WorldWideScience

Sample records for cloning nucleotide sequencing

  1. Cloning and nucleotide sequence of wild type and a mutant histidine decarboxylase from Lactobacillus 30a.

    Science.gov (United States)

    Vanderslice, P; Copeland, W C; Robertus, J D

    1986-11-15

    Prohistidine decarboxylase from Lactobacillus 30a is a protein that autoactivates to histidine decarboxylase by cleaving its peptide chain between serines 81 and 82 and converting Ser-82 to a pyruvoyl moiety. The pyruvoyl group serves as the prosthetic group for the decarboxylation reaction. We have cloned and determined the nucleotide sequence of the gene for this enzyme from a wild type strain and from a mutant with altered autoactivation properties. The nucleotide sequence modifies the previously determined amino acid sequence of the protein. A tripeptide missed in the chemical sequence is inserted, and three other amino acids show conservative changes. The activation mutant shows a single change of Gly-58 to an Asp. Sequence analysis up- and downstream from the gene suggests that histidine decarboxylase is part of a polycistronic message, and that the transcriptional promotor region is strongly homologous to those of other Gram-positive organisms.

  2. Cloning and nucleotide sequence of the Enterobacter aerogenes signal peptidase II (lsp) gene.

    OpenAIRE

    Isaki, L; Kawakami, M; Beers, R; Hom, R; Wu, H.C.

    1990-01-01

    In Escherichia coli, prolipoprotein signal peptidase is encoded by the lsp gene, which is organized into an operon consisting of ileS, lsp, and three open reading frames, designated genes x, orf-149, and orf-316. The Enterobacter aerogenes lsp gene was cloned and expressed in E. coli. The nucleotide sequence of the Enterobacter aerogenes lsp gene and a part of its flanking sequences were determined. A high degree of homology was found between the E. coli ileS-lsp operon and the corresponding ...

  3. Human secreted carbonic anhydrase: cDNA cloning, nucleotide sequence, and hybridization histochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Aldred, P.; Fu, Ping; Barrett, G.; Penschow, J.D.; Wright, R.D.; Coghlan, J.P.; Fernley, R.T. (The Howard Florey Institute of Experimental Physiology and Medicine, Parkville, Victoria (Australia))

    1991-01-01

    Complementary DNA clones coding for the human secreted carbonic anhydrase isozyme (CAVI) have been isolated and their nucleotide sequences determined. These clones identify a 1.45-kb mRNA that is present in high levels in parotid submandibular salivary glands but absent in other tissues such as the sublingual gland, kidney, liver, and prostate gland. Hybridization histochemistry of human salivary glands shows mRNA for CA VI located in the acinar cells of these glands. The cDNA clones encode a protein of 308 amino acids that includes a 17 amino acid leader sequence typical of secreted proteins. The mature protein has 291 amino acids compared to 259 or 260 for the cytoplasmic isozymes, with most of the extra amino acids present as a carboxyl terminal extension. In comparison, sheep CA VI has a 45 amino acid extension. Overall the human CA VI protein has a sequence identity of 35 {percent} with human CA II, while residues involved in the active site of the enzymes have been conserved. The human and sheep secreted carbonic anhydrases have a sequence identity of 72 {percent}. This includes the two cysteine residues that are known to be involved in an intramolecular disulfide bond in the sheep CA VI. The enzyme is known to be glycosylated and three potential N-glycosylation sites (Asn-X-Thr/Ser) have been identified. Two of these are known to be glycosylated in sheep CA VI. Southern analysis of human DNA indicates that there is only one gene coding for CA VI.

  4. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    Science.gov (United States)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

    1983-03-01

    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  5. Cloning, sequencing and identification of single nucleotide polymorphisms of partial sequence on the porcine CACNA1S gene

    Institute of Scientific and Technical Information of China (English)

    FANG XiaoMin; XU NingYing; REN ShouWen

    2008-01-01

    CACNA1S gene encodes the α1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermla synarome (MHS) in human beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrein were used. Primers were designed according to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA.PCR products were sequenced and compared with that of human, and then single nucleotide polymorphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were acquired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% between human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. According to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST fragments.

  6. Nucleotide sequence and infectious cDNA clone of the L1 isolate of Pea seed-borne mosaic potyvirus.

    Science.gov (United States)

    Olsen, B S; Johansen, I E

    2001-01-01

    The complete nucleotide sequence of Pea seed-borne mosaic potyvirus isolate L1 has been determined from cloned virus cDNA. The PSbMV L1 genome is 9895 nucleotides in length excluding the poly(A) tail. Computer analysis of the sequence revealed a single long open reading frame (ORF) of 9594 nucleotides. The ORF potentially encodes a polyprotein of 3198 amino acids with a deduced Mr of 363537. Nine putative proteolytic cleavage sites were identified by analogy to consensus sequences and genome arrangement in other potyviruses. Two full-length cDNA clones, p35S-L1-4 and p35S-L1-5, were assembled under control of an enhanced 35S promoter and nopaline synthase terminator. Clone p35S-L1-4 was constructed with four introns and p35S-L1-5 with five introns inserted in the cDNA. Clone p35S-L1-4 was unstable in Escherichia coli often resulting in amplification of plasmids with deletions. Clone p35S-L1-5 was stable and apparently less toxic to Escherichia coli resulting in larger bacterial colonies and higher plasmid yield. Both clones were infectious upon mechanical inoculation of plasmid DNA on susceptible pea cultivars Fjord, Scout, and Brutus. Eight pea genotypes resistant to L1 virus were also resistant to the cDNA derived L1 virus. Both native PSbMV L1 and the cDNA derived virus infected Chenopodium quinoa systemically giving rise to characteristic necrotic lesions on uninoculated leaves.

  7. Nucleotide sequence of cloned cDNA for human pancreatic kallikrein.

    Science.gov (United States)

    Fukushima, D; Kitamura, N; Nakanishi, S

    1985-12-31

    Cloned cDNA sequences for human pancreatic kallikrein have been isolated and determined by molecular cloning and sequence analysis. The identity between human pancreatic and urinary kallikreins is indicated by the complete coincidence between the amino acid sequence deduced from the cloned cDNA sequence and that reported partially for urinary kallikrein. The active enzyme form of the human pancreatic kallikrein consists of 238 amino acids and is preceded by a signal peptide and a profragment of 24 amino acids. A sequence comparison of this with other mammalian kallikreins indicates that key amino acid residues required for both serine protease activity and kallikrein-like cleavage specificity are retained in the human sequence, and residues corresponding to some external loops of the kallikrein diverge from other kallikreins. Analyses by RNA blot hybridization, primer extension, and S1 nuclease mapping indicate that the pancreatic kallikrein mRNA is also expressed in the kidney and sublingual gland, suggesting the active synthesis of urinary kallikrein in these tissues. Furthermore, the tissue-specific regulation of the expression of the members of the human kallikrein gene family has been discussed.

  8. Cloning, sequencing and identification of single nu-cleotide polymorphisms of partial sequence on the porcine CACNA1S gene

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    CACNA1S gene encodes the α1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermia synarome (MHS) in hu-man beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrain were used. Primers were designed ac-cording to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA. PCR products were sequenced and compared with that of human, and then single nucleotide poly-morphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were ac-quired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% be-tween human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. Ac-cording to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST frag-ments.

  9. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.

    Science.gov (United States)

    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S

    1987-01-01

    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases. Images PMID:2435707

  10. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    Energy Technology Data Exchange (ETDEWEB)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in lambda gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated lambda hARG6 and lambda hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying lambda hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes.

  11. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-10-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in lambda phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (approx. 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia.

  12. Molecular cloning and nucleotide sequence of chicken avidin-related genes 1-5.

    Science.gov (United States)

    Keinänen, R A; Wallén, M J; Kristo, P A; Laukkanen, M O; Toimela, T A; Helenius, M A; Kulomaa, M S

    1994-03-01

    Using avidin cDNA as a hybridisation probe, we detected a gene family whose putative products are related to the chicken egg-white avidin. Two overlapping genomic clones were found to contain five genes (avidin-related genes 1-5, avr1-avr5), which have been cloned, characterized and sequenced. All of the genes have a four-exon structure with an overall identity with the avidin cDNA of 88-92%. The genes appear to have no pseudogenic features and, in fact, two of these genes have been shown to be transcribed. The putative proteins share a sequence identity of 68-78% with avidin. The amino acid residues responsible for the biotin-binding activity of avidin and the bacterial biotin-binding protein, streptavidin, are highly conserved. Since avidin is induced in both a progesterone-specific manner and in connection with inflammation, these genes offer a valuable tool to study complex gene regulation in vivo.

  13. Partial Cloning and Nucleotide Sequencing of Glutamate Decarboxylase Gene Isoform 65 from Human Brain

    Directory of Open Access Journals (Sweden)

    Abolghasem Esmaeili

    2015-04-01

    Conclusion: Because obtaining fresh human brain is difficult and amount of mRNA is low, it may not be easy to clone full length of human gad gene. The approach described in this paper may be useful in cloning of other genes for which the corresponding mRNA is present at low levels.

  14. Gene cloning and nucleotide sequencing and properties of a cocaine esterase from Rhodococcus sp. strain MB1.

    Science.gov (United States)

    Bresler, M M; Rosser, S J; Basran, A; Bruce, N C

    2000-03-01

    A strain of Rhodococcus designated MB1, which was capable of utilizing cocaine as a sole source of carbon and nitrogen for growth, was isolated from rhizosphere soil of the tropane alkaloid-producing plant Erythroxylum coca. A cocaine esterase was found to initiate degradation of cocaine, which was hydrolyzed to ecgonine methyl ester and benzoate; both of these esterolytic products were further metabolized by Rhodococcus sp. strain MB1. The structural gene encoding a cocaine esterase, designated cocE, was cloned from Rhodococcus sp. strain MB1 genomic libraries by screening recombinant strains of Rhodococcus erythropolis CW25 for growth on cocaine. The nucleotide sequence of cocE corresponded to an open reading frame of 1,724 bp that codes for a protein of 574 amino acids. The amino acid sequence of cocaine esterase has a region of similarity with the active serine consensus of X-prolyl dipeptidyl aminopeptidases, suggesting that the cocaine esterase is a serine esterase. The cocE coding sequence was subcloned into the pCFX1 expression plasmid and expressed in Escherichia coli. The recombinant cocaine esterase was purified to apparent homogeneity and was found to be monomeric, with an M(r) of approximately 65,000. The apparent K(m) of the enzyme (mean +/- standard deviation) for cocaine was measured as 1.33 +/- 0.085 mM. These findings are of potential use in the development of a linked assay for the detection of illicit cocaine.

  15. Isolation, expression, and nucleotide sequencing of the pilin structural gene of the Brazilian purpuric fever clone of Haemophilus influenzae biogroup aegyptius.

    Science.gov (United States)

    St Geme, J W; Falkow, S

    1993-05-01

    In this study we isolated the pilin gene from the Brazilian purpuric fever (BPF) clone of Haemophilus influenzae biogroup aegyptius, expressed the gene in Escherichia coli, and determined its nucleotide sequence. Comparison of the nucleotide sequence of the BPF pilin gene with the sequences of pilin genes from strains of H. influenzae sensu stricto demonstrated a high degree of identity. Consistent with this observation, hemagglutination inhibition studies performed with a series of glycoconjugates indicated that BPF pili and H. influenzae type b pili possess the same erythrocyte receptor specificity.

  16. Avocado cellulase: nucleotide sequence of a putative full-length cDNA clone and evidence for a small gene family.

    Science.gov (United States)

    Tucker, M L; Durbin, M L; Clegg, M T; Lewis, L N

    1987-05-01

    A cDNA library was prepared from ripe avocado fruit (Persea americana Mill. cv. Hass) and screened for clones hybridizing to a 600 bp cDNA clone (pAV5) coding for avocado fruit cellulase. This screening led to the isolation of a clone (pAV363) containing a 2021 nucleotide transcribed sequence and an approximately 150 nucleotide poly(A) tail. Hybridization of pAV363 to a northern blot shows that the length of the homologous message is approximately 2.2 kb. The nucleotide sequence of this putative full-length mRNA clone contains an open reading frame of 1482 nucleotides which codes for a polypeptide of 54.1 kD. The deduced amino acid composition compares favorably with the amino acid composition of native avocado cellulase determined by amino acid analysis. Southern blot analysis of Hind III and Eco RI endonuclease digested genomic DNA indicates a small family of cellulase genes.

  17. Cloning, nucleotide sequence, and overexpression of the gene coding for delta 5-3-ketosteroid isomerase from Pseudomonas putida biotype B.

    Science.gov (United States)

    Kim, S W; Kim, C Y; Benisek, W F; Choi, K Y

    1994-11-01

    The structural gene coding for the delta 5-3-ketosteroid isomerase (KSI) of Pseudomonas putida biotype B has been cloned, and its entire nucleotide sequence has been determined by a dideoxynucleotide chain termination method. A 2.1-kb DNA fragment containing the ksi gene was cloned from a P. putida biotype B genomic library in lambda gt11. The open reading frame of ksi encodes 393 nucleotides, and the amino acid sequence deduced from the nucleotide sequence agrees with the directly determined amino acid sequence (K. Linden and W. F. Benisek, J. Biol. Chem. 261:6454-6460, 1986). A putative purine-rich ribosome binding site was found 8 bp upstream of the ATG start codon. Escherichia coli BL21(DE3) transformed with the pKK-KSI plasmid containing the ksi gene expressed a high level of isomerase activity when induced by isopropyl-beta-D-thiogalactopyranoside. KSI was purified to homogeneity by a simple and rapid procedure utilizing fractional precipitation and an affinity column of deoxycholate-ethylenediamine-agarose as a major chromatographic step. The molecular weight of KSI was 14,535 (calculated, 14,536) as determined by electrospray mass spectrometry. The purified KSI showed a specific activity (39,807 mumol min-1 mg-1) and a Km (60 microM) which are close to those of KSI originally obtained from P. putida biotype B.

  18. Human nucleotide sequences related to the transforming gene of a murine sarcoma virus: studies with cloned viral and cellular DNAs.

    Science.gov (United States)

    Chumakov, I M; Zabarovsky, E R; Prassolov, V S; Mett, V L; Kisselev, L L

    1982-01-01

    A recombinant plasmid, pI26, has been constructed by cloning into pBR322 a transforming gene of murine sarcoma virus (a Moloney strain, clone 124, MSV) synthesized by detergent-treated virions. From this plasmid a XbaI-HindIII fragment has been isolated which contains only mos-specific sequences. This mos-specific probe has been used for screening a human gene library cloned in bacteriophage lambda Charon 4A. Of these, 19 clones have been isolated containing mos-related sequences. By physical mapping and molecular hybridization it has been shown that these sequences are neighboured by DNA regions related to Moloney murine leukemia virus. Recombinant phages have also been found containing human inserts related to MLV, not to the mos gene. The possible existence of murine-like endogenous retroviruses in the normal human genome, including that of a sarcoma type, is discussed. By Northern blotting, expression of the cellular c-mos gene has been detected in mouse liver treated with a hepatocarcinogen. The general significance of the suggested model for evaluating the relationship between chemical carcinogenesis and oncogene expression is discussed.

  19. Nucleotide sequencing, cloning, and expression of Capra hircus Heme Oxygenase-1 in caprine islets to promote insulin secretion in vitro.

    Science.gov (United States)

    Vakhshiteh, Faezeh; Allaudin, Zeenathul Nazariah; Lila, Mohd Azmi B Mohd; Abbasiliasi, Sahar; Ajdari, Zahra

    2015-01-01

    Transplantation of islets of Langerhans that have been isolated from whole pancreas is an attractive alternative for the reversal of Type 1 diabetes. However, in vitro culture of isolated pancreatic islets has been reported to cause a decrease in glucose response over time. Hence, the improvement in islet culture conditions is an important goal in islet transplantation. Heme Oxygenase-1 (HO-1) is a stress protein that has been described as an inducible protein with the capacity of preventing apoptosis and cytoprotection via radical scavenging. Therefore, this study was aimed to assess the influence of endogenous HO-1 gene transfer on insulin secretion of caprine islets. The full-length cDNA sequence of Capra hircus HO-1 was determined using specific designed primers and rapid amplification of cDNA ends of pancreatic tissue. The HO-1 cDNA was then cloned into the prokaryotic expression vectors and transfected into caprine islets using lipid carriers. Efficiency of lipid carriers to transfect caprine islets was determined by flow cytometry. Insulin secretion assay was carried out by ovine insulin ELISA. The finding demonstrated that endogenous HO-1 gene transfer could improve caprine islet function in in vitro culture. Consequently, strategies using HO-1 gene transfer to islets might lead to better outcome in islet transplantation.

  20. Uroporphyrinogen-III synthase: Molecular cloning, nucleotide sequence, expression of a mouse full-length cDNA, and its localization on mouse chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Xu, W.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States); Kozak, C.A. [National Institute of Health, Bethesda, MD (United States)

    1995-04-10

    Uroporphyrinogen-III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for the conversion of hydroxymethylbilane to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-S is the enzymatic defect in congenital erythropoietic porphyria (CEP), an autosomal recessive disorder. For the generation of a mouse model of CEP, the human URO-S cDNA was used to screen 2 X 10{sup 6} recombinants from a mouse adult liver cDNA library. Ten positive clones were isolated, and dideoxy sequencing of the entire 1.6-kb insert of clone pmUROS-1 revealed 5{prime} and 3{prime} untranslated sequences of 144 and 623 bp, respectively, and an open reading frame of 798 bp encoding a 265-amino-acid polypeptide with a predicted molecular mass of 28,501 Da. The mouse and human coding sequences had 80.5 and 77.8% nucleotide and amino acid identity, respectively. The authenticity of the mouse cDNA was established by expression of the active monomeric enzyme in Escherichia coli. In addition, the analysis of two multilocus genetic crosses localized the mouse gene on chromosome 7, consistent with the mapping of the human gene to a position of conserved synteny on chromosome 10. The isolation, expression, and chromosomal mapping of this full-length cDNA should facilitate studies of the structure and organization of the mouse genomic sequence and the development of a mouse model of CEP for characterization of the disease pathogenesis and evaluation of gene therapy. 38 refs., 1 tab.

  1. Nucleotide sequence of a cDNA clone encoding a major allergenic protein in rice seeds. Homology of the deduced amino acid sequence with members of alpha-amylase/trypsin inhibitor family.

    Science.gov (United States)

    Izumi, H; Adachi, T; Fujii, N; Matsuda, T; Nakamura, R; Tanaka, K; Urisu, A; Kurosawa, Y

    1992-05-18

    A cDNA clone of rice major allergenic protein (RAP) was isolated from a cDNA library of maturing rice seeds. The cDNA had an open reading frame (486 nucleotides) which coded a 162 amino acid residue polypeptide comprising a 27-residue signal peptide and a 135-residue mature protein of M(r) 14,764. The deduced amino acid sequence of RAP showed a considerable similarity to barley trypsin inhibitor [1983, J. Biol. Chem. 258, 7998-8003] and wheat alpha-amylase inhibitor [1981, Phytochemistry 20, 1781-1784].

  2. Molecular cloning and nucleotide sequence of a full-length cDNA for human alpha enolase.

    Science.gov (United States)

    Giallongo, A; Feo, S; Moore, R; Croce, C M; Showe, L C

    1986-01-01

    We previously purified a 48-kDa protein (p48) that specifically reacts with an antiserum directed against the 12 carboxyl-terminal amino acids of the c-myc gene product. Using an antiserum directed against the purified p48, we have cloned a cDNA from a human expression library. This cDNA hybrid-selects an mRNA that translates to a 48-kDa protein that specifically reacts with anti-p48 serum. We have isolated a full-length cDNA that encodes p48 and spans 1755 bases. The coding region is 1299 bases long; 94 bases are 5' noncoding and 359 bases are 3' noncoding. The cDNA encodes a 433 amino acid protein that is 67% homologous to yeast enolase and 94% homologous to the rat non-neuronal enolase. The purified protein has been shown to have enolase activity and has been identified to be of the alpha type by isoenzyme analysis. The transcriptional regulation of enolase expression in response to mitogenic stimulation of peripheral blood lymphocytes and in response to heat shock is also discussed. Images PMID:3529090

  3. Cloning and nucleotide sequence of D-hydantoinase gene of marine polyphosphate-accumulating bacterium, Halomonas sp.YSR-3

    Institute of Scientific and Technical Information of China (English)

    REN Shiying; LI Xiangqian; JIA Jianbo; LIU Fei; XIAO Tian

    2011-01-01

    Hydantoinase is involved in the production of optically pure amino acids from racemic 5-mono-substituted hydantoions.We measured the D-hydantoinase activity in marine Halomonas sp.YSR-3 and amplified the D-hydantoinase gene by PCR.The gene was inserted into vector pGM-T and transformed into E.coli TOP 10.The positive transformants with the D-hydantoinase gene were sequenced.The sequenced fragment comprises 1510 base pairs.The D-hydantoinase gene from YSR-3 is 77% similar to that from Pseudomonas entomophila L4 by searching against the NCBI databse.The protein product of the YSR-3 D-hydantoinase gene is 75%,73%,and 70% similar to those from Pseudomonas fluorescens Pf-5,Marinomonas sp.MED121,and Burkholderia vietnamiensis G4,respectively.The difference of the D-hydantoinase gene between marine Halomonas sp.YSR-3 and other terrestrial organisms is distinct.

  4. Cloning, expression, and nucleotide sequence of genes involved in production of pediocin PA-1, and bacteriocin from Pediococcus acidilactici PAC1.0.

    Science.gov (United States)

    Marugg, J D; Gonzalez, C F; Kunka, B S; Ledeboer, A M; Pucci, M J; Toonen, M Y; Walker, S A; Zoetmulder, L C; Vandenbergh, P A

    1992-01-01

    The production of pediocin PA-1, a small heat-stable bacteriocin, is associated with the presence of the 9.4-kbp plasmid pSRQ11 in Pediococcus acidilactici PAC1.0. It was shown by subcloning of pSRQ11 in Escherichia coli cloning vectors that pediocin PA-1 is produced and, most probably, secreted by E. coli cells. Deletion analysis showed that a 5.6-kbp SalI-EcoRI fragment derived from pSRQ11 is required for pediocin PA-1 production. Nucleotide sequence analysis of this 5.6-kbp fragment indicated the presence of four clustered open reading frames (pedA, pedB, pedC, and pedD). The pedA gene encodes a 62-amino-acid precursor of pediocin PA-1, as the predicted amino acid residues 19 to 62 correspond entirely to the amino acid sequence of the purified pediocin PA-1. Introduction of a mutation in pedA resulted in a complete loss of pediocin production. The pedB and pedC genes, encoding proteins of 112 and 174 amino acid residues, respectively, are located directly downstream of the pediocin structural gene. Functions could not be assigned to their gene products; mutation analysis showed that the PedB protein is not involved in pediocin PA-1 production. The mutation analysis further revealed that the fourth gene, pedD, specifying a relatively large protein of 724 amino acids, is required for pediocin PA-1 production in E. coli. The predicted pedD protein shows strong similarities to several ATP-dependent transport proteins, including the E. coli hemolysin secretion protein HlyB and the ComA protein, which is required for competence induction for genetic transformation in Streptococcus pneumoniae.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1514784

  5. Tripeptidase Gene (pepT) of Lactococcus lactis : Molecular Cloning and Nucleotide Sequencing of pepT and Construction of a Chromosomal Deletion Mutant

    NARCIS (Netherlands)

    Mierau, Igor; Haandrikman, Alfred J.; Velterop, Odilia; Tan, Paris S.T.; Leenhouts, Kees L.; Konings, Wilhelmus; Venema, Gerhardus; Kok, Jan

    1994-01-01

    The gene encoding a tripeptidase (pepT) of lactococcus lactis subsp. cremoris (formerly subsp. lactis) MG1363 was cloned from a genomic library in pUC19 and subsequently sequenced. The tripeptidase of L. lactis was shown to be homologous to PepT of Salmonella typhimurium with 47.4% identity in the d

  6. Cloning, nucleotide sequence, and regulation of the Bacillus subtilis nadB gene and a nifS-like gene, both of which are essential for NAD biosynthesis.

    OpenAIRE

    Sun, D.; Setlow, P

    1993-01-01

    A number of Bacillus subtilis genes involved in NAD biosynthesis have been cloned and sequenced. One of the genes encodes a polypeptide homologous to Escherichia coli L-aspartate oxidase, and its mutation resulted in a nicotinic acid (Nic)-dependent phenotype; this gene was termed nadB. A second open reading frame (orf2) was found downstream of nadB, and an insertional plasmid separating orf2 and nadB also gave a Nic-dependent phenotype. This result suggests that orf2 may also be involved in ...

  7. Cloning of nod gene regions from mesquite rhizobia and bradyrhizobia and nucleotide sequence of the nodD gene from mesquite rhizobia.

    Science.gov (United States)

    Thomas, P M; Golly, K F; Virginia, R A; Zyskind, J W

    1995-09-01

    Nitrogen-fixing symbiosis between bacteria and the tree legume mesquite (Prosopis glandulosa) is important for the maintenance of many desert ecosystems. Genes essential for nodulation and for extending the host range to mesquite were isolated from cosmid libraries of Rhizobium (mesquite) sp. strain HW17b and Bradyrhizobium (mesquite) sp. strain HW10h and were shown to be closely linked. All of the cosmid clones of rhizobia that extended the host range of Rhizobium (Parasponia) sp. strain NGR234CS to mesquite also supported nodulation of a Sym- mesquite strain. The cosmid clones of bradyrhizobia that extended the host range of Rhizobium (Parasponia) sp. strain NGR234CS to mesquite were only able to confer nodulation ability in the Sym- mesquite strain if they also contained a nodD-hybridizing region. Subclones containing just the nodD genes of either genus did not extend the host range of Rhizobium (Parasponia) sp. to mesquite, indicating that the nodD gene is insufficient for mesquite nodulation. The nodD gene region is conserved among mesquite-nodulating rhizobia regardless of the soil depth from which they were collected, indicating descent from a common ancestor. In a tree of distance relationships, the NodD amino acid sequence from mesquite rhizobia clusters with homologs from symbionts that can infect both herbaceous and tree legumes, including Rhizobium tropici, Rhizobium leguminosarum bv; phaseoli, Rhizobium loti, and Bradyrhizobium japonicum.

  8. Cloning and nucleotide sequence of Mycobacterium tuberculosis gyrA and gyrB genes and detection of quinolone resistance mutations.

    Science.gov (United States)

    Takiff, H E; Salazar, L; Guerrero, C; Philipp, W; Huang, W M; Kreiswirth, B; Cole, S T; Jacobs, W R; Telenti, A

    1994-04-01

    The emergence of multidrug-resistant strains of Mycobacterium tuberculosis has resulted in increased interest in the fluoroquinolones (FQs) as antituberculosis agents. To investigate the frequency and mechanisms of FQ resistance in M. tuberculosis, we cloned and sequenced the wild-type gyrA and gyrB genes, which encode the A and B subunits of the DNA gyrase, respectively; DNA gyrase is the main target of the FQs. On the basis of the sequence information, we performed DNA amplification for sequencing and single-strand conformation polymorphism analysis to examine the presumed quinolone resistance regions of gyrA and gyrB from reference strains (n = 4) and clinical isolates (n = 55). Mutations in codons of gyrA analogous to those described in other FQ-resistant bacteria were identified in all isolates (n = 14) for which the ciprofloxacin MIC was > 2 micrograms/ml. In addition, we selected ciprofloxacin-resistant mutants of Mycobacterium bovis BCG and M. tuberculosis Erdman and H37ra. Spontaneously resistant mutants developed at a frequency of 1 in 10(7) to 10(8) at ciprofloxacin concentrations of 2 micrograms/ml, but no primary resistant colonies were selected at higher ciprofloxacin concentrations. Replating of those first-step mutants selected for mutants with high levels of resistance which harbored gyrA mutations similar to those found among clinical FQ-resistant isolates. The gyrA and gyrB sequence information will facilitate analysis of the mechanisms of resistance to drugs which target the gyrase and the implementation of rapid strategies for the estimation of FQ susceptibility in clinical M. tuberculosis isolates.

  9. Cloning, nucleotide sequence, and regulation of the Bacillus subtilis nadB gene and a nifS-like gene, both of which are essential for NAD biosynthesis.

    Science.gov (United States)

    Sun, D; Setlow, P

    1993-03-01

    A number of Bacillus subtilis genes involved in NAD biosynthesis have been cloned and sequenced. One of the genes encodes a polypeptide homologous to Escherichia coli L-aspartate oxidase, and its mutation resulted in a nicotinic acid (Nic)-dependent phenotype; this gene was termed nadB. A second open reading frame (orf2) was found downstream of nadB, and an insertional plasmid separating orf2 and nadB also gave a Nic-dependent phenotype. This result suggests that orf2 may also be involved in NAD biosynthesis and that nadB and orf2 are in the same operon. Upstream of nadB was a third gene, transcribed in the opposite direction to that of nadB-orf2. The amino acid sequence derived from the third gene was quite similar to those derived from nifS genes of various nitrogen-fixing bacteria; therefore, the third gene was termed nifS. As with nadB and orf2, mutations in nifS also resulted in a Nic-dependent phenotype. The promoter regions of nadB and nifS overlapped each other and both contained -10 and -35 sequences which resemble those of E sigma A-type promoters. Transcription from both the nifS and nadB promoters, as well as expression of a nadB-lacZ fusion, was repressed by Nic. However, nadB transcription and nadB-lacZ expression were decreased, at most, only slightly by a deletion in nifS. The possible role of the nifS gene product in NAD biosynthesis is discussed.

  10. Complete nucleotide sequences and construction of full-length infectious cDNA clones of cucumber green mottle mosaic virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters.

    Science.gov (United States)

    Park, Chan-Hwan; Ju, Hye-Kyoung; Han, Jae-Yeong; Park, Jong-Seo; Kim, Ik-Hyun; Seo, Eun-Young; Kim, Jung-Kyu; Hammond, John; Lim, Hyoun-Sub

    2017-04-01

    Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon and melon fields and generated full-length infectious cDNA clones. The full-length cDNAs were cloned into newly constructed binary vector pJY, which includes both the 35S and T7 promoters for versatile usage (agroinfiltration and in vitro RNA transcription) and a modified hepatitis delta virus ribozyme sequence to precisely cleave RNA transcripts at the 3' end of the tobamovirus genome. Three CGMMV isolates (OMpj, Wpj, and Mpj) were separately evaluated for infectivity in Nicotiana benthamiana, demonstrated by either Agroinfiltration or inoculation with in vitro RNA transcripts. CGMMV nucleotide identities to other tobamoviruses were calculated from pairwise alignments using DNAMAN. CGMMV identities were 49.89% to tobacco mosaic virus; 49.85% to pepper mild mottle virus; 50.47% to tomato mosaic virus; 60.9% to zucchini green mottle mosaic virus; and 60.96% to kyuri green mottle mosaic virus, confirming that CGMMV is a distinct species most similar to other cucurbit-infecting tobamoviruses. We further performed phylogenetic analysis to determine relationships of our new Korean CGMMV isolates to previously characterized isolates from Canada, China, India, Israel, Japan, Korea, Russia, Spain, and Taiwan available from NCBI. Analysis of CGMMV amino acid sequences showed three major clades, broadly typified as 'Russian,' 'Israeli,' and 'Asian' groups. All of our new Korean isolates fell within the 'Asian' clade. Neither the 128 nor 186 kDa RdRps of the three new isolates showed any detectable gene silencing suppressor function.

  11. The complete nucleotide sequence of pelargonium leaf curl virus.

    Science.gov (United States)

    McGavin, Wendy J; MacFarlane, Stuart A

    2016-05-01

    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants.

  12. 梅花鹿卵泡刺激素α-亚基cDNA的分子克隆与序列分析%Nucleotide sequence of cloned cDNA for α-subunit of sika follicle stimulating hormone

    Institute of Scientific and Technical Information of China (English)

    关洪斌; 李庆章; 张莉

    2002-01-01

    从新屠宰的母梅花鹿脑垂体中提取总RNA,反转录获得cDNA,以此cDNA为模板用PCR法扩增目的片段,获得长为380 bp的梅花鹿卵泡刺激素α--亚基cDNA片段,将它克隆至pMD-18-T-Verctor.随机挑选3个阳性重组子进行测序,并将测序结果与绵羊、牛、猪等多种哺乳动物该基因的核苷酸序列及相应氨基酸序列进行比较.结果表明,梅花鹿卵泡刺激素α--亚基基因编码的氨基酸序列与绵羊、水牛的该基因同源性最高,达97%,只有4个氨基酸不同;与牛的该基因同源性达96%.与人的该基因氨基酸序列同源性较低,为75%.其编码的核苷酸序列与绵羊、水牛、牛的同源性最高,达96%,只有14~16个碱基不同;与人的该基因核苷酸同源性最低,为84%.总的来说,哺乳动物的卵泡刺激素α-亚基具有很高的同源性.%Total RNA was prepared from pituitary gland of new butchered sika.cDNA was synthesized by RT-PCRreaction and this cDNA was used as model in PCR amplification for α-subunit of sika follicle stimulating hormone.The PCR product was 380bp in 1.2% agarose gel electro-phoresis which just was the target fragment of predictedFSHα-subunit. It was cloned it to pMD-18-T vector. 3 positive recombinant was selected at random to analyze itssequence by DNA analysis apparatus. Its amino acid sequence was compared with some other mammalian. The resultshows that it has the highest homology with sheep and buffalo,which it reaches 97%. There are only 4 amino acidsdifference among sika ,sheep and buffalo. It has lower homology in amino acid with human, its homology is 75%. Ithas the highest homology among sika ,sheep, buffalo and bovine in nucleotide sequence, which it reaches 96%.There are 14-16 nucleotides difference among them. It has lower homology in nucleotide sequence with human, it isonly 84%. It was found that the nucleotide sequence of the o-subunit in these mammalian species are highly con-servative. According to our

  13. Nucleotide sequence of the structural gene for tryptophanase of Escherichia coli K-12.

    OpenAIRE

    Deeley, M C; Yanofsky, C

    1981-01-01

    The tryptophanase structural gene, tnaA, of Escherichia coli K-12 was cloned and sequenced. The size, amino acid composition, and sequence of the protein predicted from the nucleotide sequence agree with protein structure data previously acquired by others for the tryptophanase of E. coli B. Physiological data indicated that the region controlling expression of tnaA was present in the cloned segment. Sequence data suggested that a second structural gene of unknown function was located distal ...

  14. The International Nucleotide Sequence Database Collaboration

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Sequence Database Collaboration, International Nucleotide

    2016-01-01

    The International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org) comprises three global partners committed to capturing, preserving and providing comprehensive public-domain nucleotide sequence information. The INSDC establishes standards, formats and protocols for data and metadata to make it easier for individuals and organisations to submit their nucleotide data reliably to public archives. This work enables the continuous, global exchange of information about living things. Here we present an update of the INSDC in 2015, including data growth and diversification, new standards and requirements by publishers for authors to submit their data to the public archives. The INSDC serves as a model for data sharing in the life sciences. PMID:26657633

  15. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Science.gov (United States)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  16. Complete nucleotide sequence of primitive vertebrate immunoglobulin light chain genes.

    Science.gov (United States)

    Shamblott, M J; Litman, G W

    1989-06-01

    Antibody to Heterodontus francisci (horned shark) immunoglobulin light chain was used to screen a spleen cDNA expression library, and recombinant clones encoding light chain genes were isolated. The complete sequences of the mature coding regions of two light chain genes in this phylogenetically distant vertebrate have been determined and are reported here. Comparisons of the sequences are consistent with the presence of mammalian-like framework and complementarity-determining regions. The predicted amino acid sequences of the genes are more related to mammalian lambda than to kappa light chains. The nucleotide sequences of the genes are most related to mammalian T-cell antigen receptor beta chain. Heterodontus light chain genes may reflect characteristics of the common ancestor of immunoglobulin and T-cell antigen receptors before its evolutionary diversification.

  17. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    Science.gov (United States)

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  18. Estimation of evolutionary distances between nucleotide sequences.

    Science.gov (United States)

    Zharkikh, A

    1994-09-01

    A formal mathematical analysis of the substitution process in nucleotide sequence evolution was done in terms of the Markov process. By using matrix algebra theory, the theoretical foundation of Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) and Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984) methods was provided. Extensive computer simulation was used to compare the accuracy and effectiveness of various methods for estimating the evolutionary distance between two nucleotide sequences. It was shown that the multiparameter methods of Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984), Gojobori et al.'s (J. Mol. Evol. 18:414-422, 1982), and Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) are preferable to others for the purpose of phylogenetic analysis when the sequences are long. However, when sequences are short and the evolutionary distance is large, Tajima and Nei's (Mol. Biol. Evol. 1:269-285, 1984) method is superior to others.

  19. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...

  20. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    OpenAIRE

    Kitamoto, N; Yamagata, H; Kato, T.; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosu...

  1. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

  2. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  3. Cloning and sequencing genes related to preeclampsia

    Institute of Scientific and Technical Information of China (English)

    SHI Juan-zi; LIU Yan-fang; YAO Yuan-qing; YAN Wei; ZHU Feng; ZHAO Zhong-liang

    2001-01-01

    To clone genes specifically expressed in the placenta of patients with preeclampsia, and to explain the mechanism in the etiopathology ofpreeclampsia. Methods: The placentae ofpreeclamptic and normotensive subjects with pregnancy were used as models, and the cDNA Library was constructed and 20 differentially expressed fragments were cloned after a new version of PCR-based subtractive hybridization. The false positive clones were identified by reverse dot blot analysis. With one of the obtained gene taken as the probe, the placentas of 10 normal pregnant women and 10 preeclamptic patients were studied by using dot hybridization methods. Results: Six false positive clones were identified by reverse dot blot, and the rest 14 clones were identified as preeclampsia-related genes. These clones were sequenced, and analyzed with BLAST analysis system. Eleven of 14 clones were genes already known, among which one belongs to necdin family; the rest 3 were identified as novel genes. These 3 genes were acknowledged by GenBank, with the accession numbers AF232216, AF232217, AF233648. The results of dot hybridization using necdin gene as probe were as follows: (1) There was this mRNA in the placental tissues of normal pregnancy as well as in that ofpreeclampsia.(2) The intensity of transcription of this mRNA in the placental tissues of preeclampsia increased significantly compared with that of the normal pregnancy (P<0.05). Conclusions: This study for the first time reported this group of genes, especially necdin-expressing gene, which are related to the etiopathology of preeclampsia. In addition, the overtranscription ofnecdin gene has been found in preeclampsia. It is helpful in further studies of the etiology ofpreeclampsia.

  4. Nucleotide sequence of papaya mosaic virus RNA.

    Science.gov (United States)

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  5. Cloning and characterization of a repetitive DNA sequence specific for Trichomonas vaginalis.

    Science.gov (United States)

    Paces, J; Urbánková, V; Urbánek, P

    1992-09-01

    A family of 650-bp-long repeats from the Trichomonas vaginalis genome, designated the Tv-E650 family, was cloned and sequenced. The nucleotide sequence is A+T-rich (73.3% A+T in the consensus sequence) and highly conserved among the 8 molecular clones analyzed. The differences among the clones are single-nucleotide and 2-nucleotide substitutions and insertions or deletions. The sequence uniformity of the clones as well as the presence of identical mutations in different clones suggest that efficient sequence homogenization mechanisms, such as gene conversion or recurring unequal crossing-over, operate in T. vaginalis. The copy number of the Tv-E650 repeats was estimated to be about 10(2)-10(3) per genome. Based on the DNA hybridization results, the Tv-E650 repeat family is conserved in all T. vaginalis strains examined, regardless of their diverse geographical origin. No hybridization of the Tv-E650 probe was found with the DNA from Trichomonas tenax, Trichomonas gallinae and Pentatrichomonas hominis, indicating that the Tv-E650 repeated sequences are species-specific. A dot blot hybridization protocol was developed which does not require isolation of DNA. By using this protocol it was possible to detect the DNA released from approximately 10(3) T. vaginalis cells per dot. These observations suggest that the Tv-E650 probe is potentially applicable to the identification and detection of T. vaginalis.

  6. Cloning of an Erwinia herbicola gene necessary for gluconic acid production and enhanced mineral phosphate solubilization in Escherichia coli HB101: nucleotide sequence and probable involvement in biosynthesis of the coenzyme pyrroloquinoline quinone.

    Science.gov (United States)

    Liu, S T; Lee, L Y; Tai, C Y; Hung, C H; Chang, Y S; Wolfram, J H; Rogers, R; Goldstein, A H

    1992-09-01

    Escherichia coli is capable of synthesizing the apo-glucose dehydrogenase enzyme (GDH) but not the cofactor pyrroloquinoline quinone (PQQ), which is essential for formation of the holoenzyme. Therefore, in the absence of exogenous PQQ, E. coli does not produce gluconic acid. Evidence is presented to show that the expression of an Erwinia herbicola gene in E. coli HB101(pMCG898) resulted in the production of gluconic acid, which, in turn, implied PQQ biosynthesis. Transposon mutagenesis showed that the essential gene or locus was within a 1.8-kb region of a 4.5-kb insert of the plasmid pMCG898. This 1.8-kb region contained only one apparent open reading frame. In this paper, we present the nucleotide sequence of this open reading frame, a 1,134-bp DNA fragment coding for a protein with an M(r) of 42,160. The deduced sequence of this protein had a high degree of homology with that of gene III (M(r), 43,600) of a PQQ synthase gene complex from Acinetobacter calcoaceticus previously identified by Goosen et al. (J. Bacteriol. 171:447-455, 1989). In minicell analysis, pMCG898 encoded a protein with an M(r) of 41,000. These data indicate that E. coli HB101(pMCG898) produced the GDH-PQQ holoenzyme, which, in turn, catalyzed the oxidation of glucose to gluconic acid in the periplasmic space. As a result of the gluconic acid production, E. coli HB101(pMCG898) showed an enhanced mineral phosphate-solubilizing phenotype due to acid dissolution of the hydroxyapatite substrate.

  7. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.

    Science.gov (United States)

    Venkatesan, S; Gershowitz, A; Moss, B

    1982-11-01

    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  8. Reading biological processes from nucleotide sequences

    Science.gov (United States)

    Murugan, Anand

    Cellular processes have traditionally been investigated by techniques of imaging and biochemical analysis of the molecules involved. The recent rapid progress in our ability to manipulate and read nucleic acid sequences gives us direct access to the genetic information that directs and constrains biological processes. While sequence data is being used widely to investigate genotype-phenotype relationships and population structure, here we use sequencing to understand biophysical mechanisms. We present work on two different systems. First, in chapter 2, we characterize the stochastic genetic editing mechanism that produces diverse T-cell receptors in the human immune system. We do this by inferring statistical distributions of the underlying biochemical events that generate T-cell receptor coding sequences from the statistics of the observed sequences. This inferred model quantitatively describes the potential repertoire of T-cell receptors that can be produced by an individual, providing insight into its potential diversity and the probability of generation of any specific T-cell receptor. Then in chapter 3, we present work on understanding the functioning of regulatory DNA sequences in both prokaryotes and eukaryotes. Here we use experiments that measure the transcriptional activity of large libraries of mutagenized promoters and enhancers and infer models of the sequence-function relationship from this data. For the bacterial promoter, we infer a physically motivated 'thermodynamic' model of the interaction of DNA-binding proteins and RNA polymerase determining the transcription rate of the downstream gene. For the eukaryotic enhancers, we infer heuristic models of the sequence-function relationship and use these models to find synthetic enhancer sequences that optimize inducibility of expression. Both projects demonstrate the utility of sequence information in conjunction with sophisticated statistical inference techniques for dissecting underlying biophysical

  9. Complete nucleotide sequence analysis of a Dengue-1 virus isolated on Easter Island, Chile.

    Science.gov (United States)

    Cáceres, C; Yung, V; Araya, P; Tognarelli, J; Villagra, E; Vera, L; Fernández, J

    2008-01-01

    Dengue-1 viruses responsible for the dengue fever outbreak in Easter Island in 2002 were isolated from acute-phase sera of dengue fever patients. In order to analyze the complete genome sequence, we designed primers to amplify contiguous segments across the entire sequence of the viral genome. RT-PCR products obtained were cloned, and complete nucleotide and deduced amino acid sequences were determined. This report constitutes the first complete genetic characterization of a DENV-1 isolate from Chile. Phylogenetic analysis shows that an Easter Island isolate is most closely related to Pacific DENV-1 genotype IV viruses.

  10. Infectivity and complete nucleotide sequence of cucumber fruit mottle mosaic virus isolate Cm cDNA.

    Science.gov (United States)

    Rhee, Sun-Ju; Hong, Jin-Sung; Lee, Gung Pyo

    2014-07-01

    Three isolates of cucumber fruit mottle mosaic virus (CFMMV) were collected from melon, cucumber, and pumpkin plants in Korea. A full-length cDNA clone of CFMMV-Cm (melon isolate) was produced and evaluated for infectivity after T7 transcription in vitro (pT7CF-Cmflc). The complete CFMMV genome sequence of the infectious clone pT7CF-Cmflc was determined. The genome of CFMMV-Cm consisted of 6,571 nucleotides and shared high nucleotide sequence identity (98.8 %) with the Israel isolate of CFMMV. Based on the infectious clone pT7CF-Cmflc, a CaMV 35S-promoter driven cDNA clone (p35SCF-Cmflc) was subsequently constructed and sequenced. Mechanical inoculation with RNA transcripts of pT7CF-Cmflc and agro-inoculation with p35SCF-Cmflc resulted in systemic infection of cucumber and melon, producing symptoms similar to those produced by CFMMV-Cm. Progeny virus in infected plants was detected by RT-PCR, western blot assay, and transmission electron microscopy.

  11. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax.

    Science.gov (United States)

    Fukura, K; Yamamoto, A; Hashimoto, T; Goto, N

    1996-01-01

    The small subunit ribosomal RNA (SrRNA) gene of Trichomonas tenax ATCC30207 was amplified by PCR and the 1.55-kb product was cloned into plasmid vector pUC18. Four clones were isolated and sequenced. The insert DNAs were 1,552 bp long and their G+C contents were 48.1%; three of them had exactly the same DNA sequences and one had only one nucleotide change. A representative SrRNA sequence was analyzed and a phylogenetic tree was estimated by the neighbor-joining (NJ) method. Among the protists examined, T. tenax was placed as the closest relative of Tritrichomonas foetus, as expected from the traditional taxonomy. The total homology between the two SrRNA sequences was 89.2%.

  12. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  13. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Science.gov (United States)

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  14. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...... splicing events and coding potential of isoforms from full isoform deconvolution software, such as Cufflinks (article II), is presented. Finally, a study using 5’-end RNA-seq for alternative promoter detection between healthy patients and patients with acute promyelocytic leukemia is presented (article III...

  15. Cloning and sequencing of the ferredoxin gene of blue-green alga Anabaena siamensis

    Science.gov (United States)

    Li, Shou-Dong; Song, Li-Rong; Liu, Yong-Ding; Zhao, Jin-Dong

    1998-03-01

    The structure gene for ferredoxin, petFI, from Anabaena siamensis has been amplified by polymerase chain reaction(PCR) and cloned into cloning vector pGEM-3zf(+). The nucleotide sequence of petFI has been determined with silver staining sequencing method. There is 96.8% homology between coding region of petFI from A. siamensis and that of petFI from A. sp. 7120. Amino acid sequences of seven strains of blue-green algae are compared.

  16. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  17. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  18. Cloning and Sequence Analysis of Capsid Protein Gene of Iridovirus Indonesian Isolates

    Directory of Open Access Journals (Sweden)

    Murwantoko .

    2015-11-01

    Full Text Available generated by an Adobe application 11.5606 Iridovirus was known as agents that caused serious systemic disease in freshwater and marine fishes. The mortality up to 100% of orange-spotted grouper (Epinephelus coioides due to iridovirus infection has been reported in Indonesia. The gene encoding capsid protein of iridovirus is supposed to be conserved and has the potency for the development of control methods. The objectives of this study are to clone the gene encoding capsid protein iridovirus and to analyze their sequences. The   spleen tissues of orange-spotted grouper were collected and extracted their DNA. The DNA fragment of capsid protein of iridovirus genes were amplified by PCR using designed primers with the extraction DNA as templates. The amplified DNA fragments were cloned in pBSKSII and sequenced.  The genes encoding capsid protein of iridovirus from Jepara and Bali were successfully amplified and cloned. The Jepara clone (IJP03 contained complete open reading frame (ORF of the gene composed by 1362 bp nucleotides which encoded 453 amino acids. Those Jepara and Bali (IGD01 clones shared 99.8% similarity in nucleotide level and 99.4% at amino acid level. Based on those sequences, Indonesian iridovirus was belonged to genus Megalocystivirus and shared 99,6-99,9% similarity on nucleotide level with DGIV, ISKNV, MCIV, and ALIV Normal 0 36 false false false

  19. Single-nucleotide polymorphism genotyping identifies a locally endemic clone of methicillin-resistant Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Ulrich Nübel

    Full Text Available We developed, tested, and applied a TaqMan real-time PCR assay for interrogation of three single-nucleotide polymorphisms that differentiate a clade (termed 't003-X' within the radiation of methicillin-resistant Staphylococcus aureus (MRSA ST225. The TaqMan assay achieved 98% typeability and results were fully concordant with DNA sequencing. By applying this assay to 305 ST225 isolates from an international collection, we demonstrate that clade t003-X is endemic in a single acute-care hospital in Germany at least since 2006, where it has caused a substantial proportion of infections. The strain was also detected in another hospital located 16 kilometers away. Strikingly, however, clade t003-X was not found in 62 other hospitals throughout Germany nor among isolates from other countries, and, hence, displayed a very restricted geographical distribution. Consequently, our results show that SNP-typing may be useful to identify and track MRSA clones that are specific to individual healthcare institutions. In contrast, the spatial dissemination pattern observed here had not been resolved by other typing procedures, including multilocus sequence typing (MLST, spa typing, DNA macrorestriction, and multilocus variable-number tandem repeat analysis (MLVA.

  20. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.

    Science.gov (United States)

    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V

    2015-11-01

    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny.

  1. The nucleotide sequence and genome structure of mung bean yellow mosaic geminivirus.

    Science.gov (United States)

    Morinaga, T; Ikegami, M; Miura, K

    1993-01-01

    Complete nucleotide sequences of the infectious cloned DNA components (DNA 1 and DNA 2) of mung bean yellow mosaic virus (MYMV) were determined. MYMV DNA 1 and DNA 2 consists of 2,723 and 2,675 nucleotides respectively. DNA 1 and DNA 2 have little sequence similarity except for a region of approximately 200 bases which is almost identical in the two molecules. Analysis of open reading frames revealed nine potential coding regions for proteins of mol. wt. > 10,000, six in DNA 1 and three in DNA 2. The nucleotide sequence of MYMV DNA was compared with that of bean golden mosaic virus (BGMV), tomato golden mosaic virus (TGMV) and African cassava mosaic virus (ACMV). The 200-base region common to the two DNAs of each virus had little sequence similarity, except for a highly conserved 33-36 base sequence potentially capable of forming a stable hairpin structure. The potential coding regions in the MYMV DNAs had counterparts in the BGMV, TGMV and ACMV, suggesting an overall similarity in genome organization, except for absence of 1L3 in MYMV DNA 1. The most highly conserved ORFs, MYMV 1R1, BGMV 1R1, TGMV 1R1 and ACMV 1R1, are the putative genes for the coat proteins of MYMV, BGMV, TGMV and ACMV, respectively. MYMV 1L1 has also a high degree of sequence similarity with BGMV 1L1, TGMV 1L1 and ACMV 1L1.

  2. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    Science.gov (United States)

    1988-02-02

    Montie, S. Kadis, and S. I. Ajl (ed.), Microbial toxins, vol. 3. Academic Press, Inc., New York. 23. Little, S. F., and G. B. Knudaon. 1986...Takkinen, and L. Kaariainen. 1981. Nucleotide sequence of the promoter and NHa-terminal signal peptide region of the a- amylase gene from Bacillus

  3. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ..._db.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kome/LATEST/kome_ine_full_se...quence_db.zip File size: 19 MB File name: FASTA: kome_ine_full_sequence_db.fasta.zip File URL: ftp://ftp.biosciencedbc.jp/archiv...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  4. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Directory of Open Access Journals (Sweden)

    Göpfert Jens C

    2011-03-01

    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  5. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Science.gov (United States)

    2011-01-01

    Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new virus type in

  6. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  7. Nucleotide sequencing and identification of some wild mushrooms.

    Science.gov (United States)

    Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

    2013-01-01

    The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  8. Complete nucleotide sequence of a novel porcine circovirus-like agent and its infectivity in vitro

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    A novel agent (hence termed as P2) was isolated from pig sera in China, which contained covalently bound circular genomic DNAs of 993 nucleotides. Sequence analyses indicated that the agent was closely related to the porcine circovirus (PCV). The molecular clone of P2 was constructed subsequently and used for the following studies. Intracytoplasmic inclusions and intranuclear inclusions were only found in PK-15 cells transfected with the tandem dimer of P2 molecular DNA clone. Intracytoplasmic inclusions were round or irregular in shape and 0.1-0.4 μm in diameter, and intranuclear inclusions were electronically denser than intracytoplasmic inclusions and had two general shapes: round/small (0.1 μm in diameter) and hexagonal/large (0.5―1.4 μm in diameter). The inclusions were not membranously bound. The cells transfected with the tandem dimer of P2 molecular DNA clone were tested positive for P2 DNA at passages 5. The P2 antigen could be detected in both transfected and passaged PK-15 cells. This is the first report regarding the complete nucleotide sequence of a small DNA genome in a circovirus-like infectious agent in vitro.

  9. Complete nucleotide sequence of a novel porcine circovirus-like agent and its infectivity in vitro

    Institute of Scientific and Technical Information of China (English)

    WEN LiBin; HE KongWang; YANG HanChun; NI YanXiu; ZHANG XueHan; GUO RongLi; PAN QunXin

    2008-01-01

    A novel agent (hence termed as P2) was isolated from pig sera in China, which contained covalently bound circular genomic DNAs of 993 nucleotides. Sequence analyses indicated that the agent was closely related to the porcine circovirus (PCV). The molecular clone of P2 was constructed subsequently and used for the following studies. Intracytoplasmic inclusions and intranuclear inclusions were only found in PK-15 cells transfected with the tandem dimer of P2 molecular DNA clone. Intracytoplasmic inclusions were round or irregular in shape and 0.1-0.4μm in diameter, and intranuclear inclusions were electronically denser than intracytoplasmic inclusions and had two general shapes:round/small (0.1 μm in diameter) and hexagonal/large (0.5-1.4 μm in diameter). The inclusions were not membranously bound. The cells transfected with the tandem dimer of P2 molecular DNA clone were tested positive for P2 DNA at passages 5. The P2 antigen could be detected in both transfected and passaged PK-15 cells. This is the first report regarding the complete nucleotide sequence of a small DNA genome in a circovirus-like infectious agent in vitro.

  10. Influence of simulated microgravity on the activation of the small GTPase Rho involved in cytoskeletal formation – molecular cloning and sequencing of bovine leukemia-associated guanine nucleotide exchange factor

    Directory of Open Access Journals (Sweden)

    Seki Masaya

    2006-06-01

    Full Text Available Abstract Background The irregular formation of cytoskeletal fibers in spaceflown experimental cells has been observed, but the disorganization process of fibers is still poorly understood. It is well known that the activation of the small GTPase Rho leads to actin stress fibers assembly. This study was performed to evaluate the effect of simulated microgravity on the activation of Rho that is involved in actin fiber remodeling in cells. Results Clinorotation influences actin fiber remodeling and its related signaling pathways that involve the small GTPase Rho. Actin stress fiber remodeling was significantly inhibited to a greater extent in cells cultured under clinorotation than in static cultured cells. From the gene and protein expression analyses, we found that the expression level of leukemia-associated Rho guanine nucleotide exchange factor (LARG, which activates Rho, was downregulated under clinorotation. Moreover, we identified the full-length LARG cDNA. The amount of GTP-bound RhoA, that is, the active form of RhoA, decreased under this condition. Conclusion The activation of the small GTPase Rho was influenced by simulated microgravity generated by a three-dimensional (3D clinostat. Furthermore, the full-length cDNA of bovine LARG, a member of the Rho guanine nucleotide exchange factor (GEF family, was identified, and its gene expression was observed to be downregulated under clinorotation. This downregulation subsequently resulted in the repression of RhoA activation. These results indicated that the disorganization of the actin fibers was caused by the inhibition of Rho activation by 3D clinorotation.

  11. Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

    Science.gov (United States)

    Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

    2017-09-01

    Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Cloning and first functional characterization of a plant cyclic nucleotide-gated cation channel

    Energy Technology Data Exchange (ETDEWEB)

    Leng, Q.; Mercier, R.W.; Yao, W.; Berkowitz, G.A.

    1999-11-01

    Cyclic nucleotide-gated (cng) non-selective cation channels have been cloned from a number of animal systems. These channels are characterized by direct gating upon cAMO or cGMO binding to the intracellular portion of the channel protein, which leads to an increase in channel conductance. Animal cng channels are involved in signal transduction systems; they translate stimulus-induced changes in cytosolic cyclic nucleotide into altered cell membrane potential and/or cation flux as part of a signal cascade pathway. Putative plant homologs of animal cng channels have been identified. However, functional characterization (i.e., demonstration of cyclic-nucleotide-dependent ion currents) of a plant cng channel has not yet been accomplished. The authors report the cloning and first functional characterization of a plant member of this family of ion channels. The Arabidopsis cDNA AtCNGC2 encodes a polypeptide with deduced homology to the {alpha}-subunit of animal channels, and facilitates cyclic nucleotide-dependent cation currents upon expression in a number of heterologous systems. AtCNGC2 expression in a yeast mutant lacking a low-affinity K{sup +} uptake system complements growth inhibition only when lipophilic nucleotides are present in the culture medium. Voltage clamp analysis indicates that Xenopus lawvis oocytes injected with AtCNGC2 cRNA demonstrate cyclic-nucleotide-dependent, inward-rectifying K{sup +} currents. Human embryonic kidney cells (HEK293) transfected with AtCNGC2 cDNA demonstrate increased permeability to Ca{sup 2+} only in the presence of lipophilic cyclic nucleotides. The evidence presented here supports the functional classification of AtCNGC2 as a cyclic-nucleotide-gated cation channel, and presents the first direct evidence identifying a plant member of this ion channel family.

  13. Molecular Cloning and Sequence Analysis of IGF-I from Triangular Bream(Megalobrama terminalis)

    Institute of Scientific and Technical Information of China (English)

    TONG Fu-dan; LIU Hong-yun

    2004-01-01

    The insulin-like growth factor Ⅰ(IGF-Ⅰ)gene of triangular bream(Megalobrama terminalis)(GenBank No.AY247412)(Tb)was cloned for the first time from liver by RT-PCR. The nucleotide sequence analysis showed the Tb IGF-Ⅰ cDNA consisted of 486 nucleotides and encoded 117 amino acids including B,C,A,D and E five domains. Analysis of E-domain indicated that cloned Tb IGF-Ⅰ belonged to IGF-Ⅰ Ea-2 subtype. Identity analysis showed the IGF-Ⅰ nucleotide sequence shared 99.8% homology with bluntnose bream,88.8% with grass Carp,85.8% with common carp; the pre-IGF-Ⅰ amine acid sequence shared 99.4% with bluntnose bream,88.8% with grass carp,85.4% homology with common carp. In the Cyprinus Carpio,the higher homology of nucleotide sequence and amino acid sequence in IGF-Ⅰshowed that the closer relationship the fishes have. These results could provide basic data for the research on Tb germplasm and the development and utilization of biological feed additives.

  14. Cloning, sequencing and expression of the Schwanniomyces occidentalis NADP-dependent glutamate dehydrogenase gene.

    Science.gov (United States)

    De Zoysa, P A; Connerton, I F; Watson, D C; Johnston, J R

    1991-08-01

    The cloned NADP-specific glutamate dehydrogenase (GDH) genes of Aspergillus nidulans (gdhA) and Neurospora crassa (am) have been shown to hybridize under reduced stringency conditions to genomic sequences of the yeast Schwanniomyces occidentalis. Using 5' and 3' gene-specific probes, a unique 5.1 kb BclI restriction fragment that encompasses the entire Schwanniomyces sequence has been identified. A recombinant clone bearing the unique BclI fragment has been isolated from a pool of enriched clones in the yeast/E. coli shuttle vector pWH5 by colony hybridization. The identity of the plasmid clone was confirmed by functional complementation of the Saccharomyces cerevisiae gdh-1 mutation. The nucleotide sequence of the Schw. occidentalis GDH gene, which consists of 1380 nucleotides in a continuous reading frame of 459 amino acids, has been determined. The predicted amino acid sequence shows considerable homology with GDH proteins from other fungi and significant homology with all other available GDH sequences.

  15. Complete nucleotide sequence and genomic organization of Periplaneta fuliginosa densonucleosis virus

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    We have cloned the replicative form of the Periplaneta fuliginosa densonucleosis virus (Pf DNV) genome and determined its complete sequence.The sequence has 5454 nucleotides (nt),the genome consists of an internal unique sequence flanked by inverted terminal repeats (201 nt).The first 122 nt at the 5' end and the terminal 122 nt at the 3'end of both plus and minus strands can fold into a typical hairpin structure.The genome contains seven major open reading frames (ORFs).The plus strand has 4 ORFs occupying the 5' half of the plus strand,whereas the others span the 5' half of the minus strand.Two potential promoters were found at map units (m.u.) 3 and 97.Computer analysis of sequence homologies with other parvoviruses suggests that the plus strand of Pf DNV encodes very likely the nonstructural proteins and the minus strand probably encodes the structural proteins.

  16. Cloning and Sequence Analysis of Glycoprotein D Gene of Bovine Herpesvirus-1 Strain Luojing

    Institute of Scientific and Technical Information of China (English)

    LI Ji-chang; TONG Guang-zhi; QIU Hua-ji; ZHOU Yan-jun; XUE Qiang

    2003-01-01

    By means of PCR,the gene encoding gD of bovine herpesvirus-1 (BHV-1) strain Luojing was amplified,cloned and sequenced.The nucleotide sequence of this gD gene was 1 251 bp,encoding 417 amino acids.Comparied with the published P8-2 strain,the homology of the necleotide sequence is 99.92%,and that of the deduced amino acid sequence is 100%.The results indicated that gD of BHV-1 was highly conservative.

  17. Complete nucleotide sequence and genome organization of tobacco mosaic virus isolated from Viciafaba

    Institute of Scientific and Technical Information of China (English)

    周雪平; 薛朝阳; 陈青; 戚益军; 李德葆

    2000-01-01

    Based on reported TMV-U1 sequence, primers were designed and fragments covering the entire genome of TMV broad bean strain (TMV-B) were obtained with RT-PCR. These fragments were cloned and sequenced and the 5’ and 3’ end sequences of genome were confirmed with RACE. The complete sequence of TMV-B comprises 6 395 nucleotides (nt) and four open reading frames, which correspond to 126 ku (1 116 amino acids), 183 ku (1 616 amino acids), 30 ku (268 amino acids) and 17.5 ku proteins (159 amino acids). The complete nucleotide sequence of TMV-B is 99.4% identical to that of TMV-U1. The two virus isolates share the same sequence of 5’, 3’ non-coding region and 17.5 K ORF, and 6, 1 and 3 amino acid changes are found in 126 K protein, 54 K protein and 30 K protein, respectively. The possible mechanism on the infection of TMV-B in Vicia faba is discussed.

  18. Complete nucleotide sequences of two begomoviruses infecting Madagascar periwinkle (Catharanthus roseus) from Pakistan.

    Science.gov (United States)

    Ilyas, Muhammad; Nawaz, Kiran; Shafiq, Muhammad; Haider, Muhammad Saleem; Shahid, Ahmad Ali

    2013-02-01

    Though Catharanthus roseus (Madagascar periwinkle) is an ornamental plant, it is famous for its medicinal value. Its alkaloids are known for anti-cancerous properties, and this plant is studied mainly for its alkaloids. Here, this plant has been studied for its viral diseases. Complete DNA sequences of two begomoviruses infecting C. roseus originating from Pakistan were determined. The sequence of one begomovirus (clone KN4) shows the highest level of nucleotide sequence identity (86.5 %) to an unpublished virus, chili leaf curl India virus (ChiLCIV), and then (84.4 % identity) to papaya leaf curl virus (PaLCV), and thus represents a new species, for which the name "Catharanthus yellow mosaic virus" (CYMV) is proposed. The sequence of another begomovirus (clone KN6) shows the highest level of sequence identity (95.9 % to 99 %) to a newly reported virus from India, papaya leaf crumple virus (PaLCrV). Sequence analysis shows that KN4 and KN6 are recombinants of Pedilanthus leaf curl virus (PedLCV) and croton yellow vein mosaic virus (CrYVMV).

  19. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  20. Cloning and Sequence Analysis of Y-box Binding Protein Gene in Min Pig

    Institute of Scientific and Technical Information of China (English)

    Zhang Dong-jie; Liu Di; Wang Liang; He Xin-miao; Wang Wen-tao

    2014-01-01

    In order to study the gene sequence of Min pig Y-box binding protein (YB-1) gene, the complete coding sequence of Min pig YB-1 gene was cloned by RT-PCR, the sequence features were analyzed by some software and online website. The results showed that the complete CDS of Min pig Y-box was found to be 975 bp long, encoding 324 amino acids. It contained a conserved cold shock domain and several phosphorylation sites, but had no transmembrane domains, and was consistent with a protein found in the cytoplasm. Min pig YB-1 nucleotides shared high similarity (61.37%-97.66%) with other mammals.

  1. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    Science.gov (United States)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.

    2015-09-01

    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  2. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  3. Nucleotide sequence of the capsid protein gene and 3' non-coding region of papaya mosaic virus RNA.

    Science.gov (United States)

    Abouhaidar, M G

    1988-01-01

    The nucleotide sequences of cDNA clones corresponding to the 3' OH end of papaya mosaic virus RNA have been determined. The 3'-terminal sequence obtained was 900 nucleotides in length, excluding the poly(A) tail, and contained an open reading frame capable of giving rise to a protein of 214 amino acid residues with an Mr of 22930. This protein was identified as the viral capsid protein. The 3' non-coding region of PMV genome RNA was about 121 nucleotides long [excluding the poly(A) tail] and homologous to the complementary sequence of the non-coding region at the 5' end of PMV RNA. A long open reading frame was also found in the predicted 5' end region of the negative strand.

  4. Cytochrome b nucleotide sequence variation among the Atlantic Alcidae.

    Science.gov (United States)

    Friesen, V L; Montevecchi, W A; Davidson, W S

    1993-01-01

    Analysis of cytochrome b nucleotide sequences of the six extant species of Atlantic alcids and a gull revealed an excess of adenines and cytosines and a deficit of guanines at silent sites on the coding strand. Phylogenetic analyses grouped the sequences of the common (Uria aalge) and Brünnich's (U. lomvia) guillemots, followed by the razorbill (Alca torda) and little auk (Alle alle). The black guillemot (Cepphus grylle) sequence formed a sister taxon, and the puffin (Fratercula arctica) fell outside the other alcids. Phylogenetic comparisons of substitutions indicated that mutabilities of bases did not differ, but that C was much more likely to be incorporated than was G. Imbalances in base composition appear to result from a strand bias in replication errors, which may result from selection on secondary RNA structure and/or the energetics of codon-anticodon interactions.

  5. REVISITING MOLECULAR CLONING TO SOLVE GENOME SEQUENCING PROJECT CONFLICTS

    National Research Council Canada - National Science Library

    Hugo A Barrera-Saldaña; Aarón Daniel Ramírez-Sánchez; Tiffany Editth Palacios-Tovar; Dionicio Aguirre-Treviño; Saúl Felipe Karr-de-León

    2017-01-01

    .... Molecular cloning was chosen as the most straight-forward strategy to solve the dilemma. The initial characterization of recombinant plasmids by restriction enzyme digestion confirmed the presence of two genomic sequences...

  6. Molecular cloning, expression analysis and sequence prediction of ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... comparison of the amino acid sequences from C/EBPβ cloned in this study and those from different ... subcutaneous fat was the highest among all the analyzed tissues, and the relative quantity ..... Carbohydrate Metabolism.

  7. Human sapovirus classification based on complete capsid nucleotide sequences.

    Science.gov (United States)

    Oka, Tomoichiro; Mori, Kohji; Iritani, Nobuhiro; Harada, Seiya; Ueki, You; Iizuka, Setsuko; Mise, Keiji; Murakami, Kosuke; Wakita, Takaji; Katayama, Kazuhiko

    2012-02-01

    The genetically diverse sapoviruses (SaVs) are a significant cause of acute human gastroenteritis. Human SaV surveillance is becoming more critical, and a better understanding of the diversity and distribution of the viral genotypes is needed. In this study, we analyzed 106 complete human SaV capsid nucleotide sequences to provide a better understanding of their diversity. Based on those results, we propose a novel standardized classification scheme that meets the requirements of the International Calicivirus Scientific Committee. We believe the classification scheme and strains described here will be of value for the molecular characterization and classification of newly detected SaV genotypes and for comparing data worldwide.

  8. Cloning and Sequence Analysis on 3' Coding Region of Wild Boar and Cross Bred Pig Myostatin Gene

    Institute of Scientific and Technical Information of China (English)

    LIU Di; YANG Xiu-qin; YANG Jia-fang

    2004-01-01

    Myostatin, with a highly conservative gene among breeds is a negative regulator of muscle. The 3' coding regions of wild boar and crossbred pig myostatin were cloned by RT-PCR and sequenced respectively. The homology of the nucleotide sequence between wild boar and crossbred pig was 100% and there was no difference in this region compared with pig myostatin gene of Genbank. This indicated that there was not change of gene sequence in this region during the evolution processes.

  9. Cloning of partial putative gonadotropin hormone receptor sequence from fish

    Indian Academy of Sciences (India)

    G Kumaresan; T Venugopal; A Vikas; T J Pandian; S M Athavan

    2000-03-01

    A search for the presence of mariner-like elements in the Labeo rohita genome by polymerase chain reaction led to the amplification of a partial DNA sequence coding for a putative transmembrane domain of gonadotropin hormone receptor. The amplified DNA sequence shows a high degree of homology to the available turkey and human luteinizing and follicle stimulating hormone receptor coding sequences. This is the first report on cloning such sequences of piscine origin.

  10. Isolation and characterization of sequences homologous to the tobacco clone axi 1 (auxin independent) from a Vicia sativa nodule cDNA library

    NARCIS (Netherlands)

    Yalçin-Mendi, Y.; Çetiner, S.; Bisseling, T.

    2001-01-01

    In this research, partial nucleotide sequences of the axi 1 gene, which is related to auxin perception and transduction, isolated from Vicia sativa using cDNA library screening were investigated. Four V. sativa cDNA clones representing homologous of the tobacco axi 1 (auxin independent) cDNA clone w

  11. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  12. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Science.gov (United States)

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  13. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  14. Cloning and Sequence Analysis of Light Variable Region Gene of Anti-human Retinoblastoma Monoclonal Antibody

    Institute of Scientific and Technical Information of China (English)

    Xiufeng Zhong; Yongping Li; Shuqi Huang; Bo Ning; Chunyan Zhang; Jianliang Zheng; Guanguang Feng

    2002-01-01

    Purpose: To clone the variable region gene of light chain of monoclonal antibody against human retinoblastoma and to analyze the characterization of its nucleotide sequence as well as amino acid sequence.Methods: Total RNA was extracted from 3C6 hybridoma cells secreting specific monoclonal antibody(McAb)against human retinoblastoma(RB), then transcripted reversely into cDNA with olig-dT primers.The variable region of the light chain (VL) gene fragments was amplified using polymeerase chain reaction(PCR) and further cloned into pGEM(R) -T Easy vector. Then, 3C6 VL cDNA was sequenced by Sanger's method.Homologous analysis was done by NCBI BLAST.Results: The complete nucleotide sequence of 3C6 VL cDNA consisted of 321 bp encoding 107 amino acid residues, containing four workframe regions(FRs)and three complementarity-determining regions (CDRs) as well as the typical structure of two cys residues. The sequence is most homological to a member of the Vk9 gene family, and its chain utilizes the Jkl gene segment.Conclusion: The light chain variable region gene of the McAb against human RB was amplified successfully , which belongs to the Vk9 gene family and utilizes Vk-Jk1 gene rearrangement. This study lays a good basis for constructing a recombinant antibody and for making a new targeted therapeutic agents against retinoblastoma.

  15. ACG: rapid inference of population history from recombining nucleotide sequences

    Directory of Open Access Journals (Sweden)

    O'Fallon Brendan D

    2013-02-01

    Full Text Available Abstract Background Reconstruction of population history from genetic data often requires Monte Carlo integration over the genealogy of the samples. Among tools that perform such computations, few are able to consider genetic histories including recombination events, precluding their use on most alignments of nuclear DNA. Explicit consideration of recombinations requires modeling the history of the sequences with an Ancestral Recombination Graph (ARG in place of a simple tree, which presents significant computational challenges. Results ACG is an extensible desktop application that uses a Bayesian Markov chain Monte Carlo procedure to estimate the posterior likelihood of an evolutionary model conditional on an alignment of genetic data. The ancestry of the sequences is represented by an ARG, which is estimated from the data with other model parameters. Importantly, ACG computes the full, Felsenstein likelihood of the ARG, not a pairwise or composite likelihood. Several strategies are used to speed computations, and ACG is roughly 100x faster than a similar, recombination-aware program. Conclusions Modeling the ancestry of the sequences with an ARG allows ACG to estimate the evolutionary history of recombining nucleotide sequences. ACG can accurately estimate the posterior distribution of population parameters such as the (scaled population size and recombination rate, as well as many aspects of the recombinant history, including the positions of recombination breakpoints, the distribution of time to most recent common ancestor along the sequence, and the non-recombining trees at individual sites. Multiple substitution models and population size models are provided. ACG also provides a richly informative graphical interface that allows users to view the evolution of model parameters and likelihoods in real time.

  16. cDNA cloning and sequencing of ostrich Growth hormone

    Directory of Open Access Journals (Sweden)

    Doosti Abbas

    2012-01-01

    Full Text Available In recent years, industrial breeding of ostrich (Struthio camelus has been widely developed in Iran. Growth hormone (GH is a peptide hormone that stimulates growth and cell reproduction in different animals. The aim of this study was to clone and sequence the ostrich growth hormone gene in E. coli, done for the first time in Iran. The cDNA that encodes ostrich growth hormone was isolated from total mRNA of the pituitary gland and amplified by RT-PCR using GH specific PCR primers. Then GH cDNA was cloned by T/A cloning technique and the construct was transformed into E. coli. Finally, GH cDNA sequence was submitted to the GenBank (Accession number: JN559394. The results of present study showed that GH cDNA was successfully cloned in E. coli. Sequencing confirmed that GH cDNA was cloned and that the length of ostrich GH cDNA was 672 bp; BLAST search showed that the sequence of growth hormone cDNA of the ostrich from Iran has 100% homology with other records existing in GenBank.

  17. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

    Energy Technology Data Exchange (ETDEWEB)

    Torella, JP; Lienert, F; Boehm, CR; Chen, JH; Way, JC; Silver, PA

    2014-08-07

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.

  18. cDNA Cloning and Sequence Analysis of Rice Sbel and Sbe3 Genes

    Institute of Scientific and Technical Information of China (English)

    CHENXiu-hua; LIUQiao-quan; WuHsin-kan; WANGZong-yang; GuMing-hong

    2004-01-01

    Two starch-branching enzyme (SBE) in rice, is known to be a key enzyme in amylopectin biosynthesis. The cDNA of two SBE(starch-branching enzyme) genes SheI and Shed encoding SBE Ⅰ and SBE Ⅲ (two major isoforms in rice) were cloned by an improved RT-PCR technique, from a template cDNA libray, derived from the total mRNAs extracted from the immature seeds of a japonica rice Wuyunjing 7. DNA sequence analysis showed that the size of the cloned SheI and Shed cDNAs were 2490 and 2481 bp long, respectively, including their entire coding sequences. Comparison analysis indicated that the nucleotide sequence of She3 was the same as that of shed (Genbank Accession No. D16201) as reported previously. There were only four base-pairs difference,which resulted in changes of two deduced amino acids between the cloned She1 cDNA and the reported she1 (Genbank Accession No. D11082). The cloned SheI and Shed cDNAs make it possible to improve rice starch quality through genetic engineering.

  19. cDNA Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes

    Institute of Scientific and Technical Information of China (English)

    CHEN Xiu-hua; LIU Qiao-quan; WU Hsin-kan; WANG Zong-yang; GU Ming-hong

    2004-01-01

    Two starch-branching enzyme (SBE) in rice, is known to be a key enzyme in amylopectin biosynthesis. The cDNA of two SBE(starch-branching enzyme) genes Sbe1 and Sbe3 encoding SBE I and SBE Ⅲ (two major isoforms in rice) were cloned by an improved RT-PCR technique, from a template cDNA library derived from the total mRNAs extracted from the immature seeds of a japonica rice Wuyunjing 7. DNA sequence analysis showed that the size of the cloned Sbe1 and Sbe3 cDNAs were 2490 and 2481 bp long, respectively, including their entire coding sequences. Comparison analysis indicated that the nucleotide sequence of Sbe3 was the same as that of sbe3 (Genbank Accession No. D16201) as reported previously. There were only four base-pairs difference,which resulted in changes of two deduced amino acids between the cloned Sbe1 cDNA and the reported sbe1 (Genbank Accession No. D11082). The cloned Sbe1 and Sbe3 cDNAs make it possible to improve rice starch quality through genetic engineering

  20. Molecular cloning of Ras cDNA from Penaeus japonicus (Crustacea, decapoda): geranylgeranylation and guanine nucleotide binding.

    Science.gov (United States)

    Huang, C F; Chuang, N N

    1998-12-11

    A cDNA was isolated from the shrimp Penaeus japonicus by homology cloning. The shrimp hepatopancreas cDNA encodes a 187-residue polypeptide whose predicted amino acid sequence shares 85% homology with mammalian K-Ras 4B protein and demonstrates identity in the guanine nucleotide binding domains. Expression of the shrimp cDNA in Escherichia coli yielded a 21-kDa polypeptide with a positive reactivity towards the monoclonal antibodies against mammalian Ras. The GTP binding of the shrimp ras-encoded fusion protein was approximated to be 30000units/mg of protein, whereas the binding for GDP was 5000units/mg of protein. Fluorography analysis demonstrated that the prenylation of both shrimp Ras GDP and shrimp Ras GTP by protein geranylgeranyltransferase I of shrimp Penaeus japonicus exceeded the shrimp Ras nucleotide-free form by 10-fold, and fourfold, respectively; that is, the shrimp protein geranylgeranyltransferase I prefers to react with the shrimp ras-encoded p25 fusion protein in the GDP-bound form.

  1. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    Science.gov (United States)

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  2. Complete nucleotide sequence and transcriptional analysis of snakehead fish retrovirus.

    Science.gov (United States)

    Hart, D; Frerichs, G N; Rambaut, A; Onions, D E

    1996-06-01

    The complete genome of the snakehead fish retrovirus has been cloned and sequenced, and its transcriptional profile in cell culture has been determined. The 11.2-kb provirus displays a complex expression pattern capable of encoding accessory proteins and is unique in the predicted location of the env initiation codon and signal peptide upstream of gag and the common splice donor site. The virus is distinguishable from all known retrovirus groups by the presence of an arginine tRNA primer binding site. The coding regions are highly divergent and show a number of unusual characteristics, including a large Gag coiled-coil region, a Pol domain of unknown function, and a long, lentiviral-like, Env cytoplasmic domain. Phylogenetic analysis of the Pol sequence emphasizes the divergent nature of the virus from the avian and mammalian retroviruses. The snakehead virus is also distinct from a previously characterized complex fish retrovirus, suggesting that discrete groups of these viruses have yet to be identified in the lower vertebrates.

  3. Cloning and sequence analysis of IL-2, IL-4 and IFN-γ from Indian Dromedary camels (Camelus dromedarius).

    Science.gov (United States)

    Nagarajan, G; Swami, Shelesh Kumar; Ghorui, S K; Pathak, K M L; Singh, R K; Patil, N V

    2012-06-01

    The cDNAs of three cytokines, viz., IL-2, IL-4 and IFN-γ from Dromedary camels were amplified by PCR using Bactrian camel sequences and subsequently cloned for sequence analysis. Relationship based on amino acid sequences revealed that Dromedary camel IL-2 shared 99.5% and 99.3% identity at the nucleotide and amino acid levels with Bactrian camel IL-2. In the case of IL-4, the identity of Dromedary camel was 99.7% and 99.2% at the nucleotide and amino acid levels, respectively with that of Bactrian camel. The Dromedary camel IFN-γ shared 100% identity both at nucleotide and amino acid levels with Bactrian camel IFN-γ. Phylogenetic analysis based on amino acid sequences indicated the close relationship in these cytokine genes between the Dromedary camel and other camelids.

  4. Cloning, sequencing and application of the LEU2 gene from the sour dough yeast Candida milleri.

    Science.gov (United States)

    Turakainen, Hilkka; Korhola, Matti

    2005-07-30

    We have cloned by complementation in Saccharomyces cerevisiae and sequenced a LEU2 gene from the sour dough yeast Candida milleri CBS 8195 and studied its chromosomal location. The LEU2 coding sequence was 1092 nt long encoding a putative beta-isopropylmalate dehydrogenase protein of 363 amino acids. The nucleotide sequence in the coding region had 71.6% identity to S. cerevisiae LEU2 sequence. On the protein level, the identity of C. milleri Leu2p to S. cerevisiae Leu2p was 84.1%. The CmLEU2 DNA probe hybridized to one to three chromosomal bands and two or three BamHI restriction fragments in C. milleri but did not give any signal to chromosomes or restriction fragments of C. albicans, S. cerevisiae, S. exiguus or Torulaspora delbrueckii. Using CmLEU2 probe for DNA hybridization makes it easy to quickly identify C. milleri among other sour dough yeasts.

  5. Cloning and sequencing of the bovine gastrin gene

    DEFF Research Database (Denmark)

    Lund, T; Rehfeld, J F; Olsen, Jørgen

    1989-01-01

    In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...... by an amidation-site (Gly-Arg-Arg), and a C-terminal nonapeptide. Comparison with human, porcine, and rat cDNA sequences revealed extensive homology in the coding region as well as in short noncoding structures....

  6. Sequence structure of Lowary/Widom clones forming strong nucleosomes.

    Science.gov (United States)

    Trifonov, Edward N

    2016-01-01

    Lowary and Widom selected from random sequences those which form exceptionally stable nucleosomes, including clone 601, the current champion of strong nucleosome (SN) sequences. This unique sequence database (LW sequences) carries sequence elements which confer stability on the nucleosomes formed on the sequences, and, thus, may serve as source of information on the structure of "ideal" or close to ideal nucleosome DNA sequence. An important clue is also provided by crystallographic study of Vasudevan and coauthors on clone 601 nucleosomes. It demonstrated that YR·YR dinucleotide stacks (primarily TA·TA) follow one another at distances 10 or 11 bases or multiples thereof, such that they all are located on the interface between DNA and histone octamer. Combining this important information with alignment of the YR-containing 10-mers and 11-mers from LW sequences, the bendability matrices of the stable nucleosome DNA are derived. The matrices suggest that the periodically repeated TA (YR), RR, and YY dinucleotides are the main sequence features of the SNs. This consensus coincides with the one for recently discovered SNs with visibly periodic DNA sequences. Thus, the experimentally observed stable LW nucleosomes and SNs derived computationally appear to represent the same entity - exceptionally stable SNs.

  7. The nucleotide sequence and genome structure of the geminivirus miscanthus streak virus.

    Science.gov (United States)

    Chatani, M; Matsumoto, Y; Mizuta, H; Ikegami, M; Boulton, M I; Davies, J W

    1991-10-01

    A tandem dimer of miscanthus streak virus (MiSV) DNA was inserted into the T-DNA of the binary plasmid vector pBIN19 and agroinoculated into several monocotyledonous plants (monocots) using Agrobacterium tumefaciens or A. rhizogenes. Disease symptoms and geminate particles were produced in maize and Panicum milaceum plants, and MiSV-specific double-stranded and single-stranded DNAs were found in these plants. The nucleotide sequence of the infectious MiSV clone, consisting of 2672 nucleotides, was determined. Four open reading frames (ORFs) for proteins of Mr greater than 10K were identified, two (V0 and V2) in the virus (+) sense and two (C1 and C2) in the complementary (-) sense, although C2 did not have an ATG start codon. Unlike other geminiviruses infecting monocots, complementary-sense ORFs did not overlap. Potential splicing donor and acceptor sites were identified in the sequence of the border region between the C terminus of ORF C1 and the N terminus of ORF C2. Amino acid sequences predicted from three (V2, C1 and C2) of these ORFs showed significant homology with the corresponding ORFs of other geminiviruses infecting monocots. A fifth ORF (V1), which showed some homology with ORF V1 of other monocot-infecting geminiviruses despite having a coding capacity for a product of Mr 8.8K, was found just upstream of ORF V2 as observed in those geminiviruses. ORF V0 showed no significant homology with ORFs present in any other geminiviruses. A mutation of V0 indicated that the C-terminal 30% of this ORF was not necessary for infection in maize, but that sequences around the mutated LspI site might have some regulatory role.

  8. Cloning and sequencing of the gene encoding thermophilic beta-amylase of Clostridium thermosulfurogenes.

    Science.gov (United States)

    Kitamoto, N; Yamagata, H; Kato, T; Tsukagoshi, N; Udaka, S

    1988-01-01

    A gene coding for thermophilic beta-amylase of Clostridium thermosulfurogenes was cloned into Bacillus subtilis, and its nucleotide sequence was determined. The nucleotide sequence suggested that the thermophilic beta-amylase is translated from monocistronic mRNA as a secretory precursor with a signal peptide of 32 amino acid residues. The deduced amino acid sequence of the mature beta-amylase contained 519 residues with a molecular weight of 57,167. The amino acid sequence of the C. thermosulfurogenes beta-amylase showed 54, 32, and 32% homology with those of the Bacillus polymyxa, soybean, and barley beta-amylases, respectively. Twelve well-conserved regions were found among the amino acid sequences of the four beta-amylases. To elucidate the mechanism rendering the C. thermosulfurogenes beta-amylase thermophilic, its amino acid sequence was compared with that of the B. polymyxa beta-amylase. The C. thermosulfurogenes beta-amyulase contained more Cys residues and fewer hydrophilic amino acid residues than the B. polymyxa beta-amylase did. Several regions were found in the amino acid sequence of the C. thermosulfurogenes beta-amylase, where the hydrophobicity was remarkably high as compared with that of the corresponding regions of the B. polymyxa beta-amylase. PMID:2461360

  9. Molecular cloning, sequencing, and expression in Escherichia coli of the potato virus Y cytoplasmic inclusion gene.

    Science.gov (United States)

    Ohshima, K; Inoue, A K; Shikata, E

    1993-01-01

    Complete nucleotide sequences of cytoplasmic inclusion (CI) genes of two strains of potato virus Y (PVY) were determined from six polymerase chain reaction (PCR)-amplified cDNA clones. The size of the CI genes of both ordinary (PVY-O) and necrotic strains (PVY-T13) was 1902 nucleotides, with a sequence homology of 83.4%. Comparison of the predicted amino acid sequences showed more than 90% homology. When these were compared with those of other potyviruses, the homology ranged from 53 to 61%. cDNAs of all or a part of the PVY-O CI gene containing an additional initiation codon (ATG) at the 5' end and a stop codon at the 3' end were constructed by PCR amplification and cloned into an Escherichia coli expression vector, pKK 223-3. Complete and truncated PVY-O CI proteins were successfully produced in E. coli as judged by reactivities with PVY-O CI protein-specific antiserum. To our knowledge, this is the first report on expression of PVY CI proteins in E. coli.

  10. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    Full Text Available Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/ for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/, the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  11. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  12. Isolation of a human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligonucleotide probe deduced from the amino acid sequence of bovine factor IX.

    Science.gov (United States)

    Jaye, M; de la Salle, H; Schamber, F; Balland, A; Kohli, V; Findeli, A; Tolstoshev, P; Lecocq, J P

    1983-04-25

    A unique 52mer oligonucleotide deduced from the amino acid sequence of bovine Factor IX was synthesized and used as a probe to screen a human liver cDNA bank. The Factor IX clone isolated shows 5 differences in nucleotide and deduced amino acid sequence as compared to a previously isolated clone. In addition, precisely one codon has been deleted.Images

  13. Cloning and sequencing of the beta-glucosidase gene from Acetobacter xylinum ATCC 23769.

    Science.gov (United States)

    Tajima, K; Nakajima, K; Yamashita, H; Shiba, T; Munekata, M; Takai, M

    2001-12-31

    The beta-glucosidase gene (bglxA) was cloned from the genomic DNA of Acetobacter xylinum ATCC 23769 and its nucleotide sequence (2200 bp) was determined. This bglxA gene was present downstream of the cellulose synthase operon and coded for a polypeptide of molecular mass 79 kDa. The overexpression of the beta-glucosidase in A. xylinum caused a tenfold increase in activity compared to the wild-type strain. In addition, the action pattern of the enzyme was identified as G3ase activity. The deduced amino acid sequence of the bglxA gene showed 72.3%, 49.6%, and 45.1% identity with the beta-glucosidases from A. xylinum subsp. sucrofermentans, Cellvibrio gilvus, and Mycobacterium tuberculosis, respectively. Based on amino acid sequence similarities, the beta-glucosidase (BglxA) was assigned to family 3 of the glycosyl hydrolases.

  14. Nucleotide sequence of an immediate-early frog virus 3 gene.

    Science.gov (United States)

    Willis, D; Foglesong, D; Granoff, A

    1984-12-01

    We have used "gene walking" with synthetic oligonucleotides and M13 dideoxynucleotide sequencing techniques to obtain the complete coding and flanking sequences of the gene encoding a major immediate-early RNA (molecular weight, 169,000) of frog virus 3. R-loop mapping of the cloned XbaI K fragment of frog virus 3 DNA with immediate-early RNA from infected cells showed that an RNA of approximately 500 to 600 nucleotides (the right size to code for the immediate-early viral 18-kilodalton protein of unknown function) hybridized to a region within 100 base pairs of one end of the XbaI K fragment; no evidence for splicing was observed in the electron microscope or by single-strand nuclease analysis. Further restriction mapping narrowed the location of the gene to the XbaI end of a 2-kilobase-pair XbaI-Bg/II fragment, which was bidirectionally subcloned into the bacteriophage pair mp10 and mp11 for sequencing. Mung bean nuclease mapping was used to identify both the 5' and the 3' ends of the mRNA. The 5' end mapped within an AT-rich region 19 base pairs upstream from two in-phase AUG start codons that were immediately followed by an open reading frame of 157 amino acids. Another AT-rich sequence was found at -29 base pairs from the 5' end of the mRNA start site; this sequence may function as a TATA box. The 3' end of the message displayed considerable microheterogeneity, but clearly terminated within a third AT-rich region 50 to 60 base pairs from the translation stop codon. The eucaryotic polyadenylic acid addition signal (AATAAA) was not present, a finding to be expected since frog virus 3 mRNA is not polyadenylated. Both the single-stranded mp10 clone of the XbaI-Bg/II fragment and a 15-base oligonucleotide complementary to the region flanking the two AUG translation start codons inhibited translation of the immediate-early 18-kilodalton protein in vitro, confirming the identity of the sequenced gene. As the regulatory sequences of this gene did not resemble those of

  15. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  16. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  17. cDNA cloning and sequence analysis of NIb gene of soybean mosaic virus

    Institute of Scientific and Technical Information of China (English)

    刘俊君; 彭学贤; 莽克强

    1995-01-01

    cDNA of soybean mosaic virus (Beijing isolate, SMV-BJ) has been synthesized, using viralgenomic RNA as template and random hexanucleotides as primers. Based on the sequences of SMV-BJ coat protein (CP) gene as well as SMV- and WMV-II-related regions, oligonucleotides were made as primers for polymerase chain reaction (PCR). NIb gene of SMV-BJ was amplified by PCR, and cloned into pBluescript SK. The complete sequence was determined. The comparison of NIb genes between SMV-BJ and WMV-II . (USA) shows that similarities for nucleotide sequence reach 80.3%, and the deduced amino acid sequence. 91 3%. In consideration of the high identities in between the CP gene and the 3’-non-coding region between them, WMV-II might be considered as a watermelon strain of SMV Besides, some unexpected sequences were found in the 3’-region of 2 NIb gene clones. Following modification and splicing, a binary vector of NIb gene has been constructed for its expression in higher plant for the purpose of studying the possible repl

  18. Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

    Science.gov (United States)

    Liu, X; Gorovsky, M A

    1996-01-01

    A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

  19. Citrus psorosis virus: nucleotide sequencing of the coat protein gene and detection by hybridization and RT-PCR.

    Science.gov (United States)

    Barthe, G A; Ceccardi, T L; Manjunath, K L; Derrick, K S

    1998-06-01

    Citrus psorosis virus (CPV) is a multicomponent ssRNA virus with a coat protein of approximately 48 kDa. The viral genome is encapsidated in short and long particles that are readily separated by sucrose density-gradient centrifugation. CPV particles are spiral filaments that are referred to as spiroviruses (SV). A cDNA library of purified short particles from isolate CPV-4 was prepared in a Lambda vector and screened for expression of the coat protein gene (CPG) with a monoclonal antibody to the coat protein. Sequencing of immunopositive clones indicated a single ORF encoding a 49 kDa protein. This ORF, when expressed in E. coli, gave a protein identical in size and immunoreactivity to the CPV coat protein. A full-length clone of the CPG was transcribed and used in Northern hybridization assays to establish that short particle RNA of CPV is negative sense and contains the CPG. Moreover, the CPG was not found on RNA extracted from long particles or on the sedimentable dsRNA from CPV infected tissue. RT-PCR assays were developed for the amplification of a 600 bp fragment of CPG and for the complete CPG (1317 bp). The 600 bp fragment from a biologically and serologically different isolate, CPV-6, was cloned, sequenced and found to share 86% (nucleotide) and 96% (amino acid) identity with CPV-4. BLAST analysis of sequences from CPV-4 and CPV-6 detected no significant nucleic acid or protein similarity with any known viral sequences.

  20. Evaluation of a pooled strategy for high-throughput sequencing of cosmid clones from metagenomic libraries.

    Directory of Open Access Journals (Sweden)

    Kathy N Lam

    Full Text Available High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones.

  1. Evaluation of a pooled strategy for high-throughput sequencing of cosmid clones from metagenomic libraries.

    Science.gov (United States)

    Lam, Kathy N; Hall, Michael W; Engel, Katja; Vey, Gregory; Cheng, Jiujun; Neufeld, Josh D; Charles, Trevor C

    2014-01-01

    High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones.

  2. Nucleotide sequence and phylogenetic analysis of a new potexvirus: Malva mosaic virus.

    Science.gov (United States)

    Côté, Fabien; Paré, Christine; Majeau, Nathalie; Bolduc, Marilène; Leblanc, Eric; Bergeron, Michel G; Bernardy, Michael G; Leclerc, Denis

    2008-01-01

    A filamentous virus isolated from Malva neglecta Wallr. (common mallow) and propagated in Chenopodium quinoa was grown, cloned and the complete nucleotide sequence was determined (GenBank accession # DQ660333). The genomic RNA is 6858 nt in length and contains five major open reading frames (ORFs). The genomic organization is similar to members and the viral encoded proteins shared homology with the group of the Potexvirus genus in the Flexiviridae family. Phylogenetic analysis revealed a close relationship with narcissus mosaic virus (NMV), scallion virus X (ScaVX) and, to a lesser extent, to Alstroemeria virus X (AlsVX) and pepino mosaic virus (PepMV). A novel putative pseudoknot structure is predicted in the 3'-UTR of a subgroup of potexviruses, including this newly described virus. The consensus GAAAA sequence is detected at the 5'-end of the genomic RNA and experimental data strongly suggest that this motif could be a distinctive hallmark of this genus. The name Malva mosaic virus is proposed.

  3. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H;

    1996-01-01

    , the sensitivity of H-Ras to GRF was abolished when residues 130-139 were replaced by proline-aspartic acid-glutamine, whereas substitution of the entire loop 8 (residues 123-130 replaced by leucine-isoleucine-arginine) had no effect on the stimulation of guanine nucleotide release by GRF. Substrate activity...

  4. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  5. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Science.gov (United States)

    2010-07-01

    ... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences... sequences are specifically excluded from this definition. Sequences with fewer than four specifically... acids are not intended to be embraced by this definition. Any amino acid sequence that contains...

  6. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    CERN Document Server

    Fialko, N S

    2013-01-01

    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  7. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    Protein production in Escherichia coli is a fundamental activity for a large fraction of academic, pharmaceutical, and industrial research laboratories. Maximum production is usually sought, as this reduces costs and facilitates downstream purification steps. Frustratingly, many coding sequences...... are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...... lie between the Shine-Dalgarno sequence and the start codon, they are an integral part of the translation initiation region. To identify the most optimal sequences, we devised a simple and inexpensive PCR-based step that generates sequence variants at the vector-coding sequence junction...

  8. A high-throughput strategy for screening of bacterial artificial chromosome libraries and anchoring of clones on a genetic map constructed with single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Deal Karin R

    2009-01-01

    Full Text Available Abstract Background Current techniques of screening bacterial artificial chromosome (BAC libraries for molecular markers during the construction of physical maps are slow, laborious and often assign multiple BAC contigs to a single locus on a genetic map. These limitations are the principal impediment in the construction of physical maps of large eukaryotic genomes. It is hypothesized that this impediment can be overcome by screening multidimensional pools of BAC clones using the highly parallel Illumina GoldenGate™ assay. Results To test the efficacy of the Golden Gate assay in BAC library screening, multidimensional pools involving 302976 Aegilops tauschii BAC clones were genotyped for the presence/absence of specific gene sequences with multiplexed Illumina GoldenGate oligonucleotide assays previously used to place single nucleotide polymorphisms on an Ae. tauschii genetic map. Of 1384 allele-informative oligonucleotide assays, 87.6% successfully clustered BAC pools into those positive for a BAC clone harboring a specific gene locus and those negative for it. The location of the positive BAC clones within contigs assembled from 199190 fingerprinted Ae. tauschii BAC clones was used to evaluate the precision of anchoring of BAC clones and contigs on the Ae. tauschii genetic map. For 41 (95% assays, positive BAC clones were neighbors in single contigs. Those contigs could be unequivocally assigned to loci on the genetic map. For two (5% assays, positive clones were in two different contigs and the relationships of these contigs to loci on the Ae. tauschii genetic map were equivocal. Screening of BAC libraries with a simple five-dimensional BAC pooling strategy was evaluated and shown to allow direct detection of positive BAC clones without the need for manual deconvolution of BAC clone pools. Conclusion The highly parallel Illumina oligonucleotide assay is shown here to be an efficient tool for screening BAC libraries and a strategy for high

  9. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... to a 104-kDa band in addition to the expected 36-kDa band. The protein reacting at 104 kDa is a M. hominis protein with either an epitope similar to one on GAPDH, or it is an immunoglobulin binding protein...

  10. Single nucleotide polymorphisms associated with rat expressed sequences

    NARCIS (Netherlands)

    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin

    2004-01-01

    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturall

  11. Mining for Single Nucleotide Polymorphisms in Pig genome sequence data

    NARCIS (Netherlands)

    Kerstens, H.H.D.; Kollers, S.; Kommandath, A.; Rosario, del M.; Dibbits, B.W.; Kinders, S.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.

    2009-01-01

    Background - Single nucleotide polymorphisms (SNPs) are ideal genetic markers due to their high abundance and the highly automated way in which SNPs are detected and SNP assays are performed. The number of SNPs identified in the pig thus far is still limited. Results - A total of 4.8 million whole g

  12. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-01

    Feb 1, 2010 ... sequences of the PCGs were translated on the basis of the inverte- ... their proposed cloverleaf secondary structure and anticodon sequences with the aid ...... transcription termination peptide binding site, in that the intergenic ...

  13. Cloning, characterization, and properties of seven triplet repeat DNA sequences.

    Science.gov (United States)

    Ohshima, K; Kang, S; Larson, J E; Wells, R D

    1996-07-12

    Several neuromuscular and neurodegenerative diseases are caused by genetically unstable triplet repeat sequences (CTG.CAG, CGG.CCG, or AAG.CTT) in or near the responsible genes. We implemented novel cloning strategies with chemically synthesized oligonucleotides to clone seven of the triplet repeat sequences (GTA.TAC, GAT.ATC, GTT.AAC, CAC.GTG, AGG.CCT, TCG.CGA, and AAG.CTT), and the adjoining paper (Ohshima, K., Kang, S., Larson, J. E., and Wells, R. D.(1996) J. Biol. Chem. 271, 16784-16791) describes studies on TTA.TAA. This approach in conjunction with in vivo expansion studies in Escherichia coli enabled the preparation of at least 81 plasmids containing the repeat sequences with lengths of approximately 16 up to 158 triplets in both orientations with varying extents of polymorphisms. The inserts were characterized by DNA sequencing as well as DNA polymerase pausings, two-dimensional agarose gel electrophoresis, and chemical probe analyses to evaluate the capacity to adopt negative supercoil induced non-B DNA conformations. AAG.CTT and AGG.CCT form intramolecular triplexes, and the other five repeat sequences do not form any previously characterized non-B structures. However, long tracts of TCG.CGA showed strong inhibition of DNA synthesis at specific loci in the repeats as seen in the cases of CTG.CAG and CGG.CCG (Kang, S., Ohshima, K., Shimizu, M., Amirhaeri, S., and Wells, R. D.(1995) J. Biol. Chem. 270, 27014-27021). This work along with other studies (Wells, R. D.(1996) J. Biol. Chem. 271, 2875-2878) on CTG.CAG, CGG.CCG, and TTA.TAA makes available long inserts of all 10 triplet repeat sequences for a variety of physical, molecular biological, genetic, and medical investigations. A model to explain the reduction in mRNA abundance in Friedreich's ataxia based on intermolecular triplex formation is proposed.

  14. Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene

    Indian Academy of Sciences (India)

    Wenbing Wang; Shanying Zhu; Liqun Wang; Feng Yu; Weide Shen

    2005-12-01

    Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

  15. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    Science.gov (United States)

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  16. The complete nucleotide sequence and genomic characterization of grapevine asteroid mosaic associated virus.

    Science.gov (United States)

    Vargas-Asencio, José; Wojciechowska, Klaudia; Baskerville, Maia; Gomez, Annika L; Perry, Keith L; Thompson, Jeremy R

    2017-01-02

    In analyzing grapevine clones infected with grapevine red blotch associated virus, we identified a small number of isometric particles of approximately 30nm in diameter from an enriched fraction of leaf extract. A dominant protein of 25kDa was isolated from this fraction using SDS-PAGE and was identified by mass spectrometry as belonging to grapevine asteroid mosaic associated virus (GAMaV). Using a combination of three methods RNA-Seq, sRNA-Seq, and Sanger sequencing of RT- and RACE-PCR products, we obtained a full-length genome sequence consisting of 6719 nucleotides without the poly(A) tail. The virus possesses all of the typical conserved functional domains concordant with the genus Marafivirus and lies evolutionarily between citrus sudden death associated virus and oat blue dwarf virus. A large shift in RNA-Seq coverage coincided with the predicted location of the subgenomic RNA involved in coat protein (CP) expression. Genus wide sequence alignments confirmed the cleavage motif LxG(G/A) to be dominant between the helicase and RNA dependent RNA polymerase (RdRp), and the RdRp and CP domains. A putative overlapping protein (OP) ORF lacking a canonical translational start codon was identified with a reading frame context more consistent with the putative OPs of tymoviruses and fig fleck associated virus than with those of marafiviruses. BLAST analysis of the predicted GAMaV OP showed a unique relatedness to the OPs of members of the genus Tymovirus. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    Science.gov (United States)

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  18. Cloning and Sequencing of Truncated Toxoplasma gondii Subtilisin-Like 1 Antigen

    Directory of Open Access Journals (Sweden)

    Ahmad Rouhizadeh

    2016-07-01

    Full Text Available Background Toxoplasma gondii is an obligate intracellular protozoan parasite which has significant medical and veterinary impact on all around the world. Tracking of specific antigens or antibodies for toxoplasmosis is the main choice in its diagnosis. Recombinant proteins will improve sensitivity and specificity and reduce problems of standardization and reproducibility of diagnostic kits. Toxoplasma gondii Subtilisin-like protein (TgSUB1 is a novel example of a glycosylphosphatidylinositol GPI (-anchored protein which can be considered as a potential marker for serodiagnosis of toxoplasmosis. Objectives The aims of this study were to find out major antigenic parts of this whole protein and to develop a recombinant prokaryotic plasmid. Methods In this experimental study, using bioinformatics softwares Parker Hydrophilicity prediction and Bepipred linear Epitope prediction to select best highly antigenic region of this protein, a 744 bp fragment was amplified by polymerase chain reaction (PCR on cDNA obtained from T. gondii RNA. The PCR product was cloned in PCR2.1 vector and subcloned into expression pET28a vector. The PCR2.1-SUB1 and PET28a-SUB1constructs were analyzed by PCR, restriction analysis and sequencing. Results A highly antigenic region in the hydrophilic part of the protein including amino acid residues 549 to 795 was successfully cloned and the sequences were confirmed. All nucleotide sequences in the PCR product have 100% homology with the published reference sequence. Conclusions Pairing bioinformatics tools and cloning of the candidate molecules in vaccine development studies and diagnostic approaches will have powerful impact on promotion of research in infectious diseases. This strategy is considered as available and inexpensive technology even in less developed countries where the infectious diseases like toxoplasmosis is prevalent.

  19. Cloning,sequencing and phylogenic analysis of duck prion gene

    Institute of Scientific and Technical Information of China (English)

    WANG Qigui; ZHANG Lei; HU Xiaoxiang; FAN Baoliang; LI Ning; LI Hui; WU Changxin

    2004-01-01

    Duck prion gene was cloned and sequenced. Similar to mammalian prion protein (PrP), duck prion is encoded by a single exon of a single copy in genome, which was confirmed by Southern blot analysis. All of the structural features of mammalian PrP were also identified in the duck PrP. Compared with mammalian PrP, it exhibited a 30 % of general similarity. When compared with chicken PrP, it showed a higher homology of 97%. A phylogenetic tree was constructed to trace evolution of prion gene in animals.

  20. Complete sequence of the first chimera genome constructed by cloning the whole genome of Synechocystis strain PCC6803 into the Bacillus subtilis 168 genome.

    Science.gov (United States)

    Watanabe, Satoru; Shiwa, Yuh; Itaya, Mitsuhiro; Yoshikawa, Hirofumi

    2012-12-01

    Genome synthesis of existing or designed genomes is made feasible by the first successful cloning of a cyanobacterium, Synechocystis PCC6803, in Gram-positive, endospore-forming Bacillus subtilis. Whole-genome sequence analysis of the isolate and parental B. subtilis strains provides clues for identifying single nucleotide polymorphisms (SNPs) in the 2 complete bacterial genomes in one cell.

  1. Molecular cloning and analysis of the partial sequence of Rhinopithecus roxellanae growth hormone gene

    Institute of Scientific and Technical Information of China (English)

    徐来祥; 孔繁华; 华育平

    2000-01-01

    Growth hormone gene (GH) of Rhinopithecus roxellanae was amplified by PCR based on the sequences of the reported mammalian growth hormone gene for the first time. The amplified fragment was about 1.8 kb. It was cloned and its upper stream was sequenced. This sequencing region consists of a 5¢ flanking regulatory region, exon I and part of exon II, intron I of growth hormone gene. Comparing the corresponding sequences of growth hormone gene between Rhinopithecus roxellanae and the porcine, we concluded that the homology reached 81% in the region, and there was high conservation in the 5¢ flanking sequence. The kinds of amino acids of exon I and exon II for about 90% were the same to those in pig. Many mutations occurred in the degenerate site of the triplet code. In the nucleotides of intron I, there were only 72% homologies with those in pig. It means that introns and 3¢ flanking sequence maybe play an important part in growth hormone gene regulation of the different animals.

  2. Cloning and Sequence Analysis of a Novel Cold-Adapted Lipase Gene from Strain Iip35 (Pseudomonas sp.)

    Institute of Scientific and Technical Information of China (English)

    WANG Cai-hong; GUO Run-fang; YU Hong-wei; JIA Ying-min

    2008-01-01

    A combination method of the usual-PCR and reverse-PCR for the cloning of a novel lipase gene directly from the total genomic DNA of strain lip35 (Pseudomonas sp.) is described, whereby a lipase gene (lip) was cloned directly from genomic DNA. The sequence data have been deposited in the GenBank and EMBL data bank with the accession number EU414288. The nucleotide sequence showed a major open reading frame encoding a 59-kDa protein of 566 amino acid residues, which contained a lipase consensus sequence GXSXG. The lipase lip had 74 and 70% homologies with the Upases of an uncultured bacterium and P.fluorescens PfO-1, respectively, but it did not show any overall homology with lipases from other origins. The functional lipase was obtained when the lip gene was expressed in Pichia pastoris GS115.

  3. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  4. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    Directory of Open Access Journals (Sweden)

    Kato Mikio

    2003-01-01

    Full Text Available Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA.

  5. The complete nucleotide sequence of chrysanthemum stem necrosis virus

    NARCIS (Netherlands)

    Dullemans, A.M.; Verhoeven, J.Th.J.; Kormelink, R.J.M.; Vlugt, van der R.A.A.

    2015-01-01

    The complete genome sequence of chrysanthemum stem necrosis virus (CSNV) was determined using Roche 454 next-generation sequencing. CSNV is a tentative member of the genus Tospovirus within the family Bunyaviridae, whose members are arthropod-borne. This is the first report of the entire RNA genome

  6. Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Science.gov (United States)

    Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  7. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  8. A novel regucalcin gene promoter region-related protein: comparison of nucleotide and amino acid sequences in vertebrate species.

    Science.gov (United States)

    Sawada, Natsumi; Yamaguchi, Masayoshi

    2005-01-01

    The molecular cloning and sequencing of the cDNA coding for a novel regucalcin gene promoter region-related protein (RGPR-p117) from bovine, rabbit and chicken livers was investigated using rapid amplification of cDNA endo (RACE) method. Their nucleotide and amino acid sequences were compared with human, rat and mouse sequences published previously. RGPR-p117 of bovine, rabbit and chicken livers consisted of 1052, 1045, and 929 amino acid residues with calculated molecular mass of 117, 114, and 103 kDa, and estimated pI of 5.64, 5.84, and 5.59, respectively. Comparison analysis revealed that the nucleotide sequences of RGPR-p117 from mammalian species were highly-conserved in their coding region, and the homologies were at least 72.9%. The RGPR-p117 proteins in mammalian species consisted of 1045-1060 amino acids, and had 63.1-90.2% identity. Meanwhile, the nucleotide and amino acid sequences of chicken RGPR-p117 had at least 36.4 and 43.7% identities, respectively. Phylogenetic analysis showed that RGPR-p117 in six vertebrates appears to form a single cluster. Mammalian RGPR-p117 conserved a leucine zipper motif. Moreover, the analysis for subcellular localization of RGPR-p117 from six vertebrates showed the probability of nuclear localization >52.2%; the nuclear localization in rat and mouse was 78.3%. This study demonstrates a great conservation of RGPR-p117 genes throughout evolution.

  9. Nucleotide sequences of two Korean isolates of Cucumber green mottle mosaic virus.

    Science.gov (United States)

    Kim, Sang-Min; Lee, Jung-Myung; Yim, Kyu-Ock; Oh, Man-Ho; Park, Jin-Woo; Kim, Kook-Hyung

    2003-12-31

    The nucleotide sequences of the genomic RNAs of Cucumber green mottle mosaic virus Korean watermelon isolate (CGMMV-KW) and Korean oriental melon isolate (CGMMV-KOM) were determined and compared to the sequences of other tobamoviruses including CGMMV strains W and SH. Each CGMMV isolate had a genome of 6,424 nucleotides. Each also had 60 and 176 nucleotides of 5' and 3' untranslated regions (UTRs), respectively, and four open reading frames (ORF1-4). ORFs 1 to 4 encode proteins of 129, 186, 29, and 17.4 kDa, respectively. The nucleotide and deduced amino acid sequences of CGMMV-KOM and CGMMV-KW were more than 98.3% identical. When compared to other CGMMV strains in a phylogenetic analysis they were found to form a distinct virus clade, and were more distantly related to other tobamoviruses (23.5-56.7% identity).

  10. CLONING AND SEQUENCING OF MATURED FRAGMENT OF HUMAN NEVER GROWTH FACTOR GENE

    Institute of Scientific and Technical Information of China (English)

    马巍; 吴玲; 王德利; 刘淼; 任惠民; 杨广笑; 王全颖

    2003-01-01

    Objective Molecular cloning and sequencing of the human matured fragment of human nerve growth factor(NGF) gene. Methods Extracting the human genomic DNA from the white blood cells as templates, the gene of NGF was cloned by using PCR and T-vector cloning method. Screening the positive clones and identified by the restriction enzymes, and then the cloned amplified fragment was sequenced and analyzed. Results DNA sequence comparison the cloned gene of NGF with the GenBank (V01511) sequence demonstrated that both of sequences were identical, 354bp length. Conclusion Cloning the NGF gene from the human genomic DNA has paved the way for further study on gene therapy of nerve system injury.

  11. Should nucleotide sequence analyzing computer algorithms always extend homologies by extending homologies?

    Science.gov (United States)

    Burnett, L; Basten, A; Hensley, W J

    1986-01-10

    Most computer algorithms used for comparing or aligning nucleotide sequences rely on the premise that the best way to extend a homology between the two sequences is to select a match rather than a mismatch. We have tested this assumption and found that it is not always valid.

  12. Organization and Nucleotide Sequences of Two Lactococcal Bacteriocin Operons

    NARCIS (Netherlands)

    Belkum, Marco J. van; Hayema, Bert Jan; Jeeninga, Rienk E.; Kok, Jan; Venema, Gerard

    1991-01-01

    Two distinct regions of the Lactococcus lactis subsp. cremoris 9B4 plasmid p9B4-6, each of which specified bacteriocin production as well as immunity, have been sequenced and analyzed by deletion and frameshift mutation analyses. On a 1.8-kb ScaI-ClaI fragment specifying low antagonistic activity, t

  13. Methods for making nucleotide probes for sequencing and synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Church, George M; Zhang, Kun; Chou, Joseph

    2014-07-08

    Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.

  14. Mayaro virus: complete nucleotide sequence and phylogenetic relationships with other alphaviruses.

    Science.gov (United States)

    Lavergne, Anne; de Thoisy, Benoît; Lacoste, Vincent; Pascalis, Hervé; Pouliquen, Jean-François; Mercier, Véronique; Tolou, Hugues; Dussart, Philippe; Morvan, Jacques; Talarmin, Antoine; Kazanji, Mirdad

    2006-05-01

    Mayaro (MAY) virus is a member of the genus Alphavirus in the family Togaviridae. Alphaviruses are distributed throughout the world and cause a wide range of diseases in humans and animals. Here, we determined the complete nucleotide sequence of MAY from a viral strain isolated from a French Guianese patient. The deduced MAY genome was 11,429 nucleotides in length, excluding the 5' cap nucleotide and 3' poly(A) tail. Nucleotide and amino acid homologies, as well as phylogenetic analyses of the obtained sequence confirmed that MAY is not a recombinant virus and belongs to the Semliki Forest complex according to the antigenic complex classification. Furthermore, analyses based on the E1 region revealed that MAY is closely related to Una virus, the only other South American virus clustering with the Old World viruses. On the basis of our results and of the alphaviruses diversity and pathogenicity, we suggest that alphaviruses may have an Old World origin.

  15. Cloning and sequence analysis of 5' fragment of Hoxa-11 gene in Latimeria chalumnae.

    Science.gov (United States)

    Xue, L Y; Qian, K X

    2001-01-01

    Hoxa-11 gene is essential for the development of fish fins and tetrapod limbs. Based on the published nucleotide sequences of human and mouse Hoxa-11 genes, two degenerate primers were designed. Latimeria Hoxa-11 gene fragment was amplified by PCR, cloned and sequenced. The acquired Hox gene fragment, which encodes 204 amino acids, is comprised of 2,065 bp, including most exon 1, intron and partial exon 2. The homology of latimeria Hoxa-11 protein is 66.0% to human, 67.6% to mouse, 74.4% to chick, 72.8% to frog, and 59.7% to zebrafish, respectively. The exon 2 region including the homeobox and the splice site are highly conserved. However, the exon 1 region has increased in size by 16% from latimeria to human. Sequence analysis further revealed that exon 1 of latimeria Hoxa-11 could be divided into four regions: two highly conserved regions, a moderately conserved region, and a variable region adjacent to the intron. The size variation is primarily caused by the accumulation of alanine repeats and of flanking segments rich in glycine and serine in the variable region. It implies that the variable region might be related to acquisition of new functions in the fin-limb transition and vertebrate evolution. Besides the homeobox, two highly conserved regions in exon 1 and two phylogenetic footprints in the intro were found. The strong sequence conservation suggests an important functional role of these regions.

  16. Cloning,Sequencing and Phylogenetic Study of rbcL Gene from Cyanobacteria Arthrospira and Spirulina

    Institute of Scientific and Technical Information of China (English)

    Liu Jinjie(刘金姐); Zhang Xuecheng; Sui Zhenghong; Mao Yunxiang; Sun Xue

    2004-01-01

    Large subunit gene of rubisco (rbcL) of cyanobacteria Arthrospira platensis FACHB341, A. Platensis FACHB439, A. Maxima OUQDSM and Spirulina sp. FACHB440 is cloned, sequenced and characterized. Results show that GC content of the gene in strain Spirulina sp. FACHB440 is higher than that in the others. The alignments based on deduced amino acid sequences indicate that Spirulina sp. FACHB440 is different from that in other three samples of Arthrospira, though they have the same conserved functional sites (95, 98, 121, 124, 221, 257). The nucleotide sequence similarity among the three strains of the genus of Arthrospira (96.5~99.6%) is higher than that between Arthrospira and Spirulina (78.1~78.5%). By comparison of the corresponding sequence of other cyanobacteria, a phylogenetic tree with two clusters is constructed. A. Platensis FACHB341, A. Maxima OUQDSM and A. Platensis FACHB439 form the monophyletic linage, which is fully supported by bootstrap values (1000), while Spirulina sp. FACHB440 and Anabaena sp. PCC7120 cluster in another linage with the bootstrap value of 909.

  17. Cloning and Sequence Analysis of Expansin Genes from Litchi chinensis Fruit

    Institute of Scientific and Technical Information of China (English)

    LU Wang-jin; JIANG Yue-ming

    2003-01-01

    Using PCR degenerate primers, designed with reference to the sequences of the conserved amino acids of known expansins, to amplify cDNA fragments in litchi fruit by RT-PCR, two different cDNA fragments, named as Lc-Expl and Lc-Exp2, were cloned. Lc-Expl and Lc-Exp2 was respectively composed of 531 bp encoding 177 amino acids and 537 bp encoding 179 amino acids. Eight cysteine residues and three tryptopban residues, which is supposed to be the characteristics of expansins, are conserved in both Lc-Expl and e-Exp2. In addition, the homology between the two expansins is 71.6% at nucleotide acid sequences and 76.3% at amino acid sequences. The homology of Lc-Expl with Fa-Exp2 or Pp-Expl was 92.7% or 92.1%, but that of Lc-Exp2 with Fa-Exp2 or Pp-Expl was only 77.4% or 76.3% at amino acid sequences.

  18. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...... splicing events and coding potential of isoforms from full isoform deconvolution software, such as Cufflinks (article II), is presented. Finally, a study using 5’-end RNA-seq for alternative promoter detection between healthy patients and patients with acute promyelocytic leukemia is presented (article III...

  19. Quantifying single nucleotide variant detection sensitivity in exome sequencing

    OpenAIRE

    Meynert, Alison; Bicknell, Louise; Jackson, Andrew; Taylor, Martin S.

    2013-01-01

    BACKGROUND: The targeted capture and sequencing of genomic regions has rapidlydemonstrated its utility in genetic studies. Inherent in this technology isconsiderable heterogeneity of target coverage and this is expected tosystematically impact our sensitivity to detect genuine polymorphisms. To fullyinterpret the polymorphisms identified in a genetic study it is often essentialto both detect polymorphisms and to understand where and with what probabilityreal polymorphisms may have been missed...

  20. Cloning of two glutamate dehydrogenase cDNAs from Asparagus officinalis: sequence analysis and evolutionary implications.

    Science.gov (United States)

    Pavesi, A; Ficarelli, A; Tassi, F; Restivo, F M

    2000-04-01

    Two different amplification products, termed c1 and c2, showing a high similarity to glutamate dehydrogenase sequences from plants, were obtained from Asparagus officinalis using two degenerated primers and RT-PCR (reverse transcriptase polymerase chain reaction). The genes corresponding to these cDNA clones were designated aspGDHA and aspGDHB. Screening of a cDNA library resulted in the isolation of cDNA clones for aspGDHB only. Analysis of the deduced amino acid (aa) sequence from the full-length cDNA suggests that the gene product contains all regions associated with metabolic function of NAD glutamate dehydrogenase (NAD-GDH). A first phylogenetic analysis including only GDHs from plants suggested that the two GDH genes of A. officinalis arose by an ancient duplication event, pre-dating the divergence of monocots and dicots. Codon usage analysis showed a bias towards A/T ending codons. This tendency is likely due to the biased nucleotide composition of the asparagus genome, rather than to the translational selection for specific codons. Using principal coordinate analysis, the evolutionary relatedness of plant GDHs with homologous sequences from a large spectrum of organisms was investigated. The results showed a closer affinity of plant GDHs to GDHs of thermophilic archaebacterial and eubacterial species, when compared to those of unicellular eukaryotic fungi. Sequence analysis at specific amino acid signatures, known to affect the thermal stability of GDH, and assays of enzyme activity at non-physiological temperatures, showed a greater adaptation to heat-stress conditions for the asparagus and tobacco enzymes compared with the Saccharomyces cerevisiae enzyme.

  1. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Science.gov (United States)

    Figueroa, Javier; Pendón, Carlos; Valdivia, Manuel M

    2002-01-01

    Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A) is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural plasticity. PMID:12019018

  2. Clusters of nucleotide substitutions and insertion/deletion mutations are associated with repeat sequences.

    Directory of Open Access Journals (Sweden)

    Michael J McDonald

    2011-06-01

    Full Text Available The genome-sequencing gold rush has facilitated the use of comparative genomics to uncover patterns of genome evolution, although their causal mechanisms remain elusive. One such trend, ubiquitous to prokarya and eukarya, is the association of insertion/deletion mutations (indels with increases in the nucleotide substitution rate extending over hundreds of base pairs. The prevailing hypothesis is that indels are themselves mutagenic agents. Here, we employ population genomics data from Escherichia coli, Saccharomyces paradoxus, and Drosophila to provide evidence suggesting that it is not the indels per se but the sequence in which indels occur that causes the accumulation of nucleotide substitutions. We found that about two-thirds of indels are closely associated with repeat sequences and that repeat sequence abundance could be used to identify regions of elevated sequence diversity, independently of indels. Moreover, the mutational signature of indel-proximal nucleotide substitutions matches that of error-prone DNA polymerases. We propose that repeat sequences promote an increased probability of replication fork arrest, causing the persistent recruitment of error-prone DNA polymerases to specific sequence regions over evolutionary time scales. Experimental measures of the mutation rates of engineered DNA sequences and analyses of experimentally obtained collections of spontaneous mutations provide molecular evidence supporting our hypothesis. This study uncovers a new role for repeat sequences in genome evolution and provides an explanation of how fine-scale sequence contextual effects influence mutation rates and thereby evolution.

  3. Clusters of nucleotide substitutions and insertion/deletion mutations are associated with repeat sequences.

    Science.gov (United States)

    McDonald, Michael J; Wang, Wei-Chi; Huang, Hsien-Da; Leu, Jun-Yi

    2011-06-01

    The genome-sequencing gold rush has facilitated the use of comparative genomics to uncover patterns of genome evolution, although their causal mechanisms remain elusive. One such trend, ubiquitous to prokarya and eukarya, is the association of insertion/deletion mutations (indels) with increases in the nucleotide substitution rate extending over hundreds of base pairs. The prevailing hypothesis is that indels are themselves mutagenic agents. Here, we employ population genomics data from Escherichia coli, Saccharomyces paradoxus, and Drosophila to provide evidence suggesting that it is not the indels per se but the sequence in which indels occur that causes the accumulation of nucleotide substitutions. We found that about two-thirds of indels are closely associated with repeat sequences and that repeat sequence abundance could be used to identify regions of elevated sequence diversity, independently of indels. Moreover, the mutational signature of indel-proximal nucleotide substitutions matches that of error-prone DNA polymerases. We propose that repeat sequences promote an increased probability of replication fork arrest, causing the persistent recruitment of error-prone DNA polymerases to specific sequence regions over evolutionary time scales. Experimental measures of the mutation rates of engineered DNA sequences and analyses of experimentally obtained collections of spontaneous mutations provide molecular evidence supporting our hypothesis. This study uncovers a new role for repeat sequences in genome evolution and provides an explanation of how fine-scale sequence contextual effects influence mutation rates and thereby evolution.

  4. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  5. Genomic libraries: II. Subcloning, sequencing, and assembling large-insert genomic DNA clones.

    Science.gov (United States)

    Quail, Mike A; Matthews, Lucy; Sims, Sarah; Lloyd, Christine; Beasley, Helen; Baxter, Simon W

    2011-01-01

    Sequencing large insert clones to completion is useful for characterizing specific genomic regions, identifying haplotypes, and closing gaps in whole genome sequencing projects. Despite being a standard technique in molecular laboratories, DNA sequencing using the Sanger method can be highly problematic when complex secondary structures or sequence repeats are encountered in genomic clones. Here, we describe methods to isolate DNA from a large insert clone (fosmid or BAC), subclone the sample, and sequence the region to the highest industry standard. Troubleshooting solutions for sequencing difficult templates are discussed.

  6. A novel approach to sequence validating protein expression clones with automated decision making

    Directory of Open Access Journals (Sweden)

    Mohr Stephanie E

    2007-06-01

    Full Text Available Abstract Background Whereas the molecular assembly of protein expression clones is readily automated and routinely accomplished in high throughput, sequence verification of these clones is still largely performed manually, an arduous and time consuming process. The ultimate goal of validation is to determine if a given plasmid clone matches its reference sequence sufficiently to be "acceptable" for use in protein expression experiments. Given the accelerating increase in availability of tens of thousands of unverified clones, there is a strong demand for rapid, efficient and accurate software that automates clone validation. Results We have developed an Automated Clone Evaluation (ACE system – the first comprehensive, multi-platform, web-based plasmid sequence verification software package. ACE automates the clone verification process by defining each clone sequence as a list of multidimensional discrepancy objects, each describing a difference between the clone and its expected sequence including the resulting polypeptide consequences. To evaluate clones automatically, this list can be compared against user acceptance criteria that specify the allowable number of discrepancies of each type. This strategy allows users to re-evaluate the same set of clones against different acceptance criteria as needed for use in other experiments. ACE manages the entire sequence validation process including contig management, identifying and annotating discrepancies, determining if discrepancies correspond to polymorphisms and clone finishing. Designed to manage thousands of clones simultaneously, ACE maintains a relational database to store information about clones at various completion stages, project processing parameters and acceptance criteria. In a direct comparison, the automated analysis by ACE took less time and was more accurate than a manual analysis of a 93 gene clone set. Conclusion ACE was designed to facilitate high throughput clone sequence

  7. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.

    Science.gov (United States)

    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V

    1988-10-01

    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  8. Complete Nucleotide Sequence of a South African Isolate of Grapevine Fanleaf Virus and Its Associated Satellite RNA

    Directory of Open Access Journals (Sweden)

    Johan T. Burger

    2013-07-01

    Full Text Available The complete sequences of RNA1, RNA2 and satellite RNA have been determined for a South African isolate of Grapevine fanleaf virus (GFLV-SACH44. The two RNAs of GFLV-SACH44 are 7,341 nucleotides (nt and 3,816 nt in length, respectively, and its satellite RNA (satRNA is 1,104 nt in length, all excluding the poly(A tail. Multiple sequence alignment of these sequences showed that GFLV-SACH44 RNA1 and RNA2 were the closest to the South African isolate, GFLV-SAPCS3 (98.2% and 98.6% nt identity, respectively, followed by the French isolate, GFLV-F13 (87.3% and 90.1% nt identity, respectively. Interestingly, the GFLV-SACH44 satRNA is more similar to three Arabis mosaic virus satRNAs (85%–87.4% nt identity than to the satRNA of GFLV-F13 (81.8% nt identity and was most distantly related to the satRNA of GFLV-R2 (71.0% nt identity. Full-length infectious clones of GFLV-SACH44 satRNA were constructed. The infectivity of the clones was tested with three nepovirus isolates, GFLV-NW, Arabis mosaic virus (ArMV-NW and GFLV-SAPCS3. The clones were mechanically inoculated in Chenopodium quinoa and were infectious when co-inoculated with the two GFLV helper viruses, but not when co-inoculated with ArMV-NW.

  9. Molecular cloning and sequence analysis of prion protein gene in Xiji donkey in China.

    Science.gov (United States)

    Zhang, Zhuming; Wang, Renli; Xu, Lihua; Yuan, Fangzhong; Zhou, Xiangmei; Yang, Lifeng; Yin, Xiaomin; Xu, Binrui; Zhao, Deming

    2013-10-25

    Prion diseases are a group of human and animal neurodegenerative disorders caused by the deposition of an abnormal isoform prion protein (PrP(Sc)) encoded by a single copy prion protein gene (PRNP). Prion disease has been reported in many herbivores but not in Equus and the species barrier might be playing a role in resistance of these species to the disease. Therefore, analysis of genotype of prion protein (PrP) in these species may help understand the transmission of the disease. Xiji donkey is a rare species of Equus not widely reared in Ningxia, China, for service, food and medicine, but its PRNP has not been studied. Based on the reported PrP sequence in GenBank we designed primers and amplified, cloned and sequenced the PRNP of Xiji donkey. The sequence analysis showed that the Xiji donkey PRNP was consisted of an open reading frame of 768 nucleotides encoding 256 amino acids. Amino acid residues unique to donkey as compared with some Equus animals, mink, cow, sheep, human, dog, sika deer, rabbit and hamster were identified. The results showed that the amino acid sequence of Xiji donkey PrP starts with the consensus sequence MVKSH, with almost identical amino acid sequence to the PrP of other Equus species in this study. Amino acid sequence analysis showed high identity within species and close relation to the PRNP of sika deer, sheep, dog, camel, cow, mink, rabbit and hamster with 83.1-99.7% identity. The results provided the PRNP data for an additional Equus species, which should be useful to the study of the prion disease pathogenesis, resistance and cross species transmission.

  10. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence...... was found, but no single stranded intermediates, characteristic of rolling circle replication, were found on Southern blots. The larger plasmid, pBAL, was found to be a 8294 bp plasmid with a GC content of 39%. It revealed 17 ORFs, of which three showed similarity at the amino acid (aa) level to known...

  11. Molecular evolution of a family of resistance gene analogs of nucleotide-binding site sequences in Solanum lycopersicum.

    Science.gov (United States)

    Liao, Pei-Chun; Lin, Kuan-Hung; Ko, Chin-Ling; Hwang, Shih-Ying

    2011-10-01

    Nucleotide-binding site-leucine-rich repeats (NBS-LRR) gene families are one of the major plant resistance genes. Genomic NBS evolution was studied in many plant species for diverse arrays of NBS gene families. In this study, we focused on one family of NBS sequences in an attempt to understand how closely related NBS sequences evolved in the light of selection in domesticated plant species. A phylogenetic analysis revealed five major clades (A-E) and five subclades (A1-A5) within clade A of cloned NBS sequences. Positive selection was only detected in newly evolved NBS lineages in subclades of clade A. Positively selected codon sites were found among NBS sequences of clade A. A sliding-window analysis revealed that regions with Ka/Ks ratios of >1 were in the inter-motifs when paired clades were compared, but regions with Ka/Ks ratios of >1 were found across NBS sequences when subclades of clade A were compared. Our results based on a family of closely related NBS sequences showed that positive selection was first exerted on specific lineages across all NBS sequences after selective constraints. Subsequently, sequences with mutations in commonly conserved motifs were scrutinized by purifying selection. In the long term, conserved high frequency alleles in commonly conserved motifs and changes in inter-motifs were maintained in the investigated family of NBS sequences. Moreover, codons identified to be under positive selection in the inter-motifs were mainly located in regions involved in functions of ATP binding or hydrolysis.

  12. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  13. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj

    2015-12-01

    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  14. Full genome sequencing of the Newcastle disease viruses VS/GA and clone 5

    Science.gov (United States)

    The complete genome sequence of the Villegas-Glisson/University of Georgia (VG/GA) strain of Newcastle disease virus (NDV) and of a plaque purified clone (clone 5) exhibiting a different phenotype were sequenced and analyzed. The VG/GA strain, isolated from the intestine of healthy turkeys replicat...

  15. Complete Nucleotide Sequence of a Newly Avirulent Newcastle Disease Virus Hubei 92(HB92) Strain

    Institute of Scientific and Technical Information of China (English)

    Pan Zi-shu; Chen Yu-dong; Shao Hua-bin; Yang Jun; Xiong Zhong-liang; Wen Guo-yuan; Zhang Chu-yu

    2004-01-01

    A new avirulent, heat-resistance HB92 strain of newcastle Disease Virus (NDV) was acquired from Australia V4 strain. Its complete nucleotides sequence was first determined. The entire genome of NDV HB92 consists of 15 186nucleotides (GenBank accession no. AY225110 ). It was demonstrated by sequence analysis that nucleotides homology of HB92 strain with virulent strain ZJ1 were 83.9%, and the homology compared with avirulent vaccine strain La Sota and BI were 94. 0% and 93. 5%, respectively. These results might be contributive to tbe study of the molecular mechanism of evolution of the NDV strain HB92 and to develop the engineered recombinant vaccine.

  16. Complete nucleotide sequence of the new potexvirus "Alstroemeria virus X". Brief report.

    Science.gov (United States)

    Fuji, S; Shinoda, K; Ikeda, M; Furuya, H; Naito, H; Fukumoto, F

    2005-11-01

    A flexuous virus was isolated in Japan from an alstroemeria plant showing mosaic symptoms. The virus had a broad host range but had systemically latent infectivity in alstroemeria. The virus was assigned to the genus Potexvirus based on morphology and physical properties and on an analysis of the complete nucleotide sequence. The genomic RNA of the virus was 7,009 nucleotides in length, excluding the 3'-terminal poly (A) tail. It contained five open reading frames (ORFs), which was consistent with other members of the genus Potexvirus. Although nucleotide sequences of the ORFs differ from previously reported potexviruses, a phylogenetic analysis placed it phylogenetically close to Narcissus mosaic virus and Scallion virus X. Therefore, we propose that this virus should be designated as Alstroemeria virus X (AlsVX).

  17. Complete nucleotide sequence of a begomovirus and associated betasatellite infecting croton (Croton bonplandianus) in Pakistan.

    Science.gov (United States)

    Hussain, Khadim; Hussain, Mazhar; Mansoor, Shahid; Briddon, Rob W

    2011-06-01

    The complete sequences of a begomovirus and an associated betasatellite isolated from Croton bonplandianus originating from Pakistan were determined. The sequence of the begomovirus showed the highest level of nucleotide sequence identity (88.9%) to an isolate of papaya leaf curl virus and thus represents a new species, for which we propose the name Croton yellow vein virus (CYVV). The sequence of the betasatellite showed the highest levels of sequence identity (82 to 98.4%) to six sequences in the databases that have yet to be reported, followed by isolates of tomato leaf curl Joydebpur betasatellite (48.7 to 52.5%). This indicates that the betasatellite identified here (and the six sequences in the databases) is an isolate of a newly identified species for which the name Croton yellow vein mosaic betasatellite (CroYVMB) is proposed. For the begomovirus, an analysis of the sequence indicates that it has a recombinant origin.

  18. Dependence of the E.coli promoter strength and physical parameters upon the nucleotide sequence

    Institute of Scientific and Technical Information of China (English)

    BEREZHNOY Andrey Y.; SHCKORBATOV Yuriy G.

    2005-01-01

    The energy of interaction between complementary nucleotides in promoter sequences ofE. coli was calculated and visualized. The graphic method for presentation of energy properties of promoter sequences was elaborated on. Data obtained indicated that energy distribution through the length of promoter sequence results in picture with minima at -35, -8 and +7 regions corresponding to areas with elevated AT (adenine-thymine) content. The most important difference from the random sequences area is related to -8. Four promoter groups and their energy properties were revealed. The promoters with minimal and maximal energy of interaction between complementary nucleotides have low strengths, the strongest promoters correspond to promoter clusters characterized by intermediate energy values.

  19. The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

    Science.gov (United States)

    Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

    2017-07-05

    The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

  20. [CHL15--a new gene controlling the replication of chromosomes in saccharomycetes yeast: cloning, physical mapping, sequencing, and sequence analysis].

    Science.gov (United States)

    Kuprina, N Iu; Krol', E S; Koriabin, M Iu; Shestopalov, B V; Bliskovskiĭ, V V; Bannikov, V M; Gizatullin, R Z; Kirillov, A V; Kravtsov, V Iu; Zakhar'ev, V M

    1993-01-01

    We have analyzed the CHL15 gene, earlier identified in a screen for yeast mutants with increased loss of chromosome III and artificial circular and linear chromosomes in mitosis. Mutations in the CHL15 gene lead to a 100-fold increase in the rate of chromosome III loss per cell division and a 200-fold increase in the rate of marker homozygosis on this chromosome by mitotic recombination. Analysis of segregation of artificial circular minichromosome and artificially generated nonessential marker chromosome fragment indicated that sister chromatid loss (1:0 segregation) is a main reason of chromosome destabilization in the chl15-1 mutant. A genomic clone of CHL15 was isolated and used to map its physical position on chromosome XVI. Nucleotide sequence analysis of CHL15 revealed a 2.8-kb open reading frame with a 105-kD predicted protein sequence. At the N-terminal region of the protein sequences potentially able to form DNA-binding domains defined as zinc-fingers were found. The C-terminal region of the predicted protein displayed a similarity to sequence of regulatory proteins known as the helix-loop-helix (HLH) proteins. Data on partial deletion analysis suggest that the HLH domain is essential for the function of the CHL15 gene product. Analysis of the upstream untranslated region of CHL15 revealed the presence of the hexamer element, ACGCGT (an MluI restriction site) controlling both the periodic expression and coordinate regulation of the DNA synthesis genes in budding yeast. Deletion in the RAD52 gene, the product of which is involved in double-strand break/recombination repair and replication, leads to a considerable decrease in the growth rate of the chl15 mutant. We suggest that CHL15 is a new DNA synthesis gene in the yeast Saccharomyces cerevisiae.

  1. FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    Directory of Open Access Journals (Sweden)

    Lu Jia

    2011-10-01

    Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

  2. Nucleotide sequence and genomic organization of an ophiovirus associated with lettuce big-vein disease

    NARCIS (Netherlands)

    Wilk, van der F.; Dullemans, A.M.; Verbeek, M.; Heuvel, van den J.F.J.M.

    2002-01-01

    The complete nucleotide sequence of an ophiovirus associated with lettuce big-vein disease has been elucidated. The genome consisted of four RNA molecules of approximately 7ò8, 1ò7, 1ò5 and 1ò4 kb. Virus particles were shown to contain nearly equimolar amounts of RNA molecules of both polarities.

  3. Nucleotide sequence and genomic organization of an ophiovirus associated with lettuce big-vein disease

    NARCIS (Netherlands)

    Wilk, van der F.; Dullemans, A.M.; Verbeek, M.; Heuvel, van den J.F.J.M.

    2002-01-01

    The complete nucleotide sequence of an ophiovirus associated with lettuce big-vein disease has been elucidated. The genome consisted of four RNA molecules of approximately 7ò8, 1ò7, 1ò5 and 1ò4 kb. Virus particles were shown to contain nearly equimolar amounts of RNA molecules of both polarities. Th

  4. Complete Nucleotide Sequence of a Citrobacter freundii Plasmid Carrying KPC-2 in a Unique Genetic Environment

    Science.gov (United States)

    Yao, Yancheng; Imirzalioglu, Can; Hain, Torsten; Kaase, Martin; Gatermann, Soeren; Exner, Martin; Mielke, Martin; Hauri, Anja; Dragneva, Yolanta; Bill, Rita; Wendt, Constanze; Wirtz, Angela; Chakraborty, Trinad

    2014-01-01

    The complete and annotated nucleotide sequence of a 54,036-bp plasmid harboring a blaKPC-2 gene that is clonally present in Citrobacter isolates from different species is presented. The plasmid belongs to incompatibility group N (IncN) and harbors the class A carbapenemase KPC-2 in a unique genetic environment. PMID:25395635

  5. Nucleotide sequence analysis of the lactococcal EPS plasmid pNZ4000

    NARCIS (Netherlands)

    Kranenburg, van R.; Kleerebezem, M.; Vos, de W.M.

    2000-01-01

    The complete 42180-bp nucleotide sequence of the mobilization plasmid pNZ4000, coding for exopolysaccharide (EPS) production in Lactococcus lactis, was determined. This plasmid contains a region involved in EPS biosynthesis, four functional replicons, a region containing mobilization genes, and thre

  6. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    OpenAIRE

    Chen, Chunxian; Gmitter Jr, Fred G

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for...

  7. Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)

    Energy Technology Data Exchange (ETDEWEB)

    Kawagoe, Hiroyuki; Soma, Osamu; Goji, Junko [Kobe Univ. School of Medicine (Japan)] [and others

    1995-11-20

    Phosphodiesterase I/nucleotide pyrophosphatase is a widely expressed membrane-bound enzyme that cleaves diester bonds of a variety of substrates. We have cloned brain-type cDNA for this enzyme from rat brain and designated it PD-I{alpha}. In this study we have isolated cDNA and genomic DNA encoding human PD-I{alpha}. Human PD-I{alpha} cDNA, designated PDNP2 in HGMW nomenclature, has a 2589-nucleotide open reading frame encoding a polypeptide of 863 amino acids with a calculated M{sub r} of 99,034. Northern blot analysis revealed that human PD-I{alpha} transcript was present in brain, lung, placenta, and kidney. The database analysis showed that human PD-I{alpha} was identical with human autotaxin (ATX), a novel tumor motility-stimulating factor, except that human PD-I{alpha} lacks 156 nucleotides and 52 amino acids of human ATX. Human PD-I{alpha} and human ATX are likely to be alternative splicing products from the same gene. The 5{prime} region of the human PDNP2 gene contains four putative binding sites of transcription factor Sp1 without typical TATA or CAAT boxes, and there is a potential octamer binding motif in intron 2. From the results of fluorescence in situ hybridization, the human PDNP2 gene is located at chromosome 8q24.1. 17 refs., 3 figs.

  8. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  9. Cloning and Sequence Analysis of Genome from the Inner Mongolia Strain of the Endogenous Betaretroviruses (enJSRV)

    Institute of Scientific and Technical Information of China (English)

    Yu WANG; Shu-ying LIU; Jian-yun LI; Min HAN; Zhen-ling WANG

    2008-01-01

    In order to amplify the complete genome of enJSRV from the strain of Inner Mongolia (enJSRV-NM), we used enJSRV-specific and JSRV-specific DNA probes in dot blot hybridization. Seven pairs of primers were designed based on Genbank sequences. Seven fragments were obtained by PCR and were cloned into the PMD19- T vectors. The recombinant plasmids were sequenced and analyzed. The results showed that the genome was 7 942 bp in length and contained four overlapping open reading frames corresponding to the gag, pro, pol and env genes as well as an additional open reading frame (orf-x) that overlaps the 3' end of the pol gene. The nucleotide acid sequences of the enJSRV-NM loci were compared with the sequences of South Africa enJS56A1 strain (Accession No. AF153615) and USA JSRV21 strain (Accession No. AF105220). The nucleotide acid identities were 99.2% and 92.3% respectively. Two zinc fingers were found in the NC region in the predicted amino acid sequence. However, the YXXM motif, which is a reliable molecular marker for the infectious exogenous virus, was not found in the TM region. It was found that the enJSRV-NM region was 90%-98% identical at the amino acid level to its exogenous infectious counterparts in most of the retroviral genome. This is the first nucleotide sequence of enJSRV reported in P.R China. The resource work has provided a wide range of information useful not only for expression genomics and annotation of genomic DNA sequence, but also for further research on the clinical diagnosis of OPA.

  10. A first generation physical map of the medaka genome in BACs essential for positional cloning and clone-by-clone based genomic sequencing.

    Science.gov (United States)

    Khorasani, Maryam Zadeh; Hennig, Steffen; Imre, Gabriele; Asakawa, Shuichi; Palczewski, Stefanie; Berger, Anja; Hori, Hiroshi; Naruse, Kiyoshi; Mitani, Hiroshi; Shima, Akihiro; Lehrach, Hans; Wittbrodt, Jochen; Kondoh, Hisato; Shimizu, Nobuyoshi; Himmelbauer, Heinz

    2004-07-01

    In order to realize the full potential of the medaka as a model system for developmental biology and genetics, characterized genomic resources need to be established, culminating in the sequence of the medaka genome. To facilitate the map-based cloning of genes underlying induced mutations and to provide templates for clone-based genomic sequencing, we have created a first-generation physical map of the medaka genome in bacterial artificial chromosome (BAC) clones. In particular, we exploited the synteny to the closely related genome of the pufferfish, Takifugu rubripes, by marker content mapping. As a first step, we clustered 103,144 public medaka EST sequences to obtain a set of 21,121 non-redundant sequence entities. Avoiding oversampling of gene-dense regions, 11,254 of EST clusters were successfully matched against the draft sequence of the fugu genome, and 2363 genes were selected for the BAC map project. We designed 35mer oligonucleotide probes from the selected genes and hybridized them against 64,500 BAC clones of strains Cab and Hd-rR, representing 14-fold coverage of the medaka genome. Our data set is further supplemented with 437 results generated from PCR-amplified inserts of medaka cDNA clones and BAC end-fragment markers. Our current, edited, first generation medaka BAC map consists of 902 map segments that cover about 74% of the medaka genome. The map contains 2721 markers. Of these, 2534 are from expressed sequences, equivalent to a non-redundant set of 2328 loci. The 934 markers (724 different) are anchored to the medaka genetic map. Thus, genetic map assignments provide immediate access to underlying clones and contigs, simplifying molecular access to candidate gene regions and their characterization.

  11. Nucleotide sequence of maize dwarf mosaic virus capsid protein gene and its expression in Escherichia coli

    Institute of Scientific and Technical Information of China (English)

    赛吉庆; 康良仪; 黄忠; 史春霖; 田波; 谢友菊

    1995-01-01

    The 3’-terminal 1 279 nucleotide sequence of maize dwarf mosaic virus (MDMV) genome has been determined. This sequence contains an open reading frame of 1023 nudeotides and a 3’ -non-coding region of 256 nucleotides. The open reading frame includes all of the coding regions for the viral capsid protein (CP) and part of the viral nuclear inclusion protein (Nib). The predicted viral CP consists of 313 amino acid residues with a calculated molecular weight of 35400. The amino acid sequence of the viral CP derived from MDMV cDNA shows about 47%-54% homology to that of 4 other potyviruses. The viral CP gene was constructed in frame with the lacZ gene in pUC19 plasmid and expressed in E. coli cells. The fusion polypeptide positively reacted in Western blot with an antiserum prepared against the native viral CP.

  12. Nucleotide sequencing and serologic analysis of Cache Valley virus isolates from the Yucatan Peninsula of Mexico.

    Science.gov (United States)

    Blitvich, Bradley J; Loroño-Pino, Maria A; Garcia-Rejon, Julian E; Farfan-Ale, Jose A; Dorman, Karin S

    2012-08-01

    Nucleotide sequencing was performed on part of the medium and large genome segments of 17 Cache Valley virus (CVV) isolates from the Yucatan Peninsula of Mexico. Alignment of these sequences to all other sequences in the Genbank database revealed that they have greatest nucleotide identity (97-98 %) with the equivalent regions of Tlacotalpan virus (TLAV), which is considered to be a variety of CVV. Next, cross-plaque reduction neutralization tests (PRNTs) were performed using sera from mice that had been inoculated with a representative isolate from the Yucatan Peninsula (CVV-478) or the prototype TLAV isolate (61-D-240). The PRNT titers exhibited a twofold difference in one direction and no difference in the other direction suggesting that CVV-478 and 61-D-240 belong to the same CVV subtype. In conclusion, we demonstrate that the CVV isolates from the Yucatan Peninsula of Mexico are genetically and antigenically similar to the prototype TLAV isolate.

  13. Complete nucleotide sequence analysis of Cymbidium mosaic virus Indian isolate: further evidence for natural recombination among potexviruses

    Indian Academy of Sciences (India)

    Ang Rinzing Sherpa; Vipin Hallan; Promila Pathak; Aijaz Asghar Zaidi

    2007-06-01

    The complete nucleotide sequence of an Indian strain of Cymbidium mosaic virus (CymMV) was determined and compared with other potexviruses. Phylogenetic analyses on the basis of RNA-dependent RNA polymerase (RdRp), triple gene block protein and coat protein (CP) amino acid sequences revealed that CymMV is closely related to the Narcissus mosaic virus (NMV), Scallion virus X (SVX), Pepino mosaic virus (PepMV) and Potato aucuba mosaic virus (PAMV). Different sets of primers were used for the amplification of different regions of the genome through RT-PCR and the amplified genes were cloned in a suitable vector. The full genome of the Indian isolate of CymMV from Phaius tankervilliae shares 96–97% similarity with isolates reported from other countries. It was found that the CP gene of CymMV shares a high similarity with each other and other potexviruses. One of the Indian isolates seems to be a recombinant formed by the intermolecular recombination of two other CymMV isolates. The phylogenetic analyses, Recombination Detection Program (RDP2) analyses and sequence alignment survey provided evidence for the occurrence of a recombination between an Indian isolate (AM055720) as the major parent, and a Korean type-2 isolate (AF016914) as the minor parent. Recombination was also observed between a Singapore isolate (U62963) as the major parent, and a Taiwan CymMV (AY571289) as the minor parent.

  14. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    Science.gov (United States)

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  15. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    Science.gov (United States)

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  16. Nucleotide sequences of chloroplast 5S ribosomal RNA from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata.

    OpenAIRE

    Yamano, Y; Ohyama, K; Komano, T

    1984-01-01

    The nucleotide sequences of chloroplast 5S rRNAs from cell suspension cultures of the liverworts Marchantia polymorpha and Jungermannia subulata were determined. Their nucleotide sequences, 119 nucleotides long, were highly homologous to each other (96% identity) and had high homology with those from chloroplast 5S rRNAs of two higher plants, tobacco (92% identity) and spinach (92-91% identity), but less homology (87-85% identity) with that from a lower plant, the fern Dryopteris acuminata.

  17. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    Science.gov (United States)

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  18. Nucleotide sequence evidence for the occurrence of three distinct whitefly-transmitted, Sida-infecting bipartite geminiviruses in Central America.

    Science.gov (United States)

    Frischmuth, T; Engel, M; Lauster, S; Jeske, H

    1997-10-01

    The nucleotide sequences of two Sida-infecting geminiviruses from Honduras were determined. The symptoms of both viruses are identical in Sida rhombifolia but different in Nicotiana benthamiana. An additional symptom of one virus was yellow vein clearing on infected N. benthamiana leaves. Both Sida golden mosaic viruses (SiGMV-Ho and SiGMV-Ho(yv)) have bipartite genomes (DNAs A and B). From the SiGMV-Ho(yv)-infected S. rhombifolia plant two different DNA B molecules were isolated and cloned. They differ in length by 24 nucleotides [SiGMV-Ho(yv) B1 (2593 nt) and B2 (2569 nt)] and at eight nucleotide positions. Both proteins encoded by DNA B (BV1 and BC1) are affected by these substitutions. Computer analysis shows that the bipartite genomes resemble those of other whitefly-transmitted geminiviruses. From homology analyses we conclude that both viruses are closely related but distinct. Comparison with a Sida-infecting virus from Costa Rica (SiGMV-Co) showed that the two viruses from Honduras are more similar to each other than either of them are to SiGMV-Co. Exchange of SiGMV-Ho and SiGMV-Ho(yv) genomic components resulted in viable pseudorecombinant viruses. SiGMV-Ho DNA A was able to produce a viable pseudorecombinant with SiGMV-Co DNA B while the reciprocal exchange was not infectious in N. benthamiana. SiGMV-Ho(yv) DNA A and SiGMV-Co DNA B produced a viable pseudorecombinant virus whereas only pseudorecombination of SiGMV-Co DNA A with SiGMV-Ho(yv) DNA B2, and not with DNA B1, was infectious in N. benthamiana.

  19. Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers

    Energy Technology Data Exchange (ETDEWEB)

    Kandpal, R.P.; Kandpal, G.; Weissman, S.M. (Yale Univ. School of Medicine, New Haven, CT (United States))

    1994-01-04

    The authors describe a simple and rapid method for constructing small-insert genomic libraries highly enriched for dimeric, trimeric, and tetrameric nucleotide repeat motifs. The approach involves use of DNA inserts recovered by PCR amplification of a small-insert sonicated genomic phage library or by a single-primer PCR amplification of Mbo I-digested and adaptor-ligated genomic DNA. The genomic DNA inserts are heat denatured and hybridized to a biotinylated oligonucleotde. The biotinylated hybrids are retained on a Vectrex-avidin matrix and eluted specifically. The eluate is PCR amplified and cloned. More than 90% of the clones in a library enriched for (CA)[sub n] microsatellites with this approach contained clones with inserts containing CA repeats. They have also used this protocol for enrichment of (CAG)[sub n] and (AGAT)[sub n] sequence repeats and for Not I jumping clones. They have used the enriched libraries with an adaptation of the cDNA selection method to enrich for repeat motifs encoded in yeast artificial chromosomes.

  20. Complete nucleotide sequence of wound tumor virus genomic segments encoding nonstructural polypeptides.

    Science.gov (United States)

    Anzola, J V; Dall, D J; Xu, Z K; Nuss, D L

    1989-07-01

    Sequence analysis of the genomic segments which encode the five wound tumor virus nonstructural polypeptides has been completed. The complete nucleotide sequence of segments S4 (2565 bp), S6 (1700 bp), S9 (1182 bp), and S10 (1172 bp) are presented in this report while the sequence of segment S12 (851 bp) has been described previously (T. Asamizu, D. Summers, M. B. Motika, J. V. Anzola, and D. L. Nuss, 1985, Virology 144, 398-409). Comparison of the only published sequence for another member of the genus Phytoreovirus, that of rice dwarf virus segment S10, with the combined available wound tumor virus sequence data revealed similarity with WTV segment S10: 54.9 and 30.6% at the nucleotide and amino acid level, respectively. Although wound tumor virus and rice dwarf virus differ in plant host range, tissue specificity, vector range, and disease symptom expression, the level of sequence similarity shared by the two segments suggests a common origin for these viruses. The potential use of a phytoreovirus sequence database for predicting functions of viral encoded gene products is considered.

  1. PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

    Science.gov (United States)

    Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

    2017-06-01

    Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

  2. Cloning and sequencing of hfq (host factor required for synthesis of bacteriophage Q beta RNA gene of Salmonella Typhimurium isolated from poultry

    Directory of Open Access Journals (Sweden)

    Parthasarathi Behera

    2015-05-01

    Full Text Available Aim: The aim was to clone and sequence hfq gene of Salmonella Typhimurium strain PM-45 and compare its sequence with hfq gene of other serovar of Salmonella. Materials and Methods: Salmonella Typhimurium strain PM-45 was procured from the G. B. Pant University of Agriculture and Technology, Pantnagar, India. The genomic DNA was isolated from Salmonella Typhimurium. Hfq gene was polymerase chain reaction (PCR amplified from the DNA using specific primers, which was subsequently cloned into pET32a vector and transformed into Escherichia coli BL21 pLys cells. The recombinant plasmid was isolated and subjected to restriction enzyme digestion as well as PCR. The clone was then sequenced. The sequence was analyzed and submitted in GenBank. Results: PCR produced an amplicon of 309 bp. Restriction digestion of the recombinant plasmid released the desired insert. The hfq sequence shows 100% homology with similar sequences from other Salmonella Typhimurium isolates. Both nucleotide and amino acid sequences are highly conserved. The submitted sequence is having Genbank accession no KM998764. Conclusion: Hfq, the hexameric RNA binding protein is one of the most important post-transcriptional regulator of bacteria. The sequence of hfq gene of Salmonella Typhimurium is highly conserved within and between Salmonella enterica serovars. This gene sequence is probably under heavy selection pressure to maintain the conformational integrity of its product in spite of its being not a survival gene.

  3. Nucleotide sequence of the aacC2 gene, a gentamicin resistance determinant involved in a hospital epidemic of multiply resistant members of the family Enterobacteriaceae.

    OpenAIRE

    Vliegenthart, J S; Ketelaar-van Gaalen, P A; Van de Klundert, J A

    1989-01-01

    A gentamicin resistance determinant of a conjugative plasmid from Enterobacter cloacae was cloned on a 3.2-kilobase fragment in the PstI site of pBR322. Substrate profiles for eight aminoglycosides at three concentrations showed that the resistance was due to aminoglycoside-(3)-N-acetyltransferase isoenzyme II. Insertion mapping by the gamma-delta transposon revealed that the size of the gene was approximately 1 kilobase. Nucleotide sequencing of the aacC2 gene identified an open reading fram...

  4. Cloning and sequence analysis of genetic variation on NS2-3 of bovine viral diarrhea virus (HB-DCZ) strain in Hebei Province, China

    Institute of Scientific and Technical Information of China (English)

    ZHAO Yuelan; QIN Jianhua; GUO Hongbin; ZUO Yuzhu; ZHANG Baoning; ZHANG Lei

    2007-01-01

    The objective of this research is to analyze the genetic characterization of a bovine viral diarrhea virus (BVDV) strain (HB-DCZ strain) isolated from China and describe its relationship with other BVDV strains.Special primers (forward:5'- gagatctcgggaggtac -3',reverse:5'-cctctcggcatgatcccgaaa -3) are used to amplify partial NS2-3 sequence of HB-DCZ strain by reverse transcription polymerase chain reaction (RT-PCR).The product of PCR is cloned into pMD18-T vector,and then transfected into JM109.The recombinant plasmids are extracted and identified by EcoR Ⅰand Hind Ⅲ enzyme digestion.The NS 2-3 nucleotide fragment of the isolated virus is sequenced,and then amino acid sequence is deduced.Nucleotide sequence and deduced amino acid sequence of the strain are analyzed and compared with other BVDV strains from Genebank with the aid of DNAstar software.The results show that the obtained fragment of HB-DCZ strain contains 665 bp nucleotides,which indicate that there is no insertion in the isolated virus genome.The homologies of nucleotide sequences show that HB-DCZ strain has 99.1%,97.4%,92.3%,77%,76.9%,76.4% and 76.2%,sequence similarity with 184,ZM195,Osloss,Oregon C24V,Singer,NADL,and S D-I,respectively.According to the nucleotide sequences of the obtained fragments,the 208 corresponding amino acids are deduced.The homologies of amino acid sequences show that HB-DCZ strain had 100%,93.3%,91.3% and 83.2% sequence similarity with VEDEVAC,Osloss,ILLC and Oregon C24V,respectively.In conclusion,HB-DCZ strain has no exogenous sequence insertion,no gene recombination,no gene rearrangement and no gene deficiency.HB-DCZ strain is closely related to BVDV Osloss strain,and belongs to subtype Ib.

  5. DNA Amplification and Nucleotide Sequence Determination of a Region of Mitochondrial DNA in the Sea Snake, Laticauda Semifasciata

    OpenAIRE

    Eguchi, Tomoko; Eguchi, Yukinori; Oshiro, Minoru; Asato, Tsuyoshi; Takei, Hiroshi; Nakashima, Yasutsugu

    1993-01-01

    We determined the nucleotide sequence of a region of the 12S ribosomal RNA (rRNA) gene in the mitochondrial DNA (mtDNA) of the sea snake, Laticauda semifasciata, using the polymerase chain reaction (PCR). We synthesized oligonucleotide primers according to the nucleotide sequence of human mt DNA 12S rRNA gene and found that the target sequence (386bp) of the sea snake mtDNA could be amplified with these primers. The nucleotide sequence of the amplified region of the sea snake mt DNA was deter...

  6. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  7. Cloning and sequence analysis of US1 gene in duck enteritis virus%Cloning and sequence analysis of US1gene in duck enteritis virus

    Institute of Scientific and Technical Information of China (English)

    ZHAO Yan; WANG Jun-wei; MA Bo; ZHAO Xiao-yan

    2011-01-01

    In this paper, a 1,860 bp sequence in IRs region of duck enteritis virus(DEV)was amplified by single oligonucleotide nested PCR with a single primer designed according to partial sequence of USI and then a pair of primers designed according to the 3' UTR of US8 gene and 5'end of the new getting sequence were used to amplify a 2,426 bp sequence toward the TRs region.Sequence analysis revealed that the both sequences contained an identical 990 bp open reading frame of DEV US1 gene.The two ORFs were in opposite transcription orientation.Sequence comparison of the nucleotide sequence and the deduced amino acid sequence of US1 gene showed relatively high identity to Mardivirus.Phylogenetic tree analysis showed that the eleven herpesviruses viruses were classified into three groups, and the duck enteritis virus was most closely related to Mardivirus.

  8. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Indian Academy of Sciences (India)

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  9. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Science.gov (United States)

    Li, Meng-Jun; Li, Ai-Qin; Xia, Han; Zhao, Chuan-Zhi; Li, Chang-Sheng; Wan, Shu-Bo; Bi, Yu-Ping; Wang, Xing-Jun

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, beta-ketoacyl-ACP synthase (I, II, III), beta-ketoacyl-ACP reductase, beta-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  10. Complete nucleotide sequence and host range of South African cassava mosaic virus: further evidence for recombination amongst begomoviruses.

    Science.gov (United States)

    Berrie, L C; Rybicki, E P; Rey, M E

    2001-01-01

    Complete nucleotide sequences of the DNA-A (2800 nt) and DNA-B (2760 nt) components of a novel cassava-infecting begomovirus, South African cassava mosaic virus (SACMV), were determined and compared with various New World and Old World begomoviruses. SACMV is most closely related to East African cassava mosaic virus (EACMV) in both its DNA-A (85% with EACMV-MH and -MK) and -B (90% with EACMV-UG2-Mld and EACMV-UG3-Svr) components; however, percentage sequence similarities of less than 90% in the DNA-A component allowed SACMV to be considered a distinct virus. One significant recombination event spanning the entire AC4 open reading frame was identified; however, there was no evidence of recombination in the DNA-B component. Infectivity of the cloned SACMV genome was demonstrated by successful agroinoculation of cassava and three other plant species (Phaseolus vulgaris, Malva parviflora and Nicotiana benthamiana). This is the first description of successful infection of cassava with a geminivirus using Agrobacterium tumefaciens.

  11. Cloning and characterization of genomic DNA sequences of four self-incompatibility alleles in sweet cherry ( Prunus avium L.).

    Science.gov (United States)

    Wünsch, A; Hormaza, J I

    2004-01-01

    Gametophytic self-incompatibility (GSI) in sweet cherry is determined by a locus S with multiple alleles. In the style, the S-locus codifies for an allele-specific ribonuclease ( S-RNase) that is involved in the rejection of pollen that carries the same S allele. In this work we report the cloning and genomic DNA sequence analysis including the 5' flanking regions of four S-RNases of sweet cherry ( Prunus avium L., Rosaceae). DNA from the cultivars Ferrovia, Pico Colorado, Taleguera Brillante and Vittoria was amplified through PCR using primers designed in the conserved sequences of sweet cherry S-RNases. Two alleles were amplified for each cultivar and three of them correspond to three new S-alleles named S23, S24 and S25 present in 'Pico Colorado', 'Vittoria' and 'Taleguera Brillante' respectively. To confirm the identity of the amplified fragments, the genomic DNA of these three putative S-RNases and the allele S12 amplified in the cultivar Ferrovia were cloned and sequenced. The nucleotide and deduced amino-acid sequences obtained contained the structural features of rosaceous S-RNases. The isolation of the 5'-flanking sequences of these four S-RNases revealed a conserved putative TATA box and high similarity among them downstream from that sequence. However, similarity was low compared with the 5'-flanking regions of S-RNases from the Maloideae. S6- and S24-RNase sequences are highly similar, and most amino-acid substitutions among these two RNases occur outside the rosaceous hypervariable region (RHV), but within another highly variable region. The confirmation of the different specificity of these two S-RNases would help elucidate which regions of the S-RNase sequences play a role in S-pollen specific recognition.

  12. Mouse Mammary Tumor Virus-Like Nucleotide Sequences in Canine and Feline Mammary Tumors▿

    OpenAIRE

    Hsu, Wei-Li; Lin, Hsing-Yi; Chiou, Shyan-Song; Chang, Chao-Chin; Wang, Szu-Pong; Lin, Kuan-Hsun; Chulakasian, Songkhla; Wong, Min-Liang; Chang, Shih-Chieh

    2010-01-01

    Mouse mammary tumor virus (MMTV) has been speculated to be involved in human breast cancer. Companion animals, dogs, and cats with intimate human contacts may contribute to the transmission of MMTV between mouse and human. The aim of this study was to detect MMTV-like nucleotide sequences in canine and feline mammary tumors by nested PCR. Results showed that the presence of MMTV-like env and LTR sequences in canine malignant mammary tumors was 3.49% (3/86) and 18.60% (16/86), respectively. Fo...

  13. A 2-D graphical representation of protein sequences based on nucleotide triplet codons

    Science.gov (United States)

    Bai, Fenglan; Wang, Tianming

    2005-09-01

    Graphical representation of DNA provides a simple way of viewing, sorting and comparing various gene structures. A 2-D graphical representation of protein sequences based on nucleotide triplet codons has been derived for similarity analysis of protein sequences. This approach is based on a graphical representation of triplets of DNA in which the interior of the left half plane of the complex plane is used to accommodate 64 sites for the 64 codons. We associate a directed curve, numerical value, or matrix with a protein as a descriptor. The approach is illustrated on the Homo sapiens X-linked nuclear protein (ATRX) gene.

  14. SinicView: A visualization environment for comparisons of multiple nucleotide sequence alignment tools

    Directory of Open Access Journals (Sweden)

    Wong Chun-Yi

    2006-03-01

    Full Text Available Abstract Background Deluged by the rate and complexity of completed genomic sequences, the need to align longer sequences becomes more urgent, and many more tools have thus been developed. In the initial stage of genomic sequence analysis, a biologist is usually faced with the questions of how to choose the best tool to align sequences of interest and how to analyze and visualize the alignment results, and then with the question of whether poorly aligned regions produced by the tool are indeed not homologous or are just results due to inappropriate alignment tools or scoring systems used. Although several systematic evaluations of multiple sequence alignment (MSA programs have been proposed, they may not provide a standard-bearer for most biologists because those poorly aligned regions in these evaluations are never discussed. Thus, a tool that allows cross comparison of the alignment results obtained by different tools simultaneously could help a biologist evaluate their correctness and accuracy. Results In this paper, we present a versatile alignment visualization system, called SinicView, (for Sequence-aligning INnovative and Interactive Comparison VIEWer, which allows the user to efficiently compare and evaluate assorted nucleotide alignment results obtained by different tools. SinicView calculates similarity of the alignment outputs under a fixed window using the sum-of-pairs method and provides scoring profiles of each set of aligned sequences. The user can visually compare alignment results either in graphic scoring profiles or in plain text format of the aligned nucleotides along with the annotations information. We illustrate the capabilities of our visualization system by comparing alignment results obtained by MLAGAN, MAVID, and MULTIZ, respectively. Conclusion With SinicView, users can use their own data sequences to compare various alignment tools or scoring systems and select the most suitable one to perform alignment in the

  15. Characterization of Porcine Endogenous Retrovirus γ pro-pol Nucleotide Sequences

    OpenAIRE

    Klymiuk, Nikolai; Müller, Mathias; Brem, Gottfried; Aigner, Bernhard

    2002-01-01

    Endogenous retroviral sequences in the pig genome (PERV) represent a potential infectious risk in xenotransplantation. All known infectious PERV have been asssigned to the PERV γ1 family, consisting of the subfamilies A, B, and C. The aim of the study was the concise examination of PERV γ by the analysis of the retroviral pro-pol sequences. The analysis of 52 pro-pol clones amplified in this study revealed eight PERV γ families. In addition to four already-described families (γ1, γ4, γ5, γ6),...

  16. The analysis of cytochrome b nucleotidic sequence for Carassius gibelio (Bloch, 1782

    Directory of Open Access Journals (Sweden)

    Lucian D. Gorgan

    2009-01-01

    Full Text Available The paper is part of a larger scale study for some genes` (Cytb, ND4L and D-loop nucleotidic structure identification by sequencing, to distinguish the structural differences and their exact length inase pairs. Research was carried out on individuals of Carassius gibelio (Bloch, 1782 (Actinopterygii,Cypriniformes from two different populations, Iezăreni and Movileni (Iaşi, from which dorsal musculartissue was sampled. Mitochondrial DNA (mtDNA isolation and purification was carried out automaticallyusing Promega’s Maxwell 16 (SEV module. Cytochrome b (cytb was multiplied by a two stage>polymerase chain reaction (PCR, using two sets of complementary primers (1 set for each fragment.Direct sequencing of PCR products revealed that the cytochrome b has one sequence of 1140bp. Theobtained sequences were subsequently compared with sequences of the same gene from otherindividuals within this species, towards identifying possible differences in the nucleotidic structure.Key Words: Carassius, cytocrhome b, mtDNA.

  17. Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

    Science.gov (United States)

    Schnare, M N; Gray, M W

    1982-01-01

    In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

  18. Remote access to ACNUC nucleotide and protein sequence databases at PBIL.

    Science.gov (United States)

    Gouy, Manolo; Delmotte, Stéphane

    2008-04-01

    The ACNUC biological sequence database system provides powerful and fast query and extraction capabilities to a variety of nucleotide and protein sequence databases. The collection of ACNUC databases served by the Pôle Bio-Informatique Lyonnais includes the EMBL, GenBank, RefSeq and UniProt nucleotide and protein sequence databases and a series of other sequence databases that support comparative genomics analyses: HOVERGEN and HOGENOM containing families of homologous protein-coding genes from vertebrate and prokaryotic genomes, respectively; Ensembl and Genome Reviews for analyses of prokaryotic and of selected eukaryotic genomes. This report describes the main features of the ACNUC system and the access to ACNUC databases from any internet-connected computer. Such access was made possible by the definition of a remote ACNUC access protocol and the implementation of Application Programming Interfaces between the C, Python and R languages and this communication protocol. Two retrieval programs for ACNUC databases, Query_win, with a graphical user interface and raa_query, with a command line interface, are also described. Altogether, these bioinformatics tools provide users with either ready-to-use means of querying remote sequence databases through a variety of selection criteria, or a simple way to endow application programs with an extensive access to these databases. Remote access to ACNUC databases is open to all and fully documented (http://pbil.univ-lyon1.fr/databases/acnuc/acnuc.html).

  19. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  20. Comparison of sequencing platforms for single nucleotide variant calls in a human sample.

    Science.gov (United States)

    Ratan, Aakrosh; Miller, Webb; Guillory, Joseph; Stinson, Jeremy; Seshagiri, Somasekar; Schuster, Stephan C

    2013-01-01

    Next-generation sequencings platforms coupled with advanced bioinformatic tools enable re-sequencing of the human genome at high-speed and large cost savings. We compare sequencing platforms from Roche/454(GS FLX), Illumina/HiSeq (HiSeq 2000), and Life Technologies/SOLiD (SOLiD 3 ECC) for their ability to identify single nucleotide substitutions in whole genome sequences from the same human sample. We report on significant GC-related bias observed in the data sequenced on Illumina and SOLiD platforms. The differences in the variant calls were investigated with regards to coverage, and sequencing error. Some of the variants called by only one or two of the platforms were experimentally tested using mass spectrometry; a method that is independent of DNA sequencing. We establish several causes why variants remained unreported, specific to each platform. We report the indel called using the three sequencing technologies and from the obtained results we conclude that sequencing human genomes with more than a single platform and multiple libraries is beneficial when high level of accuracy is required.

  1. Automated discovery of single nucleotide polymorphism and simple sequence repeat molecular genetic markers.

    Science.gov (United States)

    Batley, Jacqueline; Jewell, Erica; Edwards, David

    2007-01-01

    Molecular genetic markers represent one of the most powerful tools for the analysis of genomes. Molecular marker technology has developed rapidly over the last decade, and two forms of sequence-based markers, simple sequence repeats (SSRs), also known as microsatellites, and single nucleotide polymorphisms (SNPs), now predominate applications in modern genetic analysis. The availability of large sequence data sets permits mining for SSRs and SNPs, which may then be applied to genetic trait mapping and marker-assisted selection. Here, we describe Web-based automated methods for the discovery of these SSRs and SNPs from sequence data. SSRPrimer enables the real-time discovery of SSRs within submitted DNA sequences, with the concomitant design of PCR primers for SSR amplification. Alternatively, users may browse the SSR Taxonomy Tree to identify predetermined SSR amplification primers for any species represented within the GenBank database. SNPServer uses a redundancy-based approach to identify SNPs within DNA sequence data. Following submission of a sequence of interest, SNPServer uses BLAST to identify similar sequences, CAP3 to cluster and assemble these sequences, and then the SNP discovery software autoSNP to detect SNPs and insertion/deletion (indel) polymorphisms.

  2. Microvariation artifacts introduced by PCR and cloning of closely related 16S rRNA gene sequences

    NARCIS (Netherlands)

    Speksnijder, A.G.C.L.; Kowalchuk, G.A.; Jong, S. de; Kline, E.; Stephen, J.R.; Laanbroek, H.J.

    2001-01-01

    A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a m

  3. Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences

    NARCIS (Netherlands)

    Speksnijder, A.G.C.L.; Kowalchuk, G.A.; Jong, de S.; Kline, E.; Stephen, J.R.; Laanbroek, H.J.

    2001-01-01

    A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a m

  4. Sequence Length Limits for Controlling False Positives in Discovering Nucleotide Sequence Motifs

    Institute of Scientific and Technical Information of China (English)

    CHEN Lei; QiAN Zi-liang

    2008-01-01

    In the study of motif discovery, especially the transcription factor DNA binding sites discovery, a too long input sequence would return non-informative motifs rather than those biological functional motifs. This paper gave theoretical analyses and computational experiments to suggest the length limits of the input sequence. When the sequence length exceeds a certain critical point, the probability of discovering the motif decreases sharply. The work not only gave an explanation on the unsatisfying results of the existed motif discovery problems that the input sequence length might be too long and exceed the point, but also provided an estimation of input sequence length we should accept to get more meaningful and reliable results in motif discovery.

  5. Cloning and sequence analysis of benzo-a-pyrene- inducible ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... clone obtained was the structural gene of CYP1A which consists of seven exons and six introns, the initiation .... Total RNA was isolated from 2 gm of each of the samples of frozen ... Reverse transcriptase-assisted polymerase chain reaction. Reverse transcription of mRNA was performed with Superscript II.

  6. The complete nucleotide sequence of the egg drop syndrome virus: an intermediate between mastadenoviruses and aviadenoviruses.

    Science.gov (United States)

    Hess, M; Blöcker, H; Brandt, P

    1997-11-10

    The complete nucleotide sequence of an avian adenovirus, the egg drop syndrome (EDS) virus, was determined. The total genome length is 33,213 nucleotides, resulting in a molecular weight of 21.9 x 10(6). The GC content is only 42.5%. Between map units 3.5 and 76.9, the distribution of open reading frames with homology to known genes is similar to that reported for other mammalian and avian adenoviruses. However, no homologies to adenovirus genes such as E1A, pIX, pV, and E3 could be found. Outside this region, several open reading frames were identified without any obvious homology to known adenovirus proteins. In the region organized similarly as other adenoviral genomes, most homologies were found to an ovine adenovirus (OAV strain 287). The highest level of amino acid identity was found for the hexon proteins of EDS and OAV. The virus-associated RNA (VA RNA) was identified thanks to the homology with the VA RNA of fowl adenovirus serotype 1 (FAV1). Similarities with FAV1 were also found in the fiber protein. Our results demonstrate that the avian EDS virus represents an intermediate between mammalian and avian adenoviruses. The nucleotide sequence and genomic organization of the EDS virus reflect the heterogeneity of the aviadenovirus genus and the Adenoviridae family.

  7. Mouse mammary tumor virus-like nucleotide sequences in canine and feline mammary tumors.

    Science.gov (United States)

    Hsu, Wei-Li; Lin, Hsing-Yi; Chiou, Shyan-Song; Chang, Chao-Chin; Wang, Szu-Pong; Lin, Kuan-Hsun; Chulakasian, Songkhla; Wong, Min-Liang; Chang, Shih-Chieh

    2010-12-01

    Mouse mammary tumor virus (MMTV) has been speculated to be involved in human breast cancer. Companion animals, dogs, and cats with intimate human contacts may contribute to the transmission of MMTV between mouse and human. The aim of this study was to detect MMTV-like nucleotide sequences in canine and feline mammary tumors by nested PCR. Results showed that the presence of MMTV-like env and LTR sequences in canine malignant mammary tumors was 3.49% (3/86) and 18.60% (16/86), respectively. For feline malignant mammary tumors, the presence of both env and LTR sequences was found to be 22.22% (2/9). Nevertheless, the MMTV-like LTR and env sequences also were detected in normal mammary glands of dogs and cats. In comparisons of the MMTV-like DNA sequences of our findings to those of NIH 3T3 (MMTV-positive murine cell line) and human breast cancer cells, the sequence similarities ranged from 94 to 98%. Phylogenetic analysis revealed that intermixing among sequences identified from tissues of different hosts, i.e., mouse, dog, cat, and human, indicated the MMTV-like DNA existing in these hosts. Moreover, the env transcript was detected in 1 of the 19 MMTV-positive samples by reverse transcription-PCR. Taken together, our study provides evidence for the existence and expression of MMTV-like sequences in neoplastic and normal mammary glands of dogs and cats.

  8. Avian Retroviruses That Cause Carcinoma and Leukemia: Identification of Nucleotide Sequences Associated with Pathogenicity

    Science.gov (United States)

    Sheiness, Diana; Bister, Klaus; Moscovici, Carlo; Fanshier, Lois; Gonda, Thomas; Bishop, J. Michael

    1980-01-01

    Avian myelocytomatosis virus (MC29V) is a retrovirus that transforms both fibroblasts and macrophages in culture and induces myelocytomatosis, carcinomas, and sarcomas in birds. Previous work identified a sequence of about 1,500 nucleotides (here denoted oncMCV) that apparently derived from a normal cellular sequence and that may encode the oncogenic capacity of MC29V. In an effort to further implicate oncMCV in tumorigenesis, we used molecular hybridization to examine the distribution of nucleotide sequences related to oncMCV among the genomes of various avian retroviruses. In addition, we characterized further the genetic composition of the remainder of the MC29V genome. Our work exploited the availability of radioactive DNAs (cDNA's) complementary to oncMCV (cDNAMCV) or to specific portions of the genome of avian sarcoma virus (ASV). We showed that genomic RNAs of avian erythroblastosis virus (AEV) and avian myeloblastosis virus (AMV) could not hybridize appreciably with cDNAMCV. By contrast, cDNAMCV hybridized extensively (about 75%) and with essentially complete fidelity to the genome of Mill Hill 2 virus (MH2V), whose pathogenicity is very similar to that of MC29V, but different from that of AEV or AMV. Hybridization with the ASV cDNA's demonstrated that the MC29V genome includes about half of the ASV envelope protein gene and that the remainder of the MC29V genome is closely related to nucleotide sequences that are shared among the genomes of many avian leukosis and sarcoma viruses. We conclude that oncMCV probably specifies the unique set of pathogenicities displayed by MC29V and MH2V, whereas the oncogenic potentials of AEV and AMV are presumably encoded by a distinct nucleotide sequence unrelated to oncMCV. The genomes of ASV, MC29V, and other avian oncoviruses thus share a set of common sequences, but apparently owe their various oncogenic potentials to unrelated transforming genes. Images PMID:6245277

  9. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  10. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  11. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

    OpenAIRE

    Takaiwa, F.; Kusuda, M; SUGIURA, M.

    1982-01-01

    The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

  12. Analysis of nucleotide sequence of wheat yellow mosaic virus genomic RNAs

    Institute of Scientific and Technical Information of China (English)

    于嘉林; 晏立英; 苏宁; 侯占军; 李大伟; 韩成贵; 杨莉莉; 蔡祝南; 刘仪

    1999-01-01

    Wheat yellow mosaic virus (WYMV) isolate HC was used for viral cDNA synthesis and sequencing. The results show that the viral RNA1 is 7629 nueleotides encoding a polyprotein with 2407 amino acids, from which seven putative proteins may be produced by an autolytie cleavage processing besides the viral coat protein. The RNA2 is 3639 nueleotides and codes for a polypretein of 903 amino acids, which may contain two putative non-structural proteins. Although WYMV shares a similarity in genetic organization to wheat spindle streak mosaic virus (WSSMV), the identities in their nucleotide sequences or deduced amino acid sequences are as low as 70% and 75 % respectively. Based on this result, it is confirmed that WYMV and WSSMV are different species within Bymovirus.

  13. Nucleotide sequence of yeast GDH1 encoding nicotinamide adenine dinucleotide phosphate-dependent glutamate dehydrogenase.

    Science.gov (United States)

    Moye, W S; Amuro, N; Rao, J K; Zalkin, H

    1985-07-15

    The yeast GDH1 gene encodes NADP-dependent glutamate dehydrogenase. This gene was isolated by complementation of an Escherichia coli glutamate auxotroph. NADP-dependent glutamate dehydrogenase was overproduced 6-10-fold in Saccharomyces cerevisiae bearing GDH1 on a multicopy plasmid. The nucleotide sequence of the 1362-base pair coding region and 5' and 3' flanking sequences were determined. Transcription start sites were located by S1 nuclease mapping. Regulation of GDH1 was not maintained when the gene was present on a multicopy plasmid. Protein secondary structure predictions identified a region with potential to form the dinucleotide-binding domain. The amino acid sequences of the yeast and Neurospora crassa enzymes are 63% conserved. Unlike the N. crassa gene, yeast GDH1 has no introns.

  14. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015.

    Science.gov (United States)

    Furuse, Yuki; Okamoto, Michiko; Oshitani, Hitoshi

    2015-11-01

    Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV) is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  15. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  16. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  17. 454 sequencing of pooled BAC clones on chromosome 3H of barley

    Directory of Open Access Journals (Sweden)

    Yamaji Nami

    2011-05-01

    Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

  18. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    Energy Technology Data Exchange (ETDEWEB)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-04-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone lambdaHB''-1 from a phage lambdagt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone lambdaHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone lambdaHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the lambdaHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone lambdaHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens.

  19. PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences.

    Science.gov (United States)

    Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong; Warnow, Tandy

    2015-05-01

    We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate--slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory.

  20. Cloning, sequencing and expression of cDNA encoding growth hormone from Indian catfish (Heteropneustes fossilis)

    Indian Academy of Sciences (India)

    Vikas Anathy; Thayanithy Venugopal; Ramanathan Koteeswaran; Thavamani J Pandian; Sinnakaruppan Mathavan

    2001-09-01

    A tissue-specific cDNA library was constructed using polyA+ RNA from pituitary glands of the Indian catfish Heteropneustes fossilis (Bloch) and a cDNA clone encoding growth hormone (GH) was isolated. Using polymerase chain reaction (PCR) primers representing the conserved regions of fish GH sequences the 3′ region of catfish GH cDNA (540 bp) was cloned by random amplification of cDNA ends and the clone was used as a probe to isolate recombinant phages carrying the full-length cDNA sequence. The full-length cDNA clone is 1132 bp in length, coding for an open reading frame (ORF) of 603 bp; the reading frame encodes a putative polypeptide of 200 amino acids including the signal sequence of 22 amino acids. The 5′ and 3′ untranslated regions of the cDNA are 58 bp and 456 bp long, respectively. The predicted amino acid sequence of H. fossils GH shared 98% homology with other catfishes. Mature GH protein was efficiently expressed in bacterial and zebrafish systems using appropriate expression vectors. The successful expression of the cloned GH cDNA of catfish confirms the functional viability of the clone.

  1. Cloning, sequencing and expression of cDNA encoding growth hormone from Indian catfish (Heteropneustes fossilis)

    Indian Academy of Sciences (India)

    Vikas Anathy; Thayanithy Venugopal; Ramanathan Koteeswaran; Thavamani J Pandian; Sinnakaruppan Mathavan

    2013-03-01

    A tissue-specific cDNA library was constructed using polyA+ RNA from pituitary glands of the Indian catfish Heteropneustes fossilis (Bloch) and a cDNA clone encoding growth hormone (GH) was isolated. Using polymerase chain reaction (PCR) primers representing the conserved regions of fish GH sequences the 3′ region of catfish GH cDNA (540 bp) was cloned by random amplification of cDNA ends and the clone was used as a probe to isolate recombinant phages carrying the full-length cDNA sequence. The full-length cDNA clone is 1132 bp in length, coding for an open reading frame (ORF) of 603 bp; the reading frame encodes a putative polypeptide of 200 amino acids including the signal sequence of 22 amino acids. The 5′ and 3′ untranslated regions of the cDNA are 58 bp and 456 bp long, respectively. The predicted amino acid sequence of H. fossils GH shared 98% homology with other catfishes. Mature GH protein was efficiently expressed in bacterial and zebrafish systems using appropriate expression vectors. The successful expression of the cloned GH cDNA of catfish confirms the functional viability of the clone.

  2. Genomic DNA enrichment using sequence capture microarrays: a novel approach to discover sequence nucleotide polymorphisms (SNP in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Wayne E Clarke

    Full Text Available Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38. The main goal of this project was to combine sequence capture with next generation sequencing (NGS to discover single nucleotide polymorphisms (SNPs in specific areas of the B. napus genome historically associated (via quantitative trait loci -QTL- analysis to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively. Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species.

  3. Complete nucleotide sequence and genome organization of a Cactus virus X strain from Hylocereus undatus (Cactaceae).

    Science.gov (United States)

    Liou, M R; Chen, Y R; Liou, R F

    2004-05-01

    The complete nucleotide sequence of a strain of Cactus virus X (CVX-Hu) isolated from Hylocereus undatus (Cactaceae) has been determined. Excluding the poly(A) tail, the sequence is 6614 nucleotides in length and contains seven open reading frames (ORFs). The genome organization of CVX is similar to that of other potexviruses. ORF1 encodes the putative viral replicase with conserved methyltransferase, helicase, and polymerase motifs. Within ORF1, two other ORFs were located separately in the +2 reading frame, we call these ORF6 and ORF7. ORF2, 3, and 4, which form the "triple gene block" characteristic of the potexviruses, encode proteins with molecular mass of 25, 12, and 7 KDa, respectively. ORF5 encodes the coat protein with an estimated molecular mass of 24 KDa. Sequence analysis indicated that proteins encoded by ORF1-5 display certain degree of homology to the corresponding proteins of other potexviruses. Putative product of ORF6, however, shows no significant similarity to those of other potexviruses. Phylogenetic analyses based on the replicase (the methyltransferase, helicase, and polymerase domains) and coat protein demonstrated a closer relationship of CVX with Bamboo mosaic virus, Cassava common mosaic virus, Foxtail mosaic virus, Papaya mosaic virus, and Plantago asiatica mosaic virus.

  4. Analysis and location of a rice BAC clone containing telomeric DNA sequences

    Institute of Scientific and Technical Information of China (English)

    翟文学; 陈浩; 颜辉煌; 严长杰; 王国梁; 朱立煌

    1999-01-01

    BAC2, a rice BAC clone containing (TTTAGGG)n homologous sequences, was analyzed by Southern hybridization and DNA sequencing of its subclones. It was disclosed that there were many tandem repeated satellite DNA sequences, called TA352, as well as simple tandem repeats consisting of TTTAGGG or its variant within the BAC2 insert. A 0. 8 kb (TTTAGGG) n-containing fragment in BAC2 was mapped in the telomere regions of at least 5 pairs of rice chromosomes by using fluorescence in situ hybridization (FISH). By RFLP analysis of low copy sequences the BAC2 clone was localized in one terminal region of chromosome 6. All the results strongly suggest that the telomeric DNA sequences of rice are TTTAGGG or its variant, and the linked satellite DNA TA352 sequences belong to telomere-associated sequences.

  5. Nucleotides upstream of the Kozak sequence strongly influence gene expression in the yeast S. cerevisiae.

    Science.gov (United States)

    Li, Jing; Liang, Qiang; Song, Wenjiang; Marchisio, Mario Andrea

    2017-01-01

    In the yeast Saccharomyces cerevisiae, as in every eukaryotic organism, the mRNA 5(')-untranslated region (UTR) is important for translation initiation. However, the patterns and mechanisms that determine the efficiency with which ribozomes bind mRNA, the elongation of ribosomes through the 5(')-UTR, and the formation of a stable translation initiation complex are not clear. Genes that are highly expressed in S. cerevisiae seem to prefer a 5(')-UTR rich in adenine and poor in guanine, particularly in the Kozak sequence, which occupies roughly the first six nucleotides upstream of the START codon. We measured the fluorescence produced by 58 synthetic versions of the S. cerevisiae minimal CYC1 promoter (pCYC1min), each containing a different 5(')-UTR. First, we replaced with adenine the last 15 nucleotides of the original pCYC1min 5(')-UTR-a theoretically optimal configuration for high gene expression. Next, we carried out single and multiple point mutations on it. Protein synthesis was highly affected by both single and multiple point mutations upstream of the Kozak sequence. RNAfold simulations revealed that significant changes in the mRNA secondary structures occur by mutating more than three adenines into guanines between positions -15 and -9. Furthermore, the effect of point mutations turned out to be strongly context-dependent, indicating that adenines placed just upstream of the START codon do not per se guarantee an increase in gene expression, as previously suggested. New synthetic eukaryotic promoters, which differ for their translation initiation rate, can be built by acting on the nucleotides upstream of the Kozak sequence. Translation efficiency could, potentially, be influenced by another portion of the 5(')-UTR further upstream of the START codon. A deeper understanding of the role of the 5(')-UTR in gene expression would improve criteria for choosing and using promoters inside yeast synthetic gene circuits.

  6. Molecular cloning, sequence analysis and pharmacological properties of the porcine 5-HT(1D) receptor.

    NARCIS (Netherlands)

    P.L. Bhalla (Pankaj); H.S. Sharma (Hari); T. Wurch (Thierry); P.J. Pauwels (Petrus); P.R. Saxena (Pramod Ranjan)

    2000-01-01

    textabstractA cDNA encoding the full-length 5-HT(1D) receptor derived from porcine cerebral cortex was amplified, cloned and sequenced, using guinea-pig 5-HT(1D) receptor coding sequence oligonucleotide primers in reverse transcription-polymerase chain reaction (RT - PC

  7. Rapid cloning and bioinformatic analysis of spinach Y chromosome-specific EST sequences

    Indian Academy of Sciences (India)

    Chuan-Liang Deng; Wei-Li Zhang; Ying Cao; Shao-Jing Wang; Shu-Fen Li; Wu-Jun Gao; Long-Dou Lu

    2015-12-01

    The genome of spinach single chromosome complement is about 1000 Mbp, which is the model material to study the molecular mechanisms of plant sex differentiation. The cytological study showed that the biggest spinach chromosome (chromosome 1) was taken as spinach sex chromosome. It had three alleles of sex-related , m and . Many researchers have been trying to clone the sex-determining genes and investigated the molecular mechanism of spinach sex differentiation. However, there are no successful cloned reports about these genes. A new technology combining chromosome microdissection with hybridization-specific amplification (HSA) was adopted. The spinach Y chromosome degenerate oligonucleotide primed-PCR (DOP-PCR) products were hybridized with cDNA of the male spinach flowers in florescence. The female spinach genome was taken as blocker and cDNA library specifically expressed in Y chromosome was constructed. Moreover, expressed sequence tag (EST) sequences in cDNA library were cloned, sequenced and bioinformatics was analysed. There were 63 valid EST sequences obtained in this study. The fragment size was between 53 and 486 bp. BLASTn homologous alignment indicated that 12 EST sequences had homologous sequences of nucleic acids, the rest were new sequences. BLASTx homologous alignment indicated that 16 EST sequences had homologous protein-encoding nucleic acid sequence. The spinach Y chromosome-specific EST sequences laid the foundation for cloning the functional genes, specifically expressed in spinach Y chromosome. Meanwhile, the establishment of the technology system in the research provided a reference for rapid cloning of other biological sex chromosome-specific EST sequences.

  8. CATO: The Clone Alignment Tool.

    Directory of Open Access Journals (Sweden)

    Peter V Henstock

    Full Text Available High-throughput cloning efforts produce large numbers of sequences that need to be aligned, edited, compared with reference sequences, and organized as files and selected clones. Different pieces of software are typically required to perform each of these tasks. We have designed a single piece of software, CATO, the Clone Alignment Tool, that allows a user to align, evaluate, edit, and select clone sequences based on comparisons to reference sequences. The input and output are designed to be compatible with standard data formats, and thus suitable for integration into a clone processing pipeline. CATO provides both sequence alignment and visualizations to facilitate the analysis of cloning experiments. The alignment algorithm matches each of the relevant candidate sequences against each reference sequence. The visualization portion displays three levels of matching: 1 a top-level summary of the top candidate sequences aligned to each reference sequence, 2 a focused alignment view with the nucleotides of matched sequences displayed against one reference sequence, and 3 a pair-wise alignment of a single reference and candidate sequence pair. Users can select the minimum matching criteria for valid clones, edit or swap reference sequences, and export the results to a summary file as part of the high-throughput cloning workflow.

  9. CATO: The Clone Alignment Tool.

    Science.gov (United States)

    Henstock, Peter V; LaPan, Peter

    2016-01-01

    High-throughput cloning efforts produce large numbers of sequences that need to be aligned, edited, compared with reference sequences, and organized as files and selected clones. Different pieces of software are typically required to perform each of these tasks. We have designed a single piece of software, CATO, the Clone Alignment Tool, that allows a user to align, evaluate, edit, and select clone sequences based on comparisons to reference sequences. The input and output are designed to be compatible with standard data formats, and thus suitable for integration into a clone processing pipeline. CATO provides both sequence alignment and visualizations to facilitate the analysis of cloning experiments. The alignment algorithm matches each of the relevant candidate sequences against each reference sequence. The visualization portion displays three levels of matching: 1) a top-level summary of the top candidate sequences aligned to each reference sequence, 2) a focused alignment view with the nucleotides of matched sequences displayed against one reference sequence, and 3) a pair-wise alignment of a single reference and candidate sequence pair. Users can select the minimum matching criteria for valid clones, edit or swap reference sequences, and export the results to a summary file as part of the high-throughput cloning workflow.

  10. A maximum principle for the mutation--selection equilibrium of nucleotide sequences

    CERN Document Server

    Garske, T; Garske, Tini; Grimm, Uwe

    2004-01-01

    We study the equilibrium behaviour of a deterministic four-state mutation--selection model as a model for the evolution of a population of nucleotide sequences. The mutation model is the Kimura 3ST mutation scheme, and selection is assumed to be permutation invariant. Considering the evolution process both forward and backward in time, we use the ancestral distribution as the stationary state of the backward process to derive an expression for the mutational loss (as the difference between ancestral and population mean fitness), and we prove a maximum principle that determines the population mean fitness in mutation--selection balance.

  11. Complete nucleotide sequence of a virus associated with rusty mottle disease of sweet cherry (Prunus avium).

    Science.gov (United States)

    Villamor, D V; Druffel, K L; Eastwell, K C

    2013-08-01

    Cherry rusty mottle is a disease of sweet cherries first described in 1940 in western North America. Because of the graft-transmissible nature of the disease, a viral nature of the disease was assumed. Here, the complete genomic nucleotide sequences of virus isolates from two trees expressing cherry rusty mottle disease symptoms are characterized; the virus is designated cherry rusty mottle associated virus (CRMaV). The biological and molecular characteristics of this virus in comparison to those of cherry necrotic rusty mottle virus (CNRMV) and cherry green ring mottle virus (CGRMV) are described. CRMaV was subsequently detected in additional sweet cherry trees expressing symptoms of cherry rusty mottle disease.

  12. Cloning and sequencing of mouse GABA transporter complementary DNA

    Institute of Scientific and Technical Information of China (English)

    TAMANTHONYC.W.; LIHEGUO; 等

    1994-01-01

    A cDNA encoding the mouse GABA transporter has been isolated and sequenced.The results show that the mouse GABA transporter cDNA differs from that of the rat by 60 base pairs at the open reading frame region but the deduced amino acid sequences of the two cDNAs are identical and both composed of 599 amino acids.However,the amino acid sequence is different from the sequence deduced from a recently published mouse GABA transporter cDNA.

  13. Cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of Clostridium chauvoei

    Directory of Open Access Journals (Sweden)

    Saroj K. Dangi

    2017-09-01

    Full Text Available Aim: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of C. chauvoei. Materials and Methods: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct. Results: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum. Conclusion: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.

  14. Nucleotide sequence characterization and phylogenetic analysis of hantaviruses isolated in Shandong Province, China

    Institute of Scientific and Technical Information of China (English)

    LI Jian; ZHAO Zhong-tang; WANG Zhi-qiang; LIU Yun-xi; HU Mao-hong

    2007-01-01

    Background China is the most severe endemic area of hemorrhagic fever with renal syndrome (HFRS) in the world with 30 000-50 000 cases reported annually, which accounts for more than 90% of total number of cases worldwide. The incidence rate of the syndrome in Shandong Province is one of the highest in China, which has ever reached 50 per 100 000 persons per year. However, the molecular characteristics of hantaviruses (HV) epidemic in Shandong Province remain unclear. Therefore it is useful to clarify nucleotide sequence and phylogenetic characteristics of HV isolated in Shandong Province in order to provide better advices to control and prevent HFRS.Methods RNAs were extracted from sera of clinically diagnosed patients and positive rodent lungs that were detected by indirect immunofluorescent assay (IFA). Partial M segments of HV were amplified from the RNAs with reverse transcription nested polymerase chain reactions (nested PCR) using hantavirus genotype specific primers. The nested PCR products were sequenced and compared with those from previously epidemic isolates in Shandong and with other representative HV sequences from GenBank. Phylogenetic tree analyses were performed based on the sequences of the M genes.Results Thirty-four HV isolates in Shandong showed 67.1%-100% nucleotide identities. The nucleotide homologies among 6 Hantaan viruses (HTNV) isolates in Shandong were 78.1%-98.7%, while the homologies among 28 Seoul virus (SEOV) isolates in Shandong were 93.7%-100%. There were at least 3 subtypes HTNV (H2, H5, H9) and 2 subtypes SEOV (S2, S3) in Shandong Province.Conclusions In Shandong Province, the homologies of HTNV were lower and there were no predominant subtypes,while the homologies of SEOV were higher and S3 was the predominant subtype. The homologies of SEOV from rodents were higher than those from patients. The distribution of subtypes in Shandong was similar to that of the adjoining provinces. Phylogenetic analyses of the sequences showed

  15. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus.

    Science.gov (United States)

    Chen, Chunxian; Gmitter, Fred G

    2013-11-01

    Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered - 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had "no hits found", 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. High-quality EST-SNPs from different citrus genotypes were detected, and

  16. Using mitochondrial nucleotide sequences to investigate diversity and genealogical relationships within common carp (Cyprinus carpio L.).

    Science.gov (United States)

    Thai, B T; Burridge, C P; Pham, T A; Austin, C M

    2005-02-01

    Direct sequencing of mitochondrial DNA (mtDNA) D-loop (745 bp) and MTATPase6/MTATPase8 (857 bp) regions was used to investigate genetic variation within common carp and develop a global genealogy of common carp strains. The D-loop region was more variable than the MTATPase6/MTATPase8 region, but given the wide distribution of carp the overall levels of sequence divergence were low. Levels of haplotype diversity varied widely among countries with Chinese, Indonesian and Vietnamese carp showing the greatest diversity whereas Japanese Koi and European carp had undetectable nucleotide variation. A genealogical analysis supports a close relationship between Vietnamese, Koi and Chinese Color carp strains and to a lesser extent, European carp. Chinese and Indonesian carp strains were the most divergent, and their relationships do not support the evolution of independent Asian and European lineages and current taxonomic treatments.

  17. The complete nucleotide sequence and genome organization of pea streak virus (genus Carlavirus).

    Science.gov (United States)

    Su, Li; Li, Zhengnan; Bernardy, Mike; Wiersma, Paul A; Cheng, Zhihui; Xiang, Yu

    2015-10-01

    Pea streak virus (PeSV) is a member of the genus Carlavirus in the family Betaflexiviridae. Here, the first complete genome sequence of PeSV was determined by deep sequencing of a cDNA library constructed from dsRNA extracted from a PeSV-infected sample and Rapid Amplification of cDNA Ends (RACE) PCR. The PeSV genome consists of 8041 nucleotides excluding the poly(A) tail and contains six open reading frames (ORFs). The putative peptide encoded by the PeSV ORF6 has an estimated molecular mass of 6.6 kDa and shows no similarity to any known proteins. This differs from typical carlaviruses, whose ORF6 encodes a 12- to 18-kDa cysteine-rich nucleic-acid-binding protein.

  18. [Nucleotide sequence of HLA-DQA1 promoter region (QAP) in a lung cancer patient].

    Science.gov (United States)

    Qiu, C; Zhou, W; Song, C

    1996-06-01

    The HLA-DQA1 allele and nucleotide sequence of HLA-DQA1 promoter region (QAP) in a patient with IDDM complicated lung cancer have been identified by PCR/SSCP, PCR/SSCP and PCR/sequencing. The results showed that: (1) All of the lung cancer patient and his family members carried HLA-DQA1* 0301/0501 alleles. (2) a single base substitution G-->A at position -155 and deletion CAA at position -161 to -163 occurred in the patient. These results suggest that the mutation of HLA-DQA1 promoter region may modulate HLA-DQA1 gene expression by trans-acting factors binding to variant cis-acting elements and may be responsible for pathogenesis of lung cancer.

  19. Nucleotide sequences of three tRNA(Ser) from Drosophila melanogaster reading the six serine codons.

    Science.gov (United States)

    Cribbs, D L; Gillam, I C; Tener, G M

    1987-10-05

    The nucleotide sequences of three serine tRNAs from Drosophila melanogaster, together capable of decoding the six serine codons, were determined. tRNA(Ser)2b has the anticodon GCU, tRNA(Ser)4 has CGA and tRNA(Ser)7 has IGA. tRNA(Ser)2b differs from the last two by about 25%. However, tRNA(Ser)4 and tRNA(Ser)7 are 96% homologous, differing only at the first position of the anticodon and two other sites. This unusual sequence relationship suggests, together with similar pairs in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae, that eukaryotic tRNA(Ser)UCN may be undergoing concerted evolution.

  20. Identification and Validation of Single Nucleotide Polymorphisms in Poplar Using Publicly Expressed Sequence Tags

    Institute of Scientific and Technical Information of China (English)

    Bo ZHANG; Yan ZHOU; Liang ZHANG; Qiang ZHUGE; Ming-Xiu WANG; Min-Ren HUANG

    2005-01-01

    By using assembled expressed sequence tags (ESTs) from 14 different cDNA libraries that contain 84 132 sequences reads, 556 Populus candidate single nucleotide polymorphisms (SNPs) were identified. Because traces were not available from dbEST (http://www.ncbi.nlm.nih.gov/dbEST/index.html),stringent filters were used to identify reliable candidate SNPs. Sequences analysis indicated that the main types of substitutions among candidate SNPs were A/G and T/C transitions, which accounted for 22.0% and 30.8%, respectively. One hundred and ten candidate SNPs were tested. As a result, 38 candidate SNPs were confirmed by directed sequencing of PCR products amplified from six different individuals. Thirteen new SNPs in intron regions were found and multiple SNPs were found to be located in both intron and exon regions of four contigs. Heterozygosis was found in all 47 candidate sites and five SNP sites were heterozygous in all six samples. This is the first report of SNP identification in a tree species which reveals that assembled ESTs from multiple libraries of the public database may provide a rich source of comparative sequences for an SNP search in the poplar genome.

  1. [cDNA cloning and sequence analysis of pluripotency genes in tree shrews (Tupaia belangeri)].

    Science.gov (United States)

    Wang, Cai-Yun; Ma, Yun-Han; He, Da-Jian; Yang, Shi-Hua

    2013-04-01

    In this paper, partial sequences of the tree shrew (Tupaia belangeri) Klf4, Sox2, and c-Myc genes were cloned and sequenced, which were 382, 612, and 485 bp in length and encoded 127, 204, and 161 amino acids, respectively. Whereas, their cDNA sequence identities with those of human were 89%, 98%, and 89%, respectively. Their phylogenetic tree results indicated different topologies and suggested individual evolutional pathways. These results can facilitate further functional studies.

  2. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  3. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii

    Indian Academy of Sciences (India)

    En Li; Xiaoqiang Li; Xiaobing Wu; Ge Feng; Man Zhang; Haitao Shi; Lijun Wang; Jianping Jiang

    2014-12-01

    In this study, the complete nucleotide sequence (18,321 bp) of the mitochondrial (mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a tandem duplication of tRNA-Met gene). The LTPF tRNA-gene cluster, and the derived position of the ND5 gene downstream of the control region, were present in this mitogenome. Moreover, we found that in the WANCY tRNA-gene cluster, the tRNA-Asn gene was located between the tRNA-Tyr and COI genes instead of between the tRNA-Ala and tRNA-Cys genes, which is a novel mtDNA gene rearrangement in vertebrates. Based on the concatenated nucleotide sequences of the 13 protein-coding genes, phylogenetic analysis (BI, ML, MP) was performed to further clarify the phylogenetic relations of this species within anurans.

  4. Characterisation of the H5 and N1 genes of an Indonesian highly pathogenic Avian Influenza virus isolate by sequencing of multiple clone approach

    Directory of Open Access Journals (Sweden)

    Risza Hartawan

    2010-09-01

    Full Text Available Hemagglutinin and neuraminidase are the main antigenic determinants of highly pathogenic avian influenza (HPAI virus. The features of these surface glycoproteins have been intensively studied at the molecular level. The objective of this research was to characterise the genes encoding these glycoproteins by sequencing of multiple clones. The H5 and N1 genes of isolate A/duck/Tangerang/Bbalitvet-ACIAR-TE11/2007 were each amplified in one or two fragments using reverse transcriptase-PCR (RT-PCR, and subsequently cloned into pGEM-T Easy TA cloning system. The sequencing result demonstrated high homology between respective clones but with several variations that were identified as single nucleotide polymorphisms (SNPs. A total of 1,707 base pair and 1,350 base pair of H5 and N1 genes respectively were successfully assembled from multiple clones containing the genes of interest. The features of both H5 and N1 genes from this isolate resemble the typical characteristics of Indonesian strains of H5N1 virus from sub-clade 2.1.3.

  5. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten;

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  6. Optimization of Bartonella henselae multilocus sequence typing scheme using single-nucleotide polymorphism analysis of SOLiD sequence data

    Institute of Scientific and Technical Information of China (English)

    ZHAO Fan; Gemma Chaloner; Alistair Darby; SONG Xiu-ping; LI Dong-mei; Richard Birtles; LIU Qi-yong

    2012-01-01

    Background Multi-locus sequence typing (MLST) is widely used to explore the population structure of numerous bacterial pathogens.However,for genotypically-restricted pathogens,the sensitivity of MLST is limited by a paucity of variation within selected loci.For Bartonella henselae (B.henselae),although the MLST scheme currently used has been proven useful in defining the overall population structure of the species,its reliability for the accurate delineation of closely-related sequence types,between which allelic variation is usually limited to,at most,one or two nucleotide polymorphisms.Exploitation of high-throughput sequencing data allows a more informed selection of MLST loci and thus,potentially,a means of enhancing the sensitivity of the schemes they comprise.Methods We carried out SOLiD resequencing on 12 representative B.henselae isolates and explored these data using single nucleotide polymorphism (SNP) analysis.We determined the number and distribution of SNPs in the genes targeted by the established MLST scheme and modified the position of loci within these genes to capture as much genetic variation as possible.Results Using genome-wide SNP data,we found the distribution of SNPs within each open reading frame (ORF) of MLST loci,which were not represented by the established B.henselae MLST scheme.We then modified the position of loci in the MLST scheme to better reflect the polymorphism in the ORF as a whole.The use of amended loci in this scheme allowed previously indistinguishable ST1 strains to be differentiated.However,the diversity of B.henselae was still rare in China.Conclusions Our study demonstrates the use of SNP analysis to facilitate the selection of MLST loci to augment the currently-described scheme for B.henselae.And the diversity among B.henselae strains in China is markedly less than that observed in B.henselae populations elsewhere in the world.

  7. Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots.

    Science.gov (United States)

    Lindner, Daniel L; Banik, Mark T

    2009-01-01

    To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was investigated by selecting 20 small root tips (SRT, 1.0-2.0 mm long) and 20 large root tips (LRT, 5.0-6.0 mm long). DNA was isolated from each tip and PCR-amplified with fungal-specific primers. PCR reactions were divided into two portions, one of which was sequenced directly and one of which was cloned first followed by sequencing of 12 random clones. With direct sequencing all 20 SRT produced an identifiable sequence, while only 13 of 20 LRT (65%) yielded an identifiable sequence. With cloning and sequencing all 40 tips produced identifiable fungal ITS sequences regardless of size. Failure of direct sequencing in LRT was associated with the presence of multispecies assemblages. Cloning identified 18 taxa overall while direct sequencing identified four. Cloning was not affected by tip size and identified more taxa relative to direct sequencing, although cost and probability of observing lab-based contaminants (e.g., airborne or reagent-based) were higher. We suggest that standardized controls be run whenever clones are sequenced from environmental samples, including positive controls derived from pure cultures and negative controls that cover the entire extraction, amplification and cloning process. Additional studies on larger root segments and bulked samples are needed to determine whether cloning can detect fungi accurately and cost-effectively in complex environmental samples.

  8. Cloning

    Science.gov (United States)

    ... copies of whole animals Therapeutic cloning, which creates embryonic stem cells. Researchers hope to use these cells to grow healthy tissue to replace injured or diseased tissues in the human body. NIH: National Human Genome Research Institute

  9. Purification, amino acid sequence, and cDNA cloning of trypsin inhibitors from onion (Allium cepa L.) bulbs.

    Science.gov (United States)

    Deshimaru, Masanobu; Watanabe, Akira; Suematsu, Keiko; Hatano, Maki; Terada, Shigeyuki

    2003-08-01

    Three protease inhibitors (OTI-1-3) have been purified from onion (Allium cepa L.) bulbs. Molecular masses of these inhibitors were found to be 7,370.2, 7,472.2, and 7,642.6 Da by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS), respectively. Based on amino acid composition and N-terminal sequence, OTI-1 and -2 are the N-terminal truncated proteins of OTI-3. All the inhibitors are stable to heat and extreme pH. OTI-3 inhibited trypsin, chymotrypsin, and plasmin with dissociation constants of 1.3 x 10(-9) M, 2.3 x 10(-7) M, and 3.1 x 10(-7) M, respectively. The complete amino acid sequence of OTI-3 showed a significant homology to Bowman-Birk family inhibitors, and the first reactive site (P1) was found to be Arg17 by limited proteolysis by trypsin. The second reactive site (P1) was estimated to be Leu46, that may inhibit chymotrypsin. OTI-3 lacks an S-S bond near the second reactive site, resulting in a low affinity for the enzyme. The sequence of OTI-3 was also ascertained by the nucleotide sequence of a cDNA clone encoding a 101-residue precursor of the onion inhibitor.

  10. The bioinformatics of nucleotide sequence coding for proteins requiring metal coenzymes and proteins embedded with metals

    Science.gov (United States)

    Tremberger, G.; Dehipawala, Sunil; Cheung, E.; Holden, T.; Sullivan, R.; Nguyen, A.; Lieberman, D.; Cheung, T.

    2015-09-01

    All metallo-proteins need post-translation metal incorporation. In fact, the isotope ratio of Fe, Cu, and Zn in physiology and oncology have emerged as an important tool. The nickel containing F430 is the prosthetic group of the enzyme methyl coenzyme M reductase which catalyzes the release of methane in the final step of methano-genesis, a prime energy metabolism candidate for life exploration space mission in the solar system. The 3.5 Gyr early life sulfite reductase as a life switch energy metabolism had Fe-Mo clusters. The nitrogenase for nitrogen fixation 3 billion years ago had Mo. The early life arsenite oxidase needed for anoxygenic photosynthesis energy metabolism 2.8 billion years ago had Mo and Fe. The selection pressure in metal incorporation inside a protein would be quantifiable in terms of the related nucleotide sequence complexity with fractal dimension and entropy values. Simulation model showed that the studied metal-required energy metabolism sequences had at least ten times more selection pressure relatively in comparison to the horizontal transferred sequences in Mealybug, guided by the outcome histogram of the correlation R-sq values. The metal energy metabolism sequence group was compared to the circadian clock KaiC sequence group using magnesium atomic level bond shifting mechanism in the protein, and the simulation model would suggest a much higher selection pressure for the energy life switch sequence group. The possibility of using Kepler 444 as an example of ancient life in Galaxy with the associated exoplanets has been proposed and is further discussed in this report. Examples of arsenic metal bonding shift probed by Synchrotron-based X-ray spectroscopy data and Zn controlled FOXP2 regulated pathways in human and chimp brain studied tissue samples are studied in relationship to the sequence bioinformatics. The analysis results suggest that relatively large metal bonding shift amount is associated with low probability correlation R

  11. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  12. Remarkable similarity in genome nucleotide sequences between the Schwarz FF-8 and AIK-C measles virus vaccine strains and apparent nucleotide differences in the phosphoprotein gene.

    Science.gov (United States)

    Ito, Chie; Ohgimoto, Shinji; Kato, Seiichi; Sharma, Luna Bhatta; Ayata, Minoru; Komase, Katsuhiro; Takeuchi, Kaoru; Ihara, Toshiaki; Ogura, Hisashi

    2011-07-01

    The Schwarz FF-8 (FF-8) and AIK-C measles virus vaccine strains are currently used for vaccination in Japan. Here, the complete genome nucleotide sequence of the FF-8 strain has been determined and its genome sequence found to be remarkably similar to that of the AIK-C strain. These two strains are differentiated only by two nucleotide differences in the phosphoprotein gene. Since the FF-8 strain does not possess the amino acid substitutions in the phospho- and fusion proteins which are responsible for the temperature-sensitivity and small syncytium formation phenotypes of the AIK-C strain, respectively, other unidentified common mechanisms likely attenuate both the FF-8 and AIK-C strains.

  13. Cloning and sequencing of a Moraxella bovis pilin gene.

    Science.gov (United States)

    Marrs, C F; Schoolnik, G; Koomey, J M; Hardy, J; Rothbard, J; Falkow, S

    1985-07-01

    Moraxella bovis pili have been shown to play a major role in both infectivity and protective immunity of bovine infectious keratoconjunctivitis. Sonicated M. bovis DNA from the piliated strain EPP63 was inserted into the vector lambda gt11 with EcoRI linkers. Recombinant phage were screened with an oligonucleotide probe based on the amino-terminal portion of the DNA sequence of a Neisseria gonorrhoeae pilin gene. Two candidate phages produced a protein that comigrated with EPP63 beta pilin in sodium dodecyl sulfate-polyacrylamide gels and bound anti-pilus antisera. The 1.9-kilobase insert from one of these, lambda gt11M182, was subcloned in both orientations into pBR322, forming the plasmids pMxB7 and pMxB9, both of which produced beta pilin, as did pMxB12, a HindIII deletion derivative of pMxB7. In HB101(pMxB12), the M. bovis pilin protein was shown to be primarily localized in the inner membrane. The entire 939-base-pair insert of pMxB12 was sequenced, revealing a ribosome binding site just upstream of the coding region and an AT-rich region further upstream containing some potential RNA polymerase recognition sites. The translation of the sequence predicts a six-amino-acid leader sequence preceding the phenylalanine that begins the mature protein. Codon usage analysis of the M. bovis beta pilin gene revealed greater use of the CUA codon for leucine than usual for a well-expressed Escherichia coli gene. Comparisons of the M. bovis EPP63 beta pilin protein sequence with other pilin gene sequences are presented.

  14. The complete nucleotide sequence and its organization of the genome of Barley yellow dwarf virus-GAV

    Institute of Scientific and Technical Information of China (English)

    JIN; Zhibo; WANG; Xifeng; CHANG; Shengjun; ZHOU; Guanghe

    2004-01-01

    The complete nucleotide sequence of genomic RNA of BYDV-GAV was determined. It comprised 5685 nucleotides and contained six open reading frames and four un-translated regions. The size and organization of BYDV-GAV genome were similar to those of BYDV PAV-aus. The nucleotide and deduced amino acid sequences of the six ORFs were aligned and compared with those of other luteoviruses. The results showed that there was a high degree of identity between BYDV-GAV and MAV-PS1 in all ORFs except ORF5 and ORF6, which had only 87.4% and 70.2% identities respectively. The reported genomic nucleotide sequence of MAV was shorter than that of BYDV-GAV, but the comparison of the genomic nucleotide sequences for MAV-PS1 and GAV showed 90.4% sequence identity for the same region of the genome. According to the level of sequence similarities, BYDV-GAV should be closely related to BYDV-MAV.

  15. Complete nucleotide sequence of a new satellite RNA associated with cucumber mosaic virus inducing tomato necrosis

    Institute of Scientific and Technical Information of China (English)

    程宁辉; 方荣祥; 濮祖芹; 方中达

    1997-01-01

    A new strain (TN strain) of cucumber mosaic virus (CMV) was isolated from tomato plants with necrotic symptoms and proved to carry a necrogenic satellite RNA (TN-Sat RNA). Double-strand cDNA of the TN-Sat RNA was synthesized by reverse transcription and polymerase chain reaction using primers designed according to the conserved terminal sequences of known CMV satellite RNAs. Sequence analysis indicated that the TN-Sat RNA consisted of 390 nucleotides (nt). Comparison of the sequence of the TN-Sat RNA with those of other CMV satellite RNAs revealed four homologous regions ( I . 1-81 nt; II . 216-261 nt; III. 278-338 nt; IV . 349-390 nt) and one hypervarible domain in the region of 82-215 nt. Moreover, the TN-Sat RNA contained a characteristic necro-genic consensus sequence at the 3’ end (339-367 nt) as reported in the known necrosis-inducing CMV satellite RNAs.

  16. Analysing grouping of nucleotides in DNA sequences using lumped processes constructed from Markov chains.

    Science.gov (United States)

    Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude

    2006-03-01

    The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.

  17. Nucleotide sequence of the Dpn II DNA methylase gene of Streptococcus pneumoniae and its relationship to the dam gene of Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Mannarelli, B.M.; Balganesh, T.S.; Greenberg, B.; Springhorn, S.S.; Lacks, S.A.

    1985-07-01

    The structural gene (dpnM) for the Dpn II DNA methylase of Streptococcus pneumoniae, which is part of the Dpn II restriction system and methylates adenine in the sequence 5'-G-A-T-C-3', was identified by subcloning fragments of a chromosomal segment from a Dpn II-producing strain in an S. pneumoniae host/vector cloning system and demonstrating function of the gene also in Bacillus subtilis. Determination of the nucleotide sequence of the gene and adjacent DNA indicates that it encodes a polypeptide of 32,903 daltons. A putative promoter for transcription of the gene lies within a hundred nucleotides of the polypeptide start codon. Comparison of the coding sequence to that of the dam gene of Escherichia coli, which encodes a similar methylase, revealed 30% of the amino acid residues in the two enzymes to be identical. This homology presumably reflects a common origin of the two genes prior to the divergence of Gram-positive and Gram-negative bacteria. It is suggested that the restriction function of the gene is primitive, and that the homologous restriction system in E. coli has evolved to play an accessory role in heteroduplex DNA base mismatch repair.

  18. The Complete Nucleotide Sequence and Biotype Variability of Papaya leaf distortion mosaic virus.

    Science.gov (United States)

    Maoka, Tetsuo; Hataya, Tatsuji

    2005-02-01

    ABSTRACT The complete nucleotide sequence of the genome of Papaya leaf distortion mosaic virus (PLDMV) was determined. The viral RNA genome of strain LDM (leaf distortion mosaic) comprised 10,153 nucleotides, excluding the poly(A) tail, and contained one long open reading frame encoding a polyprotein of 3,269 amino acids (molecular weight 373,347). The polyprotein contained nine putative proteolytic cleavage sites and some motifs conserved in other potyviral polyproteins with 44 to 50% identities, indicating that PLDMV is a distinct species in the genus Potyvirus. Like the W biotype of Papaya ringspot virus (PRSV), the non-papaya-infecting biotype of PLDMV (PLDMV-C) was found in plants of the family Cucurbitaceae. The coat protein (CP) sequence of PLDMV-C in naturally infected-Trichosanthes bracteata was compared with those of three strains of the P biotype (PLDMV-P), LDM and two additional strains M (mosaic) and YM (yellow mosaic), which are biologically different from each other. The CP sequences of three strains of PLDMV-P share high identities of 95 to 97%, while they share lower identities of 88 to 89% with that of PLDMV-C. Significant changes in hydrophobicity and a deletion of two amino acids at the N-terminal region of the CP of PLDMV-C were observed. The finding of two biotypes of PLDMV implies the possibility that the papaya-infecting biotype evolved from the cucurbitaceae-infecting potyvirus, as has been previously suggested for PRSV. In addition, a similar evolutionary event acquiring infectivity to papaya may arise frequently in viruses in the family Cucurbitaceae.

  19. Rhipicephalus microplus strain Deutsch, 10 BAC clone sequences

    Science.gov (United States)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. We used labeled DNA probes from the coding reg...

  20. Cloning and sequence of a processed p53 pseudogene from rat: a potential source of false 'mutations' in PCR fragments of tumor DNA.

    Science.gov (United States)

    Weghorst, C M; Buzard, G S; Calvert, R J; Hulla, J E; Rice, J M

    1995-12-12

    We describe here the nucleotide (nt) sequence of a p53 processed pseudogene (psi-gene) from the normal F344 rat genome. Exon-derived primers were utilized to amplify and clone a 1447-bp polymerase chain reaction (PCR) product corresponding to the coding regions of exons 2-11 of the functional gene. This psi-gene is a cDNA-like sequence possessing 87% homology with the functional rat p53. We have also partially characterized two additional and distinctly different putative rat p53 psi-genes, focussing on the sequences surrounding the reported rat p53 mutational hot spots of codons 202R and 211R within exon 6/7. Each of these three psi-gene sequences contained various single- and/or double-nt substitutions, small deletions and insertions that distinguish them from p53. One substitution, 211R CGG-->CAG, found both in the cloned psi-gene and in one of the partially characterized, putative psi-genes, corresponded precisely with the sequence that has been reported as a mutation at one of the hot spots. Co-amplification of one or more of the p53 psi-genes with portions of the functional p53 is likely, if exon-based primers are utilized for PCR amplification of rat p53. Consequently, psi-gene sequences are potential sources of sequence variations that can be misidentified as somatic cell mutations by direct sequencing of inappropriately generated PCR products.

  1. Large scale single nucleotide polymorphism discovery in unsequenced genomes using second generation high throughput sequencing technology: applied to turkey

    NARCIS (Netherlands)

    Kerstens, H.H.D.; Crooijmans, R.P.M.A.; Veenendaal, A.; Dibbits, B.W.; Chin-A-Woeng, T.F.C.; Dunnen, den J.T.; Groenen, M.A.M.

    2009-01-01

    Background - The development of second generation sequencing methods has enabled large scale DNA variation studies at moderate cost. For the high throughput discovery of single nucleotide polymorphisms (SNPs) in species lacking a sequenced reference genome, we set-up an analysis pipeline based on a

  2. Cloning and sequencing of a Moraxella bovis pilin gene.

    OpenAIRE

    1985-01-01

    Moraxella bovis pili have been shown to play a major role in both infectivity and protective immunity of bovine infectious keratoconjunctivitis. Sonicated M. bovis DNA from the piliated strain EPP63 was inserted into the vector lambda gt11 with EcoRI linkers. Recombinant phage were screened with an oligonucleotide probe based on the amino-terminal portion of the DNA sequence of a Neisseria gonorrhoeae pilin gene. Two candidate phages produced a protein that comigrated with EPP63 beta pilin in...

  3. Nucleotide sequences related to the transforming gene of avian sarcoma virus are present in DNA of uninfected vertebrates.

    Science.gov (United States)

    Spector, D H; Varmus, H E; Bishop, J M

    1978-09-01

    We have detected nucleotide sequences related to the transforming gene of avian sarcoma vius (ASV) in the DNA of uninfected vertebrates. Purified radioactive DNA (cDNAsarc) complementary to most of all of the gene (src) required for transformation of fibroblasts by ASV was annealed with DNA from a variety of normal species. Under conditions that facilitate pairing of partially matched nucleotide sequences (1.5 M NaCl, 59 degrees), cDNAsarc formed duplexes with chicken, human, calf, mouse, and salmon DNA but not with DNA from sea urchin, Drosophila, or Escherichia coli. The kinetics of duplex formation indicated that cDNAsarc was reacting with nucleotide sequences present in a single copy or at most a few copies per cell. In contrast to the preceding findings, nucleotide sequences complementary to the remainder of the ASV genome were observed only in chicken DNA. Thermal denaturation studies of the duplexes formed with cDNAsarc indicated a high degree of conservation of the nucleotide sequences related to src in vertebrate DNAs; the reductions in melting temperature suggested about 3--4% mismatching of cDNAsarc with chicken DNA and 8--10% mismatching of cDNAsarc with the other vertebrate DNAs.

  4. The complete nucleotide sequence of a new bipartite begomovirus from Brazil infecting Abutilon.

    Science.gov (United States)

    Paprotka, T; Metzler, V; Jeske, H

    2010-05-01

    The complete nucleotide sequence of Abutilon mosaic Brazil virus (AbMBV), a new bipartite begomovirus from Bahia, Brazil, is described and analyzed phylogenetically. Its DNA A is most closely related to those of Sida-infecting begomoviruses from Brazil and forms a phylogenetic cluster with pepper- and Euphorbia-infecting begomoviruses from Central America. The DNA B component forms a cluster with different Sida- and okra-infecting begomoviruses from Brazil. Both components are distinct from those of the classical Abutilon mosaic virus originating from the West Indies. AbMBV is transmissible to Nicotiana benthamiana and Malva parviflora by biolistics of rolling-circle amplification products and induces characteristic mosaic and vein-clearing symptoms in M. parviflora.

  5. The nucleotide sequence of histidine tRNA gamma of Drosophila melanogaster.

    OpenAIRE

    Altwegg, M; Kubli, E

    1980-01-01

    The nucleotide sequence of D. melanogaster histidine tRNA gamma was determined to be: pG-G-C-C-G-U-G-A-U-C-G-U-C-psi-A-G-D-G-G-D-D-A-G-G-A-C-C-C-C-A-C-G-psi-U-G-U-G- m1G-C-C-G-U-G-G-U-A-A-C-C-m5C-A-G-G-U-psi-C-G-m1A-A-U-C-C-U-G-G-U-C-A-C-G-G-m5C -A-C-C-AOH. An additional unpaired G is found at the 5' end, and the T in the TpsiC loop is replaced by a U.

  6. Nucleotide sequence and transcription of a trypomastigote surface antigen gene of Trypanosoma cruzi.

    Science.gov (United States)

    Fouts, D L; Ruef, B J; Ridley, P T; Wrightsman, R A; Peterson, D S; Manning, J E

    1991-06-01

    In previous studies we identified a 500-bp segment of the gene, TSA-1, which encodes an 85-kDa trypomastigote-specific surface antigen of the Peru strain of Trypanosoma cruzi. TSA-1 was shown to be located at a telomeric site and to contain a 27-bp tandem repeat unit within the coding region. This repeat unit defines a discrete subset of a multigene family and places the TSA-1 gene within this subset. In this study, we present the complete nucleotide sequence of the TSA-1 gene from the Peru strain. By homology matrix analysis, fragments of two other trypomastigote specific surface antigen genes, pTt34 and SA85-1.1, are shown to have extensive sequence homology with TSA-1 indicating that these genes are members of the same gene family as TSA-1. The TSA-1 subfamily was also found to be active in two other strains of T. cruzi, one of which contains multiple telomeric members and one of which contains a single non-telomeric member, suggesting that transcription is not necessarily dependent on the gene being located at a telomeric site. Also, while some of the sequences found in this gene family are present in 2 size classes of poly(A)+ RNA, others appear to be restricted to only 1 of the 2 RNA classes.

  7. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Directory of Open Access Journals (Sweden)

    Seung Hak Yang

    2015-09-01

    Full Text Available The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site.

  8. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  9. CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

    NARCIS (Netherlands)

    DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

    1992-01-01

    The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

  10. Identification and cloning of a sequence homologue of dopamine β-hydroxylase

    NARCIS (Netherlands)

    Chambers, Kaylene J.; Tonkin, Leath A.; Chang, Edwin; Shelton, Dawne N.; Linskens, Maarten H.; Funk, Walter D.

    1998-01-01

    We have identified and cloned a cDNA encoding a new member of the monooxygenase family of enzymes. This novel enzyme, which we call MOX (monooxygenase X; unknown substrate) is a clear sequence homologue of the enzyme dopamine β-hydroxylase (DBH). MOX maintains many of the structural features of DBH,

  11. The S-layer gene of Lactobacillus helveticus CNRZ 892 : cloning, sequence and heterologous expression

    NARCIS (Netherlands)

    Callegari, M.L.; Riboli, B.; Sanders, J.W; Cocconcelli, P.S.; Kok, J.; Venema, G; Morelli, L.

    1998-01-01

    Lactobacillus helveticus CNRZ 892 contains a surface layer (S-layer) composed of protein monomers of 43 kDa organized in regular arrays. The gene encoding this protein (slpH) has been cloned in Escherichia coli and sequenced. slpH consists of 440 codons and is preceded by a ribosome-binding site (RB

  12. CLONING, SEQUENCING, AND CHARACTERIZATION OF ESCHERICHIA-COLI THIOESTERASE-II

    NARCIS (Netherlands)

    NAGGERT, J; NARASIMHAN, ML; DEVEAUX, L; CHO, HS; RANDHAWA, ZI; CRONAN, JE; GREEN, BN; SMITH, S

    1991-01-01

    The gene (tesB) encoding Escherichia coli thioesterase II, a low-abundance enzyme of unknown physiological function which can hydrolyze a broad range of acyl-CoA thioesters, has been localized by transposon mutagenesis, cloned and sequenced. A two-cistron construct containing both the lac and tesB p

  13. Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome

    NARCIS (Netherlands)

    Montaña, José Salvador; Jiménez Avella, Diego; Angel, Tatiana; Hernández, Mónica; Baena, Sandra

    2012-01-01

    Total metagenomic DNA was isolated from high Andean forest soil and subjected to taxonomical and functional composition analyses by means of clone library generation and sequencing. The obtained yield of 1.7 μg of DNA/g of soil was used to construct a metagenomic library of approximately 20,000 clon

  14. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  15. Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

    NARCIS (Netherlands)

    Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

    1998-01-01

    Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A putati

  16. [Analysis of the molecular characteristics and cloning of full-length coding sequence of interleukin-2 in tree shrews].

    Science.gov (United States)

    Huang, Xiao-Yan; Li, Ming-Li; Xu, Juan; Gao, Yue-Dong; Wang, Wen-Guang; Yin, An-Guo; Li, Xiao-Fei; Sun, Xiao-Mei; Xia, Xue-Shan; Dai, Jie-Jie

    2013-04-01

    While the tree shrew (Tupaia belangeri chinensis) is an excellent animal model for studying the mechanisms of human diseases, but few studies examine interleukin-2 (IL-2), an important immune factor in disease model evaluation. In this study, a 465 bp of the full-length IL-2 cDNA encoding sequence was cloned from the RNA of tree shrew spleen lymphocytes, which were then cultivated and stimulated with ConA (concanavalin). Clustal W 2.0 was used to compare and analyze the sequence and molecular characteristics, and establish the similarity of the overall structure of IL-2 between tree shrews and other mammals. The homology of the IL-2 nucleotide sequence between tree shrews and humans was 93%, and the amino acid homology was 80%. The phylogenetic tree results, derived through the Neighbour-Joining method using MEGA5.0, indicated a close genetic relationship between tree shrews, Homo sapiens, and Macaca mulatta. The three-dimensional structure analysis showed that the surface charges in most regions of tree shrew IL-2 were similar to between tree shrews and humans; however, the N-glycosylation sites and local structures were different, which may affect antibody binding. These results provide a fundamental basis for the future study of IL-2 monoclonal antibody in tree shrews, thereby improving their utility as a model.

  17. Genome-wide single nucleotide polymorphism-based assay for high-resolution epidemiological analysis of the methicillin-resistant Staphylococcus aureus hospital clone EMRSA-15.

    Science.gov (United States)

    Holmes, A; McAllister, G; McAdam, P R; Hsien Choi, S; Girvan, K; Robb, A; Edwards, G; Templeton, K; Fitzgerald, J R

    2014-02-01

    The EMRSA-15 clone is a major cause of nosocomial methicillin-resistant Staphylococcus aureus (MRSA) infections in the UK and elsewhere but existing typing methodologies have limited capacity to discriminate closely related strains, and are often poorly reproducible between laboratories. Here, we report the design, development and validation of a genome-wide single nucleotide polymorphism (SNP) typing method and compare it to established methods for typing of EMRSA-15. In order to identify discriminatory SNPs, the genomes of 17 EMRSA-15 strains, selected to represent the breadth of genotypic and phenotypic diversity of EMRSA-15 isolates in Scotland, were determined and phylogenetic reconstruction was carried out. In addition to 17 phylogenetically informative SNPs, five binary markers were included to form the basis of an EMRSA-15 genotyping assay. The SNP-based typing assay was as discriminatory as pulsed-field gel electrophoresis, and significantly more discriminatory than staphylococcal protein A (spa) typing for typing of a representative panel of diverse EMRSA-15 strains, isolates from two EMRSA-15 hospital outbreak investigations, and a panel of bacteraemia isolates obtained in healthcare facilities in the east of Scotland during a 12-month period. The assay is a rapid, and reproducible approach for epidemiological analysis of EMRSA-15 clinical isolates in Scotland. Unlike established methods the DNA sequence-based method is ideally suited for inter-laboratory comparison of identified genotypes, and its flexibility lends itself to supplementation with additional SNPs or markers for the identification of novel S. aureus strains in other regions of the world.

  18. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  19. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    Science.gov (United States)

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods.

  20. Cloning, Sequencing, and Expression of Selenoprotein Transcripts in the Turkey (Meleagris gallopavo).

    Science.gov (United States)

    Sunde, Roger A; Sunde, Gavin R; Sunde, Colin M; Sunde, Milton L; Evenson, Jacqueline K

    2015-01-01

    The minimum Se requirement for male turkey poults is 0.3 μg Se/g--three times higher than requirements found in rodents--based on liver and gizzard glutathione peroxidase-4 (GPX4) and GPX1 activities. In addition, turkey liver GPX4 activity is 10-fold higher and GPX1 activity is 10-fold lower than in rats, and both GPX1 and GPX4 mRNA levels are dramatically down-regulated by Se deficiency. Currently, the sequences of all annotated turkey selenoprotein transcripts and proteins in the NCBI database are only "predicted." Thus we initiated cloning and sequencing of the full turkey selenoprotein transcriptome to demonstrate expression of selenoprotein transcripts in the turkey, and to develop tools to investigate Se regulation of the full selenoproteome. Total RNA was isolated from six tissues of Se-adequate adult tom turkeys, and used to prepare reverse-transcription cDNA libraries. PCR primers were designed, based initially on chicken, rodent, porcine, bovine and human sequences and later on turkey shotgun cloning sequences. We report here the cloning of full transcript sequences for 9 selenoproteins, and 3'UTR portions for 15 additional selenoproteins, which include SECIS elements in 22 3'UTRs, and in-frame Sec (UGA) codons within coding regions of 19 selenoproteins, including 12 Sec codons in SEPP1. In addition, we sequenced the gap between two contigs from the shotgun cloning of the turkey genome, and found the missing sequence for the turkey Sec-tRNA. RTPCR was used to determine the relative transcript expression in 6 tissues. GPX3 expression was high in all tissues except kidney, GPX1 expression was high in kidney, SEPW1 expression was high in heart, gizzard and muscle, and SELU expression was high in liver. SEPP2, a selenoprotein not found in mammals, was highly expressed in liver but not in other tissues. In summary, transcripts for 24 selenoproteins are expressed in the turkey, not just predicted.

  1. Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

    Science.gov (United States)

    Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

    2012-01-01

    Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

  2. Nucleotide sequence analysis of a candidate gene for ataxia-telangiectasia group D (ATDC)

    Energy Technology Data Exchange (ETDEWEB)

    Leonhardt, E.A.; Kapp, L.N.; Young, B.R.; Murnane, J.P. (Univ. of California, San Francisco, CA (United States))

    1994-01-01

    A radioresistant cell clone (1B3) was previously isolated after transfection of an ataxia-telangiectasia (AT) group D cell line with a human cosmid library. A cosmid rescued from the integration site in 1B3 contained human DNA from chromosome position 11q23, the same region shown by both genetic linkage and chromosome transfer to contain the genes for AT complementation groups A/B, C, and D. A gene within the cosmid (ATDC) was found to produce mRNAs of different sizes. A cDNA for one of the most abundant mRNAs (3.0 kb) was isolated from a HeLa cell library. In the present study, the authors sequenced the 3.0-kb cDNA and the surrounding intron DNA in the cosmids. They used polymerase chain reaction, with primers in the introns, to confirm the number of exons and to analyze DNA from AT group D cells for mutations within this gene. Although no mutations were found, they do not rule out the possibility that mutations may be present within the regulatory sequences or coding sequences found in other mRNAs specific for this gene. From the sequence analysis, they found that the ATDC gene product is one of a group of proteins that share multiple zinc finger motifs and an adjacent leucine zipper motif. These proteins have been proposed to form homo- or hetero-dimers involved in nucleic acid binding, consistent with the fact that many of these proteins appear to be transcriptional regulatory factors involved in carcinogenesis and/or differentiation. The likelihood that the ATDC gene product is involved in transcriptional regulation could explain the pleiomorphic characteristics of AT, including abnormal cell cycle regulation. 36 refs., 5 figs., 2 tabs.

  3. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.

    Science.gov (United States)

    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M

    1991-08-27

    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  4. Cloning and DNA sequence analysis of a Lactococcus bacteriophage lysin gene.

    Science.gov (United States)

    Shearman, C; Underwood, H; Jury, K; Gasson, M

    1989-08-01

    A gene for the lysin of Lactococcus lactis bacteriphage phi vML3 was cloned using an Escherichia coli/bacteriophage lambda host-vector system. The gene was detected by its expression of antimicrobial activity against L. lactis cells in a bioassay. The cloned fragment was analysed by sub-cloning on to E. coli plasmid vectors and by restriction endonuclease and deletion mapping. Its entire DNA sequence was determined and an open reading frame for the lysin structural gene was identified. The sequenced lysin gene would express a protein of 187 amino acids with a molecular weight of 21,090, which is in good agreement with that of a protein detected after in vitro transcription and translation of DNA encoding the gene. Expression of the lysin gene in E. coli and B. subtilis from an adjacent bacteriophage promoter was readily detected but in L. lactis expression of lysin was found to be lethal. The bacteriophage phi vML3 lysin had sequence homology with protein 15 of B. subtilis bacteriophage PZA. This protein is involved in DNA packaging during bacteriophage maturation rather than in host cell lysis. The cloning and analysis of the phi vML3 lysin gene is of importance in further understanding lactic streptococcal bacteriophages, for the development of positive selection vectors and for biotechnological applications of relevance to the dairy industry.

  5. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  6. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  7. Complete nucleotide sequence analysis of the norovirus GII.4 Sydney variant in South Korea.

    Science.gov (United States)

    Park, Ji-Sun; Lee, Sung-Geun; Jin, Ji-Young; Cho, Han-Gil; Jheong, Weon-Hwa; Paik, Soon-Young

    2015-01-01

    Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4) was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF) composites throughout the whole genome: ORF1 (5,100 bp), ORF2 (1,623 bp), and ORF3 (807 bp). Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  8. Complete nucleotide sequence of a Spanish isolate of Parietaria mottle virus infecting tomato.

    Science.gov (United States)

    Galipienso, Luis; Rubio, Luis; López, Luis; Soler, Salvador; Aramburu, José

    2009-10-01

    The genome of a Spanish isolate of Parietaria mottle virus (PMoV) obtained from tomato (strain PMoV-T) was completely sequenced. Protein motifs conserved for RNA viruses were identified: the p1 protein contained a metyltransferase domain in its N-terminal half and a triphosphatase/ helicase domain in its C-terminal half, the p2 protein contained a RNA polymerase domain; the 3a protein contained a RNA-binding domain with α-helix and β-sheet secondary structures. In addition, stem-loop structures with potential capacity of protein interactions were predicted on the untranslated terminal regions. Comparison with the other sequenced PMoV isolate showed nucleotide identities of 93, 90, and 93% for genomic RNAs 1, 2 and 3, respectively, and amino acid identities ranging from 88 to 97% for the different proteins. A cytosine deletion was detected at position 1,366 of RNA 3, involving a start codon for the coat protein (CP) gene different from the other PMoV isolate, resulting in a CP 16 amino acids shorter. Comparison of synonymous and nonsynonymous mutations revealed different selective constraints along the genome.

  9. BIND – An algorithm for loss-less compression of nucleotide sequence data

    Indian Academy of Sciences (India)

    Tungadri Bose; Monzoorul Haque Mohammed; Anirban Dutta; Sharmila S Mande

    2012-09-01

    Recent advances in DNA sequencing technologies have enabled the current generation of life science researchers to probe deeper into the genomic blueprint. The amount of data generated by these technologies has been increasing exponentially since the last decade. Storage, archival and dissemination of such huge data sets require efficient solutions, both from the hardware as well as software perspective. The present paper describes BIND – an algorithm specialized for compressing nucleotide sequence data. By adopting a unique ‘block-length’ encoding for representing binary data (as a key step), BIND achieves significant compression gains as compared to the widely used general purpose compression algorithms (gzip, bzip2 and lzma). Moreover, in contrast to implementations of existing specialized genomic compression approaches, the implementation of BIND is enabled to handle non-ATGC and lowercase characters. This makes BIND a loss-less compression approach that is suitable for practical use. More importantly, validation results of BIND (with real-world data sets) indicate reasonable speeds of compression and decompression that can be achieved with minimal processor/memory usage. BIND is available for download at http://metagenomics.atc.tcs.com/compression/BIND. No license is required for academic or non-profit use.

  10. Molecular cloning, sequence analysis and expression of genome segment 7 (S7) of Antheraea mylitta cypovirus (AmCPV) that encodes a viral structural protein.

    Science.gov (United States)

    Chavali, Venkata Ramana Murthy; Ghosh, Ananta K

    2007-10-01

    The Genome segment 7 (S7) of the 11 double stranded RNA genomes from Antheraea mylitta cypovirus (AmCPV) was converted to cDNA, cloned and sequenced. The nucleotide sequence showed that segment 7 consisted of 1789 nucleotides with an ORF of 530 amino acids and could encode a protein of approximately 61 kDa, termed P61. The 5' terminal sequence, AGTAAT and the 3' terminal sequence, AGAGC of the plus strand was found to be the same as genome segment 10 of AmCPV encoding polyhedrin. No sequence similarity was found by searching nucleic acid and protein sequence databases using BLAST. The secondary structure prediction showed the presence of 17 alpha-helices, 18 extended beta-sheets along the entire length of P61. The ORF of segment 7 was expressed in E. coli as His-tagged fusion protein, purified through Ni-NTA chromatography, and polyclonal antibody was raised in rabbit indicating that P61 is immunogenic. Immunoblot analysis using this antibody on viral infected cells as well as purified polyhedra showed that P61 is a viral structural protein. Motif scan search showed some similarity of P61 with Inosine monophosphate dehydrogenase (IMPDH) cystathionine-beta-synthase (CBS) domain at the C-terminus and it was hypothesized that by binding to single stranded viral RNA through its CBS domain P61 may help in virus replication or transcription.

  11. Complete genomic sequence and an infectious BAC clone of feline herpesvirus-1 (FHV-1).

    Science.gov (United States)

    Tai, S H Sheldon; Niikura, Masahiro; Cheng, Hans H; Kruger, John M; Wise, Annabel G; Maes, Roger K

    2010-06-05

    Infection with feline herpesvirus-1 (FHV-1) is a major cause of upper respiratory and ocular diseases in Felidae. We report the first complete genomic sequence of FHV-1, as well as the construction and characterization of a bacterial artificial chromosome (BAC) clone of FHV-1, which contains the entire FHV-1 genome and has the BAC vector inserted at the left end of U(L). Complete genomic sequences were derived from both the FHV-1 BAC clone and purified virion DNA. The FHV-1 genome is 135,797bp in size with an overall G+C content of 45%. A total of 78 open reading frames were predicted, encoding 74 distinct proteins. The gene arrangement is collinear with that of most sequenced varicelloviruses. The virus regenerated from the BAC was very similar to the parental C-27 strain in vitro in terms of plaque morphology and growth characteristics and highly virulent in cats in a preliminary in vivo study.

  12. Cloning and characterization of the Dictyostelium discoideum rasG genomic sequences.

    Science.gov (United States)

    Robbins, S M; Williams, J G; Spiegelman, G B; Weeks, G

    1992-02-28

    A Dictyostelium discoideum genomic DNA clone containing the ras-related gene, rasG was isolated using the rasG cDNA as a probe. The genomic clone encompasses the entire coding region of the gene and 1.5 kb of 5' flanking region. The rasG gene contains a single intron as determined by sequence comparison with the cDNA, whereas the highly related rasD gene contains three introns. Primer extension analysis showed that transcription of the rasG gene initiates at multiple sites. Sequence analysis of the 5' flanking region of the gene revealed a stretch of thymine residues upstream from the transcription start sites but there is no evidence for a TATA box sequence.

  13. HMW glutenin subunits in multiploid Aegilops species: composition analysis and molecular cloning of coding sequences

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The Aegilops genus contains species closely related to wheat. Incommon with wheat, Aegilops species accumulate high molecular weight (HMW) glutenin subunits in their endospermic tissue. In this study, we investigated the composition of HMW glutenin subunits in four multiploid Aegilops species using SDS-PAGE analysis. Furthermore, by working with Ae. ventricosa, we established an efficient genomic PCR condition for simultaneous amplification of DNA sequences coding for either x-ory-type HMW glutenin subunits from polyploid Aegilops species. Using the genomic PCR condition, we amplified and subsequently cloned two DNA fragments that may code for HMW glutenin subunits in Ae. ventricosa. Based on an analysis of the deduced amino acid sequences, we concluded that the two cloned sequences encode one x- and one y-type of HMW glutenin subunit, respectively.

  14. Anti-DNA antibodies: Sequencing, cloning, and expression

    Energy Technology Data Exchange (ETDEWEB)

    Barry, M.M.

    1992-01-01

    To gain some insight into the mechanism of systemic lupus erythematosus, and the interactions involved in proteins binding to DNA four anti-DNA antibodies have been investigated. Two of the antibodies, Hed 10 and Jel 242, have previously been prepared from female NZB/NZW mice which develop an autoimmune disease resembling human SLE. The remaining two antibodies, Jel 72 and Jel 318, have previously been produced via immunization of C57BL/6 mice. The isotypes of the four antibodies investigated in this thesis were determined by an enzyme-linked-immunosorbent assay. All four antibodies contained [kappa] light chains and [gamma]2a heavy chains except Jel 318 which contains a [gamma]2b heavy chain. The complete variable regions of the heavy and light chains of these four antibodies were sequenced from their respective mRNAs. The gene segments and variable gene families expressed in each antibody were identified. Analysis of the genes used in the autoimmune anti-DNA antibodies and those produced by immunization indicated no obvious differences to account for their different origins. Examination of the amino acid residues present in the complementary-determining regions of these four antibodies indicates a preference for aromatic amino acids. Jel 72 and Jel 242 contain three arginine residues in the third complementary-determining region. A single-chain Fv and the variable region of the heavy chain of Hed 10 were expressed in Escherichia coli. Expression resulted in the production of a 26,000 M[sub r] protein and a 15,000 M[sub r] protein. An immunoblot indicated that the 26,000 M[sub r] protein was the Fv for Hed 10, while the 15,000 M[sub r] protein was shown to bind poly (dT). The contribution of the heavy chain to DNA binding was assessed.

  15. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S.; Drusiani, E.; Battini, R.; Fregni, M.

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  16. Construction and utility of 10-kb libraries for efficient clone-gap closure for rice genome sequencing.

    Science.gov (United States)

    Yang, Tae-Jin; Yu, Yeisoo; Nah, Gyoungju; Atkins, Michael; Lee, Seunghee; Frisch, David A; Wing, Rod A

    2003-08-01

    Rice is an important crop and a model system for monocot genomics, and is a target for whole genome sequencing by the International Rice Genome Sequencing Project (IRGSP). The IRGSP is using a clone by clone approach to sequence rice based on minimum tiles of BAC or PAC clones. For chromosomes 10 and 3 we are using an integrated physical map based on two fingerprinted and end-sequenced BAC libraries to identifying a minimum tiling path of clones. In this study we constructed and tested two rice genomic libraries with an average insert size of 10 kb (10-kb library) to support the gap closure and finishing phases of the rice genome sequencing project. The HaeIII library contains 166,752 clones covering approximately 4.6x rice genome equivalents with an average insert size of 10.5 kb. The Sau3AI library contains 138,960 clones covering 4.2x genome equivalents with an average insert size of 11.6 kb. Both libraries were gridded in duplicate onto 11 high-density filters in a 5 x 5 pattern to facilitate screening by hybridization. The libraries contain an unbiased coverage of the rice genome with less than 5% contamination by clones containing organelle DNA or no insert. An efficient method was developed, consisting of pooled overgo hybridization, the selection of 10-kb gap spanning clones using end sequences, transposon sequencing and utilization of in silico draft sequence, to close relatively small gaps between sequenced BAC clones. Using this method we were able to close a majority of the gaps (up to approximately 50 kb) identified during the finishing phase of chromosome-10 sequencing. This method represents a useful way to close clone gaps and thus to complete the entire rice genome.

  17. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  18. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  19. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    Science.gov (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  20. Nucleotide sequences of genome segments S6, S7 and S10 of Dendrolimus punctatus cypovirus 1.

    Science.gov (United States)

    Hong, J J; Duan, J L; Zhao, S L; Xu, H G; Peng, H Y

    2004-01-01

    The nucleotide sequences of genome segments S6, S7 and S10 of Dendrolimus punctatus cypovirus 1 Hunan I (DpCPV-HN(I)) and DpCPV-HN(I)-Se(3) (DpCPV-HN(I) passed three times in Spodoptera exigua) were determined. Segment S10 was 944 nucleotides in length and encoded a polyhedrin of 248 amino acids (28,439 Da). Only two nucleotide mutations were found between DpCPV-HN(I) S10 and DpCPV-HN(I)-Se3 S10, and the deduced amino acid sequences of the polyhedrin proteins were identical. Segment S7, 1 501 nucleotides, encoded a protein of 448 amino acids ( approximately 50 kDa; p50). Thirty-one nucleotide mutations were found between DpCPV-HN(I) S7 and DpCPV-HN(I)-Se3 S7, but these resulted in only four amino acid changes. DpCPV-HN(I) S6 encoded a protein of 561 amino acids (63,688 Da; p64). The amino acid sequence of p64, had a high leucine content (10%), and contained a leucine zipper motif and one ATP/GTP-binding site motif.

  1. Comparison of next-generation sequencing and clone-based sequencing in analysis of hepatitis B virus reverse transcriptase quasispecies heterogeneity.

    Science.gov (United States)

    Gong, Ling; Han, Yue; Chen, Li; Liu, Feng; Hao, Pei; Sheng, Jia; Li, Xin-Hua; Yu, De-Min; Gong, Qi-Ming; Tian, Fei; Guo, Xiao-Kui; Zhang, Xin-Xin

    2013-12-01

    We previously reported that, based on clone-based sequencing (CBS), hepatitis B virus (HBV) heterogeneity within the reverse transcriptase (RT) region was a predictor of antiviral efficacy. Here, by comparing ultradeep pyrosequencing (UDPS), i.e., next-generation sequencing (NGS), with CBS in characterizing the genetic heterogeneity of HBV quasispecies within the RT region, we evaluated the performance of UDPS in the analysis of HBV viral populations. HBV genomic DNA was extracted from serum samples from 31 antiviral treatment-naive patients with chronic hepatitis B. The RT region quasispecies were analyzed in parallel using CBS and UDPS. Characterization of quasispecies heterogeneity was conducted using bioinformatics analysis. Quasispecies complexity values were calculated with the formula Sn = -Σi(pilnpi)/lnN. The number of qualified strains obtained by UDPS was much larger than that obtained by CBS (P quasispecies complexity values at the nucleotide level for the two methods (P quasispecies simulation than that by the CBS method, although imperfect, and thus sheds light on the future clinical application of NGS in HBV quasispecies studies.

  2. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    obtained further predicted an arginine-rich sequence (RPRR) immediately upstream of the N-terminal threonine of C5a, indicating that the promolecule form of C5 is synthesized with a beta alpha-chain orientation as previously shown for pro-C3 and pro-C4. The C5 cDNA clone was sheared randomly by sonication......We have used available protein sequence data for the anaphylatoxin (C5a) portion of the fifth component of human complement (residues 19-25) to synthesize a mixed-sequence oligonucleotide probe. The labeled oligonucleotide was then used to screen a human liver cDNA library, and a single candidate cDNA...... clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence...

  3. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  4. Genomic clones of bovine parvovirus: Construction and effect of deletions and terminal sequence inversions on infectivity

    Energy Technology Data Exchange (ETDEWEB)

    Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C. (Virginia Polytechnic Institute and State Univ., Blacksburg (USA))

    1988-02-01

    Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3{prime})-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3{prime} flip and 3{prime} flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of ({sup 35}S)methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3{prime}-terminal deletions was prepared from separately subcloned 3{prime}-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3{prime} end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus.

  5. Cloning and sequencing of cagA gene fragment of Helicobacter pylori with coccoid form

    Institute of Scientific and Technical Information of China (English)

    Ke-Xia Wang; Xue-Feng Wang

    2004-01-01

    AIM: To clone and sequence the cagA gene fragment of Helicobacter pylori ( H pylori) with coccoid form.METHODS: H pylori strain NCTC11637 were transformed to coccoid form by exposure to antibiotics in subinhibitory concentrations. The coccoid H pyloriwas collected. cagA gene of the coccoid H pylori strain was amplified by PCR.After purified, the target fragment was cloned into plasmid pMD-18T. The recombinant plasmid pMD-18T-cagA was transformed into E. coli JM109. Positive clones were screened and identified by PCR and digestion with restriction endonucleases. The sequence of inserted fragment was then analysed.RESULTS: cagA gene of 3 444 bp was obtained from the coccoid H pylori genome DNA. The recombinant plasmid pMD-18T-cagA was constructed, then it was digested by BamH Ⅰ+Sac Ⅰ, and the product of digestion was identical with the predicted one. Sequence analysis showed that the homology of coccoid and the reported original sequence H pylori was 99.7%.CONCLUSION: The recombinant plasmid containing cagA gene from coccoid H pylori has been constructed successfully.The coccoid H pylori contain completed cagA gene, which may be related to pathogenicity of them.

  6. Cloning,sequence analysis and expression in E.coli of the group 3 allergen of Dermatophagoides farinae

    Institute of Scientific and Technical Information of China (English)

    CUI Yu-bao; CAI Hong-xing; LI Li; ZHOU Ying; GAO Cui-xiang; SHI Wei-hong; YU Ming

    2009-01-01

    Background The dust mites,which are mostly represented by Dermatophagoides spp.(Acari:Pyroglyphidae),are the major sources of indoor allergens.Identification and characterization of these mite allergen molecules are an important step in the development of new effective diagnostic procedures and possible therapeutic strategies for allergic disorders associated with dust mites.Methods Total RNA was extracted from Derrnatophagoides farinae.The gene coding for Der f 3 was amplified by RT-PCR with the primers designed based on previous sequence published in GenBank.The target gene was cloned intermediately into pMD19-T plasmid and finally into plasmid pET28a(+),expressed in E.coli BL21 at the aid of the inducer isopropyI-D-thiogalactopyranoside(IPTG).The physicochemical properties,spatial structure of the allergen were analyzed with bioinformatics software.Results The cDNA coding for group 3 allergen of Dermatophagoides farinae from China was cloned and expressed successfully.Sequencing analysis showed that there were nineteen mismatched nucleotides in five Der f 3 cDNA clones in comparison with the reference(GenBank Accession No.AY283291),which resulted in deduced amino acid sequence incompatibility in eleven residues.Bioinformatics analysis revealed that the Der f 3 pro-protein was an extracellular hydrophobic protein,consisting of 259 amino acids with a 16 amino acid signal peptide.The protein was deduced to have three chymotrypsin active sites(53-68 AA,108-122 AA and 205-217 hA),one N-glycosylation site,one cAMP-and cGMP-dependent protein kinase phosphorylation site,four protein kinase C phosphorylation sites,two casein kinase Ⅱ phosphorylation sites,and five N-myristoylation sites.Conclusions Der f 3 is an extracellular hydrophobic protein which possesses multiple activation and phosphorylation sites.Polymorphism may exist in the Der f3 gene but this needs to be further confirmed in the future.

  7. Nucleotide sequences of two fimbrial major subunit genes, pmpA and ucaA, from canine-uropathogenic Proteus mirabilis strains.

    Science.gov (United States)

    Bijlsma, I G; van Dijk, L; Kusters, J G; Gaastra, W

    1995-06-01

    Proteus mirabilis strains were isolated from dogs with urinary tract infection (UTI) and fimbriae were prepared from two strains. The N-terminal amino acid sequences of the major fimbrial subunits were determined and both sequences appeared identical to the N-terminal amino acid sequence of a urinary cell adhesin (UCA) (Wray, S. K., Hull, S. I., Cook, R. G., Barrish, J. & Hull, R. A., 1986, Infect Immun 54, 43-49). The genes of two different major fimbrial subunits were cloned using oligonucleotide probes that were designed on the basis of the N-terminal UCA sequence. Nucleotide sequencing revealed the complete ucaA gene of 540 bp (from strain IVB247) encoding a polypeptide of 180 amino acids, including a 22 amino acid signal sequence peptide, and the pmpA (P. mirabilis P-like pili) gene of 549 bp (from strain IVB219) encoding a polypeptide of 183 amino acids, including a 23 amino acid signal sequence. Hybridization experiments gave clear indications of the presence of both kinds of fimbriae in many UTI-related canine P. mirabilis isolates. However, the presence of these fimbriae could not be demonstrated in P. vulgaris or other Proteus-related species. Database analysis of amino acid sequences of major subunit proteins revealed that the UcaA protein shares about 56% amino acid identity with the F17A and F111A major fimbrial subunits from bovine enterotoxigenic Escherichia coli. In turn, the PmpA protein more closely resembled the pyelonephritis-associated pili (Pap)-like major subunit protein from UTI-related E. coli. The evolutionary relationship of UcaA, PmpA and various other fimbrial subunit proteins is presented in a phylogenetic tree.

  8. Nucleotide and protein sequences for dog masticatory tropomyosin identify a novel Tpm4 gene product.

    Science.gov (United States)

    Brundage, Elizabeth A; Biesiadecki, Brandon J; Reiser, Peter J

    2015-10-01

    Jaw-closing muscles of several vertebrate species, including members of Carnivora, express a unique, "masticatory", isoform of myosin heavy chain, along with isoforms of other myofibrillar proteins that are not expressed in most other muscles. It is generally believed that the complement of myofibrillar isoforms in these muscles serves high force generation for capturing live prey, breaking down tough plant material and defensive biting. A unique isoform of tropomyosin (Tpm) was reported to be expressed in cat jaw-closing muscle, based upon two-dimensional gel mobility, peptide mapping, and immunohistochemistry. The objective of this study was to obtain protein and gene sequence information for this unique Tpm isoform. Samples of masseter (a jaw-closing muscle), tibialis (predominantly fast-twitch fibers), and the deep lateral gastrocnemius (predominantly slow-twitch fibers) were obtained from adult dogs. Expressed Tpm isoforms were cloned and sequencing yielded cDNAs that were identical to genomic predicted striated muscle Tpm1.1St(a,b,b,a) (historically referred to as αTpm), Tpm2.2St(a,b,b,a) (βTpm) and Tpm3.12St(a,b,b,a) (γTpm) isoforms (nomenclature reflects predominant tissue expression ("St"-striated muscle) and exon splicing pattern), as well as a novel 284 amino acid isoform observed in jaw-closing muscle that is identical to a genomic predicted product of the Tpm4 gene (δTpm) family. The novel isoform is designated as Tpm4.3St(a,b,b,a). The myofibrillar Tpm isoform expressed in dog masseter exhibits a unique electrophoretic mobility on gels containing 6 M urea, compared to other skeletal Tpm isoforms. To validate that the cloned Tpm4.3 isoform is the Tpm expressed in dog masseter, E. coli-expressed Tpm4.3 was electrophoresed in the presence of urea. Results demonstrate that Tpm4.3 has identical electrophoretic mobility to the unique dog masseter Tpm isoform and is of different mobility from that of muscle Tpm1.1, Tpm2.2 and Tpm3.12 isoforms. We

  9. Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

    Science.gov (United States)

    Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

    2016-06-01

    We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification.

  10. [Nucleotide sequence analysis of a species specific probe by an inserted fragment from recombinant plasmid pCX7 of L. interrogans sensu stricto serovar lai].

    Science.gov (United States)

    Dai, B; Xiao, J; Yan, Z; Shen, C; Li, S; Fang, Z

    1998-12-01

    The etiological agents of leptospirosis are the pathogenic leptospires (L. interrogans sensu lato) which can be divided into 223 serovars organized into 23 serogroups. The serovar remains the basic taxon, but serotyping may now be accomplished and recognized by acceptable methods. Complementary molecular approaches are being used extensively to assess genetic relatedness amongst leptospires with restriction endonuclese analysis (REA), pulse field gel electrophoresis (PFGE) and DNA-DNA hybridization as well established tools. However, the method is cumbersome and unsuitable for routine application. To develop a sensitive and specific method for identification of pathogenic leptospires, a genomic library of L. interrogans sensu stricto serovar lai was constructed with the plasmid vector pUC9. A recombinant plasmid, designated pCX7 which has homologous fragment of pathogenic leptospires was screened from the bank. pCX7 could recognize pathogenic leptospiral DNA fragment 1.7 kb of strain 017 without cross hybridization to nonpathogenic leptospiral DNA. Inserted fragment of pCX7 DNA sequencing was performed by Dr. Yan Zhengxin (Max-Plank-Institut fur Biology, Tubingen, Germany). Insert fragment was cloned into pBluescript and sequenced by using ABI(Applied Bio. Systems, Model 373A). Nucleotide sequences were analyzed by Dr. Xiao Jianguo (Texas University Medical School and School of Public Health, Center for Infectious Diseases) using a suit of computer program (NIH). One open reading frame of 306 nucleotids were identified. There were identifiable initiation codons, terminators, pribnow box and sextama box within the sequenced regions. These results further confirmed that the little homology between L. interrogans sensu strito and L. borgpeterseni serovar javanica, L. inadai serovar ranarun and serovar manhao (L. genomospecies 2), L. biflexa serovar patoc, L. illini. pCX7 DNA probe could provide a base for identification and classification of leptospires.

  11. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  12. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  13. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    2016-01-01

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  14. Nucleotide Sequence and Evolution of the Five-Plasmid Complement of the Phytopathogen Pseudomonas syringae pv. maculicola ES4326

    OpenAIRE

    2004-01-01

    Plasmids are transmissible, extrachromosomal genetic elements that are often responsible for environmental or host-specific adaptations. In order to identify the forces driving the evolution of these important molecules, we determined the complete nucleotide sequence of the five-plasmid complement of the radish and Arabidopsis pathogen Pseudomonas syringae pv. maculicola ES4326 and conducted an intraspecific comparative genomic analysis. To date, this is the most complex fully sequenced plasm...

  15. Homology between nucleotide sequences of promoter regions of nah and sal operons of NAH7 plasmid of Pseudomonas putida.

    OpenAIRE

    1986-01-01

    The in vivo transcription start sites of the nah and sal operons of the NAH7 plasmid were determined by S1 nuclease mapping and the nucleotide sequence surrounding these transcription start sites was determined. Since expression of both of these operons is coordinately controlled by the product of the transcriptional activator gene nahR, the sequences were compared to locate potential sites involved in common regulation. In the 100-base-pair region preceding transcription start sites of both ...

  16. Cloning and sequencing of the central region of the flagellin gene from the Gram-positive bacterium Clostridium tyrobutyricum ATCC 25755.

    Science.gov (United States)

    Arnold, F; Bédouet, L; Batina, P; Robreau, G

    1999-01-01

    The purpose of this study was to sequence the central part of the coding region of the Clostridium tyrobutyricum fiagellin gene to improve the immunoenzymatic counting of cells after milk filtration. The coding region was amplified by PCR, and the amplified products were cloned. A DNA sequence analysis of positive clones gave us 1,131 nucleotides with a partial calculated flagellin molecular mass of 40,143 Da. The flagellar filament protein sequence exhibited high levels of homology to sequences of flagellin protein from other bacteria in both N- and C-terminal parts, but little homology in the central domain. A PCR-restriction fragment length polymorphism analysis of amplified C. tyrobutyricum flagellin gene products confirmed the variability of the central domain. The flagellin mRNA was determined to be 1.1 kb in size, which suggests a monocistronic mRNA. Furthermore, the deduced protein flagellin contains eleven potential N-glycosylation sites and one sequence rich in serine, which could be modified by O-glycosylation.

  17. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  18. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  19. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  20. Cloning and Overexpression of the Triosephosphate Isomerase Genes from Psychrophilic and Thermophilic Bacteria. Structural Comparison of the Predicted Protein Sequences

    NARCIS (Netherlands)

    Rentier-Delrue, Françoise; Mande, Shekhar C.; Moyens, Sylvianne; Terpstra, Peter; Mainfroid, Véronique; Goraj, Karine; Lion, Michelle; Hol, Wim G.J.; Martial, Joseph A.

    1993-01-01

    We focused on the temperature adaptation of triosephosphate isomerase (TIM; E.C. 5.3.1.1.) by comparing the structure of TIMs isolated from bacterial organisms living in either cold or hot environments. The TIM gene from psychrophilic bacteria Moraxella sp. TA137 was cloned and its nucleotide sequen

  1. Presence of the delta-MSH sequence in a proopiomelanocortin cDNA cloned from the pituitary of the galeoid shark, Heterodontus portusjacksoni.

    Science.gov (United States)

    Dores, Robert M; Cameron, Erin; Lecaude, Stephanie; Danielson, Phillip B

    2003-08-01

    Since a fourth MSH sequence, delta-MSH, has been detected in the proopiomelanocortin (POMC) gene of a dogfish and a stingray, members of superorder Squalea (class Chondrichthyes), it is possible that this novel MSH sequence might be a feature common to the POMC genes of all modern sharks and rays. As an initial step towards addressing this question, a full-length POMC cDNA was cloned and sequenced from the pituitary of the Port Jackson shark, Heterodontus portusjacksoni. The Port Jackson shark represents one of the oldest lineages in superorder Galea, and this superorder together with superorder Squalea form infraclass Neoselachii (the extant sharks and rays). The Port Jackson shark POMC cDNA has an open reading frame that is 1032 nucleotides in length and encodes the deduced amino acids sequences for beta-endorphin, ACTH/alpha-MSH, beta-MSH, gamma-MSH, and delta-MSH. Port Jackson shark delta-MSH has 83% primary sequence identity with dogfish and stingray delta-MSH, and it appears that the delta-MSH sequence may have been the result of an internal domain duplication and reinsertion of the beta-MSH sequence. The presence of the delta-MSH sequence in the POMC genes of representatives of both superorders of infraclass Neoselachii would indicate that the delta-MSH sequence must have been present in the ancestral euselachian shark that gave rise to the neoselachian radiation.

  2. Structural organization, nucleotide sequence, and regulation of the Haemophilus influenzae rec-1+ gene.

    Science.gov (United States)

    Zulty, J J; Barcak, G J

    1993-11-01

    The Haemophilus influenzae rec-1+ protein plays a central role in DNA metabolism, participating in general homologous recombination, recombinational (postreplication) DNA repair, and prophage induction. Although many H. influenzae rec-1 mutants have been phenotypically characterized, little is known about the rec-1+ gene at the molecular level. In this study, we present the genetic organization of the rec-1+ locus, the DNA sequence of rec-1+, and studies of the transcriptional regulation of rec-1+ during cellular assault by DNA-damaging agents and during the induction of competence for genetic transformation. Although little is known about promoter structure in H. influenzae, we identified a potential rec-1+ promoter that is identical in 11 of 12 positions to the bacterial sigma 70-dependent promoter consensus sequence. Results from a primer extension analysis revealed that the start site of rec-1+ transcription is centered 6 nucleotides downstream of this promoter. We identified potential DNA binding sites in the rec-1+ gene for LexA, integration host factor, and cyclic AMP receptor protein. We obtained evidence that at least one of the proposed cyclic AMP receptor protein binding sites is active in modulating rec-1+ transcription. This finding makes rec-1+ control circuitry novel among recA+ homologs. Two H. influenzae DNA uptake sequences that may function as a transcription termination signal were identified in inverted orientations at the end of the rec-1+ coding sequence. In addition, we report the first use of the Escherichia coli lacZ operon fusion technique in H. influenzae to study the transcriptional control of rec-1+. Our results indicate that rec-1+ is transcriptionally induced about threefold during DNA-damaging events. Furthermore, we show that rec-1+ can substitute for recA+ in E. coli to modulate SOS induction of dinB1 expression. Surprisingly, although 5% of the H. influenzae genome is in the form of single-stranded DNA during competence for

  3. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  4. Cloning and Analysis of Telomere-associated Sequences of Ginkgo biloba L.

    Institute of Scientific and Technical Information of China (English)

    Liu Di; Lu Hai; Ji Fei-teng; Li Feng-lan; Guo Hui-hong

    2005-01-01

    Total genomic DNA was extracted from leaves of Ginkgo biloba L. by the method of hot CTAB. After determining quantification of DNA sample by microclorimetric spectrophotography, Arabidopsis-type telomere primer and Sau3A I cassette primer were used to isolate telomere-associated sequences from G. biloba L. by the method of cassette-ligation-mediated polymerase chain reaction (PCR). Using this method, two telomere-associated sequences, TAS 1 and TAS2, were isolated. The authors preformed Southern hybridization ofEcoR I -treated G. biloba genomic DNA with each clone. The hybridization pattern showed that the clones obtained were derived from G. biloba genomic DNA. There are the Arabidopsis-type TTTAGGG tandem repeats in telomeres of G.biloba.

  5. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  6. Draft Genome Sequences of the Probiotic Enterococcus faecalis Symbioflor 1 Clones DSM16430 and DSM16434

    OpenAIRE

    Fritzenwanker, Moritz; Chakraborty, Anindita; Hain, Torsten; Zimmermann, Kurt; Domann, Eugen

    2016-01-01

    The probiotic Symbioflor 1 is a historical concoction of 10 isolates of Enterococcus faecalis. Pulsed-field gel electrophoresis revealed two groups: one comprising eight identical clones (DSM16430, DSM16432, DSM16433, DSM16435 to DSM16439) and a further two isolates (DSM16431, DSM16434) with marginally different profiles. Here, we report a comparative analysis of the draft genome sequences of representative isolates.

  7. Draft Genome Sequences of the Probiotic Enterococcus faecalis Symbioflor 1 Clones DSM16430 and DSM16434

    OpenAIRE

    Fritzenwanker, Moritz; Chakraborty, Anindita; Hain, Torsten; Zimmermann, Kurt; Domann, Eugen

    2016-01-01

    The probiotic Symbioflor 1 is a historical concoction of 10 isolates of Enterococcus faecalis. Pulsed-field gel electrophoresis revealed two groups: one comprising eight identical clones (DSM16430, DSM16432, DSM16433, DSM16435 to DSM16439) and a further two isolates (DSM16431, DSM16434) with marginally different profiles. Here, we report a comparative analysis of the draft genome sequences of representative isolates.

  8. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    Science.gov (United States)

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  9. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    OpenAIRE

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  10. Distinctive nucleotide sequences of promoters recognized by RNA polymerase containing a phage-coded "sigma-like" protein.

    Science.gov (United States)

    Talkington, C; Pero, J

    1979-11-01

    We report the nucleotide sequences of two promoters for bacteriophage SP01 "middle" genes. These promoters are recognized by a modified form of Bacillus subtilis RNA polymerase that contains a phage-coded "sigma-like" regulatory protein (gp28) in place of the bacterial sigma factor. Both promoters shared the identical hexanucleotide 5'A-G-G-A-G-A at about 35 base pairs preceding the start point of transcription and the identical heptanucleotide 5'-T-T-T-A-T-T-T (T is the thymine analog 5-hydroxymethyluracil in SP01 DNA) located about 10 base pairs preceding the transcriptional start point. The significance of these sequences in comparison with nucleotide sequences of promoters recognized by sigma-containing RNA polymerases is discussed.

  11. Cloning, sequencing, and expression of the apa gene coding for the Mycobacterium tuberculosis 45/47-kilodalton secreted antigen complex.

    Science.gov (United States)

    Laqueyrerie, A; Militzer, P; Romain, F; Eiglmeier, K; Cole, S; Marchal, G

    1995-01-01

    Effective protection against a virulent challenge with Mycobacterium tuberculosis is induced mainly by previous immunization with living attenuated mycobacteria, and it has been hypothesized that secreted proteins serve as major targets in the specific immune response. To identify and purify molecules present in culture medium filtrate which are dominant antigens during effective vaccination, a two-step selection procedure was used to select antigens able to interact with T lymphocytes and/or antibodies induced by immunization with living bacteria and to counterselect antigens interacting with the immune effectors induced by immunization with dead bacteria. A Mycobacterium bovis BCG 45/47-kDa antigen complex, present in BCG culture filtrate, has been previously identified and isolated (F. Romain, A. Laqueyrerie, P. Militzer, P. Pescher, P. Chavarot, M. Lagranderie, G. Auregan, M. Gheorghiu, and G. Marchal, Infect. Immun. 61:742-750, 1993). Since the cognate antibodies recognize the very same antigens present in M. tuberculosis culture medium filtrates, a project was undertaken to clone, express, and sequence the corresponding gene of M. tuberculosis. An M. tuberculosis shuttle cosmid library was transferred in Mycobacterium smegmatis and screened with a competitive enzyme-linked immunosorbent assay to detect the clones expressing the proteins. A clone containing a 40-kb DNA insert was selected, and by means of subcloning in Escherichia coli, a 2-kb fragment that coded for the molecules was identified. An open reading frame in the 2,061-nucleotide sequence codes for a secreted protein with a consensus signal peptide of 39 amino acids and a predicted molecular mass of 28,779 Da. The gene was referred to as apa because of the high percentages of proline (21.7%) and alanine (19%) in the purified protein. Southern hybridization analysis of digested total genomic DNA from M. tuberculosis (reference strains H37Rv and H37Ra) indicated that the apa gene was present as a

  12. Nucleotide sequence and transcript organization of a region of the vaccinia virus genome which encodes a constitutively expressed gene required for DNA replication.

    Science.gov (United States)

    Roseman, N A; Hruby, D E

    1987-05-01

    A vaccinia virus (VV) gene required for DNA replication has been mapped to the left side of the 16-kilobase (kb) VV HindIII D DNA fragment by marker rescue of a DNA- temperature-sensitive mutant, ts17, using cloned fragments of the viral genome. The region of VV DNA containing the ts17 locus (3.6 kb) was sequenced. This nucleotide sequence contains one complete open reading frame (ORF) and two incomplete ORFs reading from left to right. Analysis of this region at early times revealed that transcription from the incomplete upstream ORF terminates coincidentally with the complete ORF encoding the ts17 gene product, which is directly downstream. The predicted proteins encoded by this region correlate well with polypeptides mapped by in vitro translation of hybrid-selected early mRNA. The nucleotide sequences of a 1.3-kb BglII fragment derived from ts17 and from two ts17 revertants were also determined, and the nature of the ts17 mutation was identified. S1 nuclease protection studies were carried out to determine the 5' and 3' ends of the transcripts and to examine the kinetics of expression of the ts17 gene during viral infection. The ts17 transcript is present at both early and late times postinfection, indicating that this gene is constitutively expressed. Surprisingly, the transcriptional start throughout infection occurs at the proposed late regulatory element TAA, which immediately precedes the putative initiation codon ATG. Although the biological activity of the ts17-encoded polypeptide was not identified, it was noted that in ts17-infected cells, expression of a nonlinked VV immediate-early gene (thymidine kinase) was deregulated at the nonpermissive temperature. This result may indicate that the ts17 gene product is functionally required at an early step of the VV replicative cycle.

  13. Cloning and Sequencing the y Subunit of R-Phycoerythrin from Corallina officinalis

    Institute of Scientific and Technical Information of China (English)

    WANGSheng; ZHONGFu-Di; WUZu-Jian; LINQi-Ying; XIELian-Hui

    2004-01-01

    The full-length cDNA of the γ subunit of R-phycoerythrin from Corallina officinalis L. was cloned by rapid amplification of cDNA ends (RACE) method, and sequenced. The full-length cDNA is a 2 308 bp consisting of 5' untranslated region (UTR) of 1 203 bp, an open reading frame (ORF) of 960 bp that encodes 320 amino acids, and 3' UTR of 145 bp. The mature γ polypeptide contains two unique internal repeat domains as reported by Apt et al. (2001). Sequence analysis of the different clones revealed different 3'-end sequences at the γ subunit. The difference between the 3'-end sequences suggests that the γ subunit may have more than one copy, or have gone through different post-transcriptional modification. By comparing the DNA and cDNA sequences, we found that the γ subunit is an intronless gene. This is thefirst report of the γ subunit gene of R-phycoerythrin from C. officinalis.

  14. Large scale single nucleotide polymorphism discovery in unsequenced genomes using second generation high throughput sequencing technology: applied to turkey

    Directory of Open Access Journals (Sweden)

    den Dunnen Johan T

    2009-10-01

    Full Text Available Abstract Background The development of second generation sequencing methods has enabled large scale DNA variation studies at moderate cost. For the high throughput discovery of single nucleotide polymorphisms (SNPs in species lacking a sequenced reference genome, we set-up an analysis pipeline based on a short read de novo sequence assembler and a program designed to identify variation within short reads. To illustrate the potential of this technique, we present the results obtained with a randomly sheared, enzymatically generated, 2-3 kbp genome fraction of six pooled Meleagris gallopavo (turkey individuals. Results A total of 100 million 36 bp reads were generated, representing approximately 5-6% (~62 Mbp of the turkey genome, with an estimated sequence depth of 58. Reads consisting of bases called with less than 1% error probability were selected and assembled into contigs. Subsequently, high throughput discovery of nucleotide variation was performed using sequences with more than 90% reliability by using the assembled contigs that were 50 bp or longer as the reference sequence. We identified more than 7,500 SNPs with a high probability of representing true nucleotide variation in turkeys. Increasing the reference genome by adding publicly available turkey BAC-end sequences increased the number of SNPs to over 11,000. A comparison with the sequenced chicken genome indicated that the assembled turkey contigs were distributed uniformly across the turkey genome. Genotyping of a representative sample of 340 SNPs resulted in a SNP conversion rate of 95%. The correlation of the minor allele count (MAC and observed minor allele frequency (MAF for the validated SNPs was 0.69. Conclusion We provide an efficient and cost-effective approach for the identification of thousands of high quality SNPs in species currently lacking a sequenced genome and applied this to turkey. The methodology addresses a random fraction of the genome, resulting in an even

  15. Nucleotide sequence of the Syrian hamster intracisternal A-particle gene: close evolutionary relationship of type A particle gene to types B and D oncovirus genes.

    Science.gov (United States)

    Ono, M; Toh, H; Miyata, T; Awaya, T

    1985-08-01

    We determined the complete nucleotide sequence of the intracisternal A-particle gene, IAP-H18, cloned from the normal Syrian hamster liver DNA. IAP-H18 was 7,951 base pairs in length with two identical long terminal repeats of 376 base pairs at both ends. On the coding strand, imperfect open reading frames corresponding to gag and pol of the retrovirus genome were observed, whereas many stop codons were present in the region corresponding to env. The putative H18 gag gene (809 amino acids) had a sequence homologous to the N-terminal half of the mouse mammary tumor virus gag gene and locally to the Rous sarcoma virus gag gene. The putative H18 pol gene (900 residues) was homologous to the Rous sarcoma virus pol gene almost throughout the entire region. Two conserved regions among the retrovirus pol genes have been reported. One presumably corresponds to the DNA polymerase and the RNase H domain, and the other corresponds to the DNA endonuclease domain of the multifunctional protein pol. By the comparison of the deduced amino acid sequences of the putative endonuclease domain of six representative oncovirus genomes, a phylogenetic tree of the oncovirus genomes was constructed, and the intracisternal A-particle (type A) genome was found to be more closely related to the mouse mammary tumor virus (type B) and squirrel monkey retrovirus (type D) genomes.

  16. Nucleotide sequence of the GDH gene coding for the NADP-specific glutamate dehydrogenase of Saccharomyces cerevisiae.

    Science.gov (United States)

    Nagasu, T; Hall, B D

    1985-01-01

    The isolation of the Saccharomyces cerevisiae gene for NADP-dependent glutamate dehydrogenase (NADP-GDH) by cross hybridization to the Neurospora crassa am gene, known to encode for NADP-GDH is described. Two DNA fragments selected from a yeast genomic library in phage lambda gt11 were shown by restriction analysis to share 2.5 kb of common sequence. A yeast shuttle vector (CV13) carrying either to the cloned fragments complements the gdh- strain of S. cerevisiae and directs substantial overproduction of NADP-GDH. One of the cloned fragments was sequenced, and the deduced amino acid (aa) sequence of the yeast NADP-GDH is 64% homologous to N. crassa, 51% to Escherichia coli and 24% to bovine NADP-GDHs.

  17. Amplification, cloning, and sequencing of a nifH segment from aquatic microorganisms and natural communities.

    Science.gov (United States)

    Kirshtein, J D; Paerl, H W; Zehr, J

    1991-09-01

    By use of the polymerase chain reaction and degenerate oligonucleotide primers for highly conserved regions of nifH, a segment of nifH DNA was amplified from several aquatic microorganisms, including an N2-fixing bacterium closely associated with the marine filamentous cyanobacterium Trichodesmium sp., a heterotrophic isolate from the root/rhizome of the seagrass Ruppia maritima, and the heterocystous freshwater cyanobacterium Anabaena oscillarioides. nifH segments were amplified directly from DNA extracted from the rhizosphere of roots of the seagrass Halodule wrightii. The nifH fragments were then cloned and sequenced. The DNA and deduced amino acid sequences were compared with known sequences, revealing distinct differences between taxonomic groups. This technique was shown to be useful for (i) the detection of N2-fixing microorganisms and (ii) rapidly obtaining the DNA sequence of the nifH gene, which provides information about general taxonomic groups of N2-fixing microorganisms.

  18. Isolation, cloning and sequencing of AFLP markers related to disease-resistance traits in Fenneropenaeus chinensis

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Amplified fragment length polymorphisms (AFLP) technique was used to analyze the fingerprinting of four successive generations of Fenneropenaeus chinensis to reveal their disease-resistance traits. Some loci showed quite different genetic frequencies due to artificial selection, which implied that these fragments were putative markers related to the disease-resistance trait. We developed a simple and effective method to further characterize these AFLP fragments. Specific AFLP bands were cut directly from polyacrylamide gels,re-amplified, cloned and sequenced. Eight putative genetic markers were sequenced and their sizes ranged from 63 to 209 bp. The sequences were submitted to dbGSS (database of Genome Sequence Survey); and the BLAST analysis showed low similarity to the function genes, indicating these markers were tightly linked to a disease-resistance trait but were not functional genes.

  19. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

    Science.gov (United States)

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

    2011-10-01

    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  20. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings.

  1. Molecular cloning, sequencing and expression in Escherichia coli cells Thermus thermophilus leucyl-tRNA synthetase

    Directory of Open Access Journals (Sweden)

    Kovalenko O. P.

    2011-12-01

    Full Text Available Aim. Cloning and sequencing of the T. thermophilus leucyl-tRNA synthetase (LeuRSTT followed by the creation of genetically engineered construct for protein expression in E.coli cells and its purification. Methods. Searching for the LeuRSTT gene was performed by Southern blot hybridization with chromosomal DNA, where digoxigenin-labeled PCR fragments of DNA were used as probes. Results. The gene of T. thermophilus HB27 leucyl-tRNA synthetase was cloned and sequenced. The open reading frame encodes a polypeptide chain of 878 amino acid residues in length (molecular mass 101 kDa. Comparison of the amino acid sequence of T. thermophilus LeuRS with that of the enzymes from other organisms showed that LeuRSTT was a part of the group of similar enzymes of prokaryotes, formed by the proteins of protobacteriae, rickettsia and mitochondria of eukaryotes. The resulting phylogenetic tree of LeuRSs reveals dichotomous branching into two lines: prokaryotic/eukaryotic mitochondrial and arhaeal/eukaryotic cytosolic proteins. Differences between prokaryotic and arhaeal branches of the LeuRSs phylogenetic tree are primarily due to the structure of two domains of the enzyme – the editing and the C-terminal. T. thermophilus LeuRS was expressed in E. coli cells by cloning the corresponding gene into pET29b vector. Conclusions. The cloned T. thermophilus leuS gene and expressed recombinant protein will be used for structural and functional studies on LeuRSTT, including X-ray analysis of the enzyme and its mutant forms in complex with different substrates

  2. Cloning, Sequencing, and Expression of Selenoprotein Transcripts in the Turkey (Meleagris gallopavo.

    Directory of Open Access Journals (Sweden)

    Roger A Sunde

    Full Text Available The minimum Se requirement for male turkey poults is 0.3 μg Se/g--three times higher than requirements found in rodents--based on liver and gizzard glutathione peroxidase-4 (GPX4 and GPX1 activities. In addition, turkey liver GPX4 activity is 10-fold higher and GPX1 activity is 10-fold lower than in rats, and both GPX1 and GPX4 mRNA levels are dramatically down-regulated by Se deficiency. Currently, the sequences of all annotated turkey selenoprotein transcripts and proteins in the NCBI database are only "predicted." Thus we initiated cloning and sequencing of the full turkey selenoprotein transcriptome to demonstrate expression of selenoprotein transcripts in the turkey, and to develop tools to investigate Se regulation of the full selenoproteome. Total RNA was isolated from six tissues of Se-adequate adult tom turkeys, and used to prepare reverse-transcription cDNA libraries. PCR primers were designed, based initially on chicken, rodent, porcine, bovine and human sequences and later on turkey shotgun cloning sequences. We report here the cloning of full transcript sequences for 9 selenoproteins, and 3'UTR portions for 15 additional selenoproteins, which include SECIS elements in 22 3'UTRs, and in-frame Sec (UGA codons within coding regions of 19 selenoproteins, including 12 Sec codons in SEPP1. In addition, we sequenced the gap between two contigs from the shotgun cloning of the turkey genome, and found the missing sequence for the turkey Sec-tRNA. RTPCR was used to determine the relative transcript expression in 6 tissues. GPX3 expression was high in all tissues except kidney, GPX1 expression was high in kidney, SEPW1 expression was high in heart, gizzard and muscle, and SELU expression was high in liver. SEPP2, a selenoprotein not found in mammals, was highly expressed in liver but not in other tissues. In summary, transcripts for 24 selenoproteins are expressed in the turkey, not just predicted.

  3. Cloning and sequence analysis of the partial sequence of the rbcL from Bryopsis hypnoides

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The partial sequence of the rbcL from Bryopsis hypnoides, including the sequences of the upstream, extron and partial intron, was amplified by PCR and their sequences were determined. With Spinacia oleracea as the outgroup, neighbor-joining method and maximum parsimony method were used respectively to build phylogenetic trees according to the rbcL exon sequence among 13species that were the typical species of six phyla. Two kinds of trees showed clearly that there were two groups among those species,the green lineage and the non-green lineage. And the relationships of algae in the green lineage were similar in the two trees but those in the non-green lineage were not consistent. Analysis of codon preference indicated that the codon preference of the rbcL exon of Bryopsis hypnoides distinctly differed from that of the relevant sequence of photosynthetic bacteria.

  4. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  5. Evaluation of the flanking nucleotide sequences of sarcomeric hypertrophic cardiomyopathy substitution mutations.

    Science.gov (United States)

    Meurs, Kathryn M; Mealey, Katrina L

    2008-07-03

    Hypertrophic cardiomyopathy (HCM) is a familial myocardial disease with a prevalence of 1 in 500. More than 400 causative mutations have been identified in 13 sarcomeric and myofilament related genes, 350 of these are substitution mutations within eight sarcomeric genes. Within a population, examples of recurring identical disease causing mutations that appear to have arisen independently have been noted as well as those that appear to have been inherited from a common ancestor. The large number of novel HCM mutations could suggest a mechanism of increased mutability within the sarcomeric genes. The objective of this study was to evaluate the most commonly reported HCM genes, beta myosin heavy chain (MYH7), myosin binding protein C, troponin I, troponin T, cardiac regulatory myosin light chain, cardiac essential myosin light chain, alpha tropomyosin and cardiac alpha-actin for sequence patterns surrounding the substitution mutations that may suggest a mechanism of increased mutability. The mutations as well as the 10 flanking nucleotides were evaluated for frequency of di-, tri- and tetranucleotides containing the mutation as well as for the presence of certain tri- and tetranculeotide motifs. The most common substitutions were guanine (G) to adenine (A) and cytosine (C) to thymidine (T). The CG dinucleotide had a significantly higher relative mutability than any other dinucleotide (pmutation was calculated; none were at a statistically higher frequency than the others. The large number of G to A and C to T mutations as well as the relative mutability of CG may suggest that deamination of methylated CpG is an important mechanism for mutation development in at least some of these cardiac genes.

  6. Agouti signalling protein (ASIP) gene: molecular cloning, sequence characterisation and tissue distribution in domestic goose.

    Science.gov (United States)

    Zhang, J; Wang, C; Liu, Y; Liu, J; Wang, H Y; Liu, A F; He, D Q

    2016-06-01

    Agouti signalling protein (ASIP) is an endogenous antagonist of melanocortin-1 receptor (MC1R) and is involved in the regulation of pigmentation in mammals. The objective of this study was to identify and characterise the ASIP gene in domestic goose. The goose ASIP cDNA consisted of a 44-nucleotide 5'-terminal untranslated region (UTR), a 390-nucleotide open-reading frame (ORF) and a 45-nucleotide 3'-UTR. The length of goose ASIP genomic DNA was 6176 bp, including three coding exons and two introns. Bioinformatic analysis indicated that the ORF encodes a protein of 130 amino-acid residues with a molecular weight of 14.88 kDa and an isoelectric point of 9.73. Multiple sequence alignments and phylogenetic analysis showed that the amino-acid sequence of ASIP was conserved in vertebrates, especially in the avian species. RT-qPCR showed that the goose ASIP mRNA was differentially expressed in the pigment deposition tissues, including eye, foot, feather follicle, skin of the back, as well as in skin of the abdomen. The expression level of the ASIP gene in skin of the abdomen was higher than that in skin of the back. Those findings will contribute to further understanding the functions of the ASIP gene in geese plumage colouring.

  7. Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

    Science.gov (United States)

    Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

    2013-08-01

    Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  8. Cloning and Sequence Analysis of cDNA Encoding MRJP3 of Apis cerana cerana

    Institute of Scientific and Technical Information of China (English)

    SU Song-kun; ZHNEG Huo-qing; CHEN Sheng-lu; ZHONG Bo-xiong; Stefan Albert

    2005-01-01

    By screening the worker (Apis cerana cerana) heads cDNA library using a fragment of the mrjp3 gene ofApis cerana as probe, 120 positive clones were obtained. The clone containing A. cerana cerana MRJP3 (AccMRJP3) cDNA was selected. Based on the sequencing of the inserts of the positive clone, a sequence of AccMRJP3 cDNA which is 1 887 bp long including a poly (A) tail was obtained. The AccMRJP3 cDNA encompassed an open-reading frame (ORF) with 1 779 bp encoding 593 amino acids. The un-translated regions (UTR) of the 5' end and 3' end are 46 bp and 160 bp in length,respectively. Similar to AmMRJP3 and AdMRJP3, the putative AccMRJP3 also has a repetitive region. The comparison of the repetitive region of AccMRJP3, AmMRJP3 and AdMRJP3 shows some differences between them.

  9. Cloning, comparative mapping, and RNA expression of the mouse homologues of the Saccharomyces cerevisiae nucleotide excision repair gene RAD23.

    NARCIS (Netherlands)

    P.J. van der Spek (Peter); C.E. Visser (Cécile); F. Hanaoka (Fumio); B. Smit (Bep); A. Hagemeijer (Anne); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe Saccharomyces cerevisiae RAD23 gene is involved in nucleotide excision repair (NER). Two human homologs of RAD23, HHR23A and HHR23B (HGMW-approved symbols RAD23A and RAD23B), were previously isolated. The HHR23B protein is complexed with the protein defective in the cancer-prone

  10. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  11. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  12. Polymorphisms and ambiguous sites present in DNA sequences of Leishmania clones: looking closer.

    Science.gov (United States)

    Boité, Mariana Côrtes; de Oliveira, Taíse Salgado; Ferreira, Gabriel Eduardo Melim; Trannin, Marcos; dos Santos, Barbara Neves; Porrozzi, Renato; Cupolillo, Elisa

    2014-07-01

    In genetic studies of Leishmania parasites, co-dominant markers are chosen for their ability to detect heterozygous polymorphisms, to infer the occurrence of inbreeding and to resolve genetic variability. The majority of DNA sequence based reports perform conventional dye terminator cycle sequencing where perfectly ambiguous sites or double peaks in the chromatogram are interpreted as heterozygous strains. However, molecular peculiarities of the parasite such as aneuploidy, mixed populations and homologous recombination advise that data from regular DNA sequence analysis should be carefully evaluated. We report here a closer look at ambiguous sites observed in 6pgd DNA sequences obtained for a multilocus sequence analysis project on Leishmania (Viannia) strains. After comparing 286 DNA sequences from biological and molecular clones of six L. (Viannia) strains we could distinguish events that contribute to genetic variation in Leishmania (recombination, mutation, chromosomal mosaics). Also, the results suggest how diversity might not be completely revealed through regular DNA sequence analysis and demonstrate the importance for molecular epidemiology research to be aware of such possibilities while choosing samples for studies.

  13. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  14. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  15. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  16. Single-Nucleotide Polymorphisms Reveal Spatial Diversity Among Clones of Yersinia pestis During Plague Outbreaks in Colorado and the Western United States.

    Science.gov (United States)

    Lowell, Jennifer L; Antolin, Michael F; Andersen, Gary L; Hu, Ping; Stokowski, Renee P; Gage, Kenneth L

    2015-05-01

    In western North America, plague epizootics caused by Yersinia pestis appear to sweep across landscapes, primarily infecting and killing rodents, especially ground squirrels and prairie dogs. During these epizootics, the risk of Y. pestis transmission to humans is highest. While empirical models that include climatic conditions and densities of rodent hosts and fleas can predict when epizootics are triggered, bacterial transmission patterns across landscapes, and the scale at which Y. pestis is maintained in nature during inter-epizootic periods, are poorly defined. Elucidating the spatial extent of Y. pestis clones during epizootics can determine whether bacteria are propagated across landscapes or arise independently from local inter-epizootic maintenance reservoirs. We used DNA microarray technology to identify single-nucleotide polymorphisms (SNPs) in 34 Y. pestis isolates collected in the western United States from 1980 to 2006, 21 of which were collected during plague epizootics in Colorado. Phylogenetic comparisons were used to elucidate the hypothesized spread of Y. pestis between the mountainous Front Range and the eastern plains of northern Colorado during epizootics. Isolates collected from across the western United States were included for regional comparisons. By identifying SNPs that mark individual clones, our results strongly suggest that Y. pestis is maintained locally and that widespread epizootic activity is caused by multiple clones arising independently at small geographic scales. This is in contrast to propagation of individual clones being transported widely across landscapes. Regionally, our data are consistent with the notion that Y. pestis diversifies at relatively local scales following long-range translocation events. We recommend that surveillance and prediction by public health and wildlife management professionals focus more on models of local or regional weather patterns and ecological factors that may increase risk of widespread

  17. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  18. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations.

    Science.gov (United States)

    Manara, Richard M A; Tomasio, Susana; Khalid, Syma

    2015-01-27

    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is "exonuclease sequencing", in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  19. Cloning, DNA sequencing and heterologous expression of the gene for thermostable N-acylamino acid racemase from Amycolatopsis sp. TS-1-60 in Escherichia coli.

    Science.gov (United States)

    Tokuyama, S; Hatano, K

    1995-03-01

    The gene encoding the novel enzyme N-acylamino acid racemase (AAR) was cloned in recombinant phage lambda-4 from the DNA library of Amycolatopsis sp. TS-1-60, a rare actinomycete, using antiserum against the enzyme. The cloned gene was subcloned and transformed in Escherichia coli JM105 using pUC118 as a vector. The AAR gene consists of an open-reading frame of 1104 nucleotides, which specifies a 368-amino-acid protein with a molecular mass of 39411Da. The molecular mass deduced from the AAR gene is in good agreement with the subunit molecular mass (40kDa) of AAR from Amycolatopsis sp. TS-1-60. The guanosine plus cytosine content of the AAR gene was about 70%. Although the AAR gene uses the unusual initiation codon GTG, the gene was expressed in Escherichia coli using the lac promoter of pUC118. The amount of the enzyme produced by the transformant was 16 times that produced by Amycolatopsis sp. TS-1-60. When the unusual initiation codon GTG was changed to ATG, the enzyme productivity of the transformant increased to more than 37 times that of Amycolatopsis sp. TS-1-60. In the comparison of the DNA sequence and the deduced amino acid sequence of AAR with those of known racemases and epimerases in data bases, no significant sequence homology was found. However, AAR resembles mandelate racemase in that requires metal ions for enzyme activity.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Cloning, sequencing, and expression of interferon-γ from elk in North America

    Science.gov (United States)

    Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.

    2001-01-01

    Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

  1. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  2. CLONING, SEQUENCE ANALYSIS, AND CHARACTERIZATION OF PUTATIVE BETA-LACTAMASE OF STENOTROPHOMONAS MALTOPHILIA

    Directory of Open Access Journals (Sweden)

    Chong Seng Shueh

    2012-10-01

    Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.

  3. Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

    Science.gov (United States)

    Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

    2000-01-01

    We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

  4. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

      FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute...... for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  5. Construction of Agropyrum intermedium 2Ai-2 Chromosome DNA Library and Cloning of Species-Specific DNA Sequences

    Institute of Scientific and Technical Information of China (English)

    HE Cong-fen; MA You-zhi; XIN Zhi-yong; XU Qiong-fang; LI Lian-cheng

    2004-01-01

    The univalent from the meiosis-metaphase spreads of F1 (Z2× wheat variety Wan7107) was identified to be Agropyrum intermedium 2Ai-2 chromosome by GISH. The 2Ai-2 chromosomes were microisolated and collected. After two rounds of PCR amplification, the PCR products were ranged from 150 - 3 000 bp,with predominant fragments at about 200 - 2 000 bp. Using Ag.intermediumgenomic DNA as a probe, Southern blotting analysis confirmed the products originated from Ag. intermediumgenome. The products were purified, ligated to pUC18 and then transformed into competence E.coli DH5α to produce a 2Ai-2 chromosome DNA library. The microcloning experiments produced approximately 5×105 clones, the size range of the cloned inserts was 200- 1 500 bp, with an average of 580bp. Using Ag. intermediumgenomic DNA as a probe, dot blotting results showed that 56% clones are unique/low copy sequences, 44% are repetitive sequences in the library. Four Ag. intermedium clones were screened from the library by RFLP, and three clones(Mag065, Mag088, Mag139)belong to low/single sequences, one clone(Mag104)was repetitive sequence, and GISH results indicated that Mag104 was Ag.intermedium species-specific repetitive DNA sequence.

  6. Cloning and sequencing of a DNA fragment encoding N37 apoptotic peptide derived from p53

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective It was reported that p53 apoptotic peptide (N37) could inhibit p73 gene through being bound with iASPP,which could induce tumor cell apoptosis. To further explore the function of N37,we constructed the cloning plasmid of DNA fragment encoding p53 (N37) apoptotic peptide by using DNA synthesis and molecular biology methods. Methods According to human p53 sequence from the GenBank database,the primer of p53(N37) gene was designed using Primer V7.0 software. The DNA fragment encoding p53 (N37) apopto...

  7. Whole genome comparison of donor and cloned dogs.

    Science.gov (United States)

    Kim, Hak-Min; Cho, Yun Sung; Kim, Hyunmin; Jho, Sungwoong; Son, Bongjun; Choi, Joung Yoon; Kim, Sangsoo; Lee, Byeong Chun; Bhak, Jong; Jang, Goo

    2013-10-21

    Cloning is a process that produces genetically identical organisms. However, the genomic degree of genetic resemblance in clones needs to be determined. In this report, the genomes of a cloned dog and its donor were compared. Compared with a human monozygotic twin, the genome of the cloned dog showed little difference from the genome of the nuclear donor dog in terms of single nucleotide variations, chromosomal instability, and telomere lengths. These findings suggest that cloning by somatic cell nuclear transfer produced an almost identical genome. The whole genome sequence data of donor and cloned dogs can provide a resource for further investigations on epigenetic contributions in phenotypic differences.

  8. Nucleotide Sequence of the Coat Protein Gene of the Malaysian Passiflora Virus and its 3' Non-Coding Region

    Directory of Open Access Journals (Sweden)

    Norzihan Abdullah

    2009-01-01

    Full Text Available Problem statement: In this study, we identified the full length Coat Protein (CP gene of the Malaysian Passiflora Virus (MPV and its 3' non-coding region. The CP gene of the MPV contained 285 amino acid residues. Approach: Pairwise comparison of the MPV CP region with four other potyviruses, namely East Asian Passiflora Virus (EAPV, Passionfruit Woodiness Virus (PWV, Bean Common Mosaic Virus (BCMV and Soyabean Mosaic Virus (SMV revealed amino acid sequence similarities ranging from 72-95%. Results: The 3' non-coding region of the MPV, which consists of 255 nucleotides, showed 69-95% nucleotide sequence identity when compared with the four potyviruses. The highest (95% sequence similarities were detected with PWV and EAPV. An analysis of the deduced amino acid sequences revealed the presence of consensus motifs (DAG tripeptides characteristic of potyviruses. DAG tripeptides had been reported to be essential for aphid transmission. Conclusion: From the amino acid sequence alignment and identity level observed among the four other potyviruses, we concluded that MPV is a member of the genus Potyvirus and was closely related to both PWV and EAPV.

  9. Cloning and Sequencing of Leishmania major Thiol-Specific-Antioxidant Antigen (TSA Gene

    Directory of Open Access Journals (Sweden)

    F Tabatabaie

    2007-08-01

    Full Text Available Background: Leishmaniasis is caused by parasitic protozoa of the genus Leishmania which, in the infected host are obli­gate intracellular parasite. TSA is the immuno-dominant antigen of Leishmania major which is considered as the most promising molecule for a recombinant or DNA vaccine against leishmaniasis. Methods: Genomic DNA of TSA protein was extracted and amplificated as a template. Then the PCR product was cloned into pTZ57R/T vector. Finally, the recombinant plasmid was extracted from transformed Escherichia coli (TG1 strain and sequenced. Results: MRHO/IR/75/ER (an Iranian strain of L. major and TSA gene (Accession number LmjF15.1080 were used. Se­quence analysis of cloned TSA gene into pTZ57R/T vector showed high homology of 90% with LmjF15.1080 (TSA gene and strain "LV39" (Accession no. AF069386 and strain "Friedlin" (Accession no.AF044679. Conclusion: We cloned TSA gene of L. major successfully. Recombinant plasmid was confirmed. It is ready to express recombinant protein for further studies.

  10. IRE1α nucleotide sequence cleavage specificity in the unfolded protein response.

    Science.gov (United States)

    Poothong, Juthakorn; Sopha, Pattarawut; Kaufman, Randal J; Tirasophon, Witoon

    2017-01-01

    Inositol-requiring enzyme 1 (IRE1) is a conserved sensor of the unfolded protein response that has protein kinase and endoribonuclease (RNase) enzymatic activities and thereby initiates HAC1/XBP1 splicing. Previous studies demonstrated that human IRE1α (hIRE1α) does not cleave Saccharomyces cerevisiae HAC1 mRNA. Using an in vitro cleavage assay, we show that adenine to cytosine nucleotide substitution at the +1 position in the 3' splice site of HAC1 RNA is required for specific cleavage by hIRE1α. A similar restricted nucleotide specificity in the RNA substrate was observed for XBP1 splicing in vivo. Together these findings underscore the essential role of cytosine nucleotide at +1 in the 3' splice site for determining cleavage specificity of hIRE1α.

  11. Rapid discrimination of Acinetobacter baumannii international clone II lineage by pyrosequencing SNP analyses of bla(OXA-51-like) genes.

    Science.gov (United States)

    Matsui, Mari; Suzuki, Satowa; Suzuki, Masato; Arakawa, Yoshichika; Shibayama, Keigo

    2013-08-01

    We found that Acinetobacter baumannii international clone II generally possesses unique GTA sequence at nucleotide positions 106-108 in the bla(OXA-51-like) genes. We exploited this to develop an easy and rapid method for discrimination of international clone II from other A. baumannii by employing pyrosequencing analyses of single nucleotide polymorphisms.

  12. Cloning of full genome sequence of hepatitis E virus of Shanghai swine isolate using RACE method

    Directory of Open Access Journals (Sweden)

    Mou Jing

    2007-10-01

    Full Text Available Abstract Genotype 4 hepatitis E virus (HEV was reportedly transmitted freely between humans and swine in eastern China. The full-length genomic sequence of Shanghai swine isolate (SH-SW-zs1 recovered from feces sample of a pig which was infected with HEV RNA positive swine serum was determined using RT-PCR and RACE (Rapid Amplification of cDNA Ends methods. The full genome of the SH-SW-zs1 isolate was 7265 nucleotides in length and phylogenetic analysis indicated that this isolate belonged to genotype 4. Comparison of the 3' UTR sequence with the corresponding regions of other 38 HEV strains from different region revealed that the Shanghai swine isolate is 21–49 bp longer than the other stains.

  13. Cloning and Sequencing cDNA Encoding for Rhoptry-2 Toxoplasma Gondii Tachyzoite Local Isolate

    Directory of Open Access Journals (Sweden)

    Murwantoko M

    2015-11-01

    Full Text Available Rhoptry protein belongs to an excretory and secretory antigens (ESAs that play an important role during active penetration of parasite into the cell target. This protein an able Toxoplasma gondii to actively penetrate targeted cell, meanwhile ESAs protein stimulates intracellular vacuole modification. It is, therefore, after the parasite successfully enter the cell target then Granule (GRA proteins are responsible for the formation of parasitophorus vacuole, which is protect the fusion with other intracellular compartments such as lysosomal vacuole. Consequently, this parasite is being able to survive and multiply at the cell target. The current study was aimed to clone and sequens cDNA encoding for ROP-2 of local isolated T. gondii tachizoite through DNA recombinant technique. Total ribonucleic acid (RNA was isolated from tachyzoites of local isolated T. gondii that were grown up in Balb/c mice. Messenger RNA was isolated from total RNA using PolyAtract mRNA Isolation System. Messenger RNA was used as a template for synthesis cDNA using Riboclone cDNA Synthesis System AMV-RT. EcoRI adaptor from Riboclone EcoRI Adaptor Ligation System was added to Complementary DNA and than ligated to pUC19. Recombinant plasmid was transformed into E. coli (XL1-Blue. The transformed E. coli XL-1 Blue were plated on LB agar containing X-Gal, IPTG and ampicillin. Recombinant clones (white colony were picked up and grown up in the LB medium at 37oC overnight. Expression of recombinant protein was analysed by immunoblotting in order to identify cDNA recombinant wich is express ESA of T. gondii local isolate. Recombinant plasmid were isolated using alkalilysis method and were elektroforated in 1% agarose gel. The isolated DNA recombinant plasmid was cut using Eco RI and then sequenced through Big Dye Terminator Mix AB1 377A Sequencer using M13 Forward and M13 Reverse primers. The conclusion of this results showed that the recombinant clone was coding for excretory

  14. Cloning and sequence analysis of gene encoding plasma aquaporin of Tamarix albiflonum

    Institute of Scientific and Technical Information of China (English)

    DONG Yuzhi; YANG Chuanping; ZHANG Daoyuan; WANG Yucheng

    2007-01-01

    Plant aquaporins are water-selected-channels in plants and are involved in seed germination,cell elongation,stoma movement,fertilization and so on.Some plant aquapotins also play an important role in drought stress response.In this paper,the gene encoding the Tamarix albiflonum Aquaporin (AQP) was amplified by 5'rapid amplification of cDNA end (RACE) on the basis of the sequence information obtained from the expressed sequence tag of the subtractive hybridization library constructed under PEG6000 stress.The cDNA of the T.albiflonum AQP gene is 1,043 bp long,encoding a protein of 287 amino acids with a predicted molecular mass of 30.9 kDa,has 6 transmembrane regions,and possessing the major intrinsic protein (MIP) family signal consensus sequence SGXHXNPAVT and the higher plant plasma membrane intrinsic protein (PIP) highly conservative sequence GGGANXXXXGY and TGI/TNPARSL /FGAA I/VI/VF/YN.A comparative molecular analysis of the nucleotide sequence in National Center for Biotechnology Information (NCBI) databases showed that it shared 95% homology with the gene ofArabidopsis thaliana (MIP-C),with a theoretical isoelectric point 8.84.

  15. [Cloning and sequencing the isopenicillin N synthetase(IPNS) gene from Streptomyces cattleya].

    Science.gov (United States)

    Wang, Y; Li, R

    1996-04-01

    Great homology existed between IPNS genes from surphur-containing beta-lactam antibiotics producers including procaryotes and eucaryotes. A DNA homologous band was confirmed in S. cattleya by Southern blot analysis using IPNS gene from S. lipmanii as a probe. A recombinant plasmid containing the cyclase gene involved in thienamycin biosynthesis and IPNS gene was obtained by complementary cloning with mutant from S. cattleya. DNA sequencing revealed that the IPNS gene of S. cattleya consists of 963 bp encoding a protein of 321 amino acids with ATG as start codon, TGA as stop codon. Pairwise comparison of the predicted amino acid sequences showed 56% and 64% similarity with IPNSs of S. clavuligerus and S. lipmanii, respectively.

  16. Biodegradable plastic-degrading enzyme from Pseudozyma antarctica: cloning, sequencing, and characterization.

    Science.gov (United States)

    Shinozaki, Yukiko; Morita, Tomotake; Cao, Xiao-hong; Yoshida, Shigenobu; Koitabashi, Motoo; Watanabe, Takashi; Suzuki, Ken; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Fujii, Takeshi; Kitamoto, Hiroko K

    2013-04-01

    Pseudozyma antarctica JCM 10317 exhibits a strong degradation activity for biodegradable plastics (BPs) such as agricultural mulch films composed of poly(butylene succinate) (PBS) and poly(butylene succinate-co-adipate) (PBSA). An enzyme named PaE was isolated and the gene encoding PaE was cloned from the strain by functional complementation in Saccharomyces cerevisiae. The deduced amino acid sequence of PaE contains 198 amino acids with a predicted molecular weight of 20,362.41. High identity was observed between this sequence and that of cutinase-like enzymes (CLEs) (61-68%); therefore, the gene encoding PaE was named PaCLE1. The specific activity of PaE against emulsified PBSA was 54.8±6.3 U/mg. In addition to emulsified BPs, PaE degraded solid films of PBS, PBSA, poly(ε-caprolactone), and poly(lactic acid).

  17. Cloning and Sequence Analysis of the gp41 Gene of Clanis bilineata Nuclear Polyhedrosis Virus

    Institute of Scientific and Technical Information of China (English)

    ZHU Shan-ying; WANG Wen-bing; ZHU Jiang

    2006-01-01

    Clanis bilineata Nucleo Polyhedro Virus (CbNPV) was purified from Clanis bilineata larva. To obtain the molecular information of the virus, the genomic DNA of CbNPV was extracted, and a DNA fragment library of the virus was constructed using shotgun. The positive clones were then sequenced and analyzed. An open-reading frame (ORF) that has high identity with the gp41 gene of most NPVs was found in the library. The gp41 gene of CbNPV is 933 base pair long and encodes a protein of 310 amino acids. The result of the amino acid sequence analysis showed that the CbNPV gp41 has 53-61 and 56-73% identities with Group Ⅰ and Ⅱ NPVs gp41 proteins, respectively. The result indicates that the isolated CbNPV is a novel baculovirus, and the CbNPV shares a much closer relationship with Group Ⅱ NPVs.

  18. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Science.gov (United States)

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  19. The Nucleotide Capture Region of Alpha Hemolysin: Insights into Nanopore Design for DNA Sequencing from Molecular Dynamics Simulations

    Science.gov (United States)

    Manara, Richard M. A.; Tomasio, Susana; Khalid, Syma

    2015-01-01

    Nanopore technology for DNA sequencing is constantly being refined and improved. In strand sequencing a single strand of DNA is fed through a nanopore and subsequent fluctuations in the current are measured. A major hurdle is that the DNA is translocated through the pore at a rate that is too fast for the current measurement systems. An alternative approach is “exonuclease sequencing”, in which an exonuclease is attached to the nanopore that is able to process the strand, cleaving off one base at a time. The bases then flow through the nanopore and the current is measured. This method has the advantage of potentially solving the translocation rate problem, as the speed is controlled by the exonuclease. Here we consider the practical details of exonuclease attachment to the protein alpha hemolysin. We employ molecular dynamics simulations to determine the ideal (a) distance from alpha-hemolysin, and (b) the orientation of the monophosphate nucleotides upon release from the exonuclease such that they will enter the protein. Our results indicate an almost linear decrease in the probability of entry into the protein with increasing distance of nucleotide release. The nucleotide orientation is less significant for entry into the protein.

  20. Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang

    2016-06-21

    Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains

  1. Cloning and sequence analysis of β-actin gene from Aedes albopictus (Diptera: Culicidae)

    Institute of Scientific and Technical Information of China (English)

    Weijie Wang; Xiaobang Hu; Donghui Zhang; Jianhua Jiao; Yan Sun; Lei Ma; Changliang Zhu

    2007-01-01

    Objective: To obtain the complete β-actin gene from Aedes albopictus. Methods: Total RNA was extracted from C6/36 cells. Degenerate primers were designed based on the β-actin sequences of An. gambiae, Ae. aegypti, Cx. pipiens pallens and D.melanogaster. By RT-PCR, the product was amplified, purified, cloned into the pGT vector and sequenced. The β-actin sequence was aligned and phylogenetically analyzed by the BLAST program and the CLUSTAL W program. Results: A sequence of 1132 bp including an open reading frame of 1131 bp was obtained (GenBank DQ657949). The deduced protein had 376 amino acids.Aligned to SWISS-PROT, it exhibited a high level of identity with β-actins from Anopheles, Drosophila and Culex at the amino acid sequence level. Phylogenetic analysis indicated that Ae. albopictus β-actin was much more homologous with invertebrate β-actin than with vertebrate β-actin. Conclusion: The gene may be used as the internal control in the experiments of Ae. albopictus.

  2. Cloning and sequencing of parafusin, a calcium-dependent exocytosis-related phosphoglycoprotein.

    Science.gov (United States)

    Subramanian, S V; Wyroba, E; Andersen, A P; Satir, B H

    1994-10-11

    A cDNA for parafusin, an evolutionarily conserved phosphoglycoprotein involved in exocytosis, has been cloned and sequenced from a unicellular eukaryote, Paramecium tetraurelia. A Paramecium cDNA library was screened with an oligonucleotide probe synthesized to an internal amino acid sequence of isolated parafusin. The insert was 3 kb long with an open reading frame of 1.75 kb. Data base searches of the deduced amino acid sequence showed that Paramecium parafusin had a 50.7% sequence identity to rabbit muscle phosphoglucomutase, although no detectable phosphoglucomutase activity has been detected in isolated parafusin. The deduced parafusin amino acid sequence had four inserts and two deletions, which might confer on the protein specific functions in signal transduction events related to exocytosis. Furthermore, searches for potential phosphorylation sites showed the presence of a protein kinase C site (KDFSFR) specific to parafusin. Southern blot analysis with probes specific for parafusin and phosphoglucomutase suggested that these proteins were products of different genes. We propose that parafusin and phosphoglucomutase are members of a superfamily that conserve homologies important for the tertiary structure of the molecules.

  3. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S. (Istituto Nazionale Neurologico C. Besta, Milan (Italy)); Rocchi, M. (Istituto G. Gaslini, Genoa (Italy))

    1991-01-15

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH{sub 2}-terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH{sub 2}-terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids.

  4. Cloning and sequence analysis of Alcaligenes faecalis nifHDK gene cluster

    Institute of Scientific and Technical Information of China (English)

    张海予; 林敏; 萧凤回; 朱新生; 方宣钧; 尤崇杓; 朱玉贤

    1997-01-01

    Total DNA of Alcaligenes faecalis was probed with both the nifH and nifHD sequences from K. pneumoniae. One positive band of about 4.6 kb was discovered. This nifH homologous fragment was cloned into the vector pBluescript SK to construct the recombinant plasmid pBZl. The inserted fragment in pBZl was analyzed by physical mapping and was further subcloned for sequencing. It was found that this A. faecalis nifHDK homology pos-sessed a typical σ54-dependent promoter region with upstream activator sequence (UAS) and A-T rich region. The nifH and nifD ORFs were 888 and 1 476 bp long respectively. The GC contents of these two genes were about 61. 6% and 60.0% . The intergenic regions of nifH-nifD and nifD-nifK were 101 and 105 bp respectively. There were sepa-rate SD sequences upstream of all the three genes. The deduced amino acid sequences of the nifH gene product (the Fe-protein ) and the nifD gene product (the Mo-Fc-protein) were also highly homologous to other nitrogen-fixing bacteria, especially in th

  5. Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH.

    Science.gov (United States)

    Wang, Jianye; Duan, Jinkun; Zhu, Liqian; Jiang, Zhiwei; Zhu, Guoqiang

    2015-03-01

    In this study, the complete genome of the virulent strain LH of goose parvovirus (GPV) was sequenced and cloned into the pBluescript II (SK) plasmid vector. Sequence alignments of the inverted terminal repeats (ITR) of GPV strains revealed a common 14-nt-pair deletion in the stem of the palindromic structure in the LH strain and three other strains isolated after 1982 when compared to three GPV strains isolated earlier than that time. Transfection of 11-day-old embryonated goose eggs with the plasmid pLH, which contains the entire genome of strain LH, resulted in successful rescue of the infectious virus. Death of embryos after transfection via the chorioallantoic membrane infiltration route occurred earlier than when transfection was done via the allantoic cavity inoculation route. The rescued virus exhibited virulence similar to that of its parental virus, as evaluated by the mortality rate in goslings. Generation of the pathogenic infectious clone provides us with a powerful tool to elucidate the molecular pathogenesis of GPV in the future.

  6. Next Generation Sequencing of Classical Swine Fever Virus and Border Disease virus cloned in Bacterial Artificial Chromosomes

    DEFF Research Database (Denmark)

    Fahnøe, Ulrik; Höper, Dirk; Beer, martin

    2012-01-01

    Next generation sequencing is a powerful tool for complete sequencing of large amounts of DNA. We have recently cloned full genome cDNA copies (obtained by long-range RT-PCR) of entire genomes of classical swine fever virus (CSFV) strain Koslov and Border disease virus strain Gifhorn into bacterial...

  7. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  8. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the secon

  9. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...

  10. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    1979-01-01

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  11. An efficient strategy for large-scale high-throughput transposon-mediated sequencing of cDNA clones

    Science.gov (United States)

    Butterfield, Yaron S. N.; Marra, Marco A.; Asano, Jennifer K.; Chan, Susanna Y.; Guin, Ranabir; Krzywinski, Martin I.; Lee, Soo Sen; MacDonald, Kim W. K.; Mathewson, Carrie A.; Olson, Teika E.; Pandoh, Pawan K.; Prabhu, Anna-Liisa; Schnerch, Angelique; Skalska, Ursula; Smailus, Duane E.; Stott, Jeff M.; Tsai, Miranda I.; Yang, George S.; Zuyderduyn, Scott D.; Schein, Jacqueline E.; Jones, Steven J. M.

    2002-01-01

    We describe an efficient high-throughput method for accurate DNA sequencing of entire cDNA clones. Developed as part of our involvement in the Mammalian Gene Collection full-length cDNA sequencing initiative, the method has been used and refined in our laboratory since September 2000. Amenable to large scale projects, we have used the method to generate >7 Mb of accurate sequence from 3695 candidate full-length cDNAs. Sequencing is accomplished through the insertion of Mu transposon into cDNAs, followed by sequencing reactions primed with Mu-specific sequencing primers. Transposon insertion reactions are not performed with individual cDNAs but rather on pools of up to 96 clones. This pooling strategy reduces the number of transposon insertion sequencing libraries that would otherwise be required, reducing the costs and enhancing the efficiency of the transposon library construction procedure. Sequences generated using transposon-specific sequencing primers are assembled to yield the full-length cDNA sequence, with sequence editing and other sequence finishing activities performed as required to resolve sequence ambiguities. Although analysis of the many thousands (22 785) of sequenced Mu transposon insertion events revealed a weak sequence preference for Mu insertion, we observed insertion of the Mu transposon into 1015 of the possible 1024 5mer candidate insertion sites. PMID:12034834

  12. Cloning and sequencing of the Thermoanaerobacterium saccharolyticum B6A-RI apu gene and purification and characterization of the amylopullulanase from Escherichia coli.

    Science.gov (United States)

    Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G

    1994-01-01

    The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase.

  13. Diversification of mitochondrial genome of Daphnia galeata (Cladocera, Crustacea): Comparison with phylogenetic consideration of the complete sequences of clones isolated from five lakes in Japan.

    Science.gov (United States)

    Tokishita, Shin-Ichi; Shibuya, Hiroyuki; Kobayashi, Taku; Sakamoto, Masaki; Ha, Jin-Yong; Yokobori, Shin-Ichi; Yamagata, Hideo; Hanazato, Takayuki

    2017-05-05

    To characterize genetic diversity and gene flow among Daphnia galeata populations, the complete nucleotide (nt) sequences of the mitochondrial (mt) DNAs of D. galeata clones isolated from five lakes in Japan (Lakes Shirakaba, Suwa, Kizaki, Kasumigaura, and Biwa) were determined. Comparison of non-synonymous (amino acid altering) substitution rates with synonymous substitution rates of D. galeata mt protein-coding genes demonstrated that ATPase8 and COI genes were the most and least susceptible, respectively, to the evolutional forces selecting the aa substitutions. Several non-synonymous substitutions were found in ATPase8 and ATPase6 even in the comparison that no synonymous substitution was found. Comparison of the total number of nt variations among the mt DNAs suggested the phylogenetic relationship ((((Shirakaba/Suwa, Kizaki), Kasumigaura), Biwa), D. pulex). Maximum-likelihood analysis using the total nt sequences of mt protein-coding genes confirmed this relationship with bootstrap values higher than 98%. All the mtDNAs of the analyzed Japanese D. galeata clones contained a control region of essentially the same structure that is distinct from those of the previously reported European Daphnia species of the D. longispina complex. The two control regions of different structures spread among mtDNAs of the Japanese and European Daphnia species, respectively, probably after the divergence of the Japanese D. galeata under different selection pressures associated with their habitats. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites

    Institute of Scientific and Technical Information of China (English)

    Ya-e ZHAO; Zheng-hang WANG; Yang XU; Ji-ru XU; Wen-yan LIU; Meng WEI; Chu-ying WANG

    2012-01-01

    To our knowledge,few reports on Demodex studied at the molecular level are available at present.In this study our group,for the first time,cloned,sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum,Demodex brevis,and Demodex canis (three isolates from each species) from Xi'an China,by designing specific primers based on the only partial sequence of the CHS gene of D.canis from Japan,retrieved from GenBank.Results show that amplification was successful only in three D.canis isolates and one D.brevis isolate out of the nine Demodex isolates.The obtained fragments were sequenced to be 339 bp for D.canis and 338 bp for D.brevis.The CHS gene sequence similarities between the three Xi'an D.canis isolates and one Japanese D.canis isolate ranged from 99.7% to 100.0%,and those between four D.canis isolates and one D.brevis isolate were 99.1%-99.4%.Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters,according with the traditional classification.Two open reading frames (ORFs) were identified in each CHS gene sequenced,and their corresponding amino acid sequences were located at the catalytic domain.The relatively conserved sequences could be deduced to be a CHS class A gene,which is associated with chitin synthesis in the integument of Demodex mites.

  15. A revised its nucleotide sequence gives a specifity for Smallanthus sonchifolius (Poepp. and Endl. and its products identification

    Directory of Open Access Journals (Sweden)

    Žiarovská Jana

    2013-01-01

    Full Text Available Yacon (Smallanthus sonchifolius is an Andean crop which is very regarded for its benefits for people suffering from diabetes or various digestive or renal disorders. Because no specific Smallanthus sonchifolius identification DNA markers are still known the paper demonstrates ITS regions to be able to detect and differentiate among yacon species and the potential for specific food authentification purposes is reported, too. The newly sequenced ITS of yacon accessions originated in Peru, Ecuador and Bolivia analyse provide the unique sequence site that differs from all of the other yacon species and is recognized by DraIII restriction endonuclease. Restriction cleavadge of the PCR amplified ITSs of the twenty-eight yacon accessions was performed and in all cases the recognition site was confirmed as a typical for Smallanthus sonchifolius . Based on the nucleotide specifity of Smallanthus sonchifolius, ITS sequence the PCR method combined with the restriction clevadge protocol was developed for yacon identification.

  16. SinicView: A visualization environment for comparisons of multiple nucleotide sequence alignment tools

    OpenAIRE

    Wong Chun-Yi; Wu Yu-Wei; Chen Shiang-Heng; Peng Chin-Lin; Lin Laurent; Lee DT; Shih Arthur; Chou Meng-Yuan; Shiao Tze-Chang; Hsieh Mu-Fen

    2006-01-01

    Abstract Background Deluged by the rate and complexity of completed genomic sequences, the need to align longer sequences becomes more urgent, and many more tools have thus been developed. In the initial stage of genomic sequence analysis, a biologist is usually faced with the questions of how to choose the best tool to align sequences of interest and how to analyze and visualize the alignment results, and then with the question of whether poorly aligned regions produced by the tool are indee...

  17. Nucleotide sequence and intergeminiviral homologies of the DNA-A of papaya leaf curl geminivirus from India.

    Science.gov (United States)

    Saxena, S; Hallan, V; Singh, B P; Sane, P V

    1998-06-01

    Coat protein gene, rep protein gene and intergenic region of the genome of a whitefly transmitted geminivirus (WTG) causing severe leaf curl in papaya plants were PCR amplified, cloned and sequenced. Comparison of the amino acid sequence of the putative coat protein product of papaya leaf curl virus (PLCV) with some other mono and bipartite WTGs revealed a maximum of 89.8% homology with Indian cassava mosaic virus. The genomic organization of PLCV-India is similar to other WTGs with bipartite genomes. Comparison of the coat protein N-terminal 70 amino acid sequence (and other biological features) of PLCV with other geminiviruses shows that PLCV is a distinct geminivirus from India and is related to WTGs from the old world.

  18. CASCAD : a database of annotated candidate single nucleotide polymorphisms associated with expressed sequences

    NARCIS (Netherlands)

    Guryev, Victor; Berezikov, Eugene; Cuppen, Edwin

    2005-01-01

    BACKGROUND: With the recent progress made in large-scale genome sequencing projects a vast amount of novel data is becoming available. A comparative sequence analysis, exploiting sequence information from various resources, can be used to uncover hidden information, such as genetic variation. Althou

  19. Cloning and sequencing of protein L-isoaspartyl O-methyl transferase of Salmonella Typhimurium isolated from poultry

    Directory of Open Access Journals (Sweden)

    S. K. Dixit

    2014-09-01

    Full Text Available Aim: To clone the Salmonella Typhimurium protein L-isoaspartyl O-methyl transferase (PIMT enzyme and to analyze the sequence with PIMT gene of other pathogenic serovars of Salmonella. Materials and Methods: Salmonella Typhimurium strain E-2375 was procured from the National Salmonella Center, IVRI. The genomic DNA was isolated from Salmonella Typhimurium. Polymerase chain reaction (PCR was carried out to amplify PIMT gene using the designed primers. The PCR product was cloned into pET28c plasmid vector and transformed into Escherichia coli DH5α cells. The plasmid was isolated from E. coli and was sequenced. The sequence was analyzed and submitted in Genbank. Results: The PCR product revealed a distinct amplicon of 627 bp. The clone was confirmed by PCR. Sequencing data revealed 100% homology between PIMT sequences from Salmonella Typhimurium strain E-2375 (used in the current study and PIMT sequences of standard reported strain (Salmonella Typhimurium str. LT2 in NCBI data base. This submitted sequence in Genbank having accession no. KJ575536. Conclusions: PIMT gene of Salmonella is highly conserved in most of the pathogenic Salmonella serovars. The PIMT clone can be used to isolate PIMT protein. This PIMT protein will be helpful to identify isoaspartate containing proteins thus can help in study Salmonella virulence.

  20. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae.

    Science.gov (United States)

    Depierreux, Delphine; Vong, Minh; Nibert, Max L

    2016-06-02

    Zygosaccharomyces bailii virus Z (ZbV-Z) is a monosegmented dsRNA virus that infects the yeast Zygosaccharomyces bailii and remains unclassified to date despite its discovery >20years ago. The previously reported nucleotide sequence of ZbV-Z (GenBank AF224490) encompasses two nonoverlapping long ORFs: upstream ORF1 encoding the putative coat protein and downstream ORF2 encoding the RNA-dependent RNA polymerase (RdRp). The lack of overlap between these ORFs raises the question of how the downstream ORF is translated. After examining the previous sequence of ZbV-Z, we predicted that it contains at least one sequencing error to explain the nonoverlapping ORFs, and hence we redetermined the nucleotide sequence of ZbV-Z, derived from the same isolate of Z. bailii as previously studied, to address this prediction. The key finding from our new sequence, which includes several insertions, deletions, and substitutions relative to the previous one, is that ORF2 in fact overlaps ORF1 in the +1 frame. Moreover, a proposed sequence motif for +1 programmed ribosomal frameshifting, previously noted in influenza A viruses, plant amalgaviruses, and others, is also present in the newly identified ORF1-ORF2 overlap region of ZbV-Z. Phylogenetic analyses provided evidence that ZbV-Z represents a distinct taxon most closely related to plant amalgaviruses (genus Amalgavirus, family Amalgaviridae). We conclude that ZbV-Z is the prototype of a new species, which we propose to assign as type species of a new genus of monosegmented dsRNA mycoviruses in family Amalgaviridae. Comparisons involving other unclassified mycoviruses with RdRps apparently related to those of plant amalgaviruses, and having either mono- or bisegmented dsRNA genomes, are also discussed.

  1. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Huang, Shujia; Rao, Junhua; Ye, Weijian

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels...

  2. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Huang, Shujia; Rao, Junhua; Ye, Weijian

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) ...

  3. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Huang, Shujia; Rao, Junhua; Ye, Weijian;

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) ...

  4. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  5. Flow Cytometry-assisted Cloning of Specific Sequence Motifs fromComplex 16S ribosomal RNA Gene Libraries.

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, J.L.; Schramm, A.; Bernhard, A.E.; van den Engh, G.J.; Stahl, D.A.

    2004-07-21

    A flow cytometry method was developed for rapid screeningand recovery of cloned DNA containing common sequence motifs. Thisapproach, termed fluorescence-activated cell sorting-assisted cloning,was used to recover sequences affiliated with a unique lineage within theBacteroidetes not abundant in a clone library of environmental 16S rRNAgenes. Retrieval and sequence analysis of phylogenetically informativegenes has become a standard cultivation-independent technique toinvestigate microbial diversity in nature (7, 18). Genes encoding the 16SrRNA, because of the relative ease of their selective amplification, havebeen most frequently employed for general diversity surveys (16).Environmental studies have also focused on specific subpopulationsaffiliated with a phylogenetic group or identified by genes encodingspecific metabolic functions (e.g., ammonia oxidation, sulfaterespiration, and nitrate reduction) (8,15,20). However, specificpopulations may be of low abundance (1,23), or the genes encodingspecific metabolic functions may be insufficiently conserved to providepriming sites for general PCR amplification. Three general approacheshave been used to obtain 16S rRNA sequence information from low-abundancepopulations: screening hundreds to thousands of clones in a general 16SrRNA gene library (21), flow cytometric sorting of a subpopulation ofenvironmentally derived cells labeled by fluorescent in situhybridization (FISH) (27), or selective PCR amplification using primersspecific for the subpopulation (2,23). While the first approach is simplytime-consuming and tedious, the second has been restricted to fairlylarge and strongly fluorescent cells from aquatic samples (5, 27). Thethird approach often generates fragments of only a few hundred bases dueto the limited number of specific priming sites. Partial sequenceinformation often degrades analysis, obscuring or distorting thephylogenetic placement of the new sequences (11, 20). A more robustcharacterization of environ

  6. Cloning and Sequencing cDNA Encoding for Rhoptry-2 Toxoplasma Gondii Tachyzoite Local Isolate

    Directory of Open Access Journals (Sweden)

    Wayan T. Artama

    2015-10-01

    Full Text Available Rhoptry protein belongs to an excretory and secretory antigens (ESAs that play an important role during activepenetration of parasite into the cell target. This protein an able Toxoplasma gondii to actively penetrate targetedcell, meanwhile ESAs protein stimulates intracellular vacuole modification. It is, therefore, after the parasitesuccessfully enter the cell target then Granule (GRA proteins are responsible for the formation of parasitophorusvacuole, which is protect the fusion with other intracellular compartments such as lysosomal vacuole. Consequently,this parasite is being able to survive and multiply at the cell target. The current study was aimed to clone andsequens cDNA encoding for ROP-2 of local isolated T. gondii tachizoite through DNA recombinant technique.Total ribonucleic acid (RNA was isolated from tachyzoites of local isolated T. gondii that were grown up in Balb/c mice. Messenger RNA was isolated from total RNA using PolyAtract mRNA Isolation System. Messenger RNA wasused as a template for synthesis cDNA using Riboclone cDNA Synthesis System AMV-RT. EcoRI adaptor fromRiboclone EcoRI Adaptor Ligation System was added to Complementary DNA and than ligated to pUC19. Recombinantplasmid was transformed into E. coli (XL1-Blue. The transformed E. coli XL-1 Blue were plated on LB agarcontaining X-Gal, IPTG and ampicillin. Recombinant clones (white colony were picked up and grown up in theLB medium at 37oC overnight. Expression of recombinant protein was analysed by immunoblotting in order toidentify cDNA recombinant wich is express ESA of T. gondii local isolate. Recombinant plasmid were isolatedusing alkalilysis method and were elektroforated in 1% agarose gel. The isolated DNA recombinant plasmid wascut using Eco RI and then sequenced through Big Dye Terminator Mix AB1 377A Sequencer using M13 Forward andM13 Reverse primers. The conclusion of this results showed that the recombinant clone was coding for excretoryand secretory

  7. Nucleotide substitutions in rolC and nptII gene sequences during long-term cultivation of Panax ginseng cell cultures.

    Science.gov (United States)

    Kiselev, Konstantin V; Turlenko, Anna V; Tchernoded, Galina K; Zhuravlev, Yuri N

    2009-08-01

    It has been shown previously that the rolC gene from Agrobacterium tumefaciens gene was stably and highly expressed in 15-year-old Panax ginseng transgenic cell cultures. In the present report, we analyze in detail the nucleotide composition of the rolC and nptII (neomycin phosphotransferase) genes, which is the selective marker used for transgenic cell cultures of P. ginseng. It has been established that the nucleotide sequences of the rolC and nptII genes underwent mutagenesis during cultivation. Particularly, 1-4 nucleotide substitutions were found per sequence in the 540 and 798 bp segments of the complete rolC and nptII genes, respectively. Approximately half of these nucleotide substitutions caused changes in the structure of the predicted gene product. In addition, we attempted to determine the rate of accumulation of these changes by comparison of DNA extracted from P. ginseng cell cultures from 1995 to 2007. It was observed that the frequency of nucleotide substitutions for the rolC and nptII genes in 1995 was 1.21 +/- 0.02 per 1,000 nucleotides analyzed, while in 2007, the nucleotide substitutions significantly increased (1.37 +/- 0.07 per 1,000 nucleotides analyzed). Analyzing the nucleotide substitutions, we found that substitution to G or to C nucleotides significantly increased (in 1.9 times) in the rolC and nptII genes compared with P. ginseng actin gene. Finally, the level of nucleotide substitutions in the rolC gene was 1.1-fold higher when compared with the nptII gene. Thus, for the first time, we have experimentally demonstrated the level of nucleotide substitutions in transferred genes in transgenic plant cell cultures.

  8. Cloning and expression of Chromobacterium violaceum phenylalanine hydroxylase in Escherichia coli and comparison of amino acid sequence with mammalian aromatic amino acid hydroxylases.

    Science.gov (United States)

    Onishi, A; Liotta, L J; Benkovic, S J

    1991-10-05

    The complete amino acid sequence (296 amino acids) of Chromobacterium violaceum phenylalanine hydroxylase (PAH) was determined by nucleotide analysis of a DNA clone isolated using both a synthetic oligonucleotide probe based on the NH2-terminal amino acid sequence and an antibody against this enzyme. The ApaL I fragment (approximately 1.9 kilobase pairs) containing the entire PAH gene was subcloned in pBluescript II and induced by isopropyl-beta-D-thiogalactopyranoside. In order to eliminate fusion proteins the XbaI/ClaI fragment which contained the PAH gene from the Bluescript construct was subcloned into pMAC 5-8 containing the TAC promoter. The recombinant protein reacts with antibody raised to authentic C. violaceum PAH and its NH2-terminal 20-amino acid sequence and COOH-terminal amino acid residue were identical with the wild-type protein. Key physical and chemical characteristics of the recombinant protein, i.e. its copper content and Michaelis-Menten parameters, were the same as wild-type. Comparison of amino acid sequences revealed a highly conserved region between C. violaceum PAH and three different mammalian aromatic amino acid hydroxylases. This conserved area may well be a catalytically important domain of these pterin- and metal-requiring aromatic amino acid hydroxylases. The over-expression of C. violaceum PAH in Escherichia coli will facilitate the analysis of the enzyme mechanism by various spectroscopic methods.

  9. 树鼩Retn基因的克隆及序列测定%Cloning and sequencing of Retn gene in tree shrew

    Institute of Scientific and Technical Information of China (English)

    鲁帅尧; 和占龙; 禹文海; 赵远; 陈瑜; 李鸿钧

    2011-01-01

    目的 克隆树鼩(Tupaia belangeri)Retn基因,为在树鼩中开展Retn相关研究提供实验资料.方法 在树鼩脂肪组织中抽提总RNA,用RT-PCR进行基因扩增,通过基因克隆、重组质粒的酶切鉴定,对Retn克隆质粒的序列测定和分析.结果 抽提的总RNA完整性较好,RT-PCR产物电泳检测得到了目的条带,重组克隆质粒经Pst I单酶切证明了Retn基因已克隆至质粒载体,测序获得了363个核苷酸序列,1个编码114个氨基酸的开放阅读框,序列提交GenBank,登录号为JF267792;经Blast软件进行序列分析,其核苷酸序列和氨基酸序列与鼠类的同源性分别为95%和99%.结论 成功克隆了树鼩Retn基因及序列测定,为树鼩Retn基础数据的建立和开展相关研究提供了实验资料.%Objective The aim of this study was to clone the Retn gene of tree shrews to provide basic data for further research. Methods Total RNA was extracted from adipose tissue of tree shrews. Retn gene was amplified by RT-PCR and cloned. The sequence of Retn gene was identified by sequencing and enzyme digestion. Results The total RNA had good integrity. The expected 363 bp fragment was obtained by RT-PCR. The Retn gene was cloned in vector and identified by enzyme digestion (Pst I). 363 nucleotide acids encoded an open reading frame with 114 amino acids. The sequence has been submitted to GenBank (No. JF267792). The results showed a 95% similarity in nucleotide acids and 99% in amino acids with mouse Retn gene. Conclusion We have first reported the Retn gene of the tree shrew, and lay a foundation for further study on biological functions of Retn gene in tree shrews.

  10. Tetrachloroethene Dehalogenase from Dehalospirillum multivorans: Cloning, Sequencing of the Encoding Genes, and Expression of the pceA Gene in Escherichia coli

    Science.gov (United States)

    Neumann, Anke; Wohlfarth, Gert; Diekert, Gabriele

    1998-01-01

    The genes encoding tetrachloroethene reductive dehalogenase, a corrinoid-Fe/S protein, of Dehalospirillum multivorans were cloned and sequenced. The pceA gene is upstream of pceB and overlaps it by 4 bp. The presence of a ς70-like promoter sequence upstream of pceA and of a ρ-independent terminator downstream of pceB indicated that both genes are cotranscribed. This assumption is supported by reverse transcriptase PCR data. The pceA and pceB genes encode putative 501- and 74-amino-acid proteins, respectively, with calculated molecular masses of 55,887 and 8,354 Da, respectively. Four peptides obtained after trypsin treatment of tetrachloroethene (PCE) dehalogenase were found in the deduced amino acid sequence of pceA. The N-terminal amino acid sequence of the PCE dehalogenase isolated from D. multivorans was found 30 amino acids downstream of the N terminus of the deduced pceA product. The pceA gene contained a nucleotide stretch highly similar to binding motifs for two Fe4S4 clusters or for one Fe4S4 cluster and one Fe3S4 cluster. A consensus sequence for the binding of a corrinoid was not found in pceA. No significant similarities to genes in the databases were detected in sequence comparisons. The pceB gene contained two membrane-spanning helices as indicated by two hydrophobic stretches in the hydropathic plot. Sequence comparisons of pceB revealed no sequence similarities to genes present in the databases. Only in the presence of pUBS 520 supplying the recombinant bacteria with high levels of the rare Escherichia coli tRNA4Arg was pceA expressed, albeit nonfunctionally, in recombinant E. coli BL21 (DE3). PMID:9696761

  11. The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning.

    Science.gov (United States)

    Hazen, Jennifer L; Faust, Gregory G; Rodriguez, Alberto R; Ferguson, William C; Shumilina, Svetlana; Clark, Royden A; Boland, Michael J; Martin, Greg; Chubukov, Pavel; Tsunemoto, Rachel K; Torkamani, Ali; Kupriyanov, Sergey; Hall, Ira M; Baldwin, Kristin K

    2016-03-16

    Somatic mutation in neurons is linked to neurologic disease and implicated in cell-type diversification. However, the origin, extent, and patterns of genomic mutation in neurons remain unknown. We established a nuclear transfer method to clonally amplify the genomes of neurons from adult mice for whole-genome sequencing. Comprehensive mutation detection and independent validation revealed that individual neurons harbor ∼100 unique mutations from all classes but lack recurrent rearrangements. Most neurons contain at least one gene-disrupting mutation and rare (0-2) mobile element insertions. The frequency and gene bias of neuronal mutations differ from other lineages, potentially due to novel mechanisms governing postmitotic mutation. Fertile mice were cloned from several neurons, establishing the compatibility of mutated adult neuronal genomes with reprogramming to pluripotency and development.

  12. Cloning and sequencing of complete -crystallin cDNA from embryonic lens of Crocodylus palustris

    Indian Academy of Sciences (India)

    Raman Agrawal; Reena Chandrashekhar; Anurag Kumar Mishra; Jetty Ramadevi; Yogendra Sharma; Ramesh K Aggarwal

    2002-06-01

    -Crystallin is a taxon-specific structural protein found in eye lenses. We present here the cloning and sequencing of complete -crystallin cDNA from the embryonic lens of Crocodylus palustris and establish it to be identical to the -enolase gene from non-lenticular tissues. Quantitatively, the -crystallin was found to be the least abundant crystallin of the crocodilian embryonic lenses. Crocodile -crystallin cDNA was isolated by RT-PCR using primers designed from the only other reported sequence from duck and completed by 5′- and 3′-rapid amplification of cDNA ends (RACE) using crocodile gene specific primers designed in the study. The complete -crystallin cDNA of crocodile comprises 1305 bp long ORF and 92 and 409 bp long untranslated 5′-and 3′-ends respectively. Further, it was found to be identical to its putative counterpart enzyme -enolase, from brain, heart and gonad, suggesting both to be the product of the same gene. The study thus provides the first report on cDNA sequence of -crystallin from a reptilian species and also re-confirms it to be an example of the phenomenon of gene sharing as was demonstrated earlier in the case of peking duck. Moreover, the gene lineage reconstruction analysis helps our understanding of the evolution of crocodilians and avian species.

  13. MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

    Science.gov (United States)

    Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

    2012-06-29

    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

  14. Cloning and Expression Analysis of Downy Mildew Resistance-Related cDNA Sequences in Melon

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Melon downy mildew caused by Pseudoperonospora cubensis leads to significant losses in melon yields worldwide.Reverse-transcription Polymerase Chain Reaction (RT-PCR) was performed using cDNAs as templates from melonHuangdanzi induced with fungus Pseudoperonospora cubensis, and degenerate primers designed based on the conserved amino acid sequences of known plant disease-resistance genes. A polymorphic cDNA fragment which we named mp-19was cloned and sequenced. The Open Reading Frame (ORF) of this product comprised of 510 base pairs which encodes DNA or RNA-binding protein with 170 amino acids. The putative amino acid sequence of mp-19 appeared highly homologous with those of NBS-type resistant-genes isolated from other plants. Southern blot indicated that the melon genome contained more than 3 copies of mp-19. The obvious expression differences detected by semi-quantitative RTPCR could be observed between resistant-line Huangdanzi and susceptible-line Jiashi after Pseudoperonospora cubensis infection, which implied that mp-19 gene may be related to the resistance of downy mildew in melon.

  15. Cloning and sequence characteristics of the genomic gene of a rice metallothionein

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Northern blot analysis showed that a metallothionein gene, ricMT, is expressed strongly in the stem of rice with an expression level that could be more than 100-fold stronger than in leaf blades. The results suggest that the 5'upstream region flanking the coding sequence of the ricMT may contain a fairly strong promoter. To elucidate its regulation and promoter structure, the genomic clones of ricMT were screened out from a rice genomic library and a fragment of about 4 084 bp was sequenced. The fragment included a 5'upstream region of ca. 2 970 bp, a transcription region of ca. 690 bp and a 3'downstream region of ca. 420 bp. Computer analysis of the sequence homology showed that the 5'upstream region included a putative TATA box, a putative CAAT box, and a typical metal-responsive element TGCGCGCG. The results will promote further understanding of the mechanisms of gene regulation and metal response of plant metallothionein proteins.

  16. Cloning, sequencing, and characterization of the Azospirillum brasilense fhuE gene.

    Science.gov (United States)

    Cui, Yanhua; Tu, Ran; Guan, Yue; Ma, Luyan; Chen, Sanfeng

    2006-03-01

    The fhuE gene of Escherichia coli encodes the FhuE protein, which is a receptor protein in the coprogen-mediated siderophore iron-transport system. A fhuE gene homologue from Azospirillum brasilense, a nitrogen-fixing soil bacterium that lives in association with the roots of cereal grasses, was cloned, sequenced, and characterized. The A. brasilense fhuE encodes a protein of 802 amino acids with a predicted molecular weight of approximately 87 kDa. The deduced amino-acid sequence showed a high level of homology to the sequences of all the known fhuE gene products. The fhuE mutant was sensitive to iron starvation and defective in coprogen-mediated iron uptake. The mutant failed to express one membrane protein of approximately 78 kDa that was induced by iron starvation in the wild type. Complementation studies showed that the A. brasilense fhuE gene, when present on a low-copy number plasmid, could restore the functions of the mutant. Mutation in fhuE gene did not affect nitrogen fixation.

  17. ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

    Science.gov (United States)

    Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

    2017-03-01

    Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

  18. The complete nucleotide sequence and genomic characterization of tropical soda apple mosaic virus

    Science.gov (United States)

    Tropical soda apple mosaic virus (TSAMV) was first identified in tropical soda apple (Solanum viarum), a noxious weed, in Florida in 2002. This report provides the first full genome sequence of TSAMV. The full genome sequence of this virus will enable research scientists to develop additional spec...

  19. Efficient detection of chromosome imbalances and exome single nucleotide variants using targeted sequencing in the clinical setting.

    Science.gov (United States)

    Villela, Darine; da Costa, Silvia Souza; Vianna-Morgante, Angela M; Krepischi, Ana C V; Rosenberg, Carla

    2017-09-04

    We evaluated an approach to detect copy number variants (CNVs) and single nucleotide changes (SNVs), using a clinically focused exome panel complemented with a backbone and SNP probes that allows for genome-wide copy number changes and copy-neutral absence of heterozygosity (AOH) calls; this approach potentially substitutes the use of chromosomal microarray testing and sequencing into a single test. A panel of 16 DNA samples with known alterations ranging from megabase-scale CNVs to single base modifications were used as positive controls for sequencing data analysis. The DNA panel included CNVs (n = 13) of variable sizes (23 Kb to 27 Mb), uniparental disomy (UPD; n = 1), and single point mutations (n = 2). All DNA sequence changes were identified by the current platform, showing that CNVs of at least 23 Kb can be properly detected. The estimated size of genomic imbalances detected by microarrays and next generation sequencing are virtually the same, indicating that the resolution and sensitivity of this approach are at least similar to those provided by DNA microarrays. Accordingly, our data show that the combination of a sequencing platform comprising focused exome and whole genome backbone, with appropriate algorithms, enables a cost-effective and efficient solution for the simultaneous detection of CNVs and SNVs. Copyright © 2017. Published by Elsevier Masson SAS.

  20. Cloning and Sequencing of S Gene of Novel Variant of Infectious Bronchitis Virus ZJ971 Isolates in China

    Institute of Scientific and Technical Information of China (English)

    ZHOU Ji-yong; CHENG Li-qin; SHEN Xing-yan; DING Hong-mei; WU Jian-xiang

    2002-01-01

    A novel proventriculopathogic variant (isolate ZJ971) of infectious bronchitis virus (IBV) was identified from enlarged proeventriculus of the sick chickens in the study. The S gene cDNA segment with 3.6 kb in length was amplified by RT-PCR with special primers from the ZJ971 viral isolate of (IBV) and cloned into plasmid pBluescript SK( + ). The recombinants containing S gene of IBV-ZJ971 isotate were identified by digestion of restriction enzyme EcoRI, BamHI and PCR amplification. The cloned S gene from isolate IBVZJ971 was composed of 3492 bp in length encoding for a polypeptide of 1080 amino acids. Comparing the nucleotide of S gene of IBV isolate ZJ971 with that of reported IBV strains Beaudette, M41, Ark99 and CuT2,the homology was 97.3%, 97.5%, 88.6% and 85.6%, respectively; and the homology of the deduced amino acids of S protein of IBV isolate ZJ971 was 96%, 96.3%, 86.1% and 83.1% respectively; especially, the mutation of 3241st nucleotide of S gene of IBV isolate ZJ971 from G to T resulted in the translating termination of S protein at 3240th nucleotide site.

  1. Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database.

    Science.gov (United States)

    Niu, Ying; Zhang, Xuncai; Han, Feng

    2017-01-01

    Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack.

  2. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    Science.gov (United States)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  3. Targeted capture enrichment and sequencing identifies extensive nucleotide variation in the turkey MHC-B.

    Science.gov (United States)

    Reed, Kent M; Mendoza, Kristelle M; Settlage, Robert E

    2016-03-01

    Variation in the major histocompatibility complex (MHC) is increasingly associated with disease susceptibility and resistance in avian species of agricultural importance. This variation includes sequence polymorphisms but also structural differences (gene rearrangement) and copy number variation (CNV). The MHC has now been described for multiple galliform species including the best defined assemblies of the chicken (Gallus gallus) and domestic turkey (Meleagris gallopavo). Using this sequence resource, this study applied high-throughput sequencing to investigate MHC variation in turkeys of North America (NA turkeys). An MHC-specific SureSelect (Agilent) capture array was developed, and libraries were created for 14 turkeys representing domestic (commercial bred), heritage breed, and wild turkeys. In addition, a representative of the Ocellated turkey (M. ocellata) and chicken (G. gallus) was included to test cross-species applicability of the capture array allowing for identification of new species-specific polymorphisms. Libraries were hybridized to ∼12 K cRNA baits and the resulting pools were sequenced. On average, 98% of processed reads mapped to the turkey whole genome sequence and 53% to the MHC target. In addition to the MHC, capture hybridization recovered sequences corresponding to other MHC regions. Sequence alignment and de novo assembly indicated the presence of several additional BG genes in the turkey with evidence for CNV. Variant detection identified an average of 2245 polymorphisms per individual for the NA turkeys, 3012 for the Ocellated turkey, and 462 variants in the chicken (RJF-256). This study provides an extensive sequence resource for examining MHC variation and its relation to health of this agriculturally important group of birds.

  4. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus) Inferred from Nucleotide Sequences

    OpenAIRE

    KL Haag; Araújo AM; Gottstein B; Zaha A

    1998-01-01

    Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli) and four strains of E. granulosus (cattle, horse, pig and sheep strains) were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial) genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination ...

  5. Integrating multiple genomic data to predict disease-causing nonsynonymous single nucleotide variants in exome sequencing studies.

    Directory of Open Access Journals (Sweden)

    Jiaxin Wu

    2014-03-01

    Full Text Available Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations, SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.

  6. Novel technologies applied to the nucleotide sequencing and comparative sequence analysis of the genomes of infectious agents in veterinary medicine.

    Science.gov (United States)

    Granberg, F; Bálint, Á; Belák, S

    2016-04-01

    Next-generation sequencing (NGS), also referred to as deep, high-throughput or massively parallel sequencing, is a powerful new tool that can be used for the complex diagnosis and intensive monitoring of infectious disease in veterinary medicine. NGS technologies are also being increasingly used to study the aetiology, genomics, evolution and epidemiology of infectious disease, as well as host-pathogen interactions and other aspects of infection biology. This review briefly summarises recent progress and achievements in this field by first introducing a range of novel techniques and then presenting examples of NGS applications in veterinary infection biology. Various work steps and processes for sampling and sample preparation, sequence analysis and comparative genomics, and improving the accuracy of genomic prediction are discussed, as are bioinformatics requirements. Examples of sequencing-based applications and comparative genomics in veterinary medicine are then provided. This review is based on novel references selected from the literature and on experiences of the World Organisation for Animal Health (OIE) Collaborating Centre for the Biotechnology-based Diagnosis of Infectious Diseases in Veterinary Medicine, Uppsala, Sweden.

  7. Cloning, sequencing, and expression of nitrile hydratase gene of mutant 4D strain of Rhodococcus rhodochrous PA 34 in E. coli.

    Science.gov (United States)

    Pratush, Amit; Seth, Amit; Bhalla, T C

    2012-10-01

    The NHase encoding gene of mutant 4D was isolated by PCR amplification. The NHase gene of mutant 4D was successfully cloned and expressed in Escherichia coli by using Ek/LIC Duet cloning kits (Novagen). For the active expression of the NHase gene, the co-expression of small cobalt transporter gene (P-protein gene) has also been co-expressed with NHase gene E. coli. The nucleotide sequence of this NHase gene revealed high homology with the H-NHase of Rhodococcus rhodochrous J1. The recombinant E. coli cells showed higher NHase activity (5.9 U/mg dcw) as compared to the wild (4.1 U/mg dcw) whereas it is less than the mutant strain (8.4 U/mg dcw). Addition of cobalt ion in Luria-Bertani medium is needed up to a very small concentration (0.4 mM) for NHase activity. The recombinant E. coli exhibited maximum NHase activity at 6 h of incubation and was purified with a yield of 56 % with specific activity of 37.1 U/mg protein.

  8. Cloning of DNA sequences localized on proximal fluorescent chromosome bands by microdissection in Pinus densiflora Sieb. & Zucc.

    Science.gov (United States)

    Hizume, M; Shibata, F; Maruyama, Y; Kondo, T

    2001-09-01

    Japanese red pine, Pinus densiflora, has 2n=24 chromosomes, of which most carry chromomycin A3 (CMA) and 4',6-diamidino-2-phenylindole (DAPI) bands at their centromere-proximal regions. It was proposed that these regions contain highly repetitive DNA. The DNA localized in the proximal fluorescent bands was isolated and characterized. In P. densiflora, centromeric and neighboring segments of the somatic chromosomes were dissected with a manual micromanipulator. The centromeric DNA was amplified from the DNA contained in dissected centromeric segments by degenerate oligonucleotide primed-polymerase chain reaction (DOP-PCR) and a cloned DNA library was constructed. Thirty-one clones carrying highly repetitive DNA were selected by colony hybridization using Cot-1 DNA from this species as a probe, and their chromosomal localization was determined by fluorescent in situ hybridization (FISH). Clone PDCD501 was localized to the proximal CMA band of 20 chromosomes. This clone contained tandem repeats, comprising a 27 bp repeat unit, which was sufficient to provide the proximal FISH signal, with a 52.3% GC content. The repetitive sequence was named PCSR (proximal CMA band-specific repeat). Clone PDCD159 was 1700 bp in length, with a 61.7% AT content, and produced FISH signals at the proximal DAPI band of the remaining four chromosomes. Four clones hybridized strongly to the secondary constriction and gave weak signals at the centromeric region of several chromosomes. Clone PDCD537, one of the four clones, was homologous to the 26S rRNA gene. A PCR experiment using microdissected centromeric regions suggested that the centromeric region contains 18S and 26S rDNA. Another 24 clones hybridized to whole chromosome arms, with varying intensities and might represent dispersed repetitive DNA.

  9. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  10. Cloning and sequence analysis of Sox genes in a tetraploid cyprinid fish, Tor douronensis

    Institute of Scientific and Technical Information of China (English)

    GUO BaoCheng; LI JunBing; TONG ChaoBo; HE ShunPing

    2008-01-01

    A PCR survey for Sox genes in a young tetraploid fish Tor douronensis (Teleostei: Cyprinidae) was per-formed to access the evolutionary fates of important functional genes after genome duplication caused by polyploidization event. Totally 13 Sox genes were obtained in Tor douronensis, which represent SoxB, SoxC and SoxE groups. Phylogenetic analysis of Sox genes in Tor douronensis provided evidence for fish-specific genome duplication, and suggested that Sox19 might be a teleost specific Sox gene member. Sequence analysis revealed most of the nucleotide substitutions between duplicated copies of Sox genes caused by tetraploidization event or their orthologues in other species are silent substitutions. It would appear that the sequences are under purifying selective pressure, strongly suggesting that they repre- sent functional genes and supporting selection against all null allele at either of two duplicated loci of Sox4a, Sox9a and Sox9b. Surprising variations of the intron length and similarities of two duplicated copies of Sox9a and Sox9b, suggest that Tor douronensis might be an allotetraploidy.

  11. Cloning and Sequence Analysis of Gene Encoding psbZ from Silybum marianum (L. Gaertn

    Directory of Open Access Journals (Sweden)

    Yousef Mohammadi

    2016-09-01

    Full Text Available Photosystem II is known as the core of photosynthesis and among of the photosystem II protein complex, PsbZ protein is very important because of its role in connection PSII and LHCII. For identifying and sequencing of the psbZ gene in Silybum marianum plant, seeds were prepared from botanical garden in Tabriz, Iran. DNA was extracted by CTAB method and by using the PCR amplification the fragment length was estimated to be 705 bp. The amplified fragment was cloned in pGEM-T vector and E.coli transformation was carried out. The plasmid was extracted and the sequence was recorded at NCBI with accession number of GQ225868. BLAST of psbZ, glycine tRNA and psbZ-tRNA GLY intergenic spacer showed that each region is highly conserved among species. BLAST of predicted PsbZ protein also represents a severe conservation among species. Because of the importance of PsbZ protein in photosynthesis, it is necessary to create targeted mutations to determine the active sites of proteins.

  12. Cloning and Sequence of Glycoprotein H Gene of Duck Plague Virus

    Institute of Scientific and Technical Information of China (English)

    HAN Xian-jie; WANG Jun-wei; MA Bo

    2006-01-01

    The glycoprotein H (gH) gene homologue of duck plague virus (DPV) was cloned by degenerate polymerase chain reaction (PCR) and sequenced. It was located immediately downstream from the thymidine kinase gene (TK). In addition,the 3'-end of the gene homologue to herpesvirus UL21 was located downstream from the gH gene. DPV gH gene open reading frame (ORF) was 2 505 bp in length and its primary translation product was a polypeptide of 834 amino acids long.It possessed several characteristics of membrane glycoproteins, including an N-terminal hydrophobic signal sequence,an external domain containing eight putative N-linked glycosylation sites, a C-terminal transmembrane domain, and a charged cytoplasmic tail. Comparison with other herpesvirus revealed identities of 20.2, 25.1, 23.0, 23.0, 26.5 and 26.0% with the gH counterparts of the human herpesvirus virus 1 (HSV1), equine herpesvirus 4 (EHV4), bovine herpesvirus 1 (BHV1), pseudorabies virus (PRV), gallid herpesvirus 2 (GHV2) and gallid herpesvirus 3 (GHV3), respectively.

  13. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  14. Characterisation of single nucleotide polymorphisms identified in the bovine lactoferrin gene sequences across a range of dairy cow breeds.

    Science.gov (United States)

    O'Halloran, F; Bahar, B; Buckley, F; O'Sullivan, O; Sweeney, T; Giblin, L

    2009-01-01

    The lactoferrin gene sequences of 70 unrelated dairy cows representing six different dairy breeds were investigated for single nucleotide polymorphisms to establish a baseline of polymorphisms that exist within the Irish bovine population. Twenty-nine polymorphisms were identified within a 2.2kb regulatory region. Nineteen novel polymorphisms were identified and some of these were found within transcription factor binding sites, including GATA-1 and SPI transcription factor sites. Forty-seven polymorphisms were identified within exon sequences with unique polymorphisms that were associated with amino acid substitutions. These included a T/A SNP, identified in a Holstein Friesian animal, which resulted in a valine to aspartic acid substitution (Val89Asp) in the mature lactoferrin protein. Other SNPs of interest were associated with amino acid substitutions in the lactoferricin B peptide sequence and an A/G SNP, identified in a Jersey animal, was associated with a tyrosine to cysteine change (Tyr181Cys). The polymorphisms identified in the promoter region may have implications relating to lactoferrin expression levels in cows and those identified in the coding sequence indicate the existence of protein variants in the Irish bovine population. The data presented in this study emphasises the potential for lactoferrin to serve as a candidate gene to select for mastitis resistance with the aim of improving animal health.

  15. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  16. Distribution of the cytolethal distending toxin A gene (cdtA) among species of Shigella and Vibrio, and cloning and sequencing of the cdt gene from Shigella dysenteriae.

    Science.gov (United States)

    Okuda, J; Kurazono, H; Takeda, Y

    1995-03-01

    We investigated the distribution of the cytolethal distending toxin A gene (cdtA) among S. dysenteriae, Vibrio cholerae 01 and Vibrio parahaemolyticus by polymerase chain reaction (PCR) using primers constructed from the nucleotide sequences of Escherichia coli cdtA gene reported independently by Scott and Kaper (Infect Immun 1994; 62: 244-51) and by Pickett et al. (Infect Immun 1994; 62: 1046-51). The cdtA gene reported by Scott and Kaper was found to occur among eight of the 35 strains of S. dysenteriae but was not found among V. cholerae O1 and V. parahaemolyticus. The cdtA gene reported by Pickett et al. was not found among S. dysenteriae, V. cholerae O1 and V. parahaemolyticus. To further investigate the distribution of the cdtA gene among a large number of Shigella spp. (S. dysenteriae, S. flexneri, S. boydii and S. sonnei), and among Vibrio spp. (Vibrio cholerae O1, V. cholerae O139 and V. parahaemolyticus) by colony hybridization test, we constructed a cdtA gene specific DNA probe by amplifying the cdtA gene by PCR with primers designed from the nucleotide sequence of the cdtA gene reported by Scott and Kaper. The cdtA gene reported by Scott and Kaper was found to occur among eight of the 35 strains of S. dysenteriae and one of the 100 strains of S. sonnei, but was not found among other species of Shigella or among the Vibrio species examined. From one cdtA gene-positive S. dysenteriae strain that showed cytolethal distending toxin (CDT) activity on Chinese hamster ovary cells, we cloned and sequenced the entire cdt gene comprising cdtA, cdtB and cdtC genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Selection of Unique Escherichia coli Clones by Random Amplified Polymorphic DNA (RAPD): Evaluation by Whole Genome Sequencing

    Science.gov (United States)

    Nielsen, Karen L.; Godfrey, Paul A.; Stegger, Marc; Andersen, Paal S.; Feldgarden, Michael; Frimodt-Møller, Niels

    2014-01-01

    Identifying and characterizing clonal diversity is important when analysing fecal flora. We evaluated random amplified polymorphic DNA (RAPD) PCR, applied for selection of Escherichia coli isolates, by whole genome sequencing. RAPD was fast, and reproducible as screening method for selection of distinct E. coli clones in fecal swabs. PMID:24912108

  18. Outbreak in newborns of methicillin-resistant Staphylococcus aureus related to the sequence type 5 Geraldine clone.

    Science.gov (United States)

    Leroyer, Camille; Lehours, Philippe; Tristan, Anne; Boyer, Frederique; Marie, Veronique; Elleau, Christophe; Nolent, Paul; Venier, Anne-Gaelle; Brissaud, Olivier; de Barbeyrac, Bertille; Megraud, Francis; Rogues, Anne-Marie

    2016-02-01

    We describe the first nosocomial outbreak of a toxic shock syndrome-positive methicillin-resistant Staphylococcus aureus (MRSA) sequence type 5 Geraldine clone. Infection control interventions that are usually successful were implemented to control the outbreak. Spread of this virulent MRSA strain highlights the need to be vigilant to MRSA antibiotic susceptibilities.

  19. Cloning, sequencing and expression analysis of cDNA encoding a constitutive heat shock protein 70 (HSC70) in Fenneropenaeus chinensis

    Institute of Scientific and Technical Information of China (English)

    JIAO Chuanzhen; WANG Zaizhao; LI Fuhua; ZHANG Chengsong; XIANG Jianhai

    2004-01-01

    The cDNA encoding hsc70 of Chinese shrimp Fenneropenaeus chinensis was cloned from hepatopancreas by RT-PCR based on its EST sequence. The full length cDNA of 2090 bp contained an open reading frame of 1956 nucleotides and partial 5′- and 3′-untranslated region(5′- and 3′-UTR). PCR amplification and sequencing analysis showed the existence of introns in the region of 1-547 bp, but they did not exist in the region of 548-2090 bp of hsc70 cDNA. When the deduced 652 amino acid sequence of HSC70 was compared with the members of HSP70 family from other organisms, the results showed 85.9% similarity with HSC71 from Oncorhynchus mykiss and HSC70 from Homo sapiens. It also exhibited 85.8% similarity with HSP70 from Mus musculu and 85.4% with HSC70 from Manduca sexta. Expression analysis showed that hsc70 mRNA was espressed constitutively in hepatopancreas, muscle, eyestalks, haemocytes, heart, ovary, intestine and gills in Fenneropenaeus chinensis. No difference could be detected on hsc70 mRNA level in muscle between heat-shocked and control animals.

  20. Genome size evolution in pufferfish: an insight from BAC clone-based Diodon holocanthus genome sequencing

    Directory of Open Access Journals (Sweden)

    Gan Xiaoni

    2010-06-01

    Full Text Available Abstract Background Variations in genome size within and between species have been observed since the 1950 s in diverse taxonomic groups. Serving as model organisms, smooth pufferfish possess the smallest vertebrate genomes. Interestingly, spiny pufferfish from its sister family have genome twice as large as smooth pufferfish. Therefore, comparative genomic analysis between smooth pufferfish and spiny pufferfish is useful for our understanding of genome size evolution in pufferfish. Results Ten BAC clones of a spiny pufferfish Diodon holocanthus were randomly selected and shotgun sequenced. In total, 776 kb of non-redundant sequences without gap representing 0.1% of the D. holocanthus genome were identified, and 77 distinct genes were predicted. In the sequenced D. holocanthus genome, 364 kb is homologous with 265 kb of the Takifugu rubripes genome, and 223 kb is homologous with 148 kb of the Tetraodon nigroviridis genome. The repetitive DNA accounts for 8% of the sequenced D. holocanthus genome, which is higher than that in the T. rubripes genome (6.89% and that in the Te. nigroviridis genome (4.66%. In the repetitive DNA, 76% is retroelements which account for 6% of the sequenced D. holocanthus genome and belong to known families of transposable elements. More than half of retroelements were distributed within genes. In the non-homologous regions, repeat element proportion in D. holocanthus genome increased to 10.6% compared with T. rubripes and increased to 9.19% compared with Te. nigroviridis. A comparison of 10 well-defined orthologous genes showed that the average intron size (566 bp in D. holocanthus genome is significantly longer than that in the smooth pufferfish genome (435 bp. Conclusion Compared with the smooth pufferfish, D. holocanthus has a low gene density and repeat elements rich genome. Genome size variation between D. holocanthus and the smooth pufferfish exhibits as length variation between homologous region and different

  1. The nucleotide sequence of the dnaA gene and the first part of the dnaN gene of Escherichia coli K-12.

    Science.gov (United States)

    Hansen, E B; Hansen, F G; von Meyenburg, K

    1982-11-25

    The nucleotide sequence of the dnaA gene and the first 10% of the dnaN gene was determined. From the nucleotide sequence the amino acid sequence of the dnaA gene product was derived. It is a basic protein of 467 amino acid residues with a molecular weight of 52.5 kD. The expression of the dnaA gene is in the counterclockwise direction like the one of the dnaN gene, for which potential startsites were found.

  2. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    Science.gov (United States)

    2010-07-01

    ... “Sequence Listing” file. (6) All computer readable forms must have a label permanently affixed thereto on...) Computer readable form files submitted may be in any of the following media: (1) Diskette: 3.50 inch, 1.44... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824...

  3. Kallikrein from rat submandibular gland, cloning and sequencing of rKLK1

    Energy Technology Data Exchange (ETDEWEB)

    Xavier, L.P.; Fernandes, H.C.; Figueiredo, A.F.S.; Pesquero, J.L.; Santoro, M.M. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de Ciencias Biologicas. Dept. de Bioquimica e Imunologia

    2008-07-01

    Full text: Tissue kallikreins are closely related serine proteases that are present in all mammals and expressed in a wide variety of cells and tissues. Little is known about the physiological role of tissue kallikreins, except that the kallikreins 1 (K1) can release kinins from low- and/or high-Mr kininogen in all species. In this work, the rat tissue kallikrein from submandibular gland was purified, characterized by SDS-PAGE and mass spectrometry, and the protein was identified as rat true tissue kallikrein (rK1). Molecular techniques that permit to obtain recombinant proteins expressed in milligram quantities were used in order to allow the realization of the studies of structure-function, substrate specificity and susceptibility to inhibitors using kinetic, calorimetric and crystallographic assays. Therefore, the total RNA from submandibular gland was isolated using the Tri zol reagent and its purity was evaluated by electrophoresis on agarose gel. Reverse transcription was performed according to the manufacturer's protocol. The resulting cDNA was then used for PCR which was performed with cDNA and platinum TaqDNA polymerase; the reactions were carried out according to the manufacturer. The PCR mixture contained sense and antisense primers, with sites for the restriction enzymes XhoI and NotI, respectively, which were designed to tissue kallikrein gene, rKLK1. The amplified band of 750 bp was excised, purified from agarose gel, cloned in pGemT-easy vector, transformed in E. coli and colonies were selected. In order to purify the plasmids from the colonies it was used the Mini prep system. The analysis of plasmids sequence confirmed the insertion of the gene. In the moment rKLK1 will be cloned in the pPIC9 vector and integrated into the yeast genome.

  4. Cloning and Sequence Analysis of Disease Resistance Gene Analogues from Three Wild Rice Species in Yunnan

    Institute of Scientific and Technical Information of China (English)

    LIU Ji-mei; CHENG Zai-quan; YANG Ming-zhi; WU Cheng-jun; WANG Ling-xian; SUN Yi-ding; HUANG Xing-qi

    2003-01-01

    Two sets of degenerate oligonucleotide primers were designed according to amino acid conservedregions of reported plant disease resistance genes which encode proteins that contain nucleotide-binding site andleucine-rich repeats(NBS-LRR), and the plant disease resistance genes which encode serine/threonine proteinkinase(STK). By polymerase chain reaction(PCR), disease resistance gene analogues have been amplified fromthree wild rice species in Yunnan Province, China. The DNA fragments from amplification have been clonedinto the pGEM-T vector respectively. Sequencing of the DNA fragments indicated that 7 classes, 2 classes and6 classes NBS-LRR disease resistance gene analogues from Oryza rufipogon Griff. , Oryza officinalis Wall. ,and Oryza meyeriana Baill. were obtained respectively. The two representative fragments of TO12 from Ory-za officinalis Wall. and TR19 from Oryza rufipogon Griff. belong to the same class and homology of theirsequences are 100%. The result shows that the sequences of the same class disease resistance gene analogueshave no difference among different species of wild rice. 5 classes STK disease resistance gene analogues werealso obtained among which 4 classes from Oryza rufipogon Griff. , 1 class from Oryza officinalis Wall. Bycomparison analysis of amino acid sequences, we found that the obtained disease resistance gene analogues havevery iow identity(low to 25%) with the reported disease resistance gene L6, N, Bs2, Prf, Pto, Lr10 and Xa21etc. The finding suggests that the obtained disease resistance gene analogues are analogues of putative diseaseresistance genes that have not been isolated so far.

  5. Nucleotide sequence analysis of hypervariable junctions of Haemophilus influenzae pilus gene clusters.

    Science.gov (United States)

    Read, T D; Satola, S W; Farley, M M

    2000-12-01

    Haemophilus influenzae pili are surface structures that promote attachment to human epithelial cells. The five genes that encode pili, hifABCDE, are found inserted in genomes either between pmbA and hpt (hif-1) or between purE and pepN (hif-2). We determined the sequence between the ends of the pilus clusters and bordering genes in a number of H. influenzae strains. The junctions of the hif-1 cluster (limited to biogroup aegyptius isolates) are structurally simple. In contrast, hif-2 junctions are highly diverse, complex assemblies of conserved intergenic sequences (including genes hicA and hicB) with evidence of frequent recombination. Variation at hif-2 junctions seems to be tied to multiple copies of a 23-bp Haemophilus intergenic dyad sequence. The hif-1 cluster appears to have originated in biogroup aegyptius strains from invasion of the hpt-pmbA region by a DNA template containing the hif-2 genes with termini in the hairpin loop of flanking intergenic dyad sequences. The pilus gene clusters are an interesting model of a mobile "pathogenicity island" not associated with a phage, transposon, or insertion element.

  6. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    Science.gov (United States)

    Salgado-García, R.; Ugalde, E.

    2016-11-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations.

  7. Identification of Nucleotide Variation in Genomes Using Next-Generation Sequencing

    NARCIS (Netherlands)

    Megens, H.J.W.C.; Groenen, M.A.M.

    2012-01-01

    Discovery of genome-wide variation has taken a huge leap forward with the introduction of next-generation sequencing (NGS) technology. Variant discovery requires sampling of a number of haplotypes. This can be either the two haplotypes of a diploid organism or multiple haplotypes in a population. Va

  8. Phylogenetic analysis of Rutaceous plants based on single nucleotide polymorphism in chloroplast and nuclear gene sequences

    Science.gov (United States)

    The family Rutaceae encompasses several genera including the economically important genus Citrus. In this study, we selected 22 citrus relatives belonging to the various sub groups of Rutaceae and compared the sequences of three gene fragments. The accessions selected belong to the subfamily Rutoide...

  9. Phylogenetic analyses of nucleotide sequences confirm a unique plant intercontinental disjunction between tropical Africa, the Caribbean, and the Hawaiian Islands.

    Science.gov (United States)

    Namoff, Sandra; Luke, Quentin; Jiménez, Francisco; Veloz, Alberto; Lewis, Carl E; Sosa, Victoria; Maunder, Mike; Francisco-Ortega, Javier

    2010-01-01

    Phylogenetic analyses of nucleotide sequences of the internal transcribed spacers and 5.8 regions of the nuclear ribosomal DNA and of the trnH-psbA spacer of the chloroplast genome confirm that the three taxa of the Jacquemontia ovalifolia (Choicy) Hallier f. complex (Convolvulaceae) form a monophyletic group. Levels of nucleotide divergence and morphological differentiation among these taxa support the view that each should be recognized as distinct species. These three species display unique intercontinental disjunction, with one species endemic to Hawaii (Jacquemontia sandwicensis A. Gray.), another restricted to eastern Mexico and the Antilles [Jacquemontia obcordata (Millspaugh) House], and the third confined to East and West Africa (J. ovalifolia). The Caribbean and Hawaiian species are sister taxa and are another example of a biogeographical link between the Caribbean Basin and Polynesia. We provide a brief conservation review of the three taxa based on our collective field work and investigations; it is apparent that J. obcordata is highly threatened and declining in the Caribbean.

  10. SISP: a Fast Species Identification System for Prokaryotes Based on Total Nucleotide Identity of Whole Genome Sequences

    Directory of Open Access Journals (Sweden)

    Jiapeng Chen

    2015-06-01

    Full Text Available In the genomic era, new techniques and criteria are proposed to improve the traditionally phenotypic and biochemical test–based approaches for prokaryotic species definition. Among them, average nucleotide identity (ANI mirrors DNA-DNA hybridization and is widely used by the microbial research community. However, our test shows that ANI possibly defines distinct taxa as the same species when they shared highly homologous sequences in a very short genomic region. In this study, we propose an improved algorithm named total nucleotide identity (TNI for use in bacterial taxonomy; this algorithm provided higher accuracy for species classification than ANI. Furthermore, we developed a species identification system for prokaryotes (SISP based on pairwise TNI of 3,073 genomes acquired from GenBank. For a submitted query genome, SISP can quickly find its most closely related genome from the established database based on the TNI calculation and infer the possible species of the query genome. Given a criterion of TNI > 70%, SISP has an accuracy that was above 90% for 3,596 prokaryotic genomes. SISP is open source and is available at https://github.com/chjp/SISProkaryotes.

  11. Thermochemical and kinetic evidence for nucleotide-sequence-dependent RecA-DNA interactions.

    Science.gov (United States)

    Wittung, P; Ellouze, C; Maraboeuf, F; Takahashi, M; Nordèn, B

    1997-05-01

    RecA catalyses homologous recombination in Escherichia coli by promoting pairing of homologous DNA molecules after formation of a helical nucleoprotein filament with single-stranded DNA. The primary reaction of RecA with DNA is generally assumed to be unspecific. We show here, by direct measurement of the interaction enthalpy by means of isothermal titration calorimetry, that the polymerisation of RecA on single-stranded DNA depends on the DNA sequence, with a high exothermic preference for thymine bases. This enthalpic sequence preference of thymines by RecA correlates with faster binding kinetics of RecA to thymine DNA. Furthermore, the enthalpy of interaction between the RecA x DNA filament and a second DNA strand is large only when the added DNA is complementary to the bound DNA in RecA. This result suggests a possibility for a rapid search mechanism by RecA x DNA filaments for homologous DNA molecules.

  12. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  13. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  14. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  15. Comparative analysis of ITS1 nucleotide sequence reveals distinct genetic difference between Brugia malayi from Northeast Borneo and Thailand.

    Science.gov (United States)

    Fong, Mun-Yik; Noordin, Rahmah; Lau, Yee-Ling; Cheong, Fei-Wen; Yunus, Muhammad Hafiznur; Idris, Zulkarnain Md

    2013-01-01

    Brugia malayi is one of the parasitic worms which causes lymphatic filariasis in humans. Its geographical distribution includes a large part of Asia. Despite its wide distribution, very little is known about the genetic variation and molecular epidemiology of this species. In this study, the internal transcribed spacer 1 (ITS1) nucleotide sequences of B. malayi from microfilaria-positive human blood samples in Northeast Borneo Island were determined, and compared with published ITS1 sequences of B. malayi isolated from cats and humans in Thailand. Multiple alignment analysis revealed that B. malayi ITS1 sequences from Northeast Borneo were more similar to each other than to those from Thailand. Phylogenetic trees inferred using Neighbour-Joining and Maximum Parsimony methods showed similar topology, with 2 distinct B. malayi clusters. The first cluster consisted of Northeast Borneo B. malayi isolates, whereas the second consisted of the Thailand isolates. The findings of this study suggest that B. malayi in Borneo Island has diverged significantly from those of mainland Asia, and this has implications for the diagnosis of B. malayi infection across the region using ITS1-based molecular techniques.

  16. Nucleotide sequence of the DNA polymerase gene of herpes simplex virus type 2 and comparison with the type 1 counterpart.

    Science.gov (United States)

    Tsurumi, T; Maeno, K; Nishiyama, Y

    1987-01-01

    The complete nucleotide sequence of the DNA polymerase gene of herpes simplex virus (HSV) type 2 strain 186 has been determined. The gene included a 3720-bp major open reading frame capable of encoding 1240 amino acids. The predicted primary translation product had an Mr of 137,354, which was slightly larger than its HSV-1 counterpart. A comparison of the predicted functional amino acid sequences of the HSV-1 and HSV-2 DNA polymerases revealed 95.5% overall amino acid homology, the value of which was the highest among those of the other known polypeptides encoded by HSV-1 and HSV-2. The functional amino acid changes were spread in the N-terminal one-third of the protein, whereas the C-terminal two-third was almost identical between the two types except a particular hydrophilic region. A highly conserved sequence of 6 aa, YGDTDS, which has been observed in DNA polymerases of HSV-1, Epstein-Barr virus, adenovirus, and vaccinia virus, was also present at positions 889 to 894 in the C-terminal region of HSV-2 DNA polymerase.

  17. Characterization and Nucleotide Sequence of CARB-6, a New Carbenicillin-Hydrolyzing β-Lactamase from Vibrio cholerae

    Science.gov (United States)

    Choury, Danièle; Aubert, Gérald; Szajnert, Marie-France; Azibi, Kemal; Delpech, Marc; Paul, Gérard

    1999-01-01

    A clinical strain of Vibrio cholerae non-O1 non-O139 isolated in France produced a new β-lactamase with a pI of 5.35. The purified enzyme, with a molecular mass of 33,000 Da, was characterized. Its kinetic constants show it to be a carbenicillin-hydrolyzing enzyme comparable to the five previously reported CARB β-lactamases and to SAR-1, another carbenicillin-hydrolyzing β-lactamase that has a pI of 4.9 and that is produced by a V. cholerae strain from Tanzania. This β-lactamase is designated CARB-6, and the gene for CARB-6 could not be transferred to Escherichia coli K-12 by conjugation. The nucleotide sequence of the structural gene was determined by direct sequencing of PCR-generated fragments from plasmid DNA with four pairs of primers covering the whole sequence of the reference CARB-3 gene. The gene encodes a 288-amino-acid protein that shares 94% homology with the CARB-1, CARB-2, and CARB-3 enzymes, 93% homology with the Proteus mirabilis N29 enzyme, and 86.5% homology with the CARB-4 enzyme. The sequence of CARB-6 differs from those of CARB-3, CARB-2, CARB-1, N29, and CARB-4 at 15, 16, 17, 19, and 37 amino acid positions, respectively. All these mutations are located in the C-terminal region of the sequence and at the surface of the molecule, according to the crystal structure of the Staphylococcus aureus PC-1 β-lactamase. PMID:9925522

  18. Finding the right coverage: the impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates.

    Science.gov (United States)

    Fountain, Emily D; Pauli, Jonathan N; Reid, Brendan N; Palsbøll, Per J; Peery, M Zachariah

    2016-07-01

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown. Here, we estimated genotyping error rates in SNPs genotyped with double digest RAD sequencing from Mendelian incompatibilities in known mother-offspring dyads of Hoffman's two-toed sloth (Choloepus hoffmanni) across a range of coverage and sequence quality criteria, for both reference-aligned and de novo-assembled data sets. Genotyping error rates were more sensitive to coverage than sequence quality and low coverage yielded high error rates, particularly in de novo-assembled data sets. For example, coverage ≥5 yielded median genotyping error rates of ≥0.03 and ≥0.11 in reference-aligned and de novo-assembled data sets, respectively. Genotyping error rates declined to ≤0.01 in reference-aligned data sets with a coverage ≥30, but remained ≥0.04 in the de novo-assembled data sets. We observed approximately 10- and 13-fold declines in the number of loci sampled in the reference-aligned and de novo-assembled data sets when coverage was increased from ≥5 to ≥30 at quality score ≥30, respectively. Finally, we assessed the effects of genotyping coverage on a common population genetic application, parentage assignments, and showed that the proportion of incorrectly assigned maternities was relatively high at low coverage. Overall, our results suggest that the trade-off between sample size and genotyping error rates be considered prior to building sequencing libraries, reporting genotyping error rates become standard practice, and that effects of genotyping errors on inference be evaluated in restriction-enzyme-based SNP studies.

  19. Inferring multiple refugia and phylogeographical patterns in Pinus massoniana based on nucleotide sequence variation and DNA fingerprinting.

    Directory of Open Access Journals (Sweden)

    Xue-Jun Ge

    Full Text Available BACKGROUND: Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central-marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. METHODOLOGY/PRINCIPAL FINDINGS: We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central-marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. CONCLUSIONS/SIGNIFICANCE: The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record.

  20. A single origin and moderate bottleneck during domestication of soybean (Glycine max): implications from microsatellites and nucleotide sequences.

    Science.gov (United States)

    Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying

    2010-09-01

    Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K' = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be approximately 2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in

  1. Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria.

    Science.gov (United States)

    Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad; Rolain, Jean-Marc

    2016-12-01

    Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the blaOXA-48, blaCTX-M-15, blaSHV-1, and blaTEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The blaOXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital.

  2. The complete nucleotide sequence and multipartite organization of the tobacco mitochondrial genome: comparative analysis of mitochondrial genomes in higher plants.

    Science.gov (United States)

    Sugiyama, Y; Watase, Y; Nagase, M; Makita, N; Yagura, S; Hirai, A; Sugiura, M

    2005-02-01

    Tobacco is a valuable model system for investigating the origin of mitochondrial DNA (mtDNA) in amphidiploid plants and studying the genetic interaction between mitochondria and chloroplasts in the various functions of the plant cell. As a first step, we have determined the complete mtDNA sequence of Nicotiana tabacum. The mtDNA of N. tabacum can be assumed to be a master circle (MC) of 430,597 bp. Sequence comparison of a large number of clones revealed that there are four classes of boundaries derived from homologous recombination, which leads to a multipartite organization with two MCs and six subgenomic circles. The mtDNA of N. tabacum contains 36 protein-coding genes, three ribosomal RNA genes and 21 tRNA genes. Among the first class, we identified the genes rps1 and psirps14, which had previously been thought to be absent in tobacco mtDNA on the basis of Southern analysis. Tobacco mtDNA was compared with those of Arabidopsis thaliana, Beta vulgaris, Oryza sativa and Brassica napus. Since repeated sequences show no homology to each other among the five angiosperms, it can be supposed that these were independently acquired by each species during the evolution of angiosperms. The gene order and the sequences of intergenic spacers in mtDNA also differ widely among the five angiosperms, indicating multiple reorganizations of genome structure during the evolution of higher plants. Among the conserved genes, the same potential conserved nonanucleotide-motif-type promoter could only be postulated for rrn18-rrn5 in four of the dicotyledonous plants, suggesting that a coding sequence does not necessarily move with the promoter upon reorganization of the mitochondrial genome.

  3. Cloning and sequence analysis of hsf, an outer membrane protein gene of Pasteurella multocida serotype B:2

    Directory of Open Access Journals (Sweden)

    A. Priyadarshini

    2014-12-01

    Full Text Available Aim: The present study was undertaken to clone, sequence and analyze the hsf, an outer membrane protein gene of Pasteurella multocida serotype B:2 Materials and Methods: hsf gene was amplified from genomic DNA of P. multocida. Polymerase chain reaction (PCR product was cloned in pET-32a vector and was characterized. hsf gene was sequenced, analyzed and phylogenetic tree was constructed taking sequences of other strains. Results: Amplicon size was found to be 785 bp. Recombinant got characterized through colony PCR and restriction enzyme analysis. Conclusion: hsf gene of P. multocida serotype B is similar to serotype A, but different from serotype D. Further work is needed to evaluate role of Hsf protein in protection studies and to study the antigenic properties of this recombinant protein as a candidate for vaccine.

  4. A history of ovine pulmonary adenocarcinoma (jaagsiekte) and experiments leading to the deduction of the JSRV nucleotide sequence.

    Science.gov (United States)

    York, D F; Querat, G

    2003-01-01

    Jaagsiekte (JS), a contagious cancer affecting the lungs of sheep has been called many names over the years. At a recent workshop in Missilac, France it was agreed that the disease would be called ovine pulmonary adenocarcinoma (OPA). The disease is caused by an infectious retrovirus called jaagsiekte sheep retrovirus (JSRV). This chapter focuses on the early research that led up to the isolation, cloning and sequencing of the exogenous infectious form of JSRV and the demonstration that it has an endogenous counter part that is present in all sheep. As there was no in vitro production source of the virus much of the early research focused on the in vivo production and purification of the virus to obtain sufficient material to use to identify the viral proteins and purify the viral genetic material. Typically, new born lambs were inoculated intra-tracheally with concentrated lung lavage from previously infected sheep lungs. The optimal purification involved the concentration of lung lavage of freshly slaughtered sheep, an extraction with organic solvent, and final purification by both rate zonal and isopycnic centrifugation. Monoclonal and polyclonal antibodies were made against the purified fractions. The polyclonal antibodies were not very specific and the monoclonal antibodies proved to be against antigens expressed in high concentrations in response to any lung pathology. The genomic RNA of the virus was isolated from ex vivo purified materials, and cloned as a collection of cDNAs. The full length sequence was assembled by walking through the cDNA clones. The genome of the exogenous virus is 7462 bases and has the classical gag, pol, env genome arrangement and is flanked by a long terminal repeat (LTR) on each end. An additional open reading frame (ORF) was observed in the viral genome and has been called orfX. A function has not been determined for this ORF. JSRV is classified as a betaretrovirus, with gag and pol closely related to D type retrovirus, whereas

  5. Genetic manipulation of a transcription-regulating sequence of porcine reproductive and respiratory syndrome virus reveals key nucleotides determining its activity.

    Science.gov (United States)

    Zheng, Haihong; Zhang, Keyu; Zhu, Xing-Quan; Liu, Changlong; Lu, Jiaqi; Gao, Fei; Zhou, Yan; Zheng, Hao; Lin, Tao; Li, Liwei; Tong, Guangzhi; Wei, Zuzhang; Yuan, Shishan

    2014-08-01

    The factors that determine the transcription-regulating sequence (TRS) activity of porcine reproductive and respiratory syndrome virus (PRRSV) remain largely unclear. In this study, the effect of mutagenesis of conserved C nucleotides at positions 5 and 6 in the leader TRS (TRS-L) and/or canonical body TRS7 (TRS-B7) on the synthesis of subgenomic (sg) mRNA and virus infectivity was investigated in the context of a type 2 PRRSV infectious cDNA clone. The results showed that a double C mutation in the leader TRS completely abolished sg mRNAs synthesis and virus infectivity, but a single C mutation did not. A single C or double C mutation in TRS-B7.1 or/and TRS-B7.2 impaired or abolished the corresponding sg mRNA synthesis. Introduction of identical mutations in the leader and body TRSs partially restored sg mRNA7.1 and/or sg mRNA7.2 transcription, indicating that the base-pairing interaction between sense TRS-L and cTRS-B is a crucial factor influencing sg mRNA synthesis. Analysis of the mRNA leader-body junctions of mutants provided evidence for a mechanism of discontinuous minus-strand transcription. This study also showed that mutational inactivation of TRS-B7.1 or TRS-B7.2 did not affect the production of infectious progeny virus, and the sg mRNA formed from each of them could express N protein. However, TRS-B7.1 plays more important roles than TRS-B7.2 in maintaining the growth characteristic of type 2 PRRSV. These results provide more insight into the molecular mechanism of genome expression and subgenomic mRNA transcription of PRRSV.

  6. [Cloning, sequencing and fuctional study of gacA gene from Xanthomonas oryzae pv. oryzicola].

    Science.gov (United States)

    Yang, Wan-feng; Chen, Lei; Liu, Hong-xia; Hu, Bai-shi; Liu, Feng-quan

    2007-04-01

    A gacA homologue, designated gacA(Xooc), was cloned from Xanthomonas oryzae pv. oryzicola (Xooc), a bacterium that causes leaf streak of rice, with degenerated primers by polymerase amplification reaction (PCR). NCBI blast search indicated that GacA(Xooc) had a similar structure to that of other GacA proteins, and had a CheB (Chemotaxis response regulator containing a CheY-like receiver domain)domain. Sequence comparison showed that the gacA(Xooc) was conserved in the Xanthomonas genus. Homology search revealed that the gacA(Xooc) was 99.7% similarities to gacA (AY870457, this lab) of Xanthomonas oryzae pv. oryzae (Xoo). A gacA(Xooc), disruption mutant was successfully generated by a single cross-over event, and confirmed by PCR and Southern blot. But the mutant still had strong pathogenicity,and its virulence was not obviously different from that of wild type strain. The gacA did not globally regulate metabolism in Xooc, which was different from DC3000 of P. syringae pv. tomato, CHAO of P. fluorescens and IC1270 of Serratia plymuthica. Chemotaxis to 0.1% tryptone of the mutants was reduced compared to wild type strain. The results suggest that gacA(X00c) is involved chemotaxis of Xooc. Nevertheless, how gacA to regulate chemotaxis of Xooc, transcription and expression of genes involved in regulation still need to be further studied.

  7. Cloning,sequencing and analyzing of the heavy chain V region genes of human polyreactive antibodies

    Institute of Scientific and Technical Information of China (English)

    ZHANGJINSONG; MINGYEH

    1994-01-01

    The heavy chain variable region genes of 5 human polyreactive mAbs generated in our laboratory have been cloned and sequenced using polymerase chain reaction(PCR) technique.We found that 2 and 3 mAbs utilized genes of the VHIV and VHⅢ families,respectively.The former 2 VH segments were in germline configuration.A common VH segment,with the best similarity of 90.1% to the published VHⅢ germline genes,was utilized by 2 different rearranged genes encoding the V regions of other 3 mAbs.This strongly suggests that the common VH segment is a unmutated copy of an unidentified germline VHⅢ gene.All these polyreactive mAbs displayed a large NDN region(VH-D-JH junction).The entire H chain V regions of these polyreactive mAbs are unusually basic.The analysis of the charge properties of these mAbs as well as those of other poly-and mono-reactive mAbs from literatures prompts us to propose that the charged amino acids with a particular distribution along the H chain V region,especially the binding sites(CDRs),may be an important structural feature involved in antibody polyreactivity.

  8. Cloning, sequencing, and analysis of inv8 chromosome breakpoints associated with recombinant 8 syndrome.

    Science.gov (United States)

    Graw, S L; Sample, T; Bleskan, J; Sujansky, E; Patterson, D

    2000-03-01

    Rec8 syndrome (also known as "recombinant 8 syndrome" and "San Luis Valley syndrome") is a chromosomal disorder found in individuals of Hispanic descent with ancestry from the San Luis Valley of southern Colorado and northern New Mexico. Affected individuals typically have mental retardation, congenital heart defects, seizures, a characteristic facial appearance, and other manifestations. The recombinant chromosome is rec(8)dup(8q)inv(8)(p23.1q22.1), and is derived from a parental pericentric inversion, inv(8)(p23.1q22.1). Here we report on the cloning, sequencing, and characterization of the 8p23.1 and 8q22 breakpoints from the inversion 8 chromosome associated with Rec8 syndrome. Analysis of the breakpoint regions indicates that they are highly repetitive. Of 6 kb surrounding the 8p23.1 breakpoint, 75% consists of repetitive gene family members-including Alu, LINE, and LTR elements-and the inversion took place in a small single-copy region flanked by repetitive elements. Analysis of 3.7 kb surrounding the 8q22 breakpoint region reveals that it is 99% repetitive and contains multiple LTR elements, and that the 8q inversion site is within one of the LTR elements.

  9. Cloning and Sequencing of the Pokeweed Antiviral Protein Gene and Its Expression in E. coli

    Institute of Scientific and Technical Information of China (English)

    CHEN Ding-hu; WANG Xi-feng; LI Li; ZHOU Guang-he

    2002-01-01

    The total RNA was isolated from pokeweed (Phytolacca americana ) leaves using the method of guanidine isothiocyanite and used as a template to amplify the deleted mutant pokeweed antiviral protein (PAP) gene by RT-PCR and then the gene was cloned into the pGEMR-T vector. The sequencing results showed that the PAP gene consisted of 711nt, which was 99.6% identical to the PAP gene reported by Lin et al (1991). The IPTG-inducible expression vector containing the PAP gene was constructed and transferred into the E. coli strain BL21 (DE3)-plysS. A specific protein was produced after induction with 0.4m mol/L IPTG and its molecular weight was 26ku. The results of the double diffusion on the agar plate and the western blotting test showed that the protein produced in E. coli was highly identical with the PAP extracted by a Frenchman from French pokeweed leaves. These revealed that PAP gene was actually achieved and exactly expressed in E . coli.

  10. Complete nucleotide sequence of Dendrocalamus latiflorus and Bambusa oldhamii chloroplast genomes

    Science.gov (United States)

    WU, F.-H.; KAN, D.-P.; LEE, S.-B.; DANIELL, H.; LEE, Y.-W.; LIN, C.-C.; LIN, N.-S.; LIN, C.-S.

    2009-01-01

    Summary Although bamboo is one of the most important woody crops in Asia, information on its genome is still very limited. To investigate the relationship among Poaceae members and to understand the mechanism of albino mutant generation in vitro, the complete chloroplast genome of two economically important bamboo species, Dendrocalamus latiflorus Munro and Bambusa oldhamii Munro, was determined employing a strategy that involved polymerase chain reaction (PCR) amplification using 443 novel primers designed to amplify the chloroplast genome of these two species. The lengths of the B. oldhamii and D. latiflorus chloroplast genomes are 139,350 and 139,365 bp, respectively. The organization structure and the gene order of these two bamboos are identical to other members of Poaceae. Highly conserved chloroplast genomes of Poaceae facilitated sequencing by the PCR method. Phylogenetic analysis using both chloroplast genomes confirmed the results obtained from studies on chromosome number and reproductive organ morphology. There are 23 gaps, insertions/deletions > 100 bp, in the chloroplast genomes of 10 genera of Poaceae compared in this study. The phylogenetic distribution of these gaps corresponds to their taxonomic placement. The sequences of these two chloroplast genomes provide useful information for studying bamboo evolution, ecology and biotechnology. PMID:19324693

  11. Cloning and sequencing of the gene encoding LipL21 in the vaccinal leptospira serovars

    Directory of Open Access Journals (Sweden)

    Rasoul Hoseinpur

    2016-01-01

    Full Text Available Background: Leptospirosis is a zoonotic disease in humans and animals, caused by the bacterium Leptospira interrogans. Gene expressing LipL21 is one of the genes identified in the bacterium, existing only in the pathogenic strains. The aim of this study was to cloning and analyzing the sequence of the gene encoding surface lipoprotein, LipL21, in five vaccinal leptospira serovars in Iran. Material and Methods: Pathogenic Leptospira interrogans serovars were cultured in EMJH medium with 10% rabbit serum. After genomic DNA extraction, PCR with specific primers was employed and the resulting product inserted in a vector then transferred into E. Coli DH5&alpha. The recombinant plasmids were finally sent for sequencing. Results: The analysis of gene lipL21 in domestic vaccinal serovars and comparison of them with other serovars in the GenBank database revealed that three vaccinal serovars serjo hardjo, canicola and pomona had 100% similarity with each other and grippotyphosa serovar had the highest difference with the vaccinal serovars. In general, the results showed that this gene is a highly conserved gene in the domestic vaccinal serovars and serovars in the GenBank database with more than 95.7 percent similarity. Conclusion: These results showed that the gene, lipL21, is highly conserved in the vaccinal serovars (similarities > 96.4 %. Therefore, the gene encoding surface protein LipL21 can serve as a useful serologic test with high specificity and sensitivity for diagnosis of leptospirosis in clinical samples and in future as an effective subunit vaccine candidate to be used.

  12. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri

    2014-10-01

    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  13. Cloning and sequence analysis of genes encoding Staphylococcus hyicus exfoliative toxin types A, B, C, and D

    DEFF Research Database (Denmark)

    Ahrens, Peter; Andresen, Lars Ole

    2004-01-01

    Exfoliative toxins produced by certain strains of Staphylococcus hyicus mediate exudative epidermitis in pigs. In this study the genes coding for four different exfoliative toxin from S. hyicus (ExhA, ExhB, ExhC, and ExhD) were cloned and sequenced. The coding sequence of the four toxin genes...... ranged from 816 to 834 bp. The amino acid sequences of these four toxins were homologous to the earlier described exfoliative toxins SHETB from S. hyicus and ETA, ETB, and ETD from Staphylococcus aureus. The homology between the S. hyicus toxins was at the same level as the homology to the exfoliative...

  14. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    Science.gov (United States)

    Qi, Fei; Guo, Huarong; Wang, Jian

    2008-02-01

    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  15. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Science.gov (United States)

    Ji, Xiaolin; Wang, Qi; Li, Xiaofei; Qi, Xiaole; Wang, Yongqiang; Gao, Honglei; Gao, Yulong; Wang, Xiaomei

    2014-01-01

    Subgroup J avian leukosis virus (ALV-J) was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt) insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009) containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19). Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  16. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  17. Assessment of the labelling accuracy of spanish semipreserved anchovies products by FINS (forensically informative nucleotide sequencing).

    Science.gov (United States)

    Velasco, Amaya; Aldrey, Anxela; Pérez-Martín, Ricardo I; Sotelo, Carmen G

    2016-06-01

    Anchovies have been traditionally captured and processed for human consumption for millennia. In the case of Spain, ripened and salted anchovies are a delicacy, which, in some cases, can reach high commercial values. Although there have been a number of studies presenting DNA methodologies for the identification of anchovies, this is one of the first studies investigating the level of mislabelling in this kind of products in Europe. Sixty-three commercial semipreserved anchovy products were collected in different types of food markets in four Spanish cities to check labelling accuracy. Species determination in these commercial products was performed by sequencing two different cyt-b mitochondrial DNA fragments. Results revealed mislabelling levels higher than 15%, what authors consider relatively high considering the importance of the product. The most frequent substitute species was the Argentine anchovy, Engraulis anchoita, which can be interpreted as an economic fraud.

  18. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  19. Nucleotide sequence, DNA damage location and protein stoichiometry influence base excision repair outcome at CAG/CTG repeats

    Science.gov (United States)

    Goula, Agathi-Vasiliki; Pearson, Christopher E.; Della Maria, Julie; Trottier, Yvon; Tomkinson, Alan E.; Wilson, David M.; Merienne, Karine

    2012-01-01

    Expansion of CAG/CTG repeats is the underlying cause of >fourteen genetic disorders, including Huntington’s disease (HD) and myotonic dystrophy. The mutational process is ongoing, with increases in repeat size enhancing the toxicity of the expansion in specific tissues. In many repeat diseases the repeats exhibit high instability in the striatum, whereas instability is minimal in the cerebellum. We provide molecular insights as to how base excision repair (BER) protein stoichiometry may contribute to the tissue-selective instability of CAG/CTG repeats by using specific repair assays. Oligonucleotide substrates with an abasic site were mixed with either reconstituted BER protein stoichiometries mimicking the levels present in HD mouse striatum or cerebellum, or with protein extracts prepared from HD mouse striatum or cerebellum. In both cases, repair efficiency at CAG/CTG repeats and at control DNA sequences was markedly reduced under the striatal conditions, likely due to the lower level of APE1, FEN1 and LIG1. Damage located towards the 5’ end of the repeat tract was poorly repaired accumulating incompletely processed intermediates as compared to an AP lesion in the centre or at the 3’ end of the repeats or within a control sequences. Moreover, repair of lesions at the 5’ end of CAG or CTG repeats involved multinucleotide synthesis, particularly under the cerebellar stoichiometry, suggesting that long-patch BER processes lesions at sequences susceptible to hairpin formation. Our results show that BER stoichiometry, nucleotide sequence and DNA damage position modulate repair outcome, and suggest that a suboptimal LP-BER activity promotes CAG/CTG repeat instability. PMID:22497302

  20. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones and quality score...s Data detail Data name 5'-end sequences of budding yeast full-length cDNA clones and quality score...or-capping method, the sequence quality score generated by the Phred software, and links to SGD, dbEST and U...es. FASTA format. Quality Phred's quality score About This Database Database Desc...g yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive ...