Directory of Open Access Journals (Sweden)
Jianfeng WANG
2011-08-01
Full Text Available Aphids of the subtribe Aphidina are found mainly in the North Temperate Zone. The relative lack of diagnostic morphological characteristics has obscured the identification of species in this group. However, DNA-based taxonomic methods can clarify species relationships within this group. Sequence variation in a partial segment of the mitochondrial COI gene was highly effective for resolving species relationships within Aphidina. Forty-five species were correctly identified in a neighbor-joining tree. Mean intraspecific sequence divergence was 0.17%, with a range of 0.00% to 1.54%. Mean interspecific divergence within previously recognized genera or morphologically similar species groups was 4.54%, with variation mainly in the range of 3.50% to 8.00%. Possible reasons for anomalous levels of mean nucleotide divergence within or between some taxa are discussed.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Liao, Jing; Chao, Zhi; Zhang, Liang
2013-11-01
To identify the common snakes in medicated liquor of Guangdong using COI barcode sequence,and to test the feasibility. The COI barcode sequences of collected medicinal snakes were amplified and sequenced. The sequences combined with the data from GenBank were analyzed for divergence and building a neighbor-joining(NJ) tree with MEGA 5.0. The genetic distance and NJ tree demonstrated that there were 241 variable sites in these species, and the average (A + T) content of 56.2% was higher than the average (G + C) content of 43.7%. The maximum interspecific genetic distance was 0.2568, and the minimum was 0. 1519. In the NJ tree,each species formed a monophyletic clade with bootstrap supports of 100%. DNA barcoding identification method based on the COI sequence is accurate and can be applied to identify the common medicinal snakes.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Craspedacusta sowerbii, Lankester 1880 – population dispersal analysis using COI and ITS sequences
Directory of Open Access Journals (Sweden)
Franz BRÜMMER
2009-02-01
Full Text Available Craspedacusta sowerbii (Hydrozoa, Limnomedusae, Olindiidae is a freshwater jellyfish, which was discovered in England in 1880. Although thought to originate in South America, it became obvious that the species is native to the Yangtze River system in China. It has spread from China into lakes all over the world. Many different species, variations and sub-species have been described based on morphological characters. Specimens discovered in North America were described as separate species, as morphological differences appeared to be significant compared to European specimens. Even within Europe, differences were assumed to be obvious. Up to this point, three valid species are published; others are considered by various scientists to be true species as well, but mostly are recognized as variations. To obtain further insight into population dynamics of C. sowerbii as well as molecular information on the species itself, sequences of internal transcribed spacers (ITS and cytochrome oxidase subunit I (COI have been used to analyze specimens collected in Germany and Austria. These sequences have been compared to sequences published of different Chinese Craspedacusta species and variations. In addition, morphological descriptions were compared. For the COI sequences, we found uniformity throughout the complete set of samples. However, no comparisons could be made, as no data had been published on COI of Chinese specimens. ITS1, 5.8S and ITS2, including partial 18S and 28S, sequences, were almost uniform within the German populations, showing only minor base pair exchanges. However, comparisons to Chinese organisms indicated, that the investigated sequences of C. sowerbii from Germany and Austria are similar, although not identical in morphology, to Craspedacusta sowerbii var. kiatingi from China. Overall our data support the assumption that there are three valid species, with the possibility of C. ziguiensis being a fourth one, and several
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo
2010-11-01
The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).
Prijović, M; Skaljac, M; Drobnjaković, T; Zanić, K; Perić, P; Marčić, D; Puizina, J
2014-06-01
The greenhouse whitefly Trialeurodes vaporariorum Westwood, 1856 (Hemiptera: Aleyrodidae) is an invasive and highly polyphagous phloem-feeding pest of vegetables and ornamentals. Trialeurodes vaporariorum causes serious damage due to direct feeding and transmits several important plant viruses. Excessive use of insecticides has resulted in significantly reduced levels of susceptibility of various T. vaporariorum populations. To determine the genetic variability within and among populations of T. vaporariorum from Serbia and to explore their genetic relatedness with other T. vaporariorum populations, we analysed the mitochondrial cytochrome c oxidase I (COI) sequences of 16 populations from Serbia and six neighbouring countries: Montenegro (three populations), Macedonia (one population) and Croatia (two populations), for a total of 198 analysed specimens. A low overall level of sequence divergence and only five variable nucleotides and six haplotypes were found. The most frequent haplotype, H1, was identified in all Serbian populations and in all specimens from distant localities in Croatia and Macedonia. The COI sequence data that was retrieved from GenBank and the data from our study indicated that H1 is the most globally widespread T. vaporariorum haplotype. A lack of spatial genetic structure among the studied T. vaporariorum populations, as well as two demographic tests that we performed (Tajima's D value and Fu's Fs statistics), indicate a recent colonisation event and population growth. Phylogenetic analyses of the COI haplotypes in this study and other T. vaporariorum haplotypes that were retrieved from GenBank were performed using Bayesian inference and median-joining (MJ) network analysis. Two major haplogroups with only a single unique nucleotide difference were found: haplogroup 1 (containing the five Serbian haplotypes and those previously identified in India, China, the Netherlands, the United Kingdom, Morocco, Reunion and the USA) and haplogroup 3
Directory of Open Access Journals (Sweden)
Strassmann Joan E
2004-03-01
Full Text Available Abstract Background Social wasps in the subfamily Polistinae (Hymenoptera: Vespidae have been important in studies of the evolution of sociality, kin selection, and within colony conflicts of interest. These studies have generally been conducted within species, because a resolved phylogeny among species is lacking. We used nuclear DNA microsatellite flanking sequences, mitochondrial COI sequence, and morphological characters to generate a phylogeny for the Polistinae (Hymenoptera using 69 species. Results Our phylogeny is largely concordant with previous phylogenies at higher levels, and is more resolved at the species level. Our results support the monophyly of the New World subgenera of Polistini, while the Old World subgenera are a paraphyletic group. All genera for which we had more than one exemplar were supported as monophyletic except Polybia which is not resolved, and may be paraphyletic. Conclusion The combination of DNA sequences from flanks of microsatellite repeats with mtCOI sequences and morphological characters proved to be useful characters establishing relationships among the different subgenera and species of the Polistini. This is the first detailed hypothesis for the species of this important group.
Xu, Dongdong; Li, Sanlei; Lou, Bao; Zhang, Yurong; Zhan, Wei; Shi, Huilai
2012-07-01
Japanese flounder is one of the most important commercial species in China; however, information on the genetic background of natural populations in China seas is scarce. The lack of genetic data has hampered fishery management and aquaculture development programs for this species. In the present study, we have analyzed the genetic diversity in natural populations of Japanese flounder sampled from the Yellow Sea (Qingdao population, QD) and East China Sea (Zhoushan population, ZS) using 10 polymorphic microsatellite loci and cytochrome c oxidase subunit I (COI) sequencing data. A total of 68 different alleles were observed over 10 microsatellite loci. The total number of alleles per locus ranged from 2 to 9, and the number of genotypes per locus ranged from 3 to 45. The observed heterozygosity and expected heterozygosity in QD were 0.733 and 0.779, respectively, and in ZS the heterozygosity values were 0.708 and 0.783, respectively. Significant departures from Hardy-Weinberg equilibrium were observed in 7 of the 10 microsatellite loci in each of the two populations. The COI sequencing analysis revealed 25 polymorphic sites and 15 haplotypes in the two populations. The haplotype diversity and nucleotide diversity in the QD population were 0.746±0.072 8 and 0.003 34±0.001 03 respectively, and in ZS population the genetic diversity values were 0.712±0.047 0 and 0.003 18±0.000 49, respectively. The microsatellite data ( F st =0.048 7, P <0.001) and mitochondrial DNA data ( F st =0.128, P <0.001) both revealed significant genetic differentiation between the two populations. The information on the genetic variation and differentiation in Japanese flounder obtained in this study could be used to set up suitable guidelines for the management and conservation of this species, as well as for managing artificial selection programs. In future studies, more geographically diverse stocks should be used to obtain a deeper understanding of the population structure of Japanese
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir
2018-04-01
Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.
Zhang, Cheng; Li, Qingqing; Wu, Xugan; Liu, Qing; Cheng, Yongxu
2017-11-20
The Chinese mitten crab, Eriocheir sinensis, is one of the important native crab species in East Asian region, which has been widely cultured throughout China, particularly in river basins of Yangtze, Huanghe and Liaohe. This study was designed to evaluate the genetic diversity and genetic structure of cultured and wild E. sinensis populations from the three river basins based on mitochondrial DNA (mtDNA) cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b). The results showed that there were 62 variable sites and 30 parsimony informative sites in the 647 bp of sequenced mtDNA COI from 335 samples. Similarly, a 637 bp segment of Cyt b provided 59 variable sites and 26 parsimony informative sites. AMOVA showed that the levels of genetic differentiation were low among six populations. Although the haplotype diversity and nucleotide diversity of Huanghe wild population had slightly higher than the other populations, there were no significant differences. There was no significant differentiation between the genetic and geographic distance of the six populations, and haplotype network diagram indicated that there may exist genetic hybrids of E. sinensis from different river basins. The results of clustering and neutrality tests revealed that the distance of geographical locations were not completely related to their genetic distance values for the six populations. In conclusion, these results have great significance for the evaluation and exploitation of germplasm resources of E. sinensis.
Unusually high genetic diversity in COI sequences of Chimarra obscura (Trichoptera: Philopotamidae)
Chimarra obscura (Walker 1852) is a philopotamid caddisfly found throughout much of North America. Using the COI DNA barcode locus, we have found unexpectedly high amounts of genetic diversity and distances within C. obscura. Of the approximately 150 specimens sampled, we have fo...
Directory of Open Access Journals (Sweden)
Monte Tainá CC
2012-11-01
Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.
2012-01-01
Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987
Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo
2012-11-06
The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.
Directory of Open Access Journals (Sweden)
Vanderly Andrade-Souza
Full Text Available High morphological homogeneity and cryptic speciation may cause the diversity within Simuliidae to be underestimated. Recent molecular studies on population genetics and phylogeography have contributed to reveal which factors influenced the diversity within this group. This study aimed at examining the genetic diversity of Simulium hirtipupa Lutz, 1910 in populations from the biomes Caatinga, Cerrado, and Atlantic Forest. In this study, we carried out phylogeographic and population genetic analyses using a fragment of the mitochondrial gene COI. The 19 populations studied were clustered into seven groups, most of which are associated with geography indicating certain genetic structure. The northern region of the state of Minas Gerais is most likely the center of origin of this species. The average intergroup genetic distance was 3.7%, indicating the presence of cryptic species. The species tree as well as the haplotype network recovered all groups forming two major groups: the first comprises groups Gr-Bahia (in which the São Francisco river has not acted as geographical barrier, Gr-Pernambuco, and Gr-Mato Grosso do Sul. The second included groups comprising populations of the states of Goiás, Tocantins, Minas Gerais, Bahia, São Paulo, and Espírito Santo. The mismatch distribution for groups was consistent with the model of demographic expansion, except for the Gr-Central-East_1 group. The diversification in this group occurred about 1.19 Mya during the Pleistocene, influenced by paleoclimatic oscillations during the Quaternary glacial cycles.
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Sun, Xinxu; Xu, Dongdong; Lou, Bao; Zhang, Tao; Xin, Jian; Guo, Yaoshi; Ma, Shilei
2013-11-01
Eleutheronema rhadinum is a potential commercial fisheries species and is subject to intense exploitation in China. Knowledge on the population structure of E. rhadinum in Chinese coastal waters, which is important for sustainable exploitation and proper resource management, is lacking. In the present study, the genetic diversity and population structure of E. rhadinum were evaluated using a 564-base pair fragment of the mitochondrial cytochrome c oxidase subunit I (COI) gene. A total of 76 specimens were collected from three localities around the East (Qidong and Zhoushan) and South China Seas (Zhuhai). Among these individuals, nine polymorphic sites were detected and 11 distinct haplotypes were defined. High levels of haplotype diversity ( h =0.759±0.035) and low levels of nucleotide diversity ( π= 0.001 98±0.003 26) were observed in these populations. Hierarchical analysis of molecular variance (AMOVA) indicated that 96.72% of the genetic variation occurred within the populations, whereas 3.28% occurred among populations. No significant genealogical branches or clusters were recognized on the neighbor-joining tree. Intra-group variation among populations was significant ( φ st=0.032 85, PTests of neutral evolution and mismatch distribution suggest that E. rhadinum may have experienced a population expansion. The present study provides basic information for the conservation and sustainable exploitation of this species.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Saldamando, Clara Inés; Marquez, Edna Judith
2012-09-01
The genus Spodoptera includes 30 species of moths considered important pests worldwide, with a great representation in the Western Hemisphere. In general, Noctuidae species have morphological similarities that have caused some difficulties for assertive species identification by conventional methods. The purpose of this work was to generate an approach to the genus phylogeny from several species of the genus Spodoptera and the species Bombyx mori as an out group, with the use of molecular tools. For this, a total of 102 S. frugiperda larvae were obtained at random in corn, cotton, rice, grass and sorghum, during late 2006 and early 2009, from Colombia. We took ADN samples from the larval posterior part and we analyzed a fragment of 451 base pairs of the mitochondrial gene cytochrome oxydase I (COI), to produce a maximum likelihood (ML) tree by using 62 sequences (29 Colombian haplotypes were used). Our results showed a great genetic differentiation (K2 distances) amongst S. frugiperda haplotypes from Colombia and the United States, condition supported by the estimators obtained for haplotype diversity and polymorphism. The obtained ML tree clustered most of the species with bootstrapping values from 73-99% in the interior branches; with low values also observed in some of the branches. In addition, this tree clustered two species of the Eastern hemisphere (S littoralis and S. litura) and eight species of the Western hemisphere (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli and S. pulchella). In Colombia, S. frugiperda, S. ornithogalli and S. albula represent a group of species referred as "the Spodoptera complex" of cotton crops, and our work demonstrated that sequencing a fragment of the COI gene, allows researchers to differentiate the first two species, and thus it can be used as an alternative method to taxonomic keys based on morphology. Finally, the ML tree did not cluster S. frugiperda with S. ornithogalli
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Park, Hyun Suk; Kim, Choong-Gon; Kim, Sung; Park, Yong-Joo; Choi, Hee-Jung; Xiao, Zhizhong; Li, Jun; Xiao, Yongshuang; Lee, Youn-Ho
2018-04-01
The rock bream, Oplegnathus fasciatus, is a common rocky reef game fish in East Asia and recently has become an aquaculture species. Despite its commercial importance, the population genetic structure of this fish species remains poorly understood. In this study, 163 specimens were collected from 6 localities along the coastal waters of Korea and China and their genetic variation was analyzed with mtDNA COI sequences. A total of 34 polymorphic sites were detected which determined 30 haplotypes. The genetic pattern reveals a low level of nucleotide diversity (0.04 ± 0.003) but a high level of haplotype diversity (0.83 ± 0.02). The 30 haplotypes are divided into two major genealogical clades: one that consists of only Zhoushan (ZS, East China Sea) specific haplotypes from the southern East China Sea and the other that consists of the remaining haplotypes from the northern East China Sea, Yellow Sea, Korea Strait, and East Sea/Sea of Japan. The two clades are separated by approximately 330 435 kyBP. Analyses of AMOVA and F st show a significant population differentiation between the ZS sample and the other ones, corroborating separation of the two genealogical clades. Larval dispersal and the fresh Yangtze River plume are invoked as the main determining factors for this population genetic structure of O. fasciatus. Neutrality tests and mismatch distribution analyses indicate late Pleistocene population expansion along the coastal waters of Korea and China approximately 133-183 kyBP during which there were periodic cycles of glaciations and deglaciations. Such population information needs to be taken into account when stock enhancement and conservation measures are implemented for this fisheries species.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Shariff, Safiah; Yaakop, Salmah; Zain, Badrul Munir Md.
2013-11-01
Members of the Opiinae subfamily (Hymenoptera: Braconidae) are well known as important parasitoids of fruit fly larvae (Diptera: Tephritidae). They are widely used as biological control agents of fruit flies, especially the Bactrocera Macquart species that infest fruits. In this study, the larvae of fruit flies were collected from infested crops including star fruit, guava, wax apple and ridge gourd. The parasitized larvae were then reared under laboratory conditions until emergence of the adult parasitoids. Additionally, Malaise trap also was used to collect parasitoid species. The general concept of the multiplex PCR has been performed is to amplify two mitochondrial DNA markers, namely cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) simultaneously. Therefore, the lengthy process of reaction will be reduced. The status of the fruit fly species has also been confirmed by using COI marker on the early stage of the larvae. Maximum parsimony (MP) and Bayesian Inference (BI) were implemented to help and support the identification of Opiinae species. The result obtained from this study showed three parasitoid genera of the Opiinae viz. Fopius Wharton, Psyttalia Walker and Diachasmimorpha Viereck. Each genus has been determined by clustering together in a similar clade according to their infested crops. Therefore, accurate determination of parasitoids and the fruit fries species was highly useful and necessary for successful biological control of Bactrocera species.
Joseph, Sneha; Poriya, Paresh; Kundu, Rahul
2016-11-01
The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R
2017-11-01
Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
We utilized two molecular methods to aid in resolving the Gonatocerus tuberculifemur complex, potential glassy-winged sharpshooter (GWSS) biological control candidate agents from South America. The two methods used were DNA sequencing of both the mitochondrial cytochrome oxidase subunit 1 gene (COI...
Radhika, R; Bijoy Nandan, S; Harikrishnan, M
2017-11-01
Morphological identification of the marine cyclopoid copepod Dioithona rigida in combination with sequencing a 645 bp fragment of mitochondrial cytochrome oxidase c subunit I (mtCOI) gene, collected from offshore waters of Kavarathi Island, Lakshadweep Sea, is presented in this study. Kiefer in 1935 classified Dioithona as a separate genus from Oithona. The main distinguishing characters observed in the collected samples, such as the presence of well-developed P5 with 2 setae, 5 segmented urosome, 12 segmented antennule, compact dagger-like setae on the inner margin of proximal segment of exopod ramus in P1-P4 and engorged portion of P1-bearing a spine, confirmed their morphology to D. rigida. A comparison of setal formulae of the exopod and endopod of D. rigida with those recorded previously by various authors are also presented here. Maximum likelihood Tree analysis exhibited the clustering of D. rigida sequences into a single clade (accession numbers KP972540.1-KR528588.1), which in contrast was 37-42% divergent from other Oithona species. Further intra-specific divergence values of 0-2% also confirmed the genetic identity of D. rigida species. Paracyclopina nana was selected as an out group displayed a diverged array. The present results distinctly differentiated D. rigida from other Oithona species.
Lasota, Rafal; Pierscieniak, Karolina; Garcia, Pascale; Simon-Bouhet, Benoit; Wolowicz, Maciej
2016-11-01
The aim of the study was to determine genetic diversity in the soft-shell clam Mya arenaria on a wide geographical scale using mtDNA COI gene sequences. Low levels of genetic diversity was found, which can most likely be explained by a bottleneck effect during Pleistocene glaciations and/or selection. The geographical genetic structuring of the studied populations was also very low. The star-like phylogeny of the haplotypes indicates a relatively recent, rapid population expansion following the glaciation period and repeated expansion following the founder effect(s) after the initial introduction of the soft-shell clam to Europe. North American populations are characterized by the largest number of haplotypes, including rare ones, as expected for native populations. Because of the founder effect connected with initial and repeated expansion events, European populations have significantly lower numbers of haplotypes in comparison with those of North America. We also observed subtle differentiations among populations from the North and Baltic seas. The recently founded soft-shell clam population in the Black Sea exhibited the highest genetic similarity to Baltic populations, which confirmed the hypothesis that M. arenaria was introduced to the Gulf of Odessa from the Baltic Sea. The most enigmatic results were obtained for populations from the White Sea, which were characterized by high genetic affinity with American populations.
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
High-altitude adaptation of Tibetan chicken from MT-COI and ATP-6 perspective.
Zhao, Xiaoling; Wu, Nan; Zhu, Qing; Gaur, Uma; Gu, Ting; Li, Diyan
2016-09-01
The problem of hypoxia adaptation in high altitudes is an unsolved brainteaser in the field of life sciences. As one of the best chicken breeds with adaptability to highland environment, the Tibetan chicken, is genetically different from lowland chicken breeds. In order to gain a better understanding of the mechanism of hypoxic adaptability in high altitude, in the present study, we focused on the MT-COI together with ATP-6 gene to explore the regulatory mechanisms for hypoxia adaptability in Tibet chicken. Here, we sequenced MT-COI of 29 Tibetan chickens and 30 Chinese domestic chickens and ATP-6 gene of 28 Tibetan chickens and 29 Chinese domestic chickens. In MT-COI gene, 9 single nucleotide polymorphisms (SNPs) were detected though none of these was a missense mutation, confirming the fact that MT-COI gene is a largely conservative sequence. In ATP-6 gene, 6 single nucleotide polymorphisms (SNPs) were detected and we found a missense mutation (m.9441G > A) in the ATP-6 gene of Tibetan chicken resulting in an amino acid substitution. Due to the critical role of ATP-6 gene in the proton translocation and energy metabolism, we speculated the possibility of this mutation playing an important role in easier energy conversion and metabolism in Tibetan chickens than Chinese domestic chickens so as to better adapt to the harsh environment of the high-altitude areas. The Median-joining profile also suggested that haplotype Ha2 has the ancestral position to the other haplotypes and has significant relationship with high-altitude adaptation in ATP-6 gene. Therefore, we considered that the polymorphism (m.9441G > A) in the ATP-6 gene may affect the specific functions of ATP-6 enzyme relating to high-altitude adaptation of Tibetan chicken and MT-COI gene is a largely conservative sequence.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Jouladeh Roudbar,Arash; Eagderi,Soheil; Esmaeili,Hamid Reza; Coad,Brian; Bogutskaya,Nina
2016-01-01
Abstract The molecular status of nine species of the genus Alburnoides from different river drainages in Iran and additionally by seven species from Europe was assessed. mtDNA COI gene sequences from freshly collected specimens and available NCBI data revealed four major phylogenetic lineages. Based on the results, a distinct taxon from the Cheshmeh Ali (Ali Spring), a Damghan River tributary in the endorheic Dasht-e Kavir basin, northern Iran, which is the closest sister to Alburnoides namak...
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Applications of High-Throughput Nucleotide Sequencing (PhD)
DEFF Research Database (Denmark)
Waage, Johannes
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Directory of Open Access Journals (Sweden)
Ronny Weigelt
2017-06-01
Full Text Available The first documented scientific reports of the common marine shipworm Teredo navalis (Bivalvia for Central European waters date back to the time between 1700 and 1730 in the Netherlands. During the following centuries there were several irregular mass occurrences reported for both the North Sea and the Baltic Sea. These events were accompanied by massive destruction of wooden ships and coastal protection structures. In this study, the first population analysis of T. navalis is presented with the aim to detect the genetic population structure in the waters of Central Europe. The mtDNA COI (cytochrome c oxidase subunit I locus was found as suitable molecular marker and hence a 675 bp gene fragment was studied. A total of 352 T. navalis specimens from 13 different sampling sites distributed across Central Europe were examined. Subsequently, various population genetic indices including FST values and an AMOVA analysis were applied for the description of the population structure. To visualize the distribution of haplotypes at the different sampling sites two median-joining networks were calculated. In addition, the past demographic structure of the T. navalis population was analyzed, among others by calculating Tajima's D, Fu's F and the mismatch distribution. Finally, all computations of the population genetic indices could not reveal differentiated populations or any kind of distinct population structure in T. navalis. The network analyses revealed “star-like” patterns without differentiated substructures or demes. Therefore, it can be assumed that a sudden expansion of this species took place without any indications of neither a bottleneck nor a founder effect for the study area. The results of this study support the concept of a regional panmictic population in the waters of Central Europe with unhindered migration of individuals (e.g., via pelagic larvae between the various sampling sites as reflected by a high gene flow.
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Cloning, expression and characterization of COI1 gene (AsCOI1 from Aquilaria sinensis (Lour. Gilg
Directory of Open Access Journals (Sweden)
Yongcui Liao
2015-09-01
Full Text Available Aquilaria sinensis, a kind of typically wounding-induced medicinal plant with a great economical value, is widely used in the production of traditional Chinese medicine, perfume and incense. Coronatine-insensitive protein 1 (COI1 acts as a receptor in jasmonate (JA signaling pathway, and regulates the expression of JA-responsive genes in plant defense. However, little is known about the COI1 gene in A. sinensis. Here, based on the transcriptome data, a full-length cDNA sequence of COI1 (termed as AsCOI1 was firstly cloned by RT–PCR and rapid-amplification of cDNA ends (RACE strategies. AsCOI1 is 2330 bp in length (GenBank accession No. KM189194, and contains a complete open frame (ORF of 1839 bp. The deduced protein was composed of 612 amino acids, with a predicted molecular weight of 68.93 kDa and an isoelectric point of 6.56, and was predicted to possess F-box and LRRs domains. Combining bioinformatics prediction with subcellular localization experiment analysis, AsCOI1 was appeared to locate in nucleus. AsCOI1 gene was highly expressed in roots and stems, the major organs of agarwood formation. Methyl jasmonate (MeJA, mechanical wounding and heat stress could significantly induce the expression level of AsCOI1 gene. AsCOI1 is an early wound-responsive gene, and it likely plays some role in agarwood formation.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Directory of Open Access Journals (Sweden)
Clara Inés Saldamando
2012-09-01
several species of the genus Spodoptera and the species Bombyx mori as an out group, with the use of molecular tools. For this, a total of 102 S. frugiperda larvae were obtained at random in corn, cotton, rice, grass and sorghum, during late 2006 and early 2009, from Colombia. We took ADN samples from the larval posterior part and we analyzed a fragment of 451 base pairs of the mitochondrial gene cytochrome oxydase I (COI, to produce a maximum likelihood (ML tree by using 62 sequences (29 Colombian haplotypes were used. Our results showed a great genetic differentiation (K2 distances amongst S. frugiperda haplotypes from Colombia and the United States, condition supported by the estimators obtained for haplotype diversity and polymorphism. The obtained ML tree clustered most of the species with bootstrapping values from 73-99% in the interior branches; with low values also observed in some of the branches. In addition, this tree clustered two species of the Eastern hemisphere (S. littoralis and S. litura and eight species of the Western hemisphere (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli and S. pulchella. In Colombia, S. frugiperda, S. ornithogalli and S. albula represent a group of species referred as “the Spodoptera complex” of cotton crops, and our work demonstrated that sequencing a fragment of the COI gene, allows researchers to differentiate the first two species, and thus it can be used as an alternative method to taxonomic keys based on morphology. Finally, the ML tree did not cluster S. frugiperda with S. ornithogalli, suggesting that both species do not share the same recent ancestral even though they coexist in cotton. We suggest sequencing other genes (mitochondrial and nuclear to increase our understanding of this genus evolution.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Directory of Open Access Journals (Sweden)
Salem Mohamed
2009-11-01
Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
Roudbar, Arash Jouladeh; Eagderi, Soheil; Esmaeili, Hamid Reza; Coad, Brian W; Bogutskaya, Nina
2016-01-01
The molecular status of nine species of the genus Alburnoides from different river drainages in Iran and additionally by seven species from Europe was assessed. mtDNA COI gene sequences from freshly collected specimens and available NCBI data revealed four major phylogenetic lineages. Based on the results, a distinct taxon from the Cheshmeh Ali (Ali Spring), a Damghan River tributary in the endorheic Dasht-e Kavir basin, northern Iran, which is the closest sister to Alburnoides namaki (Namak Lake basin) + Alburnoides coadi (Nam River in the endorheic Dasht-e Kavir basin) is considered as a new species, Alburnoides damghani sp. n. It is distinguished from other Alburnoides species in Iran by a combination of character states including: a weakly-developed, variably-scaled, ventral keel from completely scaleless to completely scaled, a short snout with the tip of the mouth cleft on a level with the lower margin of the pupil or slightly lower, a small eye (eye horizontal diameter slightly to markedly less than interorbital width), commonly 8½ branched dorsal-fin rays, commonly 11-12½ branched anal-fin rays, 40-46(47) total lateral-line scales, 2.5-4.2 or 2.5-4.1 pharyngeal teeth, gill rakers short and widely spaced, 6-8 in total, 39-41 (commonly 40), total vertebrae, (19)20(21) abdominal vertebrae, 19-21 (most commonly 20) caudal vertebrae, abdominal vertebral region most commonly equal to or longer than caudal region, and most common vertebral formulae 20+20 and 21+19.
Directory of Open Access Journals (Sweden)
Robert Blakemore
2010-03-01
Full Text Available A neotype is designated for the large and ecologically interesting species of Japanese earthworm, Drawida hattamimizu Hatai, 1930. Its morphological redescription is unambiguously combined with the neotype’s sequence of the Cytochrome Oxidase I (COI locus of the mitochondrial DNA, the first time an earthworm species’ type has been thus profiled. Probably it is an introduced exotic rather than a translocated native, with a patchy distribution that appears only partly defined in Japan where it is both a restricted and an endangered listed species. Brief comparison of sympatric Drawida japonica (Michaelsen, 1892 to the type-species Drawida barwelli (Beddard, 1886 – and this latter from Shiga appears as a new record for Japan – allows the diagnosis of Drawida Michaelsen, 1900 to be amended slightly. The contentious issue of molecular ‘cryptic species’ is queried in relation to the lack of molecular data from type-specimens, the unique name-bearing references employed in zoological nomenclature. Without such reference, neither eco-taxonomic nor genomic studies of earthworm taxa can progress. In this regard, questions are raised concerning the molecular identities and provisional divergences of cosmopolitan generotypes Allolobophora chlorotica chlorotica (Savigny, 1826, the Aporrectodea caliginosa (Savigny, 1826 species-complex sensu Blakemore (2002, and of ecotoxicological standard test-species icon Eisenia fetida fetida (Savigny, 1826. Resurrection of their respective synonyms is mooted. Resolution of relationships within and between earthworm genera and families without DNA testing of the representative type-species and type-genera is flagged as another crucial concern.
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).
Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc
2011-01-01
DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
National Research Council Canada - National Science Library
Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M
2004-01-01
.... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning
Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M
2018-01-01
Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.
Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning
Teng, Haotian
2018-04-10
Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H
2008-01-01
During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Directory of Open Access Journals (Sweden)
Haag KL
1998-01-01
Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised
DNA Barcoding the Medusozoa using mtCOI
Ortman, Brian D.; Bucklin, Ann; Pagès, Francesc; Youngbluth, Marsh
2010-12-01
The Medusozoa are a clade within the Cnidaria comprising the classes Hydrozoa, Scyphozoa, and Cubozoa. Identification of medusozoan species is challenging, even for taxonomic experts, due to their fragile forms and complex, morphologically-distinct life history stages. In this study 231 sequences for a portion of the mitochondrial Cytochrome Oxidase I (mtCOI) gene were obtained from 95 species of Medusozoans including; 84 hydrozoans (61 siphonophores, eight anthomedusae, four leptomedusae, seven trachymedusae, and four narcomedusae), 10 scyphozoans (three coronatae, four semaeostomae, two rhizostomae, and one stauromedusae), and one cubozoan. This region of mtCOI has been used as a DNA barcode (i.e., a molecular character for species recognition and discrimination) for a diverse array of taxa, including some Cnidaria. Kimura 2-parameter (K2P) genetic distances between sequence variants within species ranged from 0 to 0.057 (mean 0.013). Within the 13 genera for which multiple species were available, K2P distance between congeneric species ranged from 0.056 to 0.381. A cluster diagram generated by Neighbor Joining (NJ) using K2P distances reliably clustered all barcodes of the same species with ≥99% bootstrap support, ensuring accurate identification of species. Intra- and inter-specific variation of the mtCOI gene for the Medusozoa are appropriate for this gene to be used as a DNA barcode for species-level identification, but not for phylogenetic analysis or taxonomic classification of unknown sequences at higher taxonomic levels. This study provides a set of molecular tools that can be used to address questions of speciation, biodiversity, life-history, and population boundaries in the Medusozoa.
Molecular cloning and nucleotide sequence of cDNA for human liver arginase
International Nuclear Information System (INIS)
Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.
1987-01-01
Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes
International Nuclear Information System (INIS)
Black, C.G.; Fyfe, J.A.M.; Davies, J.K.
1997-01-01
A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Symbolic complexity for nucleotide sequences: a sign of the genome structure
International Nuclear Information System (INIS)
Salgado-García, R; Ugalde, E
2016-01-01
We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)
Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.
Han, S S; Karasev, A V; Ieki, H; Iwanami, T
2002-11-01
Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.
Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard
2015-09-01
Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.
Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth
2017-08-15
Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.
1987-01-01
The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
E-Learning dengan Menggunakan COI Framework
Directory of Open Access Journals (Sweden)
Lydiawati Kosasih
2013-12-01
Full Text Available This study discusses some considerations in education to achieve a good quality of learning by utilizing technological advances such as E-Learning. This study uses a model of Community of Inquiry (COI as a comparative study to improve the quality of E-Learning program. Implementation of COI model in discussionforum on BiNusMaya through E-Learning is able to improve the quality of a discussion as improvement of knowledge management. This study aims to provide a proposal to the Department of Information Systems Bina Nusantara University in enhancing the effectiveness of the use of discussion forums on BiNusMaya (ELearning. By presenting the survey results related to the Binusmaya current condition,s such constraints and development expectations of both the lecturers and students for Binusmaya can be described. In addition, theapplication of CoI model is presented in a learning process especially when meeting outside of class (without face-to-face. The results of this study is expected to be the basis for developing a COI model design and implementation plan in Management Information Systems course, that may improve the quality of the use of discussion forums as part of the knowledge management process in future study.
The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11
International Nuclear Information System (INIS)
Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre
2003-01-01
The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K
Energy Technology Data Exchange (ETDEWEB)
Ferrari, S; Drusiani, E; Battini, R; Fregni, M
1988-01-11
Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.
Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus
International Nuclear Information System (INIS)
Upton, C.; McFadden, G.
1986-01-01
The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.
Directory of Open Access Journals (Sweden)
Fang Lü
Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Directory of Open Access Journals (Sweden)
Alban eRamette
2014-11-01
Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.
Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.
Sasaya, T; Ishikawa, K; Koganezawa, H
2001-06-01
A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.
Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A
2016-02-01
It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.
Hierarchical Trust Management of COI in Heterogeneous Mobile Networks
2017-08-01
Report: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks The views, opinions and/or findings contained in this report are those of...Institute & State University Title: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks Report Term: 0-Other Email: irchen@vt.edu...Reconfigurability, Survivability and Intrusion Tolerance for Community of Interest (COI) Applications – Our proposed COI trust management protocol will
Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo
2008-04-30
The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.
Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S
2016-08-01
Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Directory of Open Access Journals (Sweden)
Kei-ichi Morita
Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
McAllister, Christine A; Miller, Allison J
2016-07-01
Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.
Czech Academy of Sciences Publication Activity Database
Helmi, A.; Sharaf, Abdoallah
2016-01-01
Roč. 71, č. 11 (2016), s. 1266-1273 ISSN 0006-3088 Institutional support: RVO:60077344 Keywords : DNA sequencing * Aphididae * COI * biotypes * SNPs * molecular phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.759, year: 2016
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Umene, Kenichi; Shiraishi, Atsushi
2013-06-01
"Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
López-Legentil, S.; Pawlik, J. R.
2009-03-01
In recent years, reports of sponge bleaching, disease, and subsequent mortality have increased alarmingly. Population recovery may depend strongly on colonization capabilities of the affected species. The giant barrel sponge Xestospongia muta is a dominant reef constituent in the Caribbean. However, little is known about its population structure and gene flow. The 5'-end fragment of the mitochondrial gene cytochrome oxidase subunit I is often used to address these kinds of questions, but it presents very low intraspecific nucleotide variability in sponges. In this study, the usefulness of the I3-M11 partition of COI to determine the genetic structure of X. muta was tested for seven populations from Florida, the Bahamas and Belize. A total of 116 sequences of 544 bp were obtained for the I3-M11 partition corresponding to four haplotypes. In order to make a comparison with the 5'-end partition, 10 sequences per haplotype were analyzed for this fragment. The 40 resulting sequences were of 569 bp and corresponded to two haplotypes. The nucleotide diversity of the I3-M11 partition (π = 0.00386) was higher than that of the 5'-end partition (π = 0.00058), indicating better resolution at the intraspecific level. Sponges with the most divergent external morphologies (smooth vs. digitate surface) had different haplotypes, while those with the most common external morphology (rough surface) presented a mixture of haplotypes. Pairwise tests for genetic differentiation among geographic locations based on F ST values showed significant genetic divergence between most populations, but this genetic differentiation was not due to isolation by distance. While limited larval dispersal may have led to differentiation among some of the populations, the patterns of genetic structure appear to be most strongly related to patterns of ocean currents. Therefore, hydrological features may play a major role in sponge colonization and need to be considered in future plans for management and
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
Molecular phylogeny of Anopheles hyrcanus group (Diptera: Culicidae) based on mtDNA COI.
Fang, Yuan; Shi, Wen-Qi; Zhang, Yi
2017-05-08
The Anopheles hyrcanus group, which includes at least 25 species, is widely distributed in the Oriental and Palearctic regions. Some group members have been incriminated as vectors of malaria and other mosquito-borne diseases. It is difficult to identify Hyrcanus Group members by morphological features. Thus, molecular phylogeny has been proposed as an important complementary method to traditional morphological taxonomy. Based on the GenBank database and our original study data, we used 466 mitochondrial DNA COI sequences belonging to 18 species to reconstruct the molecular phylogeny of the Hyrcanus Group across its worldwide geographic range. The results are as follows. 1) The average conspecific K2P divergence was 0.008 (range 0.002-0.017), whereas sequence divergence between congroup species averaged 0.064 (range 0.026-0.108). 2) The topology of COI tree of the Hyrcanus Group was generally consistent with classical morphological taxonomy in terms of species classification, but disagreed in subgroup division. In the COI tree, the group was divided into at least three main clusters. The first cluster contained An. nimpe; the second was composed of the Nigerrimus Subgroup and An. argyropus; and the third cluster was comprised of the Lesteri Subgroup and other unassociated species. 3) Phylogenetic analysis of COI indicated that ancient hybridizations probably occurred among the three closely related species, An. sinensis, An. belenrae, and An. kleini. 4) The results supported An. paraliae as a probable synonym of An. lesteri, and it was possible that An. pseudopictus and An. hyrcanus were the same species, as evident from their extremely low interspecific genetic divergence (0.020 and 0.007, respectively) and their phylogenetic positions. In summary, we reconstructed the molecular phylogeny and analysed genetic divergence of the Hyrcanus Group using mitochondrial COI sequences. Our results suggest that in the future of malaria surveillance, we should not only pay
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Directory of Open Access Journals (Sweden)
Annemieke Smet
Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of
Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J
2014-01-01
Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
The impact of COI-based storage on order-picking times
Directory of Open Access Journals (Sweden)
Grzegorz Tarczyński
2017-09-01
Full Text Available Background: The increasing competitiveness on the global markets enforces the need for a fast and reliable delivery. This task is possible to perform by improving the order-picking systems. The implementation of automated storage and retrieval systems (AS/RS is not always profitable. In the warehouses where the order-picking is performed in accordance with the principle of picker-to-part rule, the picking efficiency optimization includes among others: the warehouse layout, the storage policy, the routing heuristic, the way of zoning, the order-batching method, and the sequencing of pick-lists. In the paper the impact of the storage policy on the order-picking times is checked. Methods: The influence of storage based on Heskett’s cube-per-order index (COI on the average order-picking times is analyzed. The items based on increasing values of COI index are divided on classes. To determine the demand for items the analytical function proposed by Caron is used. Results: In the paper the benefits of storage based on COI index are compared with random storage and storage based only on picking frequency. It is assumed that the bin, to which the picker collects items has limited capacity – some orders has to be divided on smaller pick-lists. The analysis was performed using simulation tools. Additionally, the algorithm (taking into account different sizes of picker’s bin for order-batching is presented. Conclusions: The analysis shows that the COI-based storage is particularly effective when the size of items increases. The COI-based curve is less skewed than the curve based only on picking frequency. The choice of storage policy should be carried out together with routing heuristic. The use of batching algorithm significantly increases the effectiveness of the order-picking process, but the optimal size of picker’s bin (and batch should be optimized with consideration the sorting process.
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K
1986-01-01
Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
Haplotype Diversity of COI Gene of Hylarana chalconota Species Found at State University of Malang
Directory of Open Access Journals (Sweden)
Dian Ratri Wulandari
2014-01-01
Full Text Available Hylarana chalconota is a cryptic species of frog endemic to Java Island [1]. This species is small with long legs, and brown skin. The Snout-Vent Length (SVL ranges between 30-40 mm for male and 45-65 mm for female. [4] Reports the existence of this species in State University of Malang, which was not found in 1995 [5]. Sampel #1 displays spots in its skin, which does not exist in sample #2. To reveal the haplotype diversity of COI gene in this species, we analyzed Cytochrome-c oxidase subunit-1 (COI sequences of both samples. Using a pair of primers according to [6] both samples had 604 bp and 574 bp fragment length, respectively. These fragments showed polymorphism; with mutation position in sites 104, 105, and 124. Based on this result, we suggest that the two samples share a different haplotypes, proposed as UM1 and UM2.
Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells
International Nuclear Information System (INIS)
Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada
1988-01-01
HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription
DEFF Research Database (Denmark)
Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P
1991-01-01
After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....
Czech Academy of Sciences Publication Activity Database
Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.
2006-01-01
Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006
International Nuclear Information System (INIS)
Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.
1987-01-01
The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site
Directory of Open Access Journals (Sweden)
Majewski Jacek
2006-08-01
Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.
Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J
1989-12-21
The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)
International Nuclear Information System (INIS)
O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.
1987-01-01
Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats
Lan, Zhao Jun; Lin, Long Feng; Zhao, Jun
2017-04-18
Both Hemibarbus labeo and H. medius (Cypriniformes: Cyprinidae: Gobioninae) are primary freshwater fishes and are widely distributed. As such, they provide an ideal model for phylogeographical studies. However, the similarity in morphological characters between these two species made the description of their distributions and the validation of species quite challenging. Here we employed variations in the DNA sequences of mitochondrial COI and ND5 genes (2151 bp) to solve this challenge and to study the population genetics structure of these two species. Among the 130 specimens belonging to 8 populations of H. labeo and 9 populations of H. medius from 17 drainage systems in southern China,196 variable sites (9.1% in the full sequences) falling into 50 haplotypes were identified. The haplotype diversity (h) and the nucleotide diversity (π) were 0.964 and 0.019, respectively, indicating a high level of genetic diversity and an evolutionary potential in both species. The result of neighbor-joining tree based on composite nucleotide sequences of the mtDNA COI and ND5 genes showed that the H. labeo and H. medius fell into two major clades (clade1and clade2): clade1was composed of some specimens of Oujiang River, all the specimens of Hanjiang River and Jiulongjiang River, whereas all remaining populations fell in clade2. The genetic distance between clade I and clade II was 0.036, while that between H. labeo and H. medius was 0.027. The haplotype network analyses indicated that the populations of Hanjiang River and Jiulongjiang River had relatively high genetic variation with the rest rivers. The po-pulations of Hainan Island migrated northward to Moyangjaing River. Haplotypes of the rivers of Hainan Island and Moyangjang River had relatively higher genetic variation with the Yangtze River than Pearl River. The populations of Xiangjiang River had no genetic variation with the populations of Guijiang River and Liujiang River. Analysis of molecular variance (AMOVA
Directory of Open Access Journals (Sweden)
amirreza ebadi
2015-02-01
Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.
Vongerichten, K F; Klein, J R; Matern, H; Plapp, R
1994-10-01
Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.
Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo
2013-02-04
Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.
Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi
2015-01-01
The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.
Keel, B N; Nonneman, D J; Rohrer, G A
2017-08-01
Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Zhang, Xueru; McGown, Linda B
2013-06-01
DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
International Nuclear Information System (INIS)
Xiong Gang; Wang, X.R.
2005-01-01
The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen
2013-01-01
The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).
Directory of Open Access Journals (Sweden)
Elizabeth N. Krueger
2013-07-01
Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.
Otsuka, J; Kawai, Y; Sugaya, N
2001-11-21
In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H
2002-01-01
Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E
2017-11-09
Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J
2002-01-01
The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel
Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)
Energy Technology Data Exchange (ETDEWEB)
Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)
1988-08-11
The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.
Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.
2004-01-01
A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853
Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L
2009-09-01
IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
DEFF Research Database (Denmark)
Frandsen, T P; Lok, F; Mirgorodskaya, E
2000-01-01
in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...
Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B
2000-05-01
We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.
Institute of Scientific and Technical Information of China (English)
Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian
2004-01-01
The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.
Pinzón, Jorge H; LaJeunesse, Todd C
2011-01-01
Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Berendonk Thomas U
2011-05-01
Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Kononov, Alexander; Ustyantsev, Kirill; Wang, Baode; Mastro, Victor C; Fet, Victor; Blinov, Alexander; Baranchikov, Yuri
2016-12-22
Moths of genus Dendrolimus (Lepidoptera: Lasiocampidae) are among the major pests of coniferous forests worldwide. Taxonomy and nomenclature of this genus are not entirely established, and there are many species with a controversial taxonomic position. We present a comparative evolutionary analysis of the most economically important Dendrolimus species in Eurasia. Our analysis was based on the nucleotide sequences of COI and COII mitochondrial genes and ITS2 spacer of nuclear ribosomal genes. All known sequences were extracted from GenBank. Additional 112 new sequences were identified for 28 specimens of D. sibiricus, D. pini, and D. superans from five regions of Siberia and the Russian Far East to be able to compare the disparate data from all previous studies. In total, 528 sequences were used in phylogenetic analysis. Two clusters of closely related species in Dendrolimus were found. The first cluster includes D. pini, D. sibiricus, and D. superans; and the second, D. spectabilis, D. punctatus, and D. tabulaeformis. Species D. houi and D. kikuchii appear to be the most basal in the genus. Genetic difference among the second cluster species is very low in contrast to the first cluster species. Phylogenetic position D. tabulaeformis as a subspecies was supported. It was found that D. sibiricus recently separated from D. superans. Integration of D. sibiricus mitochondrial DNA sequences and the spread of this species to the west of Eurasia have been established as the cause of the unjustified allocation of a new species: D. kilmez. Our study further clarifies taxonomic problems in the genus and gives more complete information on the genetic structure of D. pini, D. sibiricus, and D. superans.
Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai
2014-12-29
Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.
Directory of Open Access Journals (Sweden)
Matthew D. MacManes
2014-10-01
Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.
Directory of Open Access Journals (Sweden)
Ali M. Sajjad
2016-12-01
Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S
2014-11-01
Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Broad-lined Supernova 2016coi with a Helium Envelope
Energy Technology Data Exchange (ETDEWEB)
Yamanaka, Masayuki [Department of Physics, Faculty of Science and Engineering, Konan University, Okamoto, Kobe, Hyogo 658-8501 (Japan); Nakaoka, Tatsuya; Kawabata, Miho [Department of Physical Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Tanaka, Masaomi [National Astronomical Observatory of Japan, National Institutes of Natural Sciences, Osawa, Mitaka, Tokyo 181-8588 (Japan); Maeda, Keiichi [Department of Astronomy, Graduate School of Science, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan); Honda, Satoshi; Hosoya, Kensuke; Karita, Mayu; Morihana, Kumiko [Nishi-Harima Astronomical Observatory, Center for Astronomy, University of Hyogo, 407-2 Nishigaichi, Sayo-cho, Sayo, Hyogo 679-5313 (Japan); Hanayama, Hidekazu [Ishigakijima Astronomical Observatory, National Astronomical Observatory of Japan, National Institutes of Natural Sciences, 1024-1 Arakawa, Ishigaki, Okinawa 907-0024 (Japan); Morokuma, Tomoki [Institute of Astronomy, Graduate School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Imai, Masataka [Department of Cosmosciences, Graduate School of Science, Hokkaido University, Kita 10 Nishi8, Kita-ku, Sapporo 060-0810 (Japan); Kinugasa, Kenzo [Nobeyama Radio Observatory, National Astronomical Observatory of Japan, National Institutes of Natural Sciences, 462-2 Nobeyama, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Murata, Katsuhiro L. [Department of Astrophysics, Nagoya University, Chikusa-ku, Nagoya 464-8602 (Japan); Nishimori, Takefumi; Gima, Hirotaka; Ito, Ayano; Morikawa, Yuto; Murakami, Kotone [Graduate School of Science and Engineering, Kagoshima University, 1-21-35 Korimoto, Kagoshima 890-0065 (Japan); Hashimoto, Osamu, E-mail: yamanaka@center.konan-u.ac.jp [Gunma Astronomical Observatory, Takayama, Gunma 377-0702 (Japan); and others
2017-03-01
We present the early-phase spectra and the light curves of the broad-lined (BL) supernova (SN) 2016coi from t = 7 to 67 days after the estimated explosion date. This SN was initially reported as a BL Type SN Ic (SN Ic-BL). However, we found that spectra up to t = 12 days exhibited the He i λ 5876, λ 6678, and λ 7065 absorption lines. We show that the smoothed and blueshifted spectra of normal SNe Ib are remarkably similar to the observed spectrum of SN 2016coi. The line velocities of SN 2016coi were similar to those of SNe Ic-BL and significantly faster than those of SNe Ib. Analyses of the line velocity and light curve suggest that the kinetic energy and the total ejecta mass of SN 2016coi are similar to those of SNe Ic-BL. Together with BL SNe 2009bb and 2012ap, for which the detection of He i was also reported, these SNe could be transitional objects between SNe Ic-BL and SNe Ib, and be classified as BL Type “Ib” SNe (SNe “Ib”-BL). Our work demonstrates the diversity of the outermost layer in BL SNe, which should be related to the variety of the evolutionary paths.
[Significance of COI disclosure in medical research in Japan].
Sone, Saburo
2011-11-01
In medical research, remarkable increase in collaboration with industry, public organizations such as universities, research institutions, and academic societies makes researchers to be more deeply involved with the activities of commercial entities. Activities of education and research, which are the responsibilities of academic institutions and societies, conflict with the interests of individuals associated with industrial-academic collaboration. Management of such conflict of interest (COI) is of much importance for academic institutions and societies to appropriately promote industrial-academic collaborative activities. Particularly, participation not only by healthy individuals, but also patients, is essential in the medical field as subjects of clinical research. For those involved in medical research, the deeper the level of COI with commercial entities, who are the financial or benefit provider, becomes serious, the more human rights of subjects could be violated, safety of life could be endangered, and research methods, data analysis and interpretation of results could be distorted. It is also possible that research may be unfairly evaluated or not published, even if the results are accurate, sometimes resulting in the ascertained effects of reporting bias included the overestimation of efficacy and the underestimation of safety risks of interventions. According to the COI management guideline of the Japanese Association of Medical Science (JAMS), significance of COI management is discussed.
Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M
2016-10-02
Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Zagata, Patrycja; Greczek-Stachura, Magdalena; Tarcz, Sebastian; Rautian, Maria
2015-01-01
Paramecium bursaria is composed of five syngens that are morphologically indistinguishable but sexually isolated. The aim of the present study was to confirm by molecular methods (analyses of mitochondrial COI) the identification of P. bursaria syngens originating from different geographical locations. Phylograms constructed using both the neighbor-joining and maximum-likelihood methods based on a comparison of 34 sequences of P. bursaria strains and P. multimicronucleatum, P. caudatum and P.calkinsi strains used as outgroups revealed five clusters which correspond to results obtained previously by mating reaction. Our analysis shows the existence of 24 haplotypes for the COI gene sequence in the studied strains. The interspecies haplotype diversity was Hd = 0.967. We confirmed genetic differentiation between strains of P. bursaria and the occurrence of a correlation between geographical distribution and the correspondent syngen.
Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel
2014-01-01
Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878
Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun
2018-01-01
Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.
Directory of Open Access Journals (Sweden)
Abinaya Manivannan
2018-01-01
Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.
Yund, Philip O; Collins, Catherine; Johnson, Sheri L
2015-06-01
The colonial ascidian Botryllus schlosseri should be considered cryptogenic (i.e., not definitively classified as either native or introduced) in the Northwest Atlantic. Although all the evidence is quite circumstantial, over the last 15 years most research groups have accepted the scenario of human-mediated dispersal and classified B. schlosseri as introduced; others have continued to consider it native or cryptogenic. We address the invasion status of this species by adding 174 sequences to the growing worldwide database for the mitochondrial gene cytochrome c oxidase subunit I (COI) and analyzing 1077 sequences to compare genetic diversity of one clade of haplotypes in the Northwest Atlantic with two hypothesized source regions (the Northeast Atlantic and Mediterranean). Our results lead us to reject the prevailing view of the directionality of transport across the Atlantic. We argue that the genetic diversity patterns at COI are far more consistent with the existence of at least one haplotype clade in the Northwest Atlantic (and possibly a second) that substantially pre-dates human colonization from Europe, with this native North American clade subsequently introduced to three sites in Northeast Atlantic and Mediterranean waters. However, we agree with past researchers that some sites in the Northwest Atlantic have more recently been invaded by alien haplotypes, so that some populations are currently composed of a mixture of native and invader haplotypes. © 2015 Marine Biological Laboratory.
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Directory of Open Access Journals (Sweden)
Corti Stefania
2011-03-01
Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects
Directory of Open Access Journals (Sweden)
Sun Yu
2011-11-01
Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.
Phyllanthus coi (Phyllanthaceae, a new herbaceous species from the Philippines
Directory of Open Access Journals (Sweden)
Ming-Jou WU
2017-11-01
Full Text Available Phyllanthus coi M.J. Wu, Ferreras & Y.J. Chen, a new species from Benguet Province, Island of Luzon, the Philippines, is described and illustrated. Compared to its congeners in the same section, P. coi can be differentiated by having long plagiotropic branchlets with up to 30 leaves per side, seeds with sharp honey-comb-like ridges on the dorsal side, and three free styles that are not lying flat on the top of the ovary. The floral, seed and some vegetative features that distinguish this new species from its nearest morphologically related species, P. erythrotrichus C.B. Rob., P. urinaria L. and P. hookeri Müll. Arg. are provided.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Directory of Open Access Journals (Sweden)
Daniel Lancheros-Piliego
2013-11-01
Full Text Available We molecularly identified the loggerhead turtle Caretta caretta using high-speed PCR amplification and restriction analysis of mitochondrial DNA. We isolated the DNA from blood from juvenile C. caretta from Don Diego beach (Magdalena; n=4, in Islas Del Rosario (Bolívar; n=2 in the Colombian Caribbean. By using high-speed PCR amplification of mitochondrial cytochrome c oxidase I (COI, we reduced reaction by one third and obtained fragments of 650 base pairs. We analyzed the amplified IOC product using enzymes HindIII, HpyCH4III and MseI and generated an electrophoretic profile, which compared in silico to other sea turtle species sequences, revealed the loggerhead’s specific pattern. We found similarity between 97-99% with C. caretta in five of the BLAST analyzed nucleotide sequences and 92% in another. We generated a bar code for the sampled turtle information and sequences and stored them in the BOLD database. The ethodology described for the identification of C. caretta is a fast and inexpensive procedure that minimizes time and improves PCR specificity.
Directory of Open Access Journals (Sweden)
Mullen Michael P
2011-01-01
Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs
The partial mitochondrial sequence of the Old World stingless bee ...
Indian Academy of Sciences (India)
Sequences of primers used in PCR reactions of T. pagdeni mtDNA. mtDNA genes. Primer. Sequence. ATPase (6,8). ATPS6-F. 5 -AAG ATA TAT GGA AAT AAG CT-3. tRNA-ASP-R. 5 -ATA AAA TAA CGT CAA AAT GTC A-3. COI. COI-F. 5 - ATA ATT ATT GTT GCT GAT GTA-3. COI-R. 5 -CTA TTC ATA TAA CTG GAA TTT C-3.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Directory of Open Access Journals (Sweden)
Hisashi Morise
Full Text Available Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU rDNA fragments were directly amplified from each of 68 (flowerbed samples and 48 (field samples isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs, indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis.
Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko
2012-01-01
Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767
Failla, A J; Vasquez, A A; Hudson, P; Fujimoto, M; Ram, J L
2016-02-01
Establishing reliable methods for the identification of benthic chironomid communities is important due to their significant contribution to biomass, ecology and the aquatic food web. Immature larval specimens are more difficult to identify to species level by traditional morphological methods than their fully developed adult counterparts, and few keys are available to identify the larval species. In order to develop molecular criteria to identify species of chironomid larvae, larval and adult chironomids from Western Lake Erie were subjected to both molecular and morphological taxonomic analysis. Mitochondrial cytochrome c oxidase I (COI) barcode sequences of 33 adults that were identified to species level by morphological methods were grouped with COI sequences of 189 larvae in a neighbor-joining taxon-ID tree. Most of these larvae could be identified only to genus level by morphological taxonomy (only 22 of the 189 sequenced larvae could be identified to species level). The taxon-ID tree of larval sequences had 45 operational taxonomic units (OTUs, defined as clusters with >97% identity or individual sequences differing from nearest neighbors by >3%; supported by analysis of all larval pairwise differences), of which seven could be identified to species or 'species group' level by larval morphology. Reference sequences from the GenBank and BOLD databases assigned six larval OTUs with presumptive species level identifications and confirmed one previously assigned species level identification. Sequences from morphologically identified adults in the present study grouped with and further classified the identity of 13 larval OTUs. The use of morphological identification and subsequent DNA barcoding of adult chironomids proved to be beneficial in revealing possible species level identifications of larval specimens. Sequence data from this study also contribute to currently inadequate public databases relevant to the Great Lakes region, while the neighbor
Energy Technology Data Exchange (ETDEWEB)
Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)
1989-06-12
The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.
Energy Technology Data Exchange (ETDEWEB)
Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)
1988-07-25
Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Directory of Open Access Journals (Sweden)
Xiaolin Ji
Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.
Directory of Open Access Journals (Sweden)
Maíra C. M. Freire
2008-01-01
Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.
International Nuclear Information System (INIS)
Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.
1987-01-01
The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond
Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat
2017-07-01
The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
Directory of Open Access Journals (Sweden)
Saliha Hammoumi
2016-09-01
Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All
International Nuclear Information System (INIS)
Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.
1988-01-01
The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems
Directory of Open Access Journals (Sweden)
Bhattacharyya Madan K
2008-03-01
Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a
Lee, K-E; Lee, E-J; Park, H-S
2016-08-30
Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.
Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.
2002-01-01
The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily
The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...
The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
DEFF Research Database (Denmark)
Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin
2015-01-01
Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...
DEFF Research Database (Denmark)
Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar
1992-01-01
O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Ordoñez, June Feliciano F; Ventolero, Minerva Fatimae H; Santos, Mudjekeewis D
2017-07-01
The introduction of genetically enhanced tilapia has significantly boosted the performance of Philippine aquaculture industry. While enhanced strains contribute to the increase in tilapia production, genetic characterization of present tilapia stocks is critical to maintain their quality and to ensure the genetic gains are sustained. To understand and determine the genetic relationship of the genetically enhanced strains produced in the Philippines, mitochondrial cytochrome oxidase subunit I (COI) gene using DNA barcoding approach was analyzed. Specimens representing 10 genetically enhanced strains (GIFT, FaST, GET-EXCEL, GST, SST, COLD, YY-male, GMT, Molobicus, and BEST), three red tilapia (Taiwan red, Florida red, and FAC-red), and two pure lines (initially identified as O. aureus and O. spilurus) were collected, sequenced, and identified using DNA barcoding. Results revealed that farmed tilapias consisted of four different Oreochromis species. As expected, COI could not distinguish individuals at the strain level but surprisingly, mismatch between the species of maternal origin and present-day offspring was observed. This particular result may pose a question on the genetic purity and integrity of the strains being distributed to farmers and suggests a re-evaluation of the effectiveness of major tilapia breeding centers in maintaining their stocks.
Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.
2002-01-01
The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...
Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús
2010-09-01
The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.
Directory of Open Access Journals (Sweden)
Barbara V Lago
Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.
Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor
2009-01-01
Bovine viral diarrhoea virus 1 (BVDV-1) and Bovine viral diarrhoea virus 2 (BVDV-2) are two recognised bovine pestivirus species of the genus Pestivirus. Recently, a pestivirus, termed SVA/cont-08, was detected in a batch of contaminated foetal calf serum originating from South America. Comparative sequence analysis showed that the SVA/cont-08 virus shares 15-28% higher sequence identity to pestivirus D32/00_'HoBi' than to members of BVDV-1 and BVDV-2. In order to reveal the phylogenetic relationship of SVA/cont-08 with other pestiviruses, a molecular dataset of 30 pestiviruses and 1,896 characters, comprising the 5'UTR, N(pro) and E2 gene regions, was analysed by two methods: maximum likelihood and Bayesian approach. An identical, well-supported tree topology was observed, where four pestiviruses (SVA/cont-08, D32/00_'HoBi', CH-KaHo/cont, and Th/04_KhonKaen) formed a monophyletic clade that is closely related to the BVDV-1 and BVDV-2 clades. The strategy applied in this study is useful for classifying novel pestiviruses in the future.
DEFF Research Database (Denmark)
Rasmussen, Søren Kjærsgård; Johansson, A.
1992-01-01
The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription
Directory of Open Access Journals (Sweden)
Mahir Budak
2011-09-01
Full Text Available Cephinae is traditionally divided into three tribes and about 24 genera based on morphology and host utilization. There has been no study testing the monophyly of taxa under a strict phylogenetic criterion. A molecular phylogeny of Cephinae based on a total of 68 sequences of mtDNA COI gene, representing seven genera of Cephinae, is reconstructed to test the traditional limits and relationships of taxa. Monophyly of the traditional tribes is not supported. Monophyly of the genera are largely supported except for Pachycephus. A few host shift events are suggested based on phylogenetic relationships among taxa. These results indicate that a more robust phylogeny is required for a more plausible conclusion. We also report two species of Cephus for the first time from Turkey.
Directory of Open Access Journals (Sweden)
Rimantas Rakauskas
2013-07-01
Full Text Available Forty three European population samples of mealy aphids from various winter and summer host plants were attributed to respective species of Hyalopterus by means of their partial sequences of mitochondrial COI gene. Used Hyalopterus samples emerged as monophyletic relative to outgroup and formed three major clades representing three host specific mealy aphid species in the Neighbor joining, Maximum parsimony, Maximum likelihood and Bayesian inference trees. H. pruni and H. persikonus emerged as a sister species, whilst H. amygdali was located basally. Samples representing different clades in the molecular trees were used for canonical discrimination analysis based on twenty two morphological characters. Length of the median dorsal head hair enabled a 97.3 % separation of H. amygdali from the remaining two species. No single character enabled satisfactory discrimination between apterous viviparous females of H. pruni and H. persikonus. A modified key for the morphological identification of Hyalopterus species is suggested and their taxonomic status discussed.
DEFF Research Database (Denmark)
Norman, Anders; Hansen, Lars H.; She, Qunxin
2008-01-01
. The plasmid was also classified as IncX1 with incompatibility testing. The conjugal transfer and plasmid maintenance regions of pOLA52 therefore seem to represent IncX1 orthologues of the well-characterized IncX2 plasmid R6K. Sequence homology searches in GenBank also suggested a considerably higher...... of type 3 fimbriae (mrkABCDF). The plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid constituted a conserved IncX1-type backbone with predicted regions for conjugation, replication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system...... prevalence of IncX1 group plasmids than IncX2. The 21 kb 'genetic load' region of pOLA52 was shown to consist of a mosaic, among other things a fragmented Tn3 transposon encoding ampicillin resistance. Most notably the oqxAB and mrkABCDF cassettes were contained within two composite transposons (Tn6010...
Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo
2014-01-01
Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.
Directory of Open Access Journals (Sweden)
Zhaoshan Wang
Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.
Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika
2017-09-01
A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Samuel Mantip
2016-08-01
Full Text Available Peste-des-petits-ruminants virus (PPRV is a highly contagious, fatal and economically important viral disease of small ruminants that is still endemic and militates against the production of sheep and goats in endemic areas of the world. The aim of this study was to describe the viral strains within the country. This was carried out by collecting tissue and swab samples from sheep and goats in various agro-ecological zones of Nigeria. The phylogeny of archived PPRV strains or isolates and those circulating and causing recent outbreaks was determined by sequencing of the nucleoprotein (N-gene. Twenty tissue and swab samples from apparently healthy and sick sheep and goats were collected randomly from 18 states, namely 3 states in each of the 6 agro-ecological zones visited. A total of 360 samples were collected. A total of 35 samples of 360 (9.7% tested positive by reverse transcriptase–polymerase chain reaction, of which 25 were from oculo-nasal swabs and 10 were from tissue samples. Neighbour-joining phylogenetic analysis using Phylogenetic Analysis Using Parsimony (PAUP identified four different lineages, that is, lineages I, II, III and IV. Interestingly, the Nigerian strains described in this study grouped in two separate major lineages, that is, lineages II and IV. Strains from Sokoto, Oyo, Plateau and Ondo states grouped according to the historical distribution of PPRV together with the Nigerian 75/1 strain of lineage II, while other strains from Sokoto, Oyo, Plateau, Akwa-Ibom, Adamawa, Kaduna, Lagos, Bauchi, Niger and Kano states grouped together with the East African and Asian strains of lineage IV. This finding confirms that both lineage II and IV strains of PPRV are circulating in Nigeria. Previously, only strains of lineage II were found to be present in the country.
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
International Nuclear Information System (INIS)
Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha
2012-01-01
KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.
Dantur Juri, María J; Moreno, Marta; Prado Izaguirre, Mónica J; Navarro, Juan C; Zaidenberg, Mario O; Almirón, Walter R; Claps, Guillermo L; Conn, Jan E
2014-09-04
Anopheles pseudopunctipennis is an important malaria vector in the Neotropical region and the only species involved in Plasmodium transmission in the Andean foothills. Its wide geographical distribution in America, high preference for biting humans and capacity to rest inside dwellings after feeding, are attributes contributing to its vector status. Previous reports have tried to elucidate its taxonomic status, distinguishing populations from North, Central and South America. In the present study we used a mitochondrial marker to examine the demographic history of An. pseudopunctipennis in northwestern Argentina. Twelve localities were selected across 550 km of the distribution of this species in Argentina, including two near the Bolivian border and several in South Tucumán, for sampling. A fragment of the cytochrome oxidase I (COI) gene was sequenced and haplotype relationships were analyzed by a statistical parsimony network and a Neighbor-Joining (NJ) tree. Genetic differentiation was estimated with FST. Historical demographic processes were evaluated using diversity measures, neutrality tests and mismatch distribution. Forty-one haplotypes were identified, of which haplotype A was the most common and widely distributed. Neither the network nor the NJ tree showed any geographic differentiation between northern and southern populations. Haplotype diversities, Tajima's DT and Fu & Li's F and D neutrality tests and mismatch distribution supported a scenario of Holocene demographic expansion. The demographic pattern suggests that An. pseudopunctipennis has undergone a single colonization process, and the ancestral haplotype is shared by specimens from all localities, indicating mitochondrial gene flow. Genetic differentiation was minimal, observed only between one northern and one southern locality. The estimated time of the population expansion of this species was during the Holocene. These data suggest that regional vector control measures would be equally
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
DEFF Research Database (Denmark)
Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.
1998-01-01
on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...
Digital Repository Service at National Institute of Oceanography (India)
Kunal, S.P.; GirishKumar
within and between tuna Thunnus species and its application to species identification. J Fish Biol. 58, 1646–1657. 8 Terol, J., Mascarell, R., Fernandez-Pedrosa, V., Perez-Alonso, M. (2002) Statistical validation of the identification of tuna...
Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A
2016-08-01
The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.
Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D
2004-10-01
Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
ABSTRACT: Educational programmes all over the world are facing increasing ... providing biological insights, and proficiency to access and use the vast repository of computational and web- based resources which are the most available information in the world today. ... opening up new frontiers in the past two decades.
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... polymorphisms (SNPs): Emerging molecular marker tools for ... knowledge in plant biology, breeding and biotechnology. The emergence of many ...... phenotypes: past successes for Mendelian disease, future approaches for ...
Ros, V.I.D.; Breeuwer, J.A.J.
2007-01-01
The past 15 years have witnessed a number of molecular studies that aimed to resolve issues of species delineation and phylogeny of mites in the family Tetranychidae. The central part of the mitochondrial COI region has frequently been used for investigating intra- and interspecific variation. All
Québécois and Beninese researchers collaborate in the fight ...
International Development Research Centre (IDRC) Digital Library (Canada)
2010-10-12
Oct 12, 2010 ... Québécois and Beninese researchers collaborate in the fight against AIDS ... disabled" — vulnerable groups less able to make the right choices ... Less is more: Improving yields for Sahelian women with tiny dozes of fertilizer.
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C
2013-06-01
Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.
Yamamoto, K; Ichinose, Y; Shinagawa, H; Makino, K; Nakata, A; Iwanaga, M; Honda, T; Miwatani, T
1990-12-01
Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium. We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V. cholerae O1 El Tor strain, N86. Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961. Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli. N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V. cholerae were Asn-26 and Asn-158, respectively. The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V. cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products. Hemolytic activity of the 79-kDa HlyA protein from E. coli was less than 5% that for the 65-kDa cytolysin from V. cholerae. Our results suggest that in V. cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.
Directory of Open Access Journals (Sweden)
Albor Dobón
Full Text Available Resistance to biotrophic pathogens is largely dependent on the hormone salicylic acid (SA while jasmonic acid (JA regulates resistance against necrotrophs. JA negatively regulates SA and is, in itself, negatively regulated by SA. A key component of the JA signal transduction pathway is its receptor, the COI1 gene. Mutations in this gene can affect all the JA phenotypes, whereas mutations in other genes, either in JA signal transduction or in JA biosynthesis, lack this general effect. To identify components of the part of the resistance against biotrophs independent of SA, a mutagenised population of NahG plants (severely depleted of SA was screened for suppression of susceptibility. The screen resulted in the identification of intragenic and extragenic suppressors, and the results presented here correspond to the characterization of one extragenic suppressor, coi1-40. coi1-40 is quite different from previously described coi1 alleles, and it represents a strategy for enhancing resistance to biotrophs with low levels of SA, likely suppressing NahG by increasing the perception to the remaining SA. The phenotypes of coi1-40 lead us to speculate about a modular function for COI1, since we have recovered a mutation in COI1 which has a number of JA-related phenotypes reduced while others are equal to or above wild type levels.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Cyclic nucleotides and radioresistnace
International Nuclear Information System (INIS)
Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.
1982-01-01
The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru
Directory of Open Access Journals (Sweden)
Federica Bellagamba
2015-09-01
Full Text Available Pangasius hypophthalmus is one of the fish consumed in the Italian diet. It is farmed and imported from Mekong delta region of Vietnam. Among several types of Pangasius, Tra (Pangasius hypophthalmus is permitted for sales by the European Union. Since these fish species are often allegedly substituted with other morphologically similar fish due to commercial benefits, authentication of the products in the international markets become often necessary to prevent fraud and safety issues. In addition, this fish is imported as fillets without skin and bone, thus leaving the consumer’s at the risk of buying a substandard nutritional food. In this article we present the molecular approach we developed to identify Pangasius hypophthalmus from other closely related species based on cytochrome oxidase-I (COI mitochondrial barcoding gene and further described the variants in the studied population genetic of this species. Fifty-one samples of Pangasius hypophthalmus fillets labelled as Pangasio were obtained from various markets around Milan and their COI mitochondrial barcoding gene was sequenced and studied in our bioinformatics pipeline. All samples were successfully amplified and Basic Local Alignment Search Tool results of the amplified region confirmed that all sequences analysed belonged to Pangasius hypophthalmus. Based on the variations in their barcoding region single nucleotide polymorphisms were identified and delineative statistics was calculated on the sequences. Although Pangasius hypophthalmus is considered as a monophyly, seven polymorphisms were identified. The neighbour-joining tree and the Median-joining network of haplotypes showed for all the identified haplotypes a unique cluster, with the exception of one sample.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A
2016-01-01
Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Wu, Liang; Yang, Jinzeng
2012-01-01
Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species
Kim, Byeongseok; Yang, Mi Yeon; Kim, Myung Sook
2016-09-01
Although the marine red algal genus Neosiphonia is well characterized, many species of Neosiphonia are poorly understood. To correctly define the species delimitation of Neosiphonia yendoi using genetic variation, owing to the confusion over identification with " N. sphaerocarpa" from Korea, we investigated intensively the haplotype network of the mitochondrial COI and the plastid rbcL genes of specimens collected from Korea and Japan. The molecular analyses indicated that specimens collected in different sites of Korea and Japan belong to the same species, Neosiphonia yendoi and " Neosiphonia sphaerocarpa" from Korea, which is distinguished from N. sphaerocarpa from Florida and is allied with N. yendoi collected from the type locality, Muroran of Japan. A total of 29 COI and 13 rbcL haplotypes were found and the COI haplotype network shows evidence of a clear break between specimens from Jeju Island and all other locations of Korea, suggesting the possibility of cryptic diversity within N. yendoi.
Directory of Open Access Journals (Sweden)
Patrycja Zagata
2014-08-01
Full Text Available The aim of this study is an identification of Paramecium bursaria syngens originating from different geographical locations and proving the correlation between distributions and belonging to any of five syngens. Ten strains of Paramecium bursaria belonging to five different syngens and strain of Paramecium multimicronucleatum were investigated using molecular marker — mitochondrial cytochrome c oxidase subunit I (COI. According to results, obtained in this study, using phylogenetic methods like Neighbor Joining (NJ and Maximum Likelihood (ML, relationship between analyzing strains through their clustering in clusters and correlation between strains belonging to any syngen and syngen’s distribution was confirmed. Phylograms constructed using NJ and ML methods revealed strains’ grouping in five clusters. Results which were obtained revealed usefulness of COI as a biomarker, which is important in identification of Paramecium bursaria syngens. This reports to a great potential of COI as a molecular marker and obtaining dependable results through combination of molecular methods with classical ones.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
Thaler, David S; Stoeckle, Mark Y
2016-10-01
DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.
Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.
Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong
2015-07-01
Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.
Schiminovich, David
Columbia University is a Co-I institution in a collaborative research program with Caltech, the Lead Institution (PI: Christopher Martin). The Faint Intergalactic-medium Redshifted Emission Balloon (FIREBall-2) is designed to discover and map faint emission from the circumgalactic medium of low redshift galaxies (0.3zz 0.7, conduct a targeted search of circumquasar (CQM) media for selected targets, and conduct follow up on likely tar-gets selected via GALEX and a pilot survey conducted by our group. We will also conduct a statistical search for the faint IGM via statistical stacking of our data. The FIREBall-2 team includes two female graduate students in key roles (both of whom are finishing their PhDs in 2016) and is overseen by a female Postdoctoral scholar (supported by NSF AAPF and Caltech Millikan Fellowships, in addition to a recent Roman Technology Fellowship award). Additional funding is necessary to keep this highly qualified balloon team together for a second flight. FIREBall-2 will test key technologies and science strategies for a future space mission to map emission from CGM and IGM baryons. Its flights will continue to provide important training for the next generation of space astrophysicists working in UV and other wavelength instrumentation. Most importantly, FIREBall-2 will detect emission from the CGM of nearby galaxies, providing the first census of the density and kinematics of this material for low z galaxies and open-ing a new field of CGM science.
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Raibaud, O; Débarbouillé, M; Cossart, P
1982-01-01
A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Mitochondrial DNA sequence-based phylogenetic relationship ...
Indian Academy of Sciences (India)
cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...
Liu, Y; Chatterjee, A; Chatterjee, A K
1994-12-01
In most soft-rotting Erwinia spp., including E. carotovora subsp. carotovora strain 71 (Ecc71), production of the plant cell wall degrading enzyme pectin lyase (Pnl) is activated by DNA-damaging agents such as mitomycin C (MC). Induction of Pnl production in Ecc71 requires a functional recA gene and the rdg locus. DNA sequencing and RNA analyses revealed that the rdg locus contains two regulatory genes, rdgA and rdgB, in separate transcriptional units. There is high homology between RdgA and repressors of lambdoid phages, specially phi 80. RdgB, however, has significant homology with transcriptional activators of Mu phage. Both RdgA and RdgB are also predicted to possess helix-turn-helix motifs. By replacing the rdgB promoter with the IPTG-inducible tac promoter, we have determined that rdgB by itself can activate Pnl production in Escherichia coli. However, deletion analysis of rdg+ DNA indicated that, when driven by their native promoters, functions of both rdgA and rdgB are required for the induction of pnlA expression by MC treatment. While rdgB transcription occurs only after MC treatment, a substantial level of rdgA mRNA is detected in the absence of MC treatment. Moreover, upon induction with MC, a new rdgA mRNA species, initiated from a different start site, is produced at a high level. Thus, the two closely linked rdgA and rdgB genes, required for the regulation of Pnl production, are expressed differently in Ecc71.
Directory of Open Access Journals (Sweden)
Maya Kaul
2018-03-01
Full Text Available One of the greatest ways to transform education systems is to develop community-centered professional supports for in-service teachers. Given the rise of distance learning platforms such as massive open online courses (MOOCs, there is a growing potential to deliver such supports at scale. The community of inquiry (CoI framework models the asynchronous, text-based communication that defines educational experiences within such collaborative learning environments; however, methods of CoI transcript analysis must be improved. This paper uses the University of Helsinki’s 2016 MOOC, Sustainable Energy in Education, as a case study on how the CoI framework can be used to characterize the educational experience of in-service teachers in distance learning environments. Using the CoI coding protocol, this paper employs a transcript analysis of the discussion forum posts on the MOOC (n = 78, and applies improved measures of reliability in order to understand the capacity of CoI transcript analysis to reliably define online learning experiences. The findings suggest that, while the CoI framework is able to characterize some elements of online learning communities, more work needs to be done to ensure the framework captures the more nuanced elements of such educational experiences, such as the effects of course design and the relative engagement of course participants.
Boykin, L M; Shatters, R G; Hall, D G; Burns, R E; Franqui, R A
2006-10-01
Anastrepha suspensa (Loew) is an economically important pest, restricted to the Greater Antilles and southern Florida. It infests a wide variety of hosts and is of quarantine importance in citrus, a multi-million dollar industry in Florida. The observed recent increase in citrus infested with A. suspensa in Florida has raised questions regarding host-specificity of certain populations and genetic diversity of the pest throughout its geographical distribution. Cytochrome oxidase I (COI) DNA sequence data was used to characterize the genetic diversity of A. suspensa from Florida and Caribbean populations reared from different host plants. Maximum likelihood and Bayesian phylogenetic methods were used to analyse COI data. Sequence variation among mitochondrial COI genes from 107 A. suspensa samples collected throughout Florida and the Caribbean ranged between 0 and 10% and placed all A. suspensa as a monophyletic group that united all A. suspensa in a clade sister to a Central American group of the A. fraterculus paraphyletic species complex. The most likely tree of the COI locus indicated that COI sequence variation was too low to provide resolution at the subspecies level, therefore monophyletic groups based on host-plant use, geography (Florida, Jamaica, Cayman Islands, Puerto Rico or Dominican Republic) or population sampled are not supported. This result indicates that either no population segregation has occurred based on these biological or geographical distinctions and that this is a generalist, polyphagous invasive genotype. Alternatively, if populations are distinct, the segregation event was more recent than can be distinguished based on COI sequence variation.
Nucleotide excision repair in yeast
Eijk, Patrick van
2012-01-01
Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The
DEFF Research Database (Denmark)
Bohmann, Kristine; Monadjem, Ara; Noer, Christina Lehmkuhl
2011-01-01
Given the diversity of prey consumed by insectivorous bats, it is difficult to discern the composition of their diet using morphological or conventional PCR-based analyses of their faeces. We demonstrate the use of a powerful alternate tool, the use of the Roche FLX sequencing platform to deep......-sequence uniquely 5′ tagged insect-generic barcode cytochrome c oxidase I (COI) fragments, that were PCR amplified from faecal pellets of two free-tailed bat species Chaerephon pumilus and Mops condylurus (family: Molossidae). Although the analyses were challenged by the paucity of southern African insect COI...
Complete nucleotide sequence and gene rearrangement of the ...
Indian Academy of Sciences (India)
3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.
Complete nucleotide sequence and organization of the mitogenome ...
African Journals Online (AJOL)
STORAGESEVER
2010-02-01
Feb 1, 2010 ... In this study, the complete mitochondrial genome (mitogenome) of E. autonoe was .... skew” was calculated for the PCGs between two strands and the ..... codon stem and 7 bp in the anticodon loop, but also con- tained a ...
Complete nucleotide sequence and gene rearrangement of the ...
Indian Academy of Sciences (India)
mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...
Complete nucleotide sequence and organization of the mitogenome ...
African Journals Online (AJOL)
... genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, Geometroidea and Noctuoidea). Among the true butterflies (Pieridae, Nymphalidae, Lycaenidae and Papilionidae), ...
Identification of physicochemical selective pressure on protein encoding nucleotide sequences
Directory of Open Access Journals (Sweden)
Sainudiin Raazesh
2006-03-01
Full Text Available Abstract Background Statistical methods for identifying positively selected sites in protein coding regions are one of the most commonly used tools in evolutionary bioinformatics. However, they have been limited by not taking the physiochemical properties of amino acids into account. Results We develop a new codon-based likelihood model for detecting site-specific selection pressures acting on specific physicochemical properties. Nonsynonymous substitutions are divided into substitutions that differ with respect to the physicochemical properties of interest, and those that do not. The substitution rates of these two types of changes, relative to the synonymous substitution rate, are then described by two parameters, γ and ω respectively. The new model allows us to perform likelihood ratio tests for positive selection acting on specific physicochemical properties of interest. The new method is first used to analyze simulated data and is shown to have good power and accuracy in detecting physicochemical selective pressure. We then re-analyze data from the class-I alleles of the human Major Histocompatibility Complex (MHC and from the abalone sperm lysine. Conclusion Our new method allows a more flexible framework to identify selection pressure on particular physicochemical properties.
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa
2012-05-01
This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.
Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo
2004-02-04
The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
Directory of Open Access Journals (Sweden)
Adriana Cortez
2006-12-01
Full Text Available Nineteen isolates of bovine viral diarrhea virus (BVDV from Brazil were genetically characterized through partial nucleotide sequencing and analysis of the 5'UTR region. The isolates were grouped as BVDV-1 (11/19, BVDV-2 (6/19 or "atypical" pestivirus (2/19. Among the BVDV-1, eight isolates were classified as subgenotype BVDV-1a, whereas most (4 out of 6 BVDV-2 belonged to subgenotype 2b. Two isolates from aborted fetuses were not classified into any genetic group, being considered atypical BVDVs. Genetic diversity among Brazilian BVDV isolates may be responsible for vaccination and diag-nostic failure and therefore may influence the control strategies for BVDV infection in the country.Dezenove amostras do vírus da diarréia viral bovina (BVDV foram caracterizadas geneticamente através do seqüenciamento parcial de nucleotídeos da Região 5'UTR. As amostras foram agrupadas em BVDV-1 (11/19, BVDV-2 (6/19 e num terceiro grupo de amostras denominadas "atípicas" (2/19. Das onze amostras genotipadas como BVDV-1, oito amostras foram sub-genotipadas como BVDV-1a, enquanto que a maioria (4/6 das amostras de BVDV-2 foi agrupada como BVDV-2b. Duas amostras provenientes de fetos bovinos abortados foram classificadas como atípicas, não BVDV-1 e 2. A presença da diversidade genética de BVDV detectada nas amostras estudadas pode ser responsável por falhas vacinais e de diagnóstico e deve influenciar nas estratégias de controle do BVDV aplicadas nas diferentes regiões brasileiras.
Directory of Open Access Journals (Sweden)
Simon Reed
2012-09-01
Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
SN 2016coi/ASASSN-16fp: An example of residual helium in a type Ic supernova?
Prentice, S. J.; Ashall, C.; Mazzali, P. A.; Zhang, J.-J.; James, P. A.; Wang, X.-F.; Vinkó, J.; Percival, S.; Short, L.; Piascik, A.; Huang, F.; Mo, J.; Rui, L.-M.; Wang, J.-G.; Xiang, D.-F.; Xin, Y.-X.; Yi, W.-M.; Yu, X.-G.; Zhai, Q.; Zhang, T.-M.; Hosseinzadeh, G.; Howell, D. A.; McCully, C.; Valenti, S.; Cseh, B.; Hanyecz, O.; Kriskovics, L.; Pál, A.; Sárneczky, K.; Sódor, Á.; Szakáts, R.; Székely, P.; Varga-Verebélyi, E.; Vida, K.; Bradac, M.; Reichart, D. E.; Sand, D.; Tartaglia, L.
2018-05-01
The optical observations of Ic-4 supernova (SN) 2016coi/ASASSN-16fp, from ˜2 to ˜450 days after explosion, are presented along with analysis of its physical properties. The SN shows the broad lines associated with SNe Ic-3/4 but with a key difference. The early spectra display a strong absorption feature at ˜5400 Åwhich is not seen in other SNe Ic-3/4 at this epoch. This feature has been attributed to HeIin the literature. Spectral modelling of the SN in the early photospheric phase suggests the presence of residual He in a C/O dominated shell. However, the behaviour of the HeIlines is unusual when compared with He-rich SNe, showing relatively low velocities and weakening rather than strengthening over time. The SN is found to rise to peak ˜16 d after core-collapse reaching a bolometric luminosity of Lp ˜ 3 × 1042 erg s-1. Spectral models, including the nebular epoch, show that the SN ejected 2.5 - 4 M⊙of material, with ˜1.5 M⊙below 5000 km s-1, and with a kinetic energy of (4.5 - 7) × 1051 erg. The explosion synthesised ˜0.14 M⊙of 56Ni. There are significant uncertainties in E(B - V)host and the distance however, which will affect Lp and MNi. SN 2016coi exploded in a host similar to the Large Magellanic Cloud (LMC) and away from star-forming regions. The properties of the SN and the host-galaxy suggest that the progenitor had MZAMS of 23 - 28 M⊙and was stripped almost entirely down to its C/O core at explosion.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lack of nucleotide variability in a beetle pest with extreme inbreeding.
Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H
1998-05-01
The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
Preparation of protected nucleotides usable in oligonucleotide synthesis
International Nuclear Information System (INIS)
Debiard, Jean-Pascal
1983-01-01
After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.
2013-09-03
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
Raya-González, Javier; Pelagio-Flores, Ramón; López-Bucio, José
2012-09-15
Jasmonic acid (JA) regulates a broad range of plant defense and developmental responses. COI1 has been recently found to act as JA receptor. In this report, we show that low micromolar concentrations of JA inhibited primary root (PR) growth and promoted lateral root (LR) formation in Arabidopsis wild-type (WT) seedlings. It was observed that the coi1-1 mutant was less sensitive to JA on pericycle cell activation to induce lateral root primordia (LRP) formation and presented alterations in lateral root positioning and lateral root emergence on bends. To investigate JA-auxin interactions important for remodeling of root system (RS) architecture, we tested the expression of auxin-inducible markers DR5:uidA and BA3:uidA in WT and coi1-1 seedlings in response to indole-3-acetic acid (IAA) and JA and analyzed the RS architecture of a suite of auxin-related mutants under JA treatments. We found that JA did not affect DR5:uidA and BA3:uidA expression in WT and coi1-1 seedlings. Our data also showed that PR growth inhibition in response to JA was likely independent of auxin signaling and that the induction of LRP required ARF7, ARF19, SLR, TIR1, AFB2, AFB3 and AXR1 loci. We conclude that JA regulation of postembryonic root development involves both auxin-dependent and independent mechanisms. Copyright © 2012 Elsevier GmbH. All rights reserved.
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders.
Naseem, Sajida; Tahir, Hafiz Muhammad
2018-01-01
In recent years, DNA barcoding has become quite popular for molecular identification of species because it is simple, quick and an affordable method. Present study was conducted to identify spiders of most abundant families, i.e. Salticidae and Lycosidae from citrus orchards in Sargodha district using DNA barcoding. A total of 160 specimens were subjected to DNA barcoding but, sequences up to 600 bp were recovered for 156 specimens. This molecular approach proved helpful to assign the exact taxon to those specimens which were misidentified through morphological characters in the study. We were succeeded to discriminate six species of Lycosidae and nine species of Salticidae through DNA barcoding. Results revealed the presence of clear barcode gap (discontinuity in intra- and inter-specific divergences) for members of both families. Furthermore, the maximum intra-specific divergence was less than NN (nearest neighbour) distance for all species. This suggested the reliability of DNA barcoding for spider's identification up to species level. We got 98% success in our study. It is concluded from present study that DNA barcoding is more reliable tool especially for immature spiders, when morphological characters are ambiguous.
Participer à l’évolution du modèle québécois
Directory of Open Access Journals (Sweden)
Manuel Dussault
2002-10-01
Full Text Available Ce court texte vise à expliquer la position de l’Association des manufacturiers et exportateurs du Québec (AMEQ sur la question du modèle québécois. Pour l’association, il existe un modèle québécois, comme il existe un modèle français, américain, japonais ou autres. Ce modèle, ni tout a fait original, ni tout à fait pareil aux autres, est à la fois libéral et social démocratique. Il se caractérise par le nationalisme, l’équité et la concertation. L’histoire économique moderne est devenue, en partie celle du rôle de l’État par les leviers économiques qu’il a mis en place depuis la révolution tranquille. Le modèle québécois a permis le rattrapage sur l’Ontario mais, en même temps, n’a pas réussi à abaisser son taux de chômage au niveau de la moyenne canadienne. Et après mûres réflexion, l’AMEQ est d’avis que la solution ne se trouve pas dans l’adoption d’éléments issus du modèle américain. Mais, le renouveau du modèle passe par la contribution de la société civile et non seulement par des solutions étatiques, marchandes ou encore de la concertation institutionnaliséeThis short text aims at explaining the position of the Association of the manufacturers and exporters of Quebec (AMEQ on the question of the Quebecois model. For the association, there is a Quebecois model, as there is a French, American, Japanese model or other. This model, neither everything made original, nor the completely similar to the others, is liberal and social at the same moment democratic. It is characterized by the nationalism, the equity and the dialogue. The modern economic story, partially that of the role of the state by the economic control levers which it set up since the “Révolution tranquille”. The Quebecois model allowed the picking up on Ontario but, at the same time, did not manage to lower its unemployment rate at the level of the Canadian avarage. And after reflection, the AMEQ is of
Cyclic nucleotide specific phosphodiesterases of Leishmania major
Directory of Open Access Journals (Sweden)
Linder Markus
2006-03-01
Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range
Le nouveau modèle québécois axé sur la gouvernance
Directory of Open Access Journals (Sweden)
Jeffrey Roy
2002-10-01
Full Text Available L'article soutient qu'il a bien eu un modèle québécois de développement, mais il est devenu inefficace et remis en question. Ce modèle se distinguait par son interventionniste étatique dynamique et par la constitution d'alliances entre les différents partenaires sociaux. Mais les fondements d'un modèle performant tels que l'étatisme et le nationalisme civique sont devenus empreints de faiblesses et d'insuffisances que l'utilisation du concept de gouvernance permet d'identifier. Le concept se définit comme étant « la coordination efficace de l'ensemble des activités d'une entité socio-économico-politique quand les ressources, le pouvoir et l'information sont vastement distribués ». Malgré l'inefficacité décrite, il est possible de repenser le modèle québécois de développement par la construction des communautés qui s'appuie sur la régionalité et la socialité. Finalement, le renouveau s'appuierait sur une stratégie de-gouvernance pour un meilleur usage de l'intelligence collective et des cités-régions intelligentes.The article supports that it indeed had a Quebecois model of development, but it became ineffective and questioned. This model distinguished itself by his(her dynamic state interventionist and by the constitution of alliances among the various social partners. But the foundations of a successful model such as the state control and the civil nationalism became printed by weaknesses and by incapacities which the use of the concept of governance allows to identify. The concept defines itself as being « the effective coordination of all the activities of an entity « socio-économico-politique » when the resources, the power and the information are distributed spaciously » Meanwhile the described ineffectiveness, it is possible to rethink the Quebecois model of development by the construction of the communities which leans on the regionality and the sociality. Finally, the flourish would lean on a strategy
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Genome Sequence Databases (Overview): Sequencing and Assembly
Energy Technology Data Exchange (ETDEWEB)
Lapidus, Alla L.
2009-01-01
From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.
Insight into the Migration Routes of Plutella xylostella in China Using mtCOI and ISSR Markers.
Directory of Open Access Journals (Sweden)
Jiaqiang Yang
Full Text Available The larvae of the diamondback moth, Plutella xylostella, cause major economic losses to cruciferous crops, including cabbage, which is an important vegetable crop in China. In this study, we used the mitochondrial COI gene and 11 ISSR markers to characterize the genetic structure and seasonal migration routes of 23 P. xylostella populations in China. Both the mitochondrial and nuclear markers revealed high haplotype diversity and gene flow among the populations, although some degree of genetic isolation was evident between the populations of Hainan Island and other sampling sites. The dominant haplotypes, LX1 and LX2, differed significantly from all other haplotypes both in terms of the number of individuals with those haplotypes and their distributions. Haplotypes that were shared among populations revealed that P. xylostella migrates from the lower reaches of the Yangtze River to northern China and then to northeastern China. Our results also revealed another potential migration route for P. xylostella, i.e., from southwestern China to both northwestern and southern China.
Insight into the Migration Routes of Plutella xylostella in China Using mtCOI and ISSR Markers
Tian, Lixia; Xu, Baoyun; Xie, Wen; Wang, Shaoli; Zhang, Youjun; Wang, Xiangjing; Wu, Qingjun
2015-01-01
The larvae of the diamondback moth, Plutella xylostella, cause major economic losses to cruciferous crops, including cabbage, which is an important vegetable crop in China. In this study, we used the mitochondrial COI gene and 11 ISSR markers to characterize the genetic structure and seasonal migration routes of 23 P. xylostella populations in China. Both the mitochondrial and nuclear markers revealed high haplotype diversity and gene flow among the populations, although some degree of genetic isolation was evident between the populations of Hainan Island and other sampling sites. The dominant haplotypes, LX1 and LX2, differed significantly from all other haplotypes both in terms of the number of individuals with those haplotypes and their distributions. Haplotypes that were shared among populations revealed that P. xylostella migrates from the lower reaches of the Yangtze River to northern China and then to northeastern China. Our results also revealed another potential migration route for P. xylostella, i.e., from southwestern China to both northwestern and southern China. PMID:26098353
Directory of Open Access Journals (Sweden)
Youzhu Cheng
2014-06-01
Full Text Available Angiostrongylus cantonensis is a zoonotic public health concern that causes human severe eosinophilic meningitis in Southeast Asia and China. As a medically important intermediate host of A. cantonensis, Bellamya lithophaga (Gastropoda: Viviparidae is often confused with other morphologically similar sibling species of genus Bellamya, such as B. aeruginosa and B. purificata in the past. Hence, the aim of the present study was to investigate evidences to discriminate these equivocal Bellamya species.This study was carried out by getting Bellamya snail samples from Fujian Province in the South-East of China. The snail morphological features, breeding grounds and phylogenetic relationship according to mitochondrial cytochrome c oxidase subunit I (COI gene marker were analyzed.Based on external morphology, radular shape and cusp formula, as well as major breeding environment, B. lithophaga could be distinguished from B. aeruginosa, B. purificata. The phylogenetic tree also unconfirmed that B. lithophaga belongs to a different genetic clade from other morphologically similar species.Our findings demonstrate the significant differences in B. lithophaga and other sibling species, which supports the traditional species delimitation in the genus Bellamya.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
2017-03-03
Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.
Nucleotide excision repair in the test tube.
N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)
1995-01-01
textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
International Nuclear Information System (INIS)
Quintero Galvis, Julian Fernando; Castro, Lyda Raquel
2013-01-01
The family Neritidae has representatives in tropical and subtropical regions that occur in a variety of environments, and its known fossil record dates back to the late Cretaceous. However there have been few studies of molecular phylogeny in this family. We performed a phylogenetic reconstruction of the family Neritidae using the COI (722 bp) and the 16S rRNA (559 bp) regions of the mitochondrial genome. Neighbor-joining, maximum parsimony and Bayesian inference were performed. The best phylogenetic reconstruction was obtained using the COI region, and we consider it an appropriate marker for phylogenetic studies within the group. Consensus analysis (COI +16S rRNA) generally obtained the same tree topologies and confirmed that the genus Nerita is monophyletic. The consensus analysis using parsimony recovered a monophyletic group consisting of the genera Neritina, Septaria, Theodoxus, Puperita, and Clithon, while in the Bayesian analyses Theodoxus is separated from the other genera. The phylogenetic status of the species from the genus Nerita from the Colombian Caribbean generated in this study was consistent with that reported for the genus in previous studies. In the resulting consensus tree obtained using maximum parsimony, we included information on habitat type for each species, to map the evolution by habitat. Species of the family Neritidae possibly have their origin in marine environments, which is consistent with conclusions from previous reports based on anatomical studies.
Concordance négative optionnelle : contrastes forts et faibles entre picard et québécois
Directory of Open Access Journals (Sweden)
Dagnac Anne
2016-01-01
Full Text Available Cet article, basédeux études decorpus,comparele phénomène de la concordance négative(CNenpicard et enfrançais montréalais. Après avoir défini les phénomènes étudiés, il présenterapidement lefonctionnement de la négation et de la concordance négative en picard, et leurressemblances avec le système montréalais.La concordance entre marqueur négatifet mot-N y est à la fois possible et optionnelle: j’n’in sais (mie rien ‘je n’en sais rien’ (picard, j’ai (pasrien contre la loi cent un ‘je n’ai rien contre la loi cent un’ (québécois. Les contrastes en termes de contextes syntaxiques permettant ou non la CNoptionnelle, conduisent à poser ces deux dialectes commetypologiquement distinctssur des points considérés comme théoriquement cruciaux, comme la possibilité de la CNentre un marqueur denégation et un mot-N préverbalou dans des énoncés fragmentaires. Néanmoins, onmontre qu’une prise en compte plus fine des propriétéslexicalesdes items en jeuet de leurs fréquences d’emploi relativesmodifiece schéma typologique:elle montred’étonnantes convergences entre les deux systèmes, qui invitent à repenser la manière d’aborder la microvariation syntaxique. L’article défend enfin l’hypothèse que les différences entre les deux dialectes reposent sur l’existence d’un marqueur secondaire en picard, occupant une position syntaxique distinctedu marqueur pas ou point.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
BlockLogo: Visualization of peptide and sequence motif conservation
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian
2013-01-01
BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
International Nuclear Information System (INIS)
Hurley, L.H.; Needham-VanDevanter, D.R.
1986-01-01
DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Energy Technology Data Exchange (ETDEWEB)
Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2015-10-05
This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.
Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.
2012-01-01
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756
Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J
2012-02-03
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.
Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB
Directory of Open Access Journals (Sweden)
Joon-Ho Lee
2014-09-01
Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.
Directory of Open Access Journals (Sweden)
Julián Fernando Quintero Galvis
2013-05-01
La familia Neritidae cuenta con representantes en regiones tropicales y subtropicales adaptadas a diferentes ambientes, con un registro fósil que data para finales del Cretáceo. Sin embargo no se han realizado estudios de filogenia molecular en la familia. En este estudio se realizó una reconstrucción filogenética de la familia Neritidae utilizando las regiones COI (722 pb y 16S rRNA (559 pb del genoma mitocondrial. Se realizaron análisis de distancias de Neighbor-Joining, Máxima Parsimonia e Inferencia Bayesiana. La mejor reconstrucción filogenética fue mediante la región COI, considerándola un marcador apropiado para realizar estudios filogenéticos dentro del grupo. El consenso de las relaciones filogenéticas (COI+16S rRNA permitió confirmar que el género Nerita es monofilético. El consenso del análisis de parsimonia reveló un grupo monofilético formado por los géneros Neritina, Septaria, Theodoxus, Puperita y Clithon, mientras que en el análisis bayesiano Theodoxus se encuentra separado de los otros géneros. El resultado en las especies del género Nerita del Caribe colombiano fue consistente con lo reportado para el género en estudios previos. En el árbol resultante del análisis de parsimonia se sobrepuso la
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Genome-wide patterns of nucleotide polymorphism in domesticated rice
DEFF Research Database (Denmark)
Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D
2007-01-01
Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
The SWISS-PROT protein sequence data bank: current status.
Bairoch, A; Boeckmann, B
1994-01-01
SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...
Directory of Open Access Journals (Sweden)
Andrea Cristiani
2014-03-01
Full Text Available Se presenta la organización, funciones y evolución de la red de repositorios de acceso abierto OceanDocs, particularmente la experiencia de instituciones vinculadas a las Ciencias Marinas en América Latina y el Caribe. En el marco de las Redes de Datos e Información Oceanográfica de la Comisión Oceanográfica Intergubernamental (COI de UNESCO, surgieron iniciativas de repositorios locales y regionales, que más tarde se consolidan y dan lugar a la red internacional de repositorios en Ciencias Marinas: OceanDocs. En la actualidad esta red está integrada por repositorios institucionales, repositorios regionales y un repositorio central alojado por la COI. OceanDocs cuenta con políticas comunes definidas, un Grupo Directivo conformado por especialistas de distintas áreas que planifica y establece las directrices para la red, coordinadores nacionales y regionales, Unidades de Información a nivel institucional responsables de la carga de documentos, y una creciente comunidad de usuarios a nivel global.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases
Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de
1982-01-01
Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four
Simulating efficiently the evolution of DNA sequences.
Schöniger, M; von Haeseler, A
1995-02-01
Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.
Energy Technology Data Exchange (ETDEWEB)
Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2010-12-31
This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.
Bacterial nucleotide-based second messengers.
Pesavento, Christina; Hengge, Regine
2009-04-01
In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.
Nucleotide Manipulatives to Illustrate the Central Dogma
Sonja B. Yung; Todd P. Primm
2015-01-01
The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.
Nucleotide Manipulatives to Illustrate the Central Dogma
Directory of Open Access Journals (Sweden)
Sonja B. Yung
2015-08-01
Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.
Histone displacement during nucleotide excision repair
DEFF Research Database (Denmark)
Dinant, C.; Bartek, J.; Bekker-Jensen, S.
2012-01-01
Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....
Pyrrolidine nucleotide analogs with a tunable conformation
Czech Academy of Sciences Publication Activity Database
Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek
2014-01-01
Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
Energy Technology Data Exchange (ETDEWEB)
Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)
2014-01-28
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
International Nuclear Information System (INIS)
Shin, Joong-Won; Bernstein, Elliot R.
2014-01-01
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.
2013-01-01
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin
Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...
African Journals Online (AJOL)
PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene
Directory of Open Access Journals (Sweden)
Othman E. Othman
2014-12-01
It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Deslauriers, Jean-Simon
2016-01-01
Dans certains milieux syndicaux québécois, des initiatives porteuses destinées à prévenir les problèmes de santé mentale au travail ont vu le jour. Des représentants syndicaux pionniers ont mis en place des structures d’entraide opérantes, obtenu des jurisprudences importantes et développé des approches innovantes pour corriger ou bonifier l’organisation du travail, et ce depuis plus de trois décennies. Alors que la montée de l’idéologie néolibérale et les principes d’organisation du travail ...
Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.
2003-01-01
Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.
Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade
Directory of Open Access Journals (Sweden)
E. Gaitán-Solís
2008-11-01
Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.
DEFF Research Database (Denmark)
Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk
2013-01-01
to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.
2003-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...
International Nuclear Information System (INIS)
Sojfer, V.N.; Petrova, N.V.; Timofeeva, O.A.; Filipenko, M.L.; Solov'eva, N.A.; Popovskij, A.V.; Vlasko, V.V.
1998-01-01
To study DNA at the nucleotide level of resolution in residents of settlements located along the Techa river, studies are performed by direct sequencing of gene sequences preliminary amplified and selected by means of analysis of changes of the conformation of DNA unifilament fragments (SSCP-method). Results are presented in details [ru
Optimization of sequence alignment for simple sequence repeat regions
Directory of Open Access Journals (Sweden)
Ogbonnaya Francis C
2011-07-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic
DEFF Research Database (Denmark)
Friis-Nielsen, Jens; Kjartansdóttir, Kristín Rós; Mollerup, Sarah
2016-01-01
have developed a species independent pipeline that utilises sequence clustering for the identification of nucleotide sequences that co-occur across multiple sequencing data instances. We applied the workflow to 686 sequencing libraries from 252 cancer samples of different cancer and tissue types, 32...
Sharma, Sunil; Lyngdoh, Damanbha; Roy, Bishnupada; Tandon, Veena
2016-09-01
Order Cyclophyllidea (of cestode platyhelminths) has a rich diversity of parasites and includes many families and species that are known to cause serious medical condition in humans and domestic and wild animals. Despite various attempts to resolve phylogenetic relationships at the inter-family level, uncertainty remains. In order to add resolution to the existing phylogeny of the order, we generated partial mtCO1 sequences for some commonly occurring cyclophyllidean cestodes and combined them with available sequences from GenBank. Phylogeny was inferred taking a total 83 representative species spanning 8 families using Bayesian analysis. The phylogenetic tree revealed Dilepididae as the most basal taxon and showed early divergence in the phylogenetic tree. Paruterinidae, Taeniidae and Anoplocephalidae showed non-monophyletic assemblage; our result suggests that the family Paruterinidae may represent a polyphyletic group. The diverse family Taeniidae appeared in two separate clades; while one of them included all the members of the genus Echinococcus and also Versteria, the representatives of the genera Taenia and Hydatigera clubbed in the other clade. A close affinity of Dipylidiidae with Taenia and Hydatigera was seen, whereas existence of a close relationship between Mesocestoididae and Echinococcus (of Taeniidae) is also demonstrated. The crown group comprised the families Anoplocephalidae, Davaineidae, Hymenolepididae and Mesocestoididae, and also all species of the genus Echinococcus and Versteria mustelae; monophyly of these families (excepting Anolplocephalidae) and the genus Echinococcus as well as its sister-taxon relation with V. mustelae is also confirmed. Furthermore, non-monophyly of Anoplocephalidae is suggested to be correlated with divergence in the host selection.
A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Direct, rapid RNA sequence analysis
International Nuclear Information System (INIS)
Peattie, D.A.
1987-01-01
The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions
Directory of Open Access Journals (Sweden)
Yuan Jiang
Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
Navya
1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow ... used to characterize and identify the cultivars; however, it is often difficult and even .... complete deletion of the missing/gap sites from all the sequences (table 2).
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Regulation of nucleotide excision repair through ubiquitination
Institute of Scientific and Technical Information of China (English)
Jia Li; Audesh Bhat; Wei Xiao
2011-01-01
Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.
Directory of Open Access Journals (Sweden)
Waikhom Bimolata
Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
Giangaspero, Massimo; Harasawa, Ryô
2007-12-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.
Complete cDNA sequence coding for human docking protein
Energy Technology Data Exchange (ETDEWEB)
Hortsch, M; Labeit, S; Meyer, D I
1988-01-11
Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K
2014-04-01
Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.
Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.
Directory of Open Access Journals (Sweden)
B Josh Lane
2008-03-01
Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.
DEFF Research Database (Denmark)
Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria
2009-01-01
Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....
DEFF Research Database (Denmark)
Sato, Shusei; Andersen, Stig Uggerhøj
2014-01-01
The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Directory of Open Access Journals (Sweden)
Andrew T Kwon
2011-12-01
Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.
Spreadsheet macros for coloring sequence alignments.
Haygood, M G
1993-12-01
This article describes a set of Microsoft Excel macros designed to color amino acid and nucleotide sequence alignments for review and preparation of visual aids. The colored alignments can then be modified to emphasize features of interest. Procedures for importing and coloring sequences are described. The macro file adds a new menu to the menu bar containing sequence-related commands to enable users unfamiliar with Excel to use the macros more readily. The macros were designed for use with Macintosh computers but will also run with the DOS version of Excel.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Bertrand, Bénédicte; Alburaki, Mohamed; Legout, Hélène; Moulin, Sibyle; Mougel, Florence; Garnery, Lionel
2015-05-01
Honeybee subspecies have been affected by human activities in Europe over the past few decades. One such example is the importation of nonlocal subspecies of bees which has had an adverse impact on the geographical repartition and subsequently on the genetic diversity of the black honeybee Apis mellifera mellifera. To restore the original diversity of this local honeybee subspecies, different conservation centres were set up in Europe. In this study, we established a black honeybee conservation centre Conservatoire de l'Abeille Noire d'Ile de France (CANIF) in the region of Ile-de-France, France. CANIF's honeybee colonies were intensively studied over a 3-year period. This study included a drone congregation area (DCA) located in the conservation centre. MtDNA COI-COII marker was used to evaluate the genetic diversity of CANIF's honeybee populations and the drones found and collected from the DCA. The same marker (mtDNA) was used to estimate the interactions and the haplotype frequency between CANIF's honeybee populations and 10 surrounding honeybee apiaries located outside of the CANIF. Our results indicate that the colonies of the conservation centre and the drones of the DCA show similar stable profiles compared to the surrounding populations with lower level of introgression. The mtDNA marker used on both DCA and colonies of the conservation centre seems to be an efficient approach to monitor and maintain the genetic diversity of the protected honeybee populations. © 2014 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase
International Nuclear Information System (INIS)
Aalto, T.K.; Raivio, K.O.
1990-01-01
Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage
Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana
2016-05-01
accumulation of the nucleoside. The transcript levels of the five TvNTPDases gene sequences were analyzed by qRT-PCR and the highest gene expressions were found for TvNTPDase 2 and 4. The extracellular guanosine uptake was observed as (13C)GTP nucleotide into parasite DNA and it was lower than that observed for adenosine, labeled as (13C)ATP. These findings indicate the T. vaginalis preference for adenosine uptake and the accumulation of guanosine in the extracellular milieu, corroborating with HPLC data. Our data demonstrate, for the first time, the cascade of guanine nucleotides in T. vaginalis and open possibilities on the study of guanine-related purines other than the classical intracellular activity of G proteins for signal transduction. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Denisa-Adriana Oprea
2010-05-01
Full Text Available À travers l’analyse d’un corpus de romans québécois contemporains, nous tentons ici de baliser les éléments d’un parcours qui va de l’effritement à l’androgyne. Cette évolution est symptomatique tant de la remise en question du couple qu’engendre le féminisme radical que du passage du féminisme de la deuxième vague au féminisme de la troisième vague. Les romans que nous avons retenus sont Le sexe des étoiles (1987, de Monique Proulx, Copies conformes (1989, de Monique LaRue et la trilogie Soifs de Marie-Claire Blais.À travers l’analyse d’un corpus de romans québécois contemporains, nous tentons ici de baliser les éléments d’un parcours qui va de l’effritement à l’androgyne. Cette évolution est symptomatique tant de la remise en question du couple qu’engendre le féminisme radical que du passage du féminisme de la deuxième vague au féminisme de la troisième vague. Les romans que nous avons retenus sont Le sexe des étoiles1 (1987, de Monique Proulx, Copies conformes2 (1989, de Monique LaRue et la trilogie Soifs3 de Marie-Claire Blais.
Nucleotide excision repair in differentiated cells
Energy Technology Data Exchange (ETDEWEB)
Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl
2007-01-03
Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.
RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.
Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong
2017-07-01
Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.
Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo
2015-10-01
Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and