resistance was 418.39 ± 95.88 dynes/sec/cm -5 . All patients were followed up to six months and a telephonic survey was conducted using a standard questionnaire. They were assessed and classified as per NYHA grading. There was a significant reduction in the mean pulmonary artery pressure (from 40.98 ± 9.29 mmHg to 24.13 ± 7.36 mmHg, P < 0.001 and pulmonary vascular resistance (from 418.39 ± 95.88 dynes/sec/cm -5 to 142.45 ± 36.27 dynes/sec/cm -5 , P < 0.001 with a concomitant increase in the cardiac index (from 1.99 ± 0.20 L/min/m 2 to 3.28 ± 0.56 L/min/m 2 , P < 0.001 during the postoperative period. The mortality rate in our study was 12.19% (five patients. Ninety per cent of the patients reported a significant improvement in the quality of life and exercise tolerance after surgery compared to the preoperative state. Pulmonary endarterectomy is an effective and potentially curative surgical treatment for patients with severe chronic thromboembolic pulmonary hypertension. The current techniques of operation make the procedure relatively safe and
CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo.
Directory of Open Access Journals (Sweden)
Minyan Li
Full Text Available Mammalian spermatogenesis is a highly regulated multistage process of sperm generation. It is hard to uncover the real function of a testis specific gene in vitro since the in vitro model is not yet mature. With the development of the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 system, we can now rapidly generate knockout mouse models of testis specific genes to study the process of spermatogenesis in vivo. SYCP3-like X-linked 2 (SLX2 is a germ cell specific component, which contains a Cor1 domain and belongs to the XLR (X-linked, lymphocyte regulated family. Previous studies suggested that SLX2 might play an important role in mouse spermatogenesis based on its subcellular localization and interacting proteins. However, the function of SLX2 in vivo is still elusive. Here, to investigate the functions of SLX2 in spermatogenesis, we disrupted the Slx2 gene by using the CRISPR/Cas9 system. Since Slx2 is a testis specific X-linked gene, we obtained knockout male mice in the first generation and accelerated the study process. Compared with wild-type mice, Slx2 knockout mice have normal testis and epididymis. Histological observation of testes sections showed that Slx2 knockout affected none of the three main stages of spermatogenesis: mitosis, meiosis and spermiogenesis. In addition, we further confirmed that disruption of Slx2 did not affect the number of spermatogonial stem cells, meiosis progression or XY body formation by immunofluorescence analysis. As spermatogenesis was normal in Slx2 knockout mice, these mice were fertile. Taken together, we showed that Slx2 itself is not an essential gene for mouse spermatogenesis and CRISPR/Cas9 technique could speed up the functional study of testis specific X-linked gene in vivo.
Directory of Open Access Journals (Sweden)
Dunja Knapp
Full Text Available Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression - early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation.
International Nuclear Information System (INIS)
Zhang Yanyan; Chen Man; Shao Maogang; Zhang Songlin; Mao Jieming; Guo Jingxuan
1993-01-01
The result of radionuclide lung imaging was compared in 18 patients of pulmonary embolism (PE) and 2 normal persons. The discovered perfusion defects correlated well with the location of angiographic obstruction. The positive angiographic and radionuclide finding was in 141 and 104 emboli arteries respectively. The sensitivity of total emboli pulmonary segments of lung imaging was 73.8%, the specificity was 82.7 and the accuracy was 79%. The techniques correlated quite well (r = 0.83, P<0.001)
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
Castelain, V; Hervé, P; Lecarpentier, Y; Duroux, P; Simonneau, G; Chemla, D
2001-03-15
The purpose of this time-domain study was to compare pulmonary artery (PA) pulse pressure and wave reflection in chronic pulmonary thromboembolism (CPTE) and primary pulmonary hypertension (PPH). Pulmonary artery pressure waveform analysis provides a simple and accurate estimation of right ventricular afterload in the time-domain. Chronic pulmonary thromboembolism and PPH are both responsible for severe pulmonary hypertension. Chronic pulmonary thromboembolism and PPH predominantly involve proximal and distal arteries, respectively, and may lead to differences in PA pressure waveform. High-fidelity PA pressure was recorded in 14 patients (7 men/7 women, 46 +/- 14 years) with CPTE (n = 7) and PPH (n = 7). We measured thermodilution cardiac output, mean PA pressure (MPAP), PA pulse pressure (PAPP = systolic - diastolic PAP) and normalized PAPP (nPAPP = PPAP/MPAP). Wave reflection was quantified by measuring Ti, that is, the time between pressure upstroke and the systolic inflection point (Pi), deltaP, that is, the systolic PAP minus Pi difference, and the augmentation index (deltaP/PPAP). At baseline, CPTE and PPH had similar cardiac index (2.4 +/- 0.4 vs. 2.5 +/- 0.5 l/min/m2), mean PAP (59 +/- 9 vs. 59 +/- 10 mm Hg), PPAP (57 +/- 13 vs. 53 +/- 13 mm Hg) and nPPAP (0.97 +/- 0.16 vs. 0.89 +/- 0.13). Chronic pulmonary thromboembolism had shorter Ti (90 +/- 17 vs. 126 +/- 16 ms, p PPAP (0.26 +/- 0.01 vs. 0.09 +/- 0.07, p < 0.01). Our study indicated that: 1) CPTE and PPH with severe pulmonary hypertension had similar PA pulse pressure, and 2) wave reflection is elevated in both groups, and CPTE had increased and anticipated wave reflection as compared with PPH, thus suggesting differences in the pulsatile component of right ventricular afterload.