Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

NARCIS (Netherlands)

Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

1989-01-01

We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

DEFF Research Database (Denmark)

Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

2015-01-01

are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

Science.gov (United States)

Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

1992-12-01

The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

RTA, a candidate G protein-coupled receptor: Cloning, sequencing, and tissue distribution

International Nuclear Information System (INIS)

Ross, P.C.; Figler, R.A.; Corjay, M.H.; Barber, C.M.; Adam, N.; Harcus, D.R.; Lynch, K.R.

1990-01-01

Genomic and cDNA clones, encoding a protein that is a member of the guanine nucleotide-binding regulatory protein (G protein)-coupled receptor superfamily, were isolated by screening rat genomic and thoracic aorta cDNA libraries with an oligonucleotide encoding a highly conserved region of the M 1 muscarinic acetylcholine receptor. Sequence analyses of these clones showed that they encode a 343-amino acid protein (named RTA). The RTA gene is single copy, as demonstrated by restriction mapping and Southern blotting of genomic clones and rat genomic DNA. RTA RNA sequences are relatively abundant throughout the gut, vas deferens, uterus, and aorta but are only barely detectable (on Northern blots) in liver, kidney, lung, and salivary gland. In the rat brain, RTA sequences are markedly abundant in the cerebellum. TRA is most closely related to the mas oncogene (34% identity), which has been suggested to be a forebrain angiotensin receptor. They conclude that RTA is not an angiotensin receptor; to date, they have been unable to identify its ligand

Cloning and sequencing of the gene for human β-casein

International Nuclear Information System (INIS)

Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

1990-01-01

Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

Science.gov (United States)

Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

1998-07-01

An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

Energy Technology Data Exchange (ETDEWEB)

Wei, D; Andrews, G K

1988-01-25

A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

DEFF Research Database (Denmark)

Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

2000-01-01

The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

International Nuclear Information System (INIS)

Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

2005-01-01

Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

[Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].

Science.gov (United States)

Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo

2008-09-01

Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.

Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

International Nuclear Information System (INIS)

Friedberg, E.C.

1987-01-01

Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

OpenAIRE

Liljeström, P L; Liljeström, P

1987-01-01

Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

Coding sequence of human rho cDNAs clone 6 and clone 9

Energy Technology Data Exchange (ETDEWEB)

Chardin, P; Madaule, P; Tavitian, A

1988-03-25

The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

Science.gov (United States)

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

Science.gov (United States)

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

Directory of Open Access Journals (Sweden)

Janeth Silva Pinheiro

2008-01-01

Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

International Nuclear Information System (INIS)

Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

1987-01-01

A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

Science.gov (United States)

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

International Nuclear Information System (INIS)

Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

1987-01-01

The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

Science.gov (United States)

Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

2004-04-01

Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

Science.gov (United States)

Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

2012-01-01

Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

Directory of Open Access Journals (Sweden)

Mária Džunková

Full Text Available Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

Science.gov (United States)

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

International Nuclear Information System (INIS)

Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M.

1989-01-01

ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A) + RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A) + RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs

DNA Nucleotide Sequence Restricted by the RI Endonuclease

Science.gov (United States)

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

International Nuclear Information System (INIS)

Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

1988-01-01

Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

Science.gov (United States)

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

The nucleotide sequence of a Polish isolate of Tomato torrado virus.

Science.gov (United States)

Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

2008-12-01

A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

Statistical properties and fractals of nucleotide clusters in DNA sequences

International Nuclear Information System (INIS)

Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

2004-01-01

Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

An accurate clone-based haplotyping method by overlapping pool sequencing.

Science.gov (United States)

Li, Cheng; Cao, Changchang; Tu, Jing; Sun, Xiao

2016-07-08

Chromosome-long haplotyping of human genomes is important to identify genetic variants with differing gene expression, in human evolution studies, clinical diagnosis, and other biological and medical fields. Although several methods have realized haplotyping based on sequencing technologies or population statistics, accuracy and cost are factors that prohibit their wide use. Borrowing ideas from group testing theories, we proposed a clone-based haplotyping method by overlapping pool sequencing. The clones from a single individual were pooled combinatorially and then sequenced. According to the distinct pooling pattern for each clone in the overlapping pool sequencing, alleles for the recovered variants could be assigned to their original clones precisely. Subsequently, the clone sequences could be reconstructed by linking these alleles accordingly and assembling them into haplotypes with high accuracy. To verify the utility of our method, we constructed 130 110 clones in silico for the individual NA12878 and simulated the pooling and sequencing process. Ultimately, 99.9% of variants on chromosome 1 that were covered by clones from both parental chromosomes were recovered correctly, and 112 haplotype contigs were assembled with an N50 length of 3.4 Mb and no switch errors. A comparison with current clone-based haplotyping methods indicated our method was more accurate. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

OpenAIRE

Sakoda, H; Imanaka, T

1992-01-01

Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those cata...

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

Directory of Open Access Journals (Sweden)

Etchells J Peter

2009-10-01

Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

OpenAIRE

Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

1984-01-01

We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

A novel approach to sequence validating protein expression clones with automated decision making

Directory of Open Access Journals (Sweden)

Mohr Stephanie E

2007-06-01

Full Text Available Abstract Background Whereas the molecular assembly of protein expression clones is readily automated and routinely accomplished in high throughput, sequence verification of these clones is still largely performed manually, an arduous and time consuming process. The ultimate goal of validation is to determine if a given plasmid clone matches its reference sequence sufficiently to be "acceptable" for use in protein expression experiments. Given the accelerating increase in availability of tens of thousands of unverified clones, there is a strong demand for rapid, efficient and accurate software that automates clone validation. Results We have developed an Automated Clone Evaluation (ACE system – the first comprehensive, multi-platform, web-based plasmid sequence verification software package. ACE automates the clone verification process by defining each clone sequence as a list of multidimensional discrepancy objects, each describing a difference between the clone and its expected sequence including the resulting polypeptide consequences. To evaluate clones automatically, this list can be compared against user acceptance criteria that specify the allowable number of discrepancies of each type. This strategy allows users to re-evaluate the same set of clones against different acceptance criteria as needed for use in other experiments. ACE manages the entire sequence validation process including contig management, identifying and annotating discrepancies, determining if discrepancies correspond to polymorphisms and clone finishing. Designed to manage thousands of clones simultaneously, ACE maintains a relational database to store information about clones at various completion stages, project processing parameters and acceptance criteria. In a direct comparison, the automated analysis by ACE took less time and was more accurate than a manual analysis of a 93 gene clone set. Conclusion ACE was designed to facilitate high throughput clone sequence

Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

DEFF Research Database (Denmark)

Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

2000-01-01

The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...

A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

NARCIS (Netherlands)

Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

1996-01-01

A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

The nucleotide sequences of two leghemoglobin genes from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1982-01-01

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

Science.gov (United States)

Mukhopadhyaya, R; Sadaie, M R

1993-02-01

Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

NARCIS (Netherlands)

Geertsma, Eric Robin; Poolman, Berend

2008-01-01

The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

International Nuclear Information System (INIS)

Safford, R.; de Silva, J.; Lucas, C.

1987-01-01

Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

Evaluation of a pooled strategy for high-throughput sequencing of cosmid clones from metagenomic libraries.

Science.gov (United States)

Lam, Kathy N; Hall, Michael W; Engel, Katja; Vey, Gregory; Cheng, Jiujun; Neufeld, Josh D; Charles, Trevor C

2014-01-01

High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones.

cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

Science.gov (United States)

Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

1990-09-25

The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

Cloning, sequencing, and expression of cDNA for human β-glucuronidase

International Nuclear Information System (INIS)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-01-01

The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Molecular cloning, expression analysis and sequence prediction of ...

African Journals Online (AJOL)

CCAAT/enhancer-binding protein beta as an essential transcriptional factor, regulates the differentiation of adipocytes and the deposition of fat. Herein, we cloned the whole open reading frame (ORF) of bovine C/EBPβ gene and analyzed its putative protein structures via DNA cloning and sequence analysis. Then, the ...

Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30.

Science.gov (United States)

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang

2016-06-21

Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Cloning and sequencing of the bovine gastrin gene

DEFF Research Database (Denmark)

Lund, T; Rehfeld, J F; Olsen, Jørgen

1989-01-01

In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...

FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Directory of Open Access Journals (Sweden)

Lu Jia

2011-10-01

Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

Sequence variations in the FAD2 gene in seeded pumpkins.

Science.gov (United States)

Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

2015-12-21

Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

Human terminal deoxyribonucleotidyltransferase: molecular cloning and structural analysis of the gene and 5' flanking region

International Nuclear Information System (INIS)

Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.

1988-01-01

Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Characterization, cloning and sequencing of a thermostable endo-(1, 3-1, 4) beta-glucanase-encoding gene from an alkalophilic Bacillus-brevis

CSIR Research Space (South Africa)

Louw, M

1993-01-01

Full Text Available - zyme that produced 1 ~tmol reducing sugar calculated as glucose per minute under the conditions of assay. Bacterial strains, growth media and vectors. The Escherichia coli host strain for the original cloning experiment... the gels were washed in phosphate buffer, pH 6.3 (Beguin 1983). The bands of enzyme activity were detected by staining the lichen- an/PAGE gel with Congo red. Restriction mapping and nucleotide sequencing. Restriction en...

Molecular cloning and sequence analysis of hamster CENP-A cDNA

Directory of Open Access Journals (Sweden)

Valdivia Manuel M

2002-05-01

Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

WEB-server for search of a periodicity in amino acid and nucleotide sequences

Science.gov (United States)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

454 sequencing of pooled BAC clones on chromosome 3H of barley

Directory of Open Access Journals (Sweden)

Yamaji Nami

2011-05-01

Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

Science.gov (United States)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

Directory of Open Access Journals (Sweden)

Kouki Yonezawa

Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

Science.gov (United States)

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

Science.gov (United States)

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

Science.gov (United States)

Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

2009-01-01

Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

Molecular cloning of cellulase genes from indigenous bacterial isolates

International Nuclear Information System (INIS)

Jong Bor Chyan; Pauline Liew Woan Ying; Mat Rasol Awang

2006-01-01

Indigenous cellulolytic bacterial isolates having high activities in degrading carboxymethyl cellulose (CMC) were isolated from local environments. Identification of these isolates were performed by molecular techniques. By using polymerase chain reaction (PCR) techniques, PCR products encoding cellulase gene were amplified from the total genomic DNAs. Purified PCR product was successfully cloned and expressed in Escherichia coli host system. The complete nucleotide sequences of the cellulase genes determined. The analysis of amino acid sequences deduced from the genes indicated that the cloned DNA fragments show high homology to those of endoglucanase genes of family GH5. All cloned genes consist of an N-terminal signal peptide, a catalytic domain of family 5 glycosyl hydrolase and a cellulose-binding domain of family III. (Author)

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Directory of Open Access Journals (Sweden)

Moore JE

2006-01-01

Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Science.gov (United States)

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

Science.gov (United States)

Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

1999-01-01

A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

Science.gov (United States)

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

Cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of Clostridium chauvoei

Directory of Open Access Journals (Sweden)

Saroj K. Dangi

2017-09-01

Full Text Available Aim: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of C. chauvoei. Materials and Methods: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct. Results: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum. Conclusion: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Cloning and sequence analysis of benzo-a-pyreneinducible ...

African Journals Online (AJOL)

The phylogenetic tree based on the amino acid sequences clearly shows tilapia CYP1A and killifish CYP1A to be more closely related to each other than to the other CYP1A subfamilies. Sequence analysis of 3727 bp of genomic DNA showed that the clone obtained was the structural gene of CYP1A which consists of ...

Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

International Nuclear Information System (INIS)

Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-08-01

The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

Science.gov (United States)

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

Directory of Open Access Journals (Sweden)

Wang Zhen

2011-11-01

Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

Science.gov (United States)

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

International Nuclear Information System (INIS)

Lo, A.; Yang, H.L.

1990-01-01

This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

DEFF Research Database (Denmark)

Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

1991-01-01

A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

Science.gov (United States)

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

DEFF Research Database (Denmark)

Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

1985-01-01

DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

Complete nucleotide sequences of avian metapneumovirus subtype B genome.

Science.gov (United States)

Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

2010-12-01

Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

Science.gov (United States)

Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

2003-01-01

A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

Energy Technology Data Exchange (ETDEWEB)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

International Nuclear Information System (INIS)

Harper, J.F.; Surowy, T.K.; Sussman, M.R.

1989-01-01

In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

Molecular cloning of lupin leghemoglobin cDNA

DEFF Research Database (Denmark)

Konieczny, A; Jensen, E O; Marcker, K A

1987-01-01

Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

African Journals Online (AJOL)

Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

Cloning of a glutathione S-transferase decreasing during differentiation of HL60 cell line

Energy Technology Data Exchange (ETDEWEB)

Kim, Jae Chul; Park, In Kyu; Lee, Kyu Bo; Sohn, Sang Kyun; Kim, Moo Kyu; Kim, Jung Chul [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of)

1999-06-01

By sequencing the Expressed Sequence Tags of human dermal papilla cDNA library, we identified a clone named K872 of which the expression decreased during differentiation of HL60 cell line. K872 plasmid DNA was isolated according to QIA plasmid extraction kit (Qiagen GmbH, Germany). The nucleotide sequencing was performed by Sanger's method with K872 plasmid DNA. The most updated GenBank EMBL necleic acid banks were searched through the internet by using BLAST (Basic Local Alignment Search Tools) program. Northern bots were performed using RNA isolated from various human tissues and cancer cell lines. The gene expression of the fusion protein was achieved by His-Patch Thiofusion expression system and the protein product was identified on SDS-PAGE. K872 clone is 1006 nucleotides long, and has a coding region of 675 nucleotides and a 3' non-coding region of 280 nucleotides. The presumed open reading frame starting at the 5' terminus of K872 encodes 226 amino acids, including the initiation methionine residue. The amino acid sequence deduced from the open reading frame of K872 shares 70% identity with that of rat glutathione S-transferase kappa 1 (rGSTK1). The transcripts were expressed inh a variety of human tissues and cancer cells. The levels of transcript were relatively high in those tissues such as heart, skeletal muscle, and peripheral blood leukocyte. It is noteworthy that K872 was found to be abundantly expressed in colorectal cancer and melanoma cell lines. Homology search result suggests that K872 clone is the human homolog of the rGSTK1 which is known to be involved in the resistance of cytotoxic therapy. We propose that meticulous functional analysis should be followed to confirm that.

Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

Science.gov (United States)

Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

2017-09-01

Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis

International Nuclear Information System (INIS)

Kato, Nobuyuki; Hijikata, Makoto; Ootsuyama, Yuko; Nakagawa, Masanori; Ohkoshi, Showgo; Sugimura, Takashi; Shimotohno, Kunitada

1990-01-01

The nucleotide sequence of the Japanese type of hepatitis C virus (HCV-J) genome, consisting of 9413 nucleotides, was determined by analyses of cDNA clones from plasma specimens from Japanese patients with chronic hepatitis. HCV-J genome contains a long open reading frame that can encode a sequence of 3010 amino acid residues. Comparison of HCV-J with the American isolate of HCV showed 22.6% difference in nucleotide sequence and 15.1% difference in amino acid sequence. Thus HCV-J and the American isolate of HCV are probably different subtypes of HCV. The relationship of HCV-J with other animal RNA virus families and the putative organization of the HCV-J genome are discussed

Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

Science.gov (United States)

Daniel L. Lindner; Mark T. Banik

2009-01-01

To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

Nucleotide sequence of a human tRNA gene heterocluster

International Nuclear Information System (INIS)

Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

1986-01-01

Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

Capillary electrophoresis fragment analysis and clone sequencing in detection of dynamic mutations of spinocerebellar ataxia

Directory of Open Access Journals (Sweden)

Yuan-yuan CHEN

2018-04-01

Full Text Available Objective To estimate the accuracy and stability of capillary electrophoresis fragment analysis and clone sequencing in detecting dynamic mutations of spinocerebellar ataxia (SCA. Methods Capillary electrophoresis fragment analysis and clone sequencing were used in detecting trinucleotide repeated sequence of 14 SCA patients (3 cases of SCA2, 2 cases of SCA7, 7 cases of SCA8 and 2 cases of SCA17. Results Capillary electrophoresis fragment analysis of 3 SCA2 cases showed the expanded cytosine-adenine-guanine (CAG repeats were 31, 30 and 32, and the copy numbers of 3 clone sequencing for 3 colonies in each case were 37/40/40, 37/38/39 and 38/39/40 respectively. Capillary electrophoresis fragment analysis of 2 SCA7 cases showed the expanded CAG repeats were 57 and 34, and the copy numbers of repeats were 69, 74, 75 in 3 colonies of one case, and was 45 in the other case. For the 7 SCA8 cases with the expanded cytosine-thymine-adenine (CTA/cytosine-thymine-guanine (CTG repeats of 99, 111, 104, 92, 89, 104 and 75, the results of clone sequencing were 97, 116, 104, 90, 90, 102 and 76 respectively. For 2 SCA17 cases with the short/expanded CAG repeats of 37/50 and 36/45, the results of clone sequencing were 51/50/52 and 45/44 for 3 and 2 colonies. Conclusions Although the higher mobility of polymerase chain reaction (PCR products containing dynamic mutation in the capillary electrophoresis fragment analysis might cause the deviation for analysis of copy numbers, the deviation was predictable and the results were repeatable. The clone sequencing results showed obvious instability, especially for SCA2 and SCA7 genes, which might owing to their simple CAG repeats. Consequently, clone sequencing is not suited for detection of dynamic mutation, not to mention the quantitative criteria of dynamic mutation sequencing. DOI: 10.3969/j.issn.1672-6731.2018.03.008

Characterization and cloning of TMV resistance gene N homologues ...

African Journals Online (AJOL)

Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

Science.gov (United States)

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

Science.gov (United States)

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Cloning and sequencing of growth hormone gene of Iranian Lori Bakhtiari sheep

Directory of Open Access Journals (Sweden)

M Dayani-Nia

2010-05-01

Full Text Available Growth hormone (GH is a peptide hormone that stimulates growth and cell reproduction in humans and animals. It is a 191-amino acid, single chain polypeptide hormone which is synthesized, stored, and secreted by the somatotroph cells within the lateral wings of the anterior pituitary gland. The goal of this research was to clone and sequence sheep growth hormone of Lori Bakhtiary breed in Iran. For this purpose, RNA was extracted from the pituitary gland of freshly slaughtered sheep and cDNA of growth hormone produced. The T/A cloning technique was used to clone the cDNA of growth hormone and then the synthesized construct was transferred into E. coli as the host. Once the correct recombinants were further confirmed by colony PCR or restriction enzyme digestion, sequencing was done. The sequencing results showed that, the length of sheep growth hormone cDNA was 690 bp fragments. Comparison of sequence of growth hormone inside the synthesized construct with those recorded in Genebank (NCBI, Blast indicated high degrees of similarity between Iranian native sheep and other sheep breeds of the world.

Enzyme assay, cloning and sequencing of novel β-glucosidase ...

African Journals Online (AJOL)

Bioinformatics studies also suggested that the cloned β-glucosidases share some characteristics with their bacterial counterparts. The findings in this study highlight the increasing need for more information on β-glucosidase structure and function. Keywords: Aspergillus niger, β-glucosidase, cellulase, PCR, sequencing, ...

Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

Science.gov (United States)

Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

1999-09-01

Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

Energy Technology Data Exchange (ETDEWEB)

Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

1988-09-26

The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

Construction and sequencing of an infectious clone of the human parvovirus B19

International Nuclear Information System (INIS)

Zhi Ning; Zadori, Zoltan; Brown, Kevin E.; Tijssen, Peter

2004-01-01

Human parvovirus B19 has a nonenveloped, icosahedral capsid packaging a linear single-stranded DNA genome of 5.6 kb with long inverted terminal repeats (ITR) at both the 5' and 3' end. Previous attempts to construct a full-length B19 clone were unsuccessful due to deletions in the ITR sequences. We cloned the complete parvovirus B19 genome with intact ITRs from an aplastic crisis patient. Sequence analysis of the complete viral genome indicated that both 5' and 3' ITRs have two sequence configurations and several base changes within the ITRs compared to previous published sequences. After transfection of the plasmid into permissive cells, spliced and non-spliced viral transcripts and viral capsid proteins could be detected. Southern blot analysis of the DNA purified from the plasmid-transfected cells confirmed parvovirus B19 DNA replication. Production of infectious virus by the B19 plasmid was shown by inoculation of cell lysate derived from transfected cells into fresh cells. Together, these results indicate the first successful production of an infectious clone for parvovirus B19 virus

Human cDNA clones for an α subunit of G/sub i/ signal-transduction protein

International Nuclear Information System (INIS)

Bray, P.; Carter, A.; Guo, V.; Puckett, C.; Kamholz, J.; Spiegel, A.; Nirenberg, M.

1987-01-01

Two cDNA clones were obtained from a λgt11 cDNA human brain library that correspond to α/sub i/ subunits of G signal-transduction proteins (where α/sub i/ subunits refer to the α subunits of G proteins that inhibit adenylate cyclase). The nucleotide sequence of human brain α/sub i/ is highly homologous to that of bovine brain α/sub i/ and the predicted amino acid sequences are identical. However, human and bovine brain α/sub i/ cDNAs differ significantly from α/sub i/ cDNAs from human monocytes, rat glioma, and mouse macrophages in amino acid (88% homology) and nucleotide (71-75% homology) sequences. In addition, the nucleotide sequences of the 3' untranslated regions of human and bovine brain α/sub i/ cDNAs differ markedly from the sequences of human monocyte, rat glioma, and mouse macrophage α/sub i/ cDNAs. These results suggest there are at least two classes of α/sub i/ mRNA

Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

DEFF Research Database (Denmark)

Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

2004-01-01

for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Cloning, sequencing and expression of a novel xylanase cDNA from ...

African Journals Online (AJOL)

A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

Directory of Open Access Journals (Sweden)

Alexander Ulrich

Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

Science.gov (United States)

Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

1992-06-01

Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

Clone DB: an integrated NCBI resource for clone-associated data

Science.gov (United States)

Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

2013-01-01

The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

cDNA, genomic cloning and sequence analysis of ribosomal protein ...

African Journals Online (AJOL)

enoh

2012-03-13

Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

Cloning and sequence analysis of the defective in anther ...

African Journals Online (AJOL)

To clone the defective in anther dehiscence1 (DAD1) gene fragment of Chinese kale, about 700 bp product was obtained by PCR amplification using Chinese kale genomic DNA as the template and a pair of specific primers designed according to the conserved sequence of DAD1 genes of Arabidopsis thaliana and ...

Cloning, DNA sequence, and expression of the Rhodobacter sphaeroides cytochrome c/sub 2/ gene

Energy Technology Data Exchange (ETDEWEB)

Donohue, T.J.; McEwan, A.G.; Kaplan, S.

1986-11-01

The Rhodobacter sphaeroides cytochrome c/sub 2/ functions as a mobile electron carrier in both aerobic and photosynthetic electron transport chains. Synthetic deoxyoligonucleotide probes, based on the known amino acid sequence of this protein (M/sub r/ 14,000), were used to identify and clone the cytochrome c/sub 2/ structural gene (cycA). DNA sequence analysis of the cycA gene indicated the presence of a typical procaryotic 21-residue signal sequence, suggesting that this periplasmic protein is synthesized in vivo as a precursor. Synthesis of an immunoreactive cytochrome c/sub 2/ precursor protein (M/sub r/ 15,500) was observed in vitro when plasmids containing the cycA gene were used as templates in an R. sphaeroides coupled transcription-translation system. Approximately 500 base pairs of DNA upstream of the cycA gene was sufficient to allow expression of this gene product in vitro. Northern blot analysis with an internal cycA-specific probe identified at least two possibly monocistronic transcripts present in both different cellular levels and relative stoichiometries in steady-state cells grown under different physiological conditions. The ratio of the small (740-mucleotide) and large (920-nucleotide) cycA-specific mRNA species was dependent on cultural conditions but was not affected by light intensity under photosynthetic conditions. These results suggest that the increase in the cellular level of the cytochrome c/sub 2/ protein found in photosynthetic cells was due, in part, to increased transcription of the single-copy cyc operon.

Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

Science.gov (United States)

Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

2010-12-01

Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

International Nuclear Information System (INIS)

Aris, J.P.; Blobel, G.

1991-01-01

The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

Science.gov (United States)

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

NARCIS (Netherlands)

Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

2002-01-01

The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

Directory of Open Access Journals (Sweden)

Shui-Lian He

Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

Science.gov (United States)

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

Molecular cloning of cDNAs of human liver and placenta NADH-cytochrome b5 reductase

International Nuclear Information System (INIS)

Yubisui, T.; Naitoh, Y.; Zenno, S.; Tamura, M.; Takeshita, M.; Sakaki, Y.

1987-01-01

A cDNA coding for human liver NADH-cytochrome b 5 reductase was cloned from a human liver cDNA library constructed in phage λgt11. The library was screened by using an affinity-purified rabbit antibody against NADH-cytochrome b 5 reductase of human erythrocytes. A cDNA about 1.3 kilobase pairs long was isolated. By using the cDNA as a probe, another cDNA (pb 5 R141) of 1817 base pairs was isolated that hybridized with a synthetic oligonucleotide encoding Pro-Asp-Ile-Lys-Tyr-Pro, derived from the amino acid sequence at the amino-terminal region of the enzyme from human erythrocytes. Furthermore, by using the pb 5 R141 as a probe, cDNA clones having more 5' sequence were isolated from a human placenta cDNA library. The amino acid sequences deduced from the nucleotide sequences of these cDNA clones overlapped each other and consisted of a sequence that completely coincides with that of human erythrocytes and a sequence of 19 amino acid residues extended at the amino-terminal side. The latter sequence closely resembles that of the membrane-binding domain of steer liver microsomal enzyme

Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

Energy Technology Data Exchange (ETDEWEB)

Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

1989-06-12

The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

OpenAIRE

Liew, C C; Jandreski, M A

1986-01-01

A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

Molecular cloning of osteoma-inducing replication-competent murine leukemia viruses from the RFB osteoma virus stock

DEFF Research Database (Denmark)

Pedersen, Lene; Behnisch, Werner; Schmidt, Jörg

1992-01-01

We report the molecular cloning of two replication-competent osteoma-inducing murine leukemia viruses from the RFB osteoma virus stock (M. P. Finkel, C. A. Reilly, Jr., B. O. Biskis, and I. L. Greco, p. 353-366, in C. H. G. Price and F. G. M. Ross, ed., Bone--Certain Aspects of Neoplasia, 1973......). Like the original RFB osteoma virus stock, viruses derived from the molecular RFB clones induced multiple osteomas in mice of the CBA/Ca strain. The cloned RFB viruses were indistinguishable by restriction enzyme analysis and by nucleotide sequence analysis of their long-terminal-repeat regions...

Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.

Science.gov (United States)

Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit

2018-01-01

Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.

Sequencing genes in silico using single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Zhang Xinyi

2012-01-01

Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

Cloning of the human carnitine-acylcarnitine carrier cDNA and identification of the molecular defect in a patient

NARCIS (Netherlands)

Huizing, M.; Iacobazzi, V.; IJlst, L.; Savelkoul, P.; Ruitenbeek, W.; van den Heuvel, L.; Indiveri, C.; Smeitink, J.; Trijbels, F.; Wanders, R.; Palmieri, F.

1997-01-01

The carnitine-acylcarnitine carrier (CAC) catalyzes the translocation of long-chain fatty acids across the inner mitochondrial membrane. We cloned and sequenced the human CAC cDNA, which has an open reading frame of 903 nucleotides. Northern blot studies revealed different expression levels of CAC

Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

International Nuclear Information System (INIS)

Han, J.H.; Stratowa, C.; Rutter, W.J.

1987-01-01

The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

KAUST Repository

Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

2011-01-01

Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

International Nuclear Information System (INIS)

Nuc, K.; Nuc, P.; Pawelkiewicz, J.

1993-01-01

We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

Science.gov (United States)

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

Directory of Open Access Journals (Sweden)

Cheng-Chong Chou

2004-11-01

Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

cDNA, genomic sequence cloning and analysis of the ribosomal ...

African Journals Online (AJOL)

Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

Identification and cloning of four riboswitches from Burkholderia pseudomallei strain K96243

Science.gov (United States)

Munyati-Othman, Noor; Fatah, Ahmad Luqman Abdul; Piji, Mohd Al Akmarul Fizree Bin Md; Ramlan, Effirul Ikhwan; Raih, Mohd Firdaus

2015-09-01

Structured RNAs referred as riboswitches have been predicted to be present in the genome sequence of Burkholderia pseudomallei strain K96243. Four of the riboswitches were identified and analyzed through BLASTN, Rfam search and multiple sequence alignment. The RNA aptamers belong to the following riboswitch classifications: glycine riboswitch, cobalamin riboswitch, S-adenosyl-(L)-homocysteine (SAH) riboswitch and flavin mononucleotide (FMN) riboswitch. The conserved nucleotides for each aptamer were identified and were marked on the secondary structure generated by RNAfold. These riboswitches were successfully amplified and cloned for further study.

Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

International Nuclear Information System (INIS)

Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

1987-01-01

Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

Directory of Open Access Journals (Sweden)

Yu-Hoon Kim

2014-01-01

Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

Directory of Open Access Journals (Sweden)

Tautz Diethard

2002-03-01

Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

International Nuclear Information System (INIS)

Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

1988-01-01

HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

International Nuclear Information System (INIS)

Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

1988-01-01

cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.

Directory of Open Access Journals (Sweden)

Rui-Jun Su

Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

Science.gov (United States)

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

International Nuclear Information System (INIS)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-01-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

Energy Technology Data Exchange (ETDEWEB)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-02-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2014-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

DEFF Research Database (Denmark)

Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

2004-01-01

The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....

A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

Directory of Open Access Journals (Sweden)

Boulund Fredrik

2012-12-01

Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

Molecular cloning and characterization of Antheraea mylitta cytoplasmic polyhedrosis virus polyhedrin gene and its variant forms

International Nuclear Information System (INIS)

Sinha-Datta, Uma; Chavali, Venkata Ramana Murthy; Ghosh, Ananta K.

2005-01-01

The segments 10 (S10) of the 11 double stranded RNA genomes from Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV) encoding a novel polyhedrin polypeptide was converted to cDNA, cloned, and sequenced. Three cDNA clones consisting of 1502 (AmCPV10-1), 1120 (AmCPV10-2), and 1415 (AmCPV10-3) nucleotides encoding polyhedrin of 254, 339, and 319 amino acids with molecular masses of 29, 39, and 37 kDa, respectively, were obtained, and verified by Northern analysis. These clones showed 70-94% sequence identity among them but none with any sequences in databases. The expression of AmCPV10-1 cDNA encoded polyhedrin in Sf-9 cells was detected by immunoblot analysis and formation of polyhedra by electron microscopy, as observed in AmCPV-infected gut cells, but no expression of AmCPV10-2 or AmCPV10-3 cDNA was detected, indicating that during AmCPV replication, along with functional S10 RNA, some defective variant forms of S10 RNAs are packaged in virion particles

Directed PCR-free engineering of highly repetitive DNA sequences

Directory of Open Access Journals (Sweden)

Preissler Steffen

2011-09-01

Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

Cloning and Expression Vector Construction of Glutamate Decarboxylase Gene from Lactobacillus Plantarum

Directory of Open Access Journals (Sweden)

B Arabpour

2016-06-01

Full Text Available BACKGROUND AND OBJECTIVE: Gamma-aminobutyric acid (GABA is a four-carbon non-protein amino acid used in the treatment of hypertension, diabetes, inflammation, and depression. GABA is synthesized by glutamic acid decarboxylase (GAD enzyme in many organisms, including bacteria. Therefore, cloning of this enzyme is essential to the optimization of GABA production. This study aimed to clone and construct the expression vector of GAD gene from Lactobacillus plantarum PTCC 1058 bacterium. METHODS: In this experimental study, we investigated the morphological, biochemical, genetic and 16s rDNA sequencing of L. plantarum PTCC 1058 strain. Genomic DNA of the bacterium was isolated and amplified using the GAD gene via polymerase chain reaction (PCR. Afterwards, the gene was inserted into the pJET1.2/blunt cloning vector and subcloned in vector pET32a. Plasmid pET32a-gad expression vector was transformed in Escherichia coli BL21 strain, and protein expression was assessed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE. FINDINGS: Morphological, biochemical and genetic analyses of 16s rDNA sequencing indicated that the studied substrain was of the L. plantarum strain. In addition, results of nucleotide sequencing of the fragmented segment via PCR showed the presence of GAD gene. Results of colony PCR and SDS-PAGE analysis confirmed the accuracy of the cloning and gene expression of the recombinant Escherichia coli BL21 strain. CONCLUSION: According to the results of this study, cloning of GAD gene from L. plantarum PTCC 1058 was successful. These cloned genes could grow rapidly in prokaryotic and eukaryotic systems and be used in cost-effective culture media and even non-recyclable waste.

Distinct forms of the β subunit of GTP-binding regulatory proteins identified by molecular cloning

International Nuclear Information System (INIS)

Fong, H.K.W.; Amatruda, T.T. III; Birren, B.W.; Simon, M.I.

1987-01-01

Two distinct β subunits of guanine nucleotide-binding regulatory proteins have been identified by cDNA cloning and are referred to as β 1 and β 1 subunits. The bovine transducin β subunit (β 1 ) has been cloned previously. The author now isolated and analyzed cDNA clones that encode the β 2 subunit from bovine adrenal, bovine brain, and a human myeloid leukemia cell line, HL-60. The 340-residue M/sub r/ 37,329 Β 2 protein is 90% identical with β 1 in predicted amino acid sequence, and it is also organized as a series of repetitive homologous segments. The major mRNA that encodes the bovine β 2 subunit is 1.7 kilobases in length. It is expressed at lower levels than β 1 subunit mRNA in all tissues examined. The β 1 and β 2 messages are expressed in cloned human cell lines. Hybridization of cDNA probes to bovine DNA showed that β 1 and β 2 are encoded by separate genes. The amino acid sequences for the bovine and human β 2 subunit are identical, as are the amino acid sequences for the bovine and human β 1 subunit. This evolutionary conservation suggests that the two β subunits have different roles in the signal transduction process

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

Science.gov (United States)

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

The cDNA sequence of a neutral horseradish peroxidase.

Science.gov (United States)

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

Science.gov (United States)

Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

2016-08-01

A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

In vitro and in silico cloning of Xenopus laevis SOD2 cDNA and its phylogenetic analysis.

Science.gov (United States)

Purrello, Michele; Di Pietro, Cinzia; Ragusa, Marco; Pulvirenti, Alfredo; Giugno, Rosalba; Di Pietro, Valentina; Emmanuele, Giovanni; Travali, Salvo; Scalia, Marina; Shasha, Dennis; Ferro, Alfredo

2005-02-01

By using the methodology of both wet and dry biology (i.e., RT-PCR and cycle sequencing, and biocomputational technology, respectively) and the data obtained through the Genome Projects, we have cloned Xenopus laevis SOD2 (MnSOD) cDNA and determined its nucleotide sequence. These data and the deduced protein primary structure were compared with all the other SOD2 nucleotide and amino acid sequences from eukaryotes and prokaryotes, published in public databases. The analysis was performed by using both Clustal W, a well known and widely used program for sequence analysis, and AntiClustAl, a new algorithm recently created and implemented by our group. Our results demonstrate a very high conservation of the enzyme amino acid sequence during evolution, which proves a close structure-function relationship. This is to be expected for very ancient molecules endowed with critical biological functions, performed through a specific structural organization. The nucleotide sequence conservation is less pronounced: this too was foreseeable, due to neutral mutations and to the species-specific codon usage. The data obtained by using AntiClustAl are comparable with those produced with Clustal W, which validates this algorithm as an important new tool for biocomputational analysis. Finally, it is noteworthy that evolutionary trees, drawn by using all the available data on SOD2 nucleotide sequences and amino acid and either Clustal W or AntiClustAl, are comparable to those obtained through phylogenetic analysis based on fossil records.

Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

International Nuclear Information System (INIS)

Maat, J.

1978-01-01

A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

NARCIS (Netherlands)

DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

1992-01-01

The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

Nucleotide sequence of the human N-myc gene

International Nuclear Information System (INIS)

Stanton, L.W.; Schwab, M.; Bishop, J.M.

1986-01-01

Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

DEFF Research Database (Denmark)

Vorum, H; Liu, X; Madsen, Peder

1998-01-01

By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

International Nuclear Information System (INIS)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human.

Science.gov (United States)

Magness, Charles L; Fellin, P Campion; Thomas, Matthew J; Korth, Marcus J; Agy, Michael B; Proll, Sean C; Fitzgibbon, Matthew; Scherer, Christina A; Miner, Douglas G; Katze, Michael G; Iadonato, Shawn P

2005-01-01

We report the initial sequencing and comparative analysis of the Macaca mulatta transcriptome. Cloned sequences from 11 tissues, nine animals, and three species (M. mulatta, M. fascicularis, and M. nemestrina) were sampled, resulting in the generation of 48,642 sequence reads. These data represent an initial sampling of the putative rhesus orthologs for 6,216 human genes. Mean nucleotide diversity within M. mulatta and sequence divergence among M. fascicularis, M. nemestrina, and M. mulatta are also reported.

Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum

International Nuclear Information System (INIS)

Anon.

1986-01-01

Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively

Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

Science.gov (United States)

Cai, Yongping; Lin, Yi

2013-01-01

In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Yuan Tong

2010-01-01

Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

Science.gov (United States)

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

Directory of Open Access Journals (Sweden)

Roberts Richard J

2008-05-01

Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

International Nuclear Information System (INIS)

Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

1997-01-01

A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

Science.gov (United States)

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

Science.gov (United States)

Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

1992-04-01

This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

Science.gov (United States)

Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

2016-03-01

The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

Science.gov (United States)

Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

1993-02-01

A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

Science.gov (United States)

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

NARCIS (Netherlands)

Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport

Human catechol-O-methyltransferase: Cloning and expression of the membrane-associated form

International Nuclear Information System (INIS)

Bertocci, B.; Miggiano, V.; Da Prada, M.; Dembic, Z.; Lahm, H.W.; Malherbe, P.

1991-01-01

A cDNA clone for human catechol-O-methyltransferase was isolated from a human hepatoma cell line (Hep G2) cDNA library by hybridization screening with a porcine cDNA probe. The cDNA clone was sequenced and found to have an insert of 1226 nucleotides. The deduced primary structure of hCOMT is composed of 271 amino acid residues with the predicted molecular mass of 30 kDa. At its N terminus it has a hydrophobic segment of 21 amino acid residues that may be responsible for insertion of hCOMT into the endoplasmic reticulum membrane. The primary structure of hCOMT exhibits high homology to the porcine partial cDNA sequence (93%). The deduced amino acid sequence contains two tryptic peptide sequences (T-22, T-33) found in porcine liver catechol-O-methyltransferase (CEMT). The coding region of hCOMT cDNA was placed under the control of the cytomegalovirus promoter to transfect human kidney 293 cells. The recombinant hCOMT was shown by immunoblot analysis to be mainly associated with the membrane fraction. RNA blot analysis revealed one COMT mRNA transcript of 1.4 kilobases in Hep G2 poly(A) + RNA

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Science.gov (United States)

2010-07-01

... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

Base Sequence Context Effects on Nucleotide Excision Repair

Directory of Open Access Journals (Sweden)

Yuqin Cai

2010-01-01

Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

Science.gov (United States)

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

Characterization of the env gene and long terminal repeat of molecularly cloned Friend mink cell focus-inducing virus DNA.

OpenAIRE

Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A

1984-01-01

The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

Science.gov (United States)

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

Directory of Open Access Journals (Sweden)

Xiaolin Ji

Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

Science.gov (United States)

Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

2016-10-01

A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

CLONING, SEQUENCE ANALYSIS, AND CHARACTERIZATION OF PUTATIVE BETA-LACTAMASE OF STENOTROPHOMONAS MALTOPHILIA

Directory of Open Access Journals (Sweden)

Chong Seng Shueh

2012-10-01

Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.

Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

Science.gov (United States)

Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

2016-01-01

Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

Energy Technology Data Exchange (ETDEWEB)

Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

1986-01-24

The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

Directory of Open Access Journals (Sweden)

Qing Jin

Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

Science.gov (United States)

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

DEFF Research Database (Denmark)

Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

1987-01-01

We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

Energy Technology Data Exchange (ETDEWEB)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

1987-02-01

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

Science.gov (United States)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

Science.gov (United States)

Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

2007-01-01

Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

Molecular Cloning, Expression and Characterization of Plasmid Encoding Rhomboid 4 (ROM4 of Tachyzoite of Toxoplasma gondii RH Strain

Directory of Open Access Journals (Sweden)

Mohammad Taghi RAHIMI

2017-12-01

Full Text Available AbstractBackground: The objective of this study was to clone, express and characterize the gene encoding rhomboid 4 (ROM4 proteins, a vital gene in surface adhesion and host cell invasion process of tachyzoite of T. gondii in an appropriate expression vector and eukaryotic cell for production of recombinant protein.Methods: Toxoplasma RNA was isolated from tachyzoites (RH strain and complementary DNA was synthesized. Oligonucleotide primer pair was designed based on Toxoplasma ROM4 gene sequence with XhoI and EcoRI restriction sites at 5´ end of forward and reverse primers, respectively. ROM4 gene was amplified by PCR, cloned into pTG19-T vector and the recombinant plasmid was sequenced. The gene was subcloned into pcDNA3 plasmid and expressed in CHO cells as eukaryotic cell. SDS-PAGE and western blotting were performed for protein determination and verification.Results: Cloning of ROM4 gene in pTG19-T vector was confirmed by colony-PCR and enzymatic digestion. The results of enzymatic digestion and gene sequencing confirmed successful cloning and subcloning procedures. The nucleotide sequence of the cloned ROM4 gene showed 99% homology compared to the corresponding sequences of original gene. SDS-PAGE and western blotting analyses of the purified protein revealed a single band having expected size of 65 kDa.Conclusion: This eukaryotic expression system is an appropriate system for high-level recombinant protein production of ROM4 gene from T. gondii tachyzoites used as antigenic component for serological assay and vaccine development.

Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

Directory of Open Access Journals (Sweden)

White Frank F

2011-07-01

Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

Science.gov (United States)

Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

2009-11-01

RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

Supplementation of Nucleosides During Selection can Reduce Sequence Variant Levels in CHO Cells Using GS/MSX Selection System.

Science.gov (United States)

Tang, Danming; Lam, Cynthia; Louie, Salina; Hoi, Kam Hon; Shaw, David; Yim, Mandy; Snedecor, Brad; Misaghi, Shahram

2018-01-01

In the process of generating stable monoclonal antibody (mAb) producing cell lines, reagents such as methotrexate (MTX) or methionine sulfoximine (MSX) are often used. However, using such selection reagent(s) increases the possibility of having higher occurrence of sequence variants in the expressed antibody molecules due to the effects of MTX or MSX on de novo nucleotide synthesis. Since MSX inhibits glutamine synthase (GS) and results in both amino acid and nucleoside starvation, it is questioned whether supplementing nucleosides into the media could lower sequence variant levels without affecting titer. The results show that the supplementation of nucleosides to the media during MSX selection decreased genomic DNA mutagenesis rates in the selected cells, probably by reducing nucleotide mis-incorporation into the DNA. Furthermore, addition of nucleosides enhance clone recovery post selection and does not affect antibody expression. It is further observed that nucleoside supplements lowered DNA mutagenesis rates only at the initial stage of the clone selection and do not have any effect on DNA mutagenesis rates after stable cell lines are established. Therefore, the data suggests that addition of nucleosides during early stages of MSX selection can lower sequence variant levels without affecting titer or clone stability in antibody expression. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

Science.gov (United States)

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

Science.gov (United States)

Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

2016-10-04

To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

International Nuclear Information System (INIS)

Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

1988-01-01

Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

KAUST Repository

Sugumar, Thennarasu

2011-12-12

Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

Science.gov (United States)

Kröger, M; Tschesche, H

1997-09-01

The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

NARCIS (Netherlands)

Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

Science.gov (United States)

Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

2011-04-01

A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

Science.gov (United States)

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

Science.gov (United States)

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

Science.gov (United States)

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Genomic organization and developmental fate of adjacent repeated sequences in a foldback DNA clone of Tetrahymena thermophila

International Nuclear Information System (INIS)

Tschunko, A.H.; Loechel, R.H.; McLaren, N.C.; Allen, S.L.

1987-01-01

DNA sequence elimination and rearrangement occurs during the development of somatic cell lineages of eukaryotes and was first discovered over a century ago. However, the significance and mechanism of chromatin elimination are not understood. DNA elimination also occurs during the development of the somatic macronucleus from the germinal micronucleus in unicellular ciliated protozoa such as Tetrahymena thermophila. In this study foldback DNA from the micronucleus was used as a probe to isolate ten clones. All of those tested (4/4) contained sequences that were repetitive in the micronucleus and rearranged in the macronucleus. Inverted repeated sequences were present in one clone. This clone, pTtFBl, was subjected to a detailed analysis of its developmental fate. Subregions were subcloned and used as probes against Southern blots of micronuclear and macronuclear DNA. DNA was labeled with [ 33 P]-labeled dATP. The authors found that all subregions defined repeated sequence families in the micronuclear genome. A minimum of four different families was defined, two of which are retained in the macronucleus and two of which are completely eliminated. The inverted repeat family is retained with little rearrangement. Two of the families, defined by subregions that do not contain parts of the inverted repeat are totally eliminated during macronuclear development-and contain open reading frames. The significance of retained inverted repeats to the process of elimination is discussed

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Directory of Open Access Journals (Sweden)

Meiler Arno

2012-09-01

Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Science.gov (United States)

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Cloning and sequence of the human adrenodoxin reductase gene

International Nuclear Information System (INIS)

Lin, Dong; Shi, Y.; Miller, W.L.

1990-01-01

Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

Identification of cDNA clones expressing immunodiagnostic antigens from Trichinella spiralis

International Nuclear Information System (INIS)

Zarlenga, D.; Gamble, H.R.

1987-01-01

A cDNA expression library was built in lambda gt11 phage using poly A mRNA isolated from Trichinella spiralis muscle stage larvae. This library was screened with rabbit antibodies to parasite excretory-secretory (ES) products and greater than 180 clones were isolated. Thirteen clones producing highly immunogenic protein antigens were plaque purified and rescreened with pig antisera to T.spiralis, Trichuris suis or Ascaris suum to identify clones producing epitopes specific to T.spiralis ES products, only. Two clones, TsAc-2 and TsAc-8, which displayed strong interactions with pig antisera to T. spiralis were lysogenized in E. coli Y1089 and the protein extracted. Western blots of the crude fusion proteins revealed molecular weights of 133 kD and 129 kD, respectively. Northern blot analysis of total RNA with 32 P labelled cDNA:lambda gt11 probes indicated single RNA transcripts for each clone with molecular sizes corresponding to 800-850 nucleotides. dscDNA inserts were estimated by southern blot analysis to be 500 bp and 340 bp, respectively, with no cross-hybridization observed between the cloned sequences. Dot blots using pig sera to screen crude fusion protein preparations, total bacterial protein (negative controls) and crude worm extract or ES products from T.spiralis, T.suis and A.suum (positive controls) corroborated the specificity and sensitivity of these clones as potential diagnostic antigens for swine trichinellosis

Cloning, sequencing, and expression of interferon-γ from elk in North America

Science.gov (United States)

Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.

2001-01-01

Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

Science.gov (United States)

Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

2010-04-15

Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

CLONING AND SEQUENCING OF PGIP FROM ‘JIN SERIES’ ALMOND (PRUNUS DULCIS

Directory of Open Access Journals (Sweden)

Yuhu Han

2015-12-01

Full Text Available Specific primers synthesized according to conservative regions of polygalacturonase inhibiting protein (PGIP gene were used to amplify Prunus Dulcis genomic DNA by polymerase-chain reaction (PCR. Six bands (pgip1, pgip2, pgip3, pgip4, pgip5 and pgip6 of genes were obtained and cloned into PBS-T vector. According to the length of bands, 717bp, 864bp, 796bp were A1 (pgip1, pgip2, pgip3, A2 (pgip4, A4 (pgip5, pgip6, respectively. DNA sequences showed that the fragments taken together were the gene encoding PGIP. A2 and A3 contained two exons interrupted by one intron, which has GT-AG sequence. Its DNA and amino acid sequences were highly homologies to those from Prunus Persica; Prunus Salicina; Prunus Americana; Prunus Mume, respectively. A conserved lencinerial fragment exists in the derived protein sequence.

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

Science.gov (United States)

Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

1995-06-01

cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

Directory of Open Access Journals (Sweden)

Chih-Jie Shen

2014-01-01

Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

Science.gov (United States)

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

Directory of Open Access Journals (Sweden)

Francesca Bertolini

Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Sequence determination and analysis of the NSs genes of two tospoviruses.

Science.gov (United States)

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Simultaneous cloning and expression of two cellulase genes from Bacillus subtilis newly isolated from Golden Takin (Budorcas taxicolor Bedfordi)

International Nuclear Information System (INIS)

Li, Wang; Huan, Xiajuan; Zhou, Ying; Ma, Qingyi; Chen, Yulin

2009-01-01

A bacterial strain with high cellulase activity was isolated of feces sample of Golden Takin (Budorcas taxicolor Bedfordi). The bacterium was classified and designated Bacillus subtilis LN by morphological and 16SrDNA gene sequence analysis. Two putative cellulase genes, CelL15 and CelL73, were simultaneously cloned from the isolated strain by PCR. The putative gene CelL15 consisted of an open reading frame (ORF) of 1470 nucleotides and encoded a protein of 490 amino acids with a molecular weight of 54 kDa. The CelL73 gene consisted of an open reading frame (ORF) of 741 nucleotides and encoded a protein of 247 amino acids with a molecular weight of 27 kDa. Both genes were purified and cloned into pET-28a for expression in Escherichia coli BL21 (DE3). The ability of E. coli to degrade cellulose was enhanced when the two recombinants were cultured together.

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

Science.gov (United States)

Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

2014-01-25

Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

NARCIS (Netherlands)

Steenbergh, P.H.; Sussenbach, J.S.

The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Science.gov (United States)

2010-07-01

... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

Science.gov (United States)

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

International Nuclear Information System (INIS)

Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

1987-01-01

Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

Science.gov (United States)

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

[Scientific ethics of human cloning].

Science.gov (United States)

Valenzuela, Carlos Y

2005-01-01

True cloning is fission, budding or other types of asexual reproduction. In humans it occurs in monozygote twinning. This type of cloning is ethically and religiously good. Human cloning can be performed by twinning (TWClo) or nuclear transfer (NTClo). Both methods need a zygote or a nuclear transferred cell, obtained in vitro (IVTec). They are under the IVTec ethics. IVTecs use humans (zygotes, embryos) as drugs or things; increase the risk of malformations; increase development and size of abnormalities and may cause long-term changes. Cloning for preserving extinct (or almost extinct) animals or humans when sexual reproduction is not possible is ethically valid. The previous selection of a phenotype in human cloning violates some ethical principles. NTClo for reproductive or therapeutic purposes is dangerous since it increases the risk for nucleotide or chromosome mutations, de-programming or re-programming errors, aging or malignancy of the embryo cells thus obtained.

Rapid in silico cloning of genes using expressed sequence tags (ESTs).

Science.gov (United States)

Gill, R W; Sanseau, P

2000-01-01

Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

OpenAIRE

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

Science.gov (United States)

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

Planarian homeobox genes: cloning, sequence analysis, and expression.

Science.gov (United States)

Garcia-Fernàndez, J; Baguñà, J; Saló, E

1991-01-01

Freshwater planarians (Platyhelminthes, Turbellaria, and Tricladida) are acoelomate, triploblastic, unsegmented, and bilaterally symmetrical organisms that are mainly known for their ample power to regenerate a complete organism from a small piece of their body. To identify potential pattern-control genes in planarian regeneration, we have isolated two homeobox-containing genes, Dth-1 and Dth-2 [Dugesia (Girardia) tigrina homeobox], by using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from helix-3 of the homeodomain. Dth-1 and Dth-2 homeodomains are closely related (68% at the nucleotide level and 78% at the protein level) and show the conserved residues characteristic of the homeodomains identified to data. Similarity with most homeobox sequences is low (30-50%), except with Drosophila NK homeodomains (80-82% with NK-2) and the rodent TTF-1 homeodomain (77-87%). Some unusual amino acid residues specific to NK-2, TTF-1, Dth-1, and Dth-2 can be observed in the recognition helix (helix-3) and may define a family of homeodomains. The deduced amino acid sequences from the cDNAs contain, in addition to the homeodomain, other domains also present in various homeobox-containing genes. The expression of both genes, detected by Northern blot analysis, appear slightly higher in cephalic regions than in the rest of the intact organism, while a slight increase is detected in the central period (5 days) or regeneration. Images PMID:1714599

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

Science.gov (United States)

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

Science.gov (United States)

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH.

Science.gov (United States)

Wang, Jianye; Duan, Jinkun; Zhu, Liqian; Jiang, Zhiwei; Zhu, Guoqiang

2015-03-01

In this study, the complete genome of the virulent strain LH of goose parvovirus (GPV) was sequenced and cloned into the pBluescript II (SK) plasmid vector. Sequence alignments of the inverted terminal repeats (ITR) of GPV strains revealed a common 14-nt-pair deletion in the stem of the palindromic structure in the LH strain and three other strains isolated after 1982 when compared to three GPV strains isolated earlier than that time. Transfection of 11-day-old embryonated goose eggs with the plasmid pLH, which contains the entire genome of strain LH, resulted in successful rescue of the infectious virus. Death of embryos after transfection via the chorioallantoic membrane infiltration route occurred earlier than when transfection was done via the allantoic cavity inoculation route. The rescued virus exhibited virulence similar to that of its parental virus, as evaluated by the mortality rate in goslings. Generation of the pathogenic infectious clone provides us with a powerful tool to elucidate the molecular pathogenesis of GPV in the future.

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure

Directory of Open Access Journals (Sweden)

Claudia Trigo Pedroso Moraes

2015-02-01

Full Text Available Human respiratory syncytial virus (HRSV is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure.

Science.gov (United States)

Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz

2015-02-01

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.

Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

International Nuclear Information System (INIS)

Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

2003-01-01

The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

[Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

Science.gov (United States)

Kuznedelov, K D; Timoshkin, O A

1995-01-01

Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

Science.gov (United States)

Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

2011-10-01

Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

Science.gov (United States)

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-04-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

Isolation of a sex-linked DNA sequence in cranes.

Science.gov (United States)

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

Science.gov (United States)

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

DEFF Research Database (Denmark)

Cowell, G M; Kønigshøfer, E; Danielsen, E M

1988-01-01

The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

Cloning and Sequence Analysis of the Amylase Gene from the Rice Pest Walker and its Inhibitor from Wheat (Variety MP Sehore

Directory of Open Access Journals (Sweden)

Poonam Sharma

2009-01-01

Full Text Available Scirpophaga incertulas Walker (Lepidoptera: Pyralideae, commonly known as yellow stem borer, is a predominant monophagous pest of rice, which causes 5% to 30% loss of the rice crop. We report for the first time, the cloning and sequence analysis of the amylase gene of this pest. The cloned gene translates into a protein of 487 amino acids having a predicted molecular weight of 54,955 daltons and a theoretical pI of 5.9. The 3D structure of the amylase is predicted from its amino acid sequence by homology modeling using the structure of the amylase from Tenebrio molitor L (Coleoptera: Tenebrionidae. We also report the purification of a dimeric α-amylase inhibitor from a local variety of wheat MP Sehore that is specific for the amylase of this pest and does not inhibit human salivary amylase or porcine pancreatic amylase. The gene encoding this inhibitor has been cloned and its sequence has been analysed to find a possible explanation for this specificity.

Characterization of a novel HLA-B*39:01:01-related allele, HLA-B*39:130, by cloning and phasing.

Science.gov (United States)

Li, L X; Tian, W; Zhu, F M; Wang, W Y; Cai, J H

2017-12-01

A novel HLA-B*39:01:01-related variant, HLA-B*39:130, has been identified in a normal individual of Han ethnicity in Hunan province, southern China. Following Sanger polymerase chain reaction-sequence-based typing (PCR-SBT), this new allele was further confirmed by cloning, phasing and sequencing. Aligned with HLA-B*39:01:01, HLA-B*39:130 has a nonsynonymous thymine substitution at nucleotide position 94 in exon 4, resulting in amino acid change from threonine to isoleucine at codon 214 (ACA→ATA) of the mature HLA-BmRNA molecule. © 2017 John Wiley & Sons Ltd.

The first insight into the salvia (lamiaceae) genome via bac library construction and high-throughput sequencing of target bac clones

International Nuclear Information System (INIS)

Hao, D.C.; Vautrin, S.; Berges, H.; Chen, S.L.

2015-01-01

Salvia is a representative genus of Lamiaceae, a eudicot family with significant species diversity and population adaptibility. One of the key goals of Salvia genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of medicinal plants to increase their health and productivity. Large-insert genomic libraries are a fundamental tool for achieving this purpose. We report herein the construction, characterization and screening of a gridded BAC library for Salvia officinalis (sage). The S. officinalis BAC library consists of 17,764 clones and the average insert size is 107 Kb, corresponding to 3 haploid genome equivalents. Seventeen positive clones (average insert size 115 Kb) containing five terpene synthase (TPS) genes were screened out by PCR and 12 of them were subject to Illumina HiSeq 2000 sequencing, which yielded 28,097,480 90-bp raw reads (2.53 Gb). Scaffolds containing sabinene synthase (Sab), a Sab homolog, TPS3 (kaurene synthase-like 2), copalyl diphosphate synthase 2 and one cytochrome P450 gene were retrieved via de novo assembly and annotation, which also have flanking noncoding sequences, including predicted promoters and repeat sequences. Among 2,638 repeat sequences, there are 330 amplifiable microsatellites. This BAC library provides a new resource for Lamiaceae genomic studies, including microsatellite marker development, physical mapping, comparative genomics and genome sequencing. Characterization of positive clones provided insights into the structure of the Salvia genome. These sequences will be used in the assembly of a future genome sequence for S. officinalis. (author)

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Genomic clones of bovine parvovirus: Construction and effect of deletions and terminal sequence inversions on infectivity

International Nuclear Information System (INIS)

Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C.

1988-01-01

Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of [ 35 S]methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

Science.gov (United States)

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

International Nuclear Information System (INIS)

Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

1988-01-01

A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

Directory of Open Access Journals (Sweden)

Redkar Rajendra

2004-02-01

Full Text Available Abstract Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives.

Single-Nucleotide Polymorphisms Reveal Spatial Diversity Among Clones of Yersinia pestis During Plague Outbreaks in Colorado and the Western United States.

Science.gov (United States)

Lowell, Jennifer L; Antolin, Michael F; Andersen, Gary L; Hu, Ping; Stokowski, Renee P; Gage, Kenneth L

2015-05-01

In western North America, plague epizootics caused by Yersinia pestis appear to sweep across landscapes, primarily infecting and killing rodents, especially ground squirrels and prairie dogs. During these epizootics, the risk of Y. pestis transmission to humans is highest. While empirical models that include climatic conditions and densities of rodent hosts and fleas can predict when epizootics are triggered, bacterial transmission patterns across landscapes, and the scale at which Y. pestis is maintained in nature during inter-epizootic periods, are poorly defined. Elucidating the spatial extent of Y. pestis clones during epizootics can determine whether bacteria are propagated across landscapes or arise independently from local inter-epizootic maintenance reservoirs. We used DNA microarray technology to identify single-nucleotide polymorphisms (SNPs) in 34 Y. pestis isolates collected in the western United States from 1980 to 2006, 21 of which were collected during plague epizootics in Colorado. Phylogenetic comparisons were used to elucidate the hypothesized spread of Y. pestis between the mountainous Front Range and the eastern plains of northern Colorado during epizootics. Isolates collected from across the western United States were included for regional comparisons. By identifying SNPs that mark individual clones, our results strongly suggest that Y. pestis is maintained locally and that widespread epizootic activity is caused by multiple clones arising independently at small geographic scales. This is in contrast to propagation of individual clones being transported widely across landscapes. Regionally, our data are consistent with the notion that Y. pestis diversifies at relatively local scales following long-range translocation events. We recommend that surveillance and prediction by public health and wildlife management professionals focus more on models of local or regional weather patterns and ecological factors that may increase risk of widespread

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

Science.gov (United States)

Sakoda, H; Imanaka, T

1992-02-01

Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH.

Grizzly bear corticosteroid binding globulin: Cloning and serum protein expression.

Science.gov (United States)

Chow, Brian A; Hamilton, Jason; Alsop, Derek; Cattet, Marc R L; Stenhouse, Gordon; Vijayan, Mathilakath M

2010-06-01

Serum corticosteroid levels are routinely measured as markers of stress in wild animals. However, corticosteroid levels rise rapidly in response to the acute stress of capture and restraint for sampling, limiting its use as an indicator of chronic stress. We hypothesized that serum corticosteroid binding globulin (CBG), the primary transport protein for corticosteroids in circulation, may be a better marker of the stress status prior to capture in grizzly bears (Ursus arctos). To test this, a full-length CBG cDNA was cloned and sequenced from grizzly bear testis and polyclonal antibodies were generated for detection of this protein in bear sera. The deduced nucleotide and protein sequences were 1218 bp and 405 amino acids, respectively. Multiple sequence alignments showed that grizzly bear CBG (gbCBG) was 90% and 83% identical to the dog CBG nucleotide and amino acid sequences, respectively. The affinity purified rabbit gbCBG antiserum detected grizzly bear but not human CBG. There were no sex differences in serum total cortisol concentration, while CBG expression was significantly higher in adult females compared to males. Serum cortisol levels were significantly higher in bears captured by leg-hold snare compared to those captured by remote drug delivery from helicopter. However, serum CBG expression between these two groups did not differ significantly. Overall, serum CBG levels may be a better marker of chronic stress, especially because this protein is not modulated by the stress of capture and restraint in grizzly bears. Copyright 2010 Elsevier Inc. All rights reserved.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Characterization of Rous sarcoma virus-related sequences in the Japanese quail.

Science.gov (United States)

Chambers, J A; Cywinski, A; Chen, P J; Taylor, J M

1986-08-01

We detected sequences related to the avian retrovirus Rous sarcoma virus within the genome of the Japanese quail, a species previously considered to be free of endogenous avian leukosis virus elements. Using low-stringency conditions of hybridization, we screened a quail genomic library for clones containing retrovirus-related information. Of five clones so selected, one, lambda Q48, contained sequence information related to the gag, pol, and env genes of Rous sarcoma virus arranged in a contiguous fashion and spanning a distance of approximately 5.8 kilobases. This organization is consistent with the presence of an endogenous retroviral element within the Japanese quail genome. Use of this element as a high-stringency probe on Southern blots of genomic digests of several quail DNA demonstrated hybridization to a series of high-molecular-weight bands. By slot hybridization to quail DNA with a cloned probe, it was deduced that there were approximately 300 copies per diploid cell. In addition, the quail element also hybridized at low stringency to the DNA of the White Leghorn chicken and at high stringency to the DNAs of several species of jungle fowl and both true and ruffed pheasants. Limited nucleotide sequencing analysis of lambda Q48 revealed homologies of 65, 52, and 46% compared with the sequence of Rous sarcoma virus strain Prague C for the endonuclease domain of pol, the pol-env junction, and the 3'-terminal region of env, respectively. Comparisons at the amino acid level were also significant, thus confirming the retrovirus relatedness of the cloned quail element.

Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

Directory of Open Access Journals (Sweden)

Yuki Furuse

2015-11-01

Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

International Nuclear Information System (INIS)

Deen, K.C.; Sweet, R.W.

1986-01-01

Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

NARCIS (Netherlands)

Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

1998-01-01

Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Genome sequence of M6, a diploid inbred clone of the high-glycoalkaloid-producing tuber-bearing potato species Solanum chacoense, reveals residual heterozygosity.

Science.gov (United States)

Leisner, Courtney P; Hamilton, John P; Crisovan, Emily; Manrique-Carpintero, Norma C; Marand, Alexandre P; Newton, Linsey; Pham, Gina M; Jiang, Jiming; Douches, David S; Jansky, Shelley H; Buell, C Robin

2018-05-01

Cultivated potato (Solanum tuberosum L.) is a highly heterozygous autotetraploid that presents challenges in genome analyses and breeding. Wild potato species serve as a resource for the introgression of important agronomic traits into cultivated potato. One key species is Solanum chacoense and the diploid, inbred clone M6, which is self-compatible and has desirable tuber market quality and disease resistance traits. Sequencing and assembly of the genome of the M6 clone of S. chacoense generated an assembly of 825 767 562 bp in 8260 scaffolds with an N50 scaffold size of 713 602 bp. Pseudomolecule construction anchored 508 Mb of the genome assembly into 12 chromosomes. Genome annotation yielded 49 124 high-confidence gene models representing 37 740 genes. Comparative analyses of the M6 genome with six other Solanaceae species revealed a core set of 158 367 Solanaceae genes and 1897 genes unique to three potato species. Analysis of single nucleotide polymorphisms across the M6 genome revealed enhanced residual heterozygosity on chromosomes 4, 8 and 9 relative to the other chromosomes. Access to the M6 genome provides a resource for identification of key genes for important agronomic traits and aids in genome-enabled development of inbred diploid potatoes with the potential to accelerate potato breeding. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

Science.gov (United States)

Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

2013-11-01

Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

Cloning of Soluble Human Stem Cell Factor in pET-26b(+) Vector.

Science.gov (United States)

Asghari, Salman; Shekari Khaniani, Mahmoud; Darabi, Masood; Mansoori Derakhshan, Sima

2014-01-01

Stem cell factor (SCF) plays an important role in the survival, proliferation and differentiation of hematopoietic stem cells and progenitor cells. Potential therapeutic applications of SCF include hematopoietic stem cell mobilization, exvivo stem/progenitor cell expansion, gene therapy, and immunotherapy. Considering the cost and problem in accessibility of this product in Iran, clears the importance of indigenizing production of rhSCF. In the present work, we describe the construction of the soluble rhSCF expression vector in pET-26b (+) with periplasmic localization potential. Following PCR amplification of human SCF ORF, it is cloned in pET-26b (+) vector in NcoI and XhoI sites. The recombinant construct was transformed into BL21 (DE3) Ecoli strains. The construction of recombinant vector was verified by colony PCR and sequence analysis of pET26b-hSCF vector. Sequence analyses proved that human SCF ORF has been inserted into NcoI and XhoI site with correct orientation downstream of strong T7 promotor and showed no nucleotide errors. The SCF ORF was successfully cloned in pET-26b (+) expression vector and is ready for future production of SCF protein.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

Science.gov (United States)

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

NARCIS (Netherlands)

Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

Purification, Characterization, and Cloning of Cinnamyl Alcohol Dehydrogenase in Loblolly Pine (Pinus taeda L.).

Science.gov (United States)

O'malley, D M; Porter, S; Sederoff, R R

1992-04-01

Cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1. 195) has been purified to homogeneity from differentiating xylem tissue and developing seeds of loblolly pine (Pinus taeda L.). The enzyme is a dimer with a native molecular weight of 82,000 and a subunit molecular weight of 44,000, and is the only form of CAD involved in lignification in differentiating xylem. High levels of loblolly pine CAD enzyme were found in nonlignifying seed tissue. Characterization of the enzyme from both seeds and xylem demonstrated that the enzyme is the same in both tissues. The enzyme has a high affinity for coniferaldehyde (K(m) = 1.7 micromolar) compared with sinapaldehyde (K(m) in excess of 100 micromolar). Kinetic data strongly suggest that coniferin is a noncompetitive inhibitor of CAD enzyme activity. Protein sequences were obtained for the N-terminus (28 amino acids) and for two other peptides. Degenerate oligonucleotide primers based on the protein sequences were used to amplify by polymerase chain reaction a 1050 base pair DNA fragment from xylem cDNA. Nucleotide sequence from the cloned DNA fragment coded for the N-terminal protein sequence and an internal peptide of CAD. The N-terminal protein sequence has little similarity with the lambdaCAD4 clone isolated from bean (MH Walter, J Grima-Pettenati, C Grand, AM Boudet, CJ Lamb [1988] Proc Natl Acad Sci USA 86:5546-5550), which has homology with malic enzyme.

Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

Directory of Open Access Journals (Sweden)

Qinghua ZHOU

2010-02-01

Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

Science.gov (United States)

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

International Nuclear Information System (INIS)

Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

Cloning and Sequencing of Gene Encoding Outer Membrane Lipoprotein LipL41 of Leptospira Interrogans Serovar Grippotyphosa

Directory of Open Access Journals (Sweden)

M.S. Soltani

2014-12-01

Full Text Available Background: Leptospirosis is an infectious bacterial disease caused by pathogenic serovars of Leptospira. Development of reliable and applicable diagnostic test and also recombinant vaccine for this disease require specific antigens that are highly conserved among diverse pathogenic leptospiral serovars. Outer membrane proteins(OMPs of leptospira are effective antigens which can stimulate remarkable immune responses during infection, among them LipL41 is an immunogenic lipoprotein which is present only in pathogenic serovars so it could be regarded as a good candidate for vaccine development and diagnostic method. In order to identify genetic conservation of the lipL41 gene, we cloned and sequenced this gen from Leptospira interrogans serovar vaccinal and field of Grippotyphosa. Materials and Methods: Leptospira interrogans serovar vaccinal Grippotyphosa (RTCC2808 and serovar field Grippotyphosa (RTCC2825were used to inoculate into the selective culture medium(EMJH. The genomic DNA was extracted by standard phenol-chloroform method. The lipL41 gene were amplified by specific primers and cloned into pTZ57R/T vector and transformed into the competent E. coli (Top10 cells. the extracted recombinant plasmid were sequenced. And the related sequences were subjected to homology analysis by comparing them to sequences in the Genbank database. Results: PCR amplification of the lipL41 gene resulted in the 1065 bp PCR product. DNA sequence analysis revealed that lipL41 gene between serovar vaccinal Grippotyphosa (RTCC2808and serovar field Grippotyphosa (RTCC2825 in Iran was 100%. It was also showed that the lipL41 gene had high identity (96%-100% with other pathogenic serovars submitted in Genbank database. Conclusion: The results of this study showed that the lipL41 gene was highly conserved among various pathogenic Leptospira serovars( >95.9 % identity. Hence the cloned gene could be further used for expression of recombinant protein for serodiagnosis

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones.

Science.gov (United States)

Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S; Brown, Kevin E

2008-05-10

Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus.

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

Science.gov (United States)

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

International Nuclear Information System (INIS)

O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

1987-01-01

Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

Direct selection of expressed sequences on a YAC clone revealed proline-rich-like genes and BARE-1 sequences physically linked to the complex ¤Mla¤ powdery mildew resistance locus of barley (¤Hordeum vulgare¤ L.)

DEFF Research Database (Denmark)

Schwarz, G.; Michalek, W.; Jahoor, A.

2002-01-01

homology to the copia-like retroelement BA REI of barley, putatively involved in evolution of disease resistance loci. The high degree of clones representing barley rRNA sequences or false positives is a major disadvantage of direct selection of cDNAs in barley. (C) 2002 Elsevier Science Ireland Ltd. All...... gene. Of 22 selected cDNA clones, six were re-located on the YAC by southern analysis. Two of these clones are predicted to encode members of the hydroxyproline-rich glycoprotein and proline-rich protein gene families which have been implicated in plant defense response. Four sequences showed high...

Cloning and Characterization of an Endoglucanase Gene from sp. Korean Native Goat 40

Directory of Open Access Journals (Sweden)

Sung Chan Kim

2016-01-01

Full Text Available A gene from Actinomyces sp. Korean native goat (KNG 40 that encodes an endo-β-1,4-glucanase, EG1, was cloned and expressed in Escherichia coli (E. coli DH5α. Recombinant plasmid DNA from a positive clone with a 3.2 kb insert hydrolyzing carboxyl methyl-cellulose (CMC was designated as pDS3. The entire nucleotide sequence was determined, and an open-reading frame (ORF was deduced. The ORF encodes a polypeptide of 684 amino acids. The recombinant EG1 produced in E. coli DH5α harboring pDS3 was purified in one step using affinity chromatography on crystalline cellulose and characterized. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis/zymogram analysis of the purified enzyme revealed two protein bands of 57.1 and 54.1 kDa. The amino terminal sequences of these two bands matched those of the deduced ones, starting from residue 166 and 208, respectively. Putative signal sequences, a Shine–Dalgarno-type ribosomal binding site, and promoter sequences related to the consensus sequences were deduced. EG1 has a typical tripartite structure of cellulase, a catalytic domain, a serine-rich linker region, and a cellulose-binding domain. The optimal temperature for the activity of the purified enzyme was 55°C, but it retained over 90% of maximum activity in a broad temperature range (40°C to 60°C. The optimal pH for the enzyme activity was 6.0. Kinetic parameters, Km and Vmax of rEG1 were 0.39% CMC and 143 U/mg, respectively.

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

Directory of Open Access Journals (Sweden)

Sukdeb Nandi

2010-03-01

Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

Science.gov (United States)

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Purification, Characterization, and Cloning of Cinnamyl Alcohol Dehydrogenase in Loblolly Pine (Pinus taeda L.) 1

Science.gov (United States)

O'Malley, David M.; Porter, Stephanie; Sederoff, Ronald R.

1992-01-01

Cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1. 195) has been purified to homogeneity from differentiating xylem tissue and developing seeds of loblolly pine (Pinus taeda L.). The enzyme is a dimer with a native molecular weight of 82,000 and a subunit molecular weight of 44,000, and is the only form of CAD involved in lignification in differentiating xylem. High levels of loblolly pine CAD enzyme were found in nonlignifying seed tissue. Characterization of the enzyme from both seeds and xylem demonstrated that the enzyme is the same in both tissues. The enzyme has a high affinity for coniferaldehyde (Km = 1.7 micromolar) compared with sinapaldehyde (Km in excess of 100 micromolar). Kinetic data strongly suggest that coniferin is a noncompetitive inhibitor of CAD enzyme activity. Protein sequences were obtained for the N-terminus (28 amino acids) and for two other peptides. Degenerate oligonucleotide primers based on the protein sequences were used to amplify by polymerase chain reaction a 1050 base pair DNA fragment from xylem cDNA. Nucleotide sequence from the cloned DNA fragment coded for the N-terminal protein sequence and an internal peptide of CAD. The N-terminal protein sequence has little similarity with the λCAD4 clone isolated from bean (MH Walter, J Grima-Pettenati, C Grand, AM Boudet, CJ Lamb [1988] Proc Natl Acad Sci USA 86:5546-5550), which has homology with malic enzyme. ImagesFigure 2Figure 3 PMID:16668801

Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing.

Science.gov (United States)

Cabot, Gabriel; López-Causapé, Carla; Ocampo-Sosa, Alain A; Sommer, Lea M; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Peña, Carmen; Martínez-Martínez, Luis; Plesiat, Patrick; Oliver, Antonio

2016-12-01

Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

Science.gov (United States)

Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

2012-10-01

The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

Variation in biological properties of cauliflower mosaic virus clones.

Science.gov (United States)

al-Kaff, N; Covey, S N

1994-11-01

Infectious clones were prepared from virion DNA of three cauliflower mosaic virus (CaMV) isolates, 11/3, Xinjiang (XJ), and Aust, to investigate pathogenic variation in virus populations. Of 10 infectious clones obtained for isolate 11/3, four pathotypes were identified, each producing symptoms in turnip that differed from those of the 11/3 wild-type. Virus from two clonal groups of 11/3 was transmissible by aphids whereas that from two others was not. Of the five infectious clones obtained from isolate XJ, two groups were identified, one of which differed symptomatically from the wild-type. Only one infectious clone was obtained from isolate Aust and this had properties similar to the wild-type. Restriction enzyme polymorphisms were found in some clonal groups and these correlated with symptoms. Other groups with different pathogenic properties could not be distinguished apart by restriction site polymorphisms. Further variation was observed in the nucleotide sequences of gene II (coding for aphid transmission factor) from these viruses as compared with other CaMV isolates. In the aphid non-transmissible clones of isolate 11/3, one had a Gly to Arg mutation in gene II similar to that of other non-deleted non-transmissible CaMV isolates. The second had a 322 bp deletion at the site of a small direct repeat similar to that of isolate CM4-184 although occurring in a different position. The gene II deletion of isolate 11/3 produced a frame-shift that separated genes II and III by 60 bp. Most CaMV clones studied remained biologically stable producing similar symptoms during subsequent passages. However, one clone (11/3-7) produced two new biotypes during its first passage suggesting that it was relatively unstable. Our results show that wild-type populations of CaMV contain a range of infectious genome variants with contrasting biological properties and differing stability. We suggest that a variety of significant viral phenotypic changes can occur during each

Sequence of cDNAs for mammalian H2A. Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species

Energy Technology Data Exchange (ETDEWEB)

Hatch, C L; Bonner, W M

1988-02-11

The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

Science.gov (United States)

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

Science.gov (United States)

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

Science.gov (United States)

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

[Molecular cloning of activin betaA subunit mature peptide from peafowl and its application in taxonomy and phylogeny].

Science.gov (United States)

Zou, Fang-Dong; Tong, Xin-Xin; Yue, Bi-Song

2005-03-01

The sequences of activin gene betaA subunit mature peptide have been amplified from white peafowl, blue peafowl (pavo cristatus) and green peafowl (pavo muticus) genomic DNA by polymerase chain reaction (PCR) with a pair of degenerate primers. The target fragments were cloned into the vector pMD18-T and sequenced. The length of activin gene betaA subunit mature peptide is 345bp, which encoded a peptide of 115 amino acid residues. Sequence analysis of activin gene betaA subunit mature peptide demonstrated that the identity of nucleotide is 98.0% between blue peaflowl and green peafowl, and the identity of that is 98.8% between blue peaflowl and white peafow. Sequences comparison in NCBI revealed that the sequences of activin gene betaA subunit mature peptides of different species are highly conserved during evolution process. In addition, the restriction enzyme map of activins is high similar between white peafowl and blue peafowl. Phylogenetic tree was constructed with Mega 2 and Clustalxldx software. The result showed that white peafowl has a closer relationship to blue peafowl than to green peafowl. Considered the nucleotide differences of peafowls' activin gene betaA subunit mature peptides, a highly conserved region, we supported that white peafowl was derived from blue peafowl, and it is more possible the hybrid but just the product of color mutation, or maybe as a subspecies of Pavo genus.

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

Science.gov (United States)

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-08-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

An outbreak of respiratory tularemia caused by diverse clones of Francisella tularensis.

Science.gov (United States)

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Ohrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M; Forsman, Mats; Larsson, Pär

2014-12-01

The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1-3 of 1 585 229 examined nucleotides. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Comparative Genomic Analysis of Rapid Evolution of an Extreme-Drug-Resistant Acinetobacter baumannii Clone

Science.gov (United States)

Tan, Sean Yang-Yi; Chua, Song Lin; Liu, Yang; Høiby, Niels; Andersen, Leif Percival; Givskov, Michael; Song, Zhijun; Yang, Liang

2013-01-01

The emergence of extreme-drug-resistant (EDR) bacterial strains in hospital and nonhospital clinical settings is a big and growing public health threat. Understanding the antibiotic resistance mechanisms at the genomic levels can facilitate the development of next-generation agents. Here, comparative genomics has been employed to analyze the rapid evolution of an EDR Acinetobacter baumannii clone from the intensive care unit (ICU) of Rigshospitalet at Copenhagen. Two resistant A. baumannii strains, 48055 and 53264, were sequentially isolated from two individuals who had been admitted to ICU within a 1-month interval. Multilocus sequence typing indicates that these two isolates belonged to ST208. The A. baumannii 53264 strain gained colistin resistance compared with the 48055 strain and became an EDR strain. Genome sequencing indicates that A. baumannii 53264 and 48055 have almost identical genomes—61 single-nucleotide polymorphisms (SNPs) were found between them. The A. baumannii 53264 strain was assembled into 130 contigs, with a total length of 3,976,592 bp with 38.93% GC content. The A. baumannii 48055 strain was assembled into 135 contigs, with a total length of 4,049,562 bp with 39.00% GC content. Genome comparisons showed that this A. baumannii clone is classified as an International clone II strain and has 94% synteny with the A. baumannii ACICU strain. The ResFinder server identified a total of 14 antibiotic resistance genes in the A. baumannii clone. Proteomic analyses revealed that a putative porin protein was down-regulated when A. baumannii 53264 was exposed to antimicrobials, which may reduce the entry of antibiotics into the bacterial cell. PMID:23538992

Representational difference analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone

NARCIS (Netherlands)

Bart, A.; Dankert, J.; van der Ende, A.

2000-01-01

Neisseria meningitidis may cause meningitis and septicemia. Since the early 1980s, an increased incidence of meningococcal disease has been caused by the lineage III clone in many countries in Europe and in New Zealand. We hypothesized that lineage III meningococci have specific DNA sequences,

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

Science.gov (United States)

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Cloning of Soluble Human Stem Cell Factor in pET-26b(+ Vector

Directory of Open Access Journals (Sweden)

Salman Asghari

2014-03-01

Full Text Available Purpose: Stem cell factor (SCF plays an important role in the survival, proliferation and differentiation of hematopoietic stem cells and progenitor cells. Potential therapeutic applications of SCF include hematopoietic stem cell mobilization, exvivo stem/progenitor cell expansion, gene therapy, and immunotherapy. Considering the cost and problem in accessibility of this product in Iran, clears the importance of indigenizing production of rhSCF. In the present work, we describe the construction of the soluble rhSCF expression vector in pET-26b (+ with periplasmic localization potential. Methods: Following PCR amplification of human SCF ORF, it is cloned in pET-26b (+ vector in NcoI and XhoI sites. The recombinant construct was transformed into BL21 (DE3 Ecoli strains. Results: The construction of recombinant vector was verified by colony PCR and sequence analysis of pET26b-hSCF vector. Sequence analyses proved that human SCF ORF has been inserted into NcoI and XhoI site with correct orientation downstream of strong T7 promotor and showed no nucleotide errors. Conclusion: The SCF ORF was successfully cloned in pET-26b (+ expression vector and is ready for future production of SCF protein.

A comparison of parallel pyrosequencing and sanger clone-based sequencing and its impact on the characterization of the genetic diversity of HIV-1.

Directory of Open Access Journals (Sweden)

Binhua Liang

Full Text Available BACKGROUND: Pyrosequencing technology has the potential to rapidly sequence HIV-1 viral quasispecies without requiring the traditional approach of cloning. In this study, we investigated the utility of ultra-deep pyrosequencing to characterize genetic diversity of the HIV-1 gag quasispecies and assessed the possible contribution of pyrosequencing technology in studying HIV-1 biology and evolution. METHODOLOGY/PRINCIPAL FINDINGS: HIV-1 gag gene was amplified from 96 patients using nested PCR. The PCR products were cloned and sequenced using capillary based Sanger fluorescent dideoxy termination sequencing. The same PCR products were also directly sequenced using the 454 pyrosequencing technology. The two sequencing methods were evaluated for their ability to characterize quasispecies variation, and to reveal sites under host immune pressure for their putative functional significance. A total of 14,034 variations were identified by 454 pyrosequencing versus 3,632 variations by Sanger clone-based (SCB sequencing. 11,050 of these variations were detected only by pyrosequencing. These undetected variations were located in the HIV-1 Gag region which is known to contain putative cytotoxic T lymphocyte (CTL and neutralizing antibody epitopes, and sites related to virus assembly and packaging. Analysis of the positively selected sites derived by the two sequencing methods identified several differences. All of them were located within the CTL epitope regions. CONCLUSIONS/SIGNIFICANCE: Ultra-deep pyrosequencing has proven to be a powerful tool for characterization of HIV-1 genetic diversity with enhanced sensitivity, efficiency, and accuracy. It also improved reliability of downstream evolutionary and functional analysis of HIV-1 quasispecies.

Molecular characterization and clonal diversity of meticillin-resistant Staphylococcus aureus isolated from the community in Spain: emergence of clone sequence type 72.

Science.gov (United States)

Potel, C; Rey, S; Otero, S; Rubio, J; Álvarez, M

2016-08-01

Sequence type 72 meticillin-resistant Staphylococcus aureus (ST72 MRSA) was recently detected in our hospital. Although in Europe this clone is rarely isolated, it is the leading cause of community-associated MRSA infections in Korea, spreading also into hospitals, where it has also emerged as the main MRSA clone recovered from raw meat. We studied MRSA isolated from outpatients in Spain during a nine-year period. More than 70% of the isolates belonged to predominant clones found in hospitals. There was a significant increase in the ST72 prevalence. It appears that boundaries of dominance among MRSA clones have become blurred, demanding continuous surveillance. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

Directory of Open Access Journals (Sweden)

Erena A. Edae

2013-07-01

Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

DEFF Research Database (Denmark)

Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

1991-01-01

After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

DEFF Research Database (Denmark)

Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

2013-01-01

Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip

Directory of Open Access Journals (Sweden)

Yanling Xia

2018-04-01

Full Text Available Objective Molecular cloning and bioinformatics analysis of annexin A2 (ANXA2 gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. Methods The reverse transcriptase polymerase chain reaction (RT-PCR was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer (Cervus Nippon hortulorum and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR. Results The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus. Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period. Conclusion ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Molecular cloning and biological characterization of the human excision repair gene ERCC-3

International Nuclear Information System (INIS)

Weeda, G.; van Ham, R.C.; Masurel, R.; Westerveld, A.; Odijk, H.; de Wit, J.; Bootsma, D.; van der Eb, A.J.; Hoeijmakers, J.H.

1990-01-01

In this report we present the cloning, partial characterization, and preliminary studies of the biological activity of a human gene, designated ERCC-3, involved in early steps of the nucleotide excision repair pathway. The gene was cloned after genomic DNA transfection of human (HeLa) chromosomal DNA together with dominant marker pSV3gptH to the UV-sensitive, incision-defective Chinese hamster ovary (CHO) mutant 27-1. This mutant belongs to complementation group 3 of repair-deficient rodent mutants. After selection of UV-resistant primary and secondary 27-1 transformants, human sequences associated with the induced UV resistance were rescued in cosmids from the DNA of a secondary transformant by using a linked dominant marker copy and human repetitive DNA as probes. From coinheritance analysis of the ERCC-3 region in independent transformants, we deduce that the gene has a size of 35 to 45 kilobases, of which one essential segment has so far been refractory to cloning. Conserved unique human sequences hybridizing to a 3.0-kilobase mRNA were used to isolate apparently full-length cDNA clones. Upon transfection to 27-1 cells, the ERCC-3 cDNA, inserted in a mammalian expression vector, induced specific and (virtually) complete correction of the UV sensitivity and unscheduled DNA synthesis of mutants of complementation group 3 with very high efficiency. Mutant 27-1 is, unlike other mutants of complementation group 3, also very sensitive toward small alkylating agents. This unique property of the mutant is not corrected by introduction of the ERCC-3 cDNA, indicating that it may be caused by an independent second mutation in another repair function. By hybridization to DNA of a human x rodent hybrid cell panel, the ERCC-3 gene was assigned to chromosome 2, in agreement with data based on cell fusion

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria : research communication

Directory of Open Access Journals (Sweden)

D.O. Oluwayelu

2008-09-01

Full Text Available This work reports the first molecular analysis study of chicken anaemia virus (CAV in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6 % and 4 % nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2 % amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/Cl-8 and NGR/Cl-9 were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Genome sequencing and molecular characterisation of Staphylococcus aureus ST772-MRSA-V, "Bengal Bay Clone".

Science.gov (United States)

Monecke, Stefan; Baier, Vico; Coombs, Geoffrey W; Slickers, Peter; Ziegler, Albrecht; Ehricht, Ralf

2013-12-20

The PVL-positive ST772-MRSA-V is an emerging community-associated (CA-) MRSA clone that has been named Bengal Bay Clone since most patients have epidemiological connections to the Indian subcontinent. It is found increasingly common in other areas of the world. One isolate of ST772-MRSA-V was sequenced using the Illumina Genome Analyzer System. After initial assembling the multiple sequence contigs were analysed using different in-house annotation scripts. Results were compared to microarray hybridisation results of clinical isolates of ST772-MRSA-V, of related strains and to another ST772-MRSA-V genome sequence. According to MLST e-burst analysis, ST772-MRSA-V belongs to Clonal Complex (CC)1, differing from ST1 only in one MLST allele (pta-22). However, there are several additional differences including agr alleles (group II rather than III), capsule type (5 rather than 8), the presence of the egc enterotoxin gene cluster and of the enterotoxin homologue ORF CM14 as well as the absence of the enterotoxin H gene seh. Enterotoxin genes sec and sel are present. ST772-MRSA-V harbours the genes encoding enterotoxin A (sea) and PVL (lukS/F-PV). Both are located on the same prophage. ST772-MRSA-V may have emerged from the same lineage as globally spread CC1 and CC5 strains. It has acquired a variety of virulence factors, and for a CA-MRSA strain it has an unusually high number of genes associated with antibiotic resistance.

Draft Genome Sequences of the Probiotic Enterococcus faecalis Symbioflor 1 Clones DSM16430 and DSM16434

OpenAIRE

Fritzenwanker, Moritz; Chakraborty, Anindita; Hain, Torsten; Zimmermann, Kurt; Domann, Eugen

2016-01-01

The probiotic Symbioflor 1 is a historical concoction of 10 isolates of Enterococcus faecalis. Pulsed-field gel electrophoresis revealed two groups: one comprising eight identical clones (DSM16430, DSM16432, DSM16433, DSM16435 to DSM16439) and a further two isolates (DSM16431, DSM16434) with marginally different profiles. Here, we report a comparative analysis of the draft genome sequences of representative isolates.

Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

Directory of Open Access Journals (Sweden)

Sahu Binod B

2012-01-01

Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

Science.gov (United States)

Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

2013-01-01

Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

Energy Technology Data Exchange (ETDEWEB)

Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

1988-08-11

The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

Minimal Residual Disease Detection and Evolved IGH Clones Analysis in Acute B Lymphoblastic Leukemia Using IGH Deep Sequencing.

Science.gov (United States)

Wu, Jinghua; Jia, Shan; Wang, Changxi; Zhang, Wei; Liu, Sixi; Zeng, Xiaojing; Mai, Huirong; Yuan, Xiuli; Du, Yuanping; Wang, Xiaodong; Hong, Xueyu; Li, Xuemei; Wen, Feiqiu; Xu, Xun; Pan, Jianhua; Li, Changgang; Liu, Xiao

2016-01-01

Acute B lymphoblastic leukemia (B-ALL) is one of the most common types of childhood cancer worldwide and chemotherapy is the main treatment approach. Despite good response rates to chemotherapy regiments, many patients eventually relapse and minimal residual disease (MRD) is the leading risk factor for relapse. The evolution of leukemic clones during disease development and treatment may have clinical significance. In this study, we performed immunoglobulin heavy chain ( IGH ) repertoire high throughput sequencing (HTS) on the diagnostic and post-treatment samples of 51 pediatric B-ALL patients. We identified leukemic IGH clones in 92.2% of the diagnostic samples and nearly half of the patients were polyclonal. About one-third of the leukemic clones have correct open reading frame in the complementarity determining region 3 (CDR3) of IGH , which demonstrates that the leukemic B cells were in the early developmental stage. We also demonstrated the higher sensitivity of HTS in MRD detection and investigated the clinical value of using peripheral blood in MRD detection and monitoring the clonal IGH evolution. In addition, we found leukemic clones were extensively undergoing continuous clonal IGH evolution by variable gene replacement. Dynamic frequency change and newly emerged evolved IGH clones were identified upon the pressure of chemotherapy. In summary, we confirmed the high sensitivity and universal applicability of HTS in MRD detection. We also reported the ubiquitous evolved IGH clones in B-ALL samples and their response to chemotherapy during treatment.

Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

Science.gov (United States)

Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

2017-07-01

DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

Science.gov (United States)

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria.

Science.gov (United States)

Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad; Rolain, Jean-Marc

2016-12-01

Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the bla OXA-48 , bla CTX-M-15 , bla SHV-1 , and bla TEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The bla OXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

International Nuclear Information System (INIS)

Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

1998-01-01

To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

Viral Bacterial Artificial Chromosomes: Generation, Mutagenesis, and Removal of Mini-F Sequences

Directory of Open Access Journals (Sweden)

B. Karsten Tischer

2012-01-01

Full Text Available Maintenance and manipulation of large DNA and RNA virus genomes had presented an obstacle for virological research. BAC vectors provided a solution to both problems as they can harbor large DNA sequences and can efficiently be modified using well-established mutagenesis techniques in Escherichia coli. Numerous DNA virus genomes of herpesvirus and pox virus were cloned into mini-F vectors. In addition, several reverse genetic systems for RNA viruses such as members of Coronaviridae and Flaviviridae could be established based on BAC constructs. Transfection into susceptible eukaryotic cells of virus DNA cloned as a BAC allows reconstitution of recombinant viruses. In this paper, we provide an overview on the strategies that can be used for the generation of virus BAC vectors and also on systems that are currently available for various virus species. Furthermore, we address common mutagenesis techniques that allow modification of BACs from single-nucleotide substitutions to deletion of viral genes or insertion of foreign sequences. Finally, we review the reconstitution of viruses from BAC vectors and the removal of the bacterial sequences from the virus genome during this process.

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

Single nucleotide polymorphism (SNP) panels for rapid positional cloning in zebrafish

NARCIS (Netherlands)

Clark, M.D.; Guryev, V.; de Bruijn, E.; Nijman, I.J.; Tada, M.; Wilson, C.; Deloukas, P.; Postlethwait, J.H.; Cuppen, E.; Stemple, D.L.

2011-01-01

Despite considerable genetic and genomic resources the positional cloning of forward mutations remains a slow and manually intensive task, typically using gel based genotyping and sequential rounds of mapping. We have used the latest genetic resources and genotyping technologies to develop two

Main: Nucleotide Analysis [KOME

Lifescience Database Archive (English)

Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

International Nuclear Information System (INIS)

Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

1990-01-01

A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

Science.gov (United States)

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

International Nuclear Information System (INIS)

Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

1987-01-01

Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis

Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

Energy Technology Data Exchange (ETDEWEB)

Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

1987-12-01

Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis.

Identification, Cloning, and Characterization of l-Phenylserine Dehydrogenase from Pseudomonas syringae NK-15

Directory of Open Access Journals (Sweden)

Sakuko Ueshima

2010-01-01

Full Text Available The gene encoding d-phenylserine dehydrogenase from Pseudomonas syringae NK-15 was identified, and a 9,246-bp nucleotide sequence containing the gene was sequenced. Six ORFs were confirmed in the sequenced region, four of which were predicted to form an operon. A homology search of each ORF predicted that orf3 encoded l-phenylserine dehydrogenase. Hence, orf3 was cloned and overexpressed in Escherichia coli cells and recombinant ORF3 was purified to homogeneity and characterized. The purified ORF3 enzyme showed l-phenylserine dehydrogenase activity. The enzymological properties and primary structure of l-phenylserine dehydrogenase (ORF3 were quite different from those of d-phenylserine dehydrogenase previously reported. l-Phenylserine dehydrogenase catalyzed the NAD+-dependent oxidation of the β-hydroxyl group of l-β-phenylserine. l-Phenylserine and l-threo-(2-thienylserine were good substrates for l-phenylserine dehydrogenase. The genes encoding l-phenylserine dehydrogenase and d-phenylserine dehydrogenase, which is induced by phenylserine, are located in a single operon. The reaction products of both enzymatic reactions were 2-aminoacetophenone and CO2.

Comparative analysis of the prion protein gene sequences in African lion.

Science.gov (United States)

Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

2006-10-01

The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

Science.gov (United States)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Use of homologous recombination in yeast to create chimeric bovine viral diarrhea virus cDNA clones

Directory of Open Access Journals (Sweden)

Sandra Arenhart

Full Text Available Abstract The open reading frame of a Brazilian bovine viral diarrhea virus (BVDV strain, IBSP4ncp, was recombined with the untranslated regions of the reference NADL strain by homologous recombination in Saccharomyces cerevisiae, resulting in chimeric full-length cDNA clones of BVDV (chi-NADL/IBSP4ncp#2 and chi-NADL/IBSP4ncp#3. The recombinant clones were successfully recovered, resulting in viable viruses, having the kinetics of replication, focus size, and morphology similar to those of the parental virus, IBSP4ncp. In addition, the chimeric viruses remained stable for at least 10 passages in cell culture, maintaining their replication efficiency unaltered. Nucleotide sequencing revealed a few point mutations; nevertheless, the phenotype of the rescued viruses was nearly identical to that of the parental virus in all experiments. Thus, genetic stability of the chimeric clones and their phenotypic similarity to the parental virus confirm the ability of the yeast-based homologous recombination to maintain characteristics of the parental virus from which the recombinant viruses were derived. The data also support possible use of the yeast system for the manipulation of the BVDV genome.

Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

International Nuclear Information System (INIS)

Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

1988-01-01

An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

Science.gov (United States)

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

Science.gov (United States)

Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

2010-09-01

The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A set of BAC clones spanning the human genome.

NARCIS (Netherlands)

Krzywinski, M.; Bosdet, I.; Smailus, D.; Chiu, R.; Mathewson, C.; Wye, N.; Barber, S.; Brown-John, M.; Chan, S.; Chand, S.; Cloutier, A.; Girn, N.; Lee, D.; Masson, A.; Mayo, M.; Olson, T.; Pandoh, P.; Prabhu, A.L.; Schoenmakers, E.F.P.M.; Tsai, M.Y.; Albertson, D.; Lam, W.W.; Choy, C.O.; Osoegawa, K.; Zhao, S.; Jong, P.J. de; Schein, J.; Jones, S.; Marra, M.A.

2004-01-01

Using the human bacterial artificial chromosome (BAC) fingerprint-based physical map, genome sequence assembly and BAC end sequences, we have generated a fingerprint-validated set of 32 855 BAC clones spanning the human genome. The clone set provides coverage for at least 98% of the human

Comparative Genomic Analysis of Rapid Evolution of an Extreme-Drug-Resistant Acinetobacter baumannii Clone

DEFF Research Database (Denmark)

Tan, Sean Yang-Yi; Chua, Song Lin; Liu, Yang

2013-01-01

, comparative genomics has been employed to analyze the rapid evolution of an EDR Acinetobacter baumannii clone from the intensive care unit (ICU) of Rigshospitalet at Copenhagen. Two resistant A. baumannii strains, 48055 and 53264, were sequentially isolated from two individuals who had been admitted to ICU...... within a 1-month interval. Multilocus sequence typing indicates that these two isolates belonged to ST208. The A. baumannii 53264 strain gained colistin resistance compared with the 48055 strain and became an EDR strain. Genome sequencing indicates that A. baumannii 53264 and 48055 have almost identical...... genomes—61 single-nucleotide polymorphisms (SNPs) were found between them. The A. baumannii 53264 strain was assembled into 130 contigs, with a total length of 3,976,592 bp with 38.93% GC content. The A. baumannii 48055 strain was assembled into 135 contigs, with a total length of 4,049,562 bp with 39...

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

Science.gov (United States)

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

Cloning of cDNAs coding for the heavy chain region and connecting region of human factor V, a blood coagulation factor with four types of internal repeats

International Nuclear Information System (INIS)

Kane, W.H.; Ichinose, A.; Hagen, F.S.; Davie, E.W.

1987-01-01

Human factor V is a high molecular weight plasma glycoprotein that participates as a cofactor in the conversion of prothrombin to thrombin by factor X/sub a/. Prior to its participation in the coagulation cascade, factor V is converted to factor V/sub a/ by thrombin generating a heavy chain and a light chain, and these two chains are held together by calcium ions. A connecting region originally located between the heavy and light chains is liberated during the activation reaction. In a previous study, a cDNA of 2970 nucleotides that codes for the carboxyl-terminal 938 amino acids of factor V was isolated and characterized from a Hep G2 cDNA library. This cDNA has been used to obtain additional clones from Hep G2 and human liver cDNA libraries. Furthermore, a Hep G2 cDNA library prepared with an oligonucleotide from the 5' end of these cDNAs was screened to obtain overlapping cDNA clones that code for the amino-terminal region of the molecule. The composite sequence of these clones spans 6911 nucleotides and is consistent with the size of the factor V message present in Hep G2 cells (approximately 7 kilobases). The cDNA codes for a leader sequence of 28 amino acids and a mature protein of 2196 amino acids. The amino acid sequence predicted from the cDNA was in complete agreement with 139 amino acid residues that were identified by Edman degradation of cyanogen bromide peptides isolated from the heavy chain region and connecting region of plasma factor V. The domain structure of human factor V is similar to that previously reported for human coagulation factor VIII. Two types of tandem repeats (17 and 9 amino acids) have also been identified in the connecting region of factor V. The present data indicate that the amino acid sequence in the heavy and light chain regions of factor V is ∼ 40% identical with the corresponding regions of factor VIII

Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

Directory of Open Access Journals (Sweden)

NED A SETAYESH

2009-01-01

Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

Energy Technology Data Exchange (ETDEWEB)

Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others

1994-08-01

Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

Molecular cloning and characterization of an alpha-amylase from Pichia burtonii 15-1.

Science.gov (United States)

Kato, Saemi; Shimizu-Ibuka, Akiko; Mura, Kiyoshi; Takeuchi, Akiko; Tokue, Chiyoko; Arai, Soichi

2007-12-01

An alpha-amylase secreted by Pichia burtonii 15-1 isolated from a traditional starter murcha of Nepal, named Pichia burtonii alpha-amylase (PBA), was studied. The gene was cloned and its nucleotide sequence was determined. PBA was deduced to consist of 494 amino acid residues. It shared certain degrees of amino acid sequence identity with other homologous proteins: 60% with Schwanniomyces occidentalis alpha-amylase, 58% with Saccharomycopsis sp. alpha-amylase, and 47% with Taka-amylase A from Aspergillus oryzae. A three-dimensional structural model of PBA generated using the known three-dimensional structure of Taka-amylase A as a template suggested high structural similarity between them. Kinetic analysis revealed that the K(m) values of PBA were lower than those of Taka-amylase A for the oligosaccharides. Although the k(cat) values of PBA were lower than those of Taka-amylase A for the oligosaccharide substrates, the k(cat)/K(m) values of PBA were higher.

Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

Science.gov (United States)

Tabassum, Rabia

2017-10-18

Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

Map-based Cloning and Characterization of a Brown Planthopper Resistance Gene BPH26 from Oryza sativa L. ssp. indica Cultivar ADR52

OpenAIRE

Tamura, Yasumori; Hattori, Makoto; Yoshioka, Hirofumi; Yoshioka, Miki; Takahashi, Akira; Wu, Jianzhong; Sentoku, Naoki; Yasui, Hideshi

2014-01-01

The brown planthopper (BPH) is the most serious insect pest of rice in Asia. The indica rice cultivar ADR52 carries two BPH resistance genes, BPH26 (BROWN PLANTHOPPER RESISTANCE 26) and BPH25. Map-based cloning of BPH26 revealed that BPH26 encodes a coiled-coil-nucleotide-binding-site?leucine-rich repeat (CC?NBS?LRR) protein. BPH26 mediated sucking inhibition in the phloem sieve element. BPH26 was identical to BPH2 on the basis of DNA sequence analysis and feeding ability of the BPH2-virulent...

The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

Energy Technology Data Exchange (ETDEWEB)

Van Coillie, E.; Fiten, P.; Van Damme, J.; Opdenakker, G. [Univ. of Leuven (Belgium)] [and others

1997-03-01

Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genes a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.

Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

Directory of Open Access Journals (Sweden)

Qicheng Zhang

Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

Science.gov (United States)

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

NARCIS (Netherlands)

I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

1993-01-01

textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

Cloning, purification, crystallization and preliminary X-ray diffraction analysis of nitrile hydratase from the themophilic Bacillus smithii SC-J05-1

International Nuclear Information System (INIS)

Hourai, Shinji; Ishii, Takeshi; Miki, Misao; Takashima, Yoshiki; Mitsuda, Satoshi; Yanagi, Kazunori

2005-01-01

The nitrile hydratase from the themophilic B. smithii SC-J05-1 (Bs NHase) has been purified, cloned and crystallized. Nitrile hydratase (NHase) converts nitriles to the corresponding amides and is recognized as having important industrial applications. Purification, cloning, crystallization and initial crystallographic studies of the NHase from Bacillus smithii SC-J05-1 (Bs NHase) were conducted to analyze the activity, specificity and thermal stability of this hydrolytic enzyme. Bs NHase was purified to homogeneity from microbial cells of B. smithii SC-J05-1 and the nucleotide sequences of both the α- and β-subunits were determined. Purified Bs NHase was used for crystallization and several crystal forms were obtained by the vapour-diffusion method. Microseeding and the addition of magnesium ions were essential components to obtain crystals suitable for X-ray diffraction analysis

Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

Science.gov (United States)

Le Gall, O; Candresse, T; Dunez, J

1988-02-01

Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

International Nuclear Information System (INIS)

Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

1988-01-01

A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

Distribution and sequence homogeneity of an abundant satellite DNA in the beetle, Tenebrio molitor.

Science.gov (United States)

Davis, C A; Wyatt, G R

1989-01-01

The mealworm beetle, Tenebrio molitor, contains an unusually abundant and homogeneous satellite DNA which constitutes up to 60% of its genome. The satellite DNA is shown to be present in all of the chromosomes by in situ hybridization. 18 dimers of the repeat unit were cloned and sequenced. The consensus sequence is 142 nt long and lacks any internal repeat structure. Monomers of the sequence are very similar, showing on average a 2% divergence from the calculated consensus. Variant nucleotides are scattered randomly throughout the sequence although some variants are more common than others. Neighboring repeat units are no more alike than randomly chosen ones. The results suggest that some mechanism, perhaps gene conversion, is acting to maintain the homogeneity of the satellite DNA despite its abundance and distribution on all of the chromosomes. Images PMID:2762148

Quantitative discrimination of Aggregatibacter actinomycetemcomitans highly leukotoxic JP2 clone from non-JP2 clones in diagnosis of aggressive periodontitis.

Science.gov (United States)

Yoshida, Akihiro; Ennibi, Oum-Keltoum; Miyazaki, Hideo; Hoshino, Tomonori; Hayashida, Hideaki; Nishihara, Tatsuji; Awano, Shuji; Ansai, Toshihiro

2012-10-11

Aggregatibacter actinomycetemcomitans is the etiological agent of periodontitis, and there is a strong association between clone JP2 and aggressive periodontitis in adolescents of African descent. The JP2 clone has an approximately 530-bp deletion (∆530) in the promoter region of the lkt/ltx gene, which encodes leukotoxin, and this clone has high leukotoxic activity. Therefore, this clone is very important in aggressive periodontitis. To diagnose this disease, culture methods and conventional PCR techniques are used. However, quantitative detection based on qPCR for the JP2 clone has not been developed due to genetic difficulties. In this study, we developed a qPCR-based quantification method specific to the JP2 clone. Based on our analysis of the DNA sequence of the lkt/ltx gene and its flanking region, we designed a reverse primer specific for the ∆530 deletion border sequence and developed a JP2-specific PCR-based quantification method using this primer. We also analyzed the DNA sequence of the ∆530 locus and found it to be highly conserved (97-100%) among 17 non-JP2 strains. Using the ∆530 locus, we designed a qPCR primer-probe set specific to non-JP2 clones. Next, we determined the numbers of JP2 and non-JP2 clone cells in the periodontal pockets of patients with aggressive periodontitis. The JP2-specific primers specifically amplified the genomic DNA of the A. actinomycetemcomitans JP2 clone and did not react with other bacterial DNA, whereas the non-JP2 specific primers reacted only with A. actinomycetemcomitans non-JP2 clones. Samples from the 88 periodontal sites in the 11 patients with aggressive periodontitis were analyzed. The bacterial cell numbers in 88 periodontal sites ranged from 0 to 4.8 × 10(8) (mean 1.28 × 10(7)) for JP2 clones and from 0 to 1.6 × 10(6) for non-JP2 clones (mean 1.84 × 10(5)). There were significant differences in the JP2 cell number between a clinical attachment level (CAL) ≤6 mm and a level ≥7 mm (p clones. This

Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

Directory of Open Access Journals (Sweden)

Jacqueline Morris

2017-12-01

Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

Directory of Open Access Journals (Sweden)

Ritland Carol

2009-08-01

Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

Science.gov (United States)

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

Science.gov (United States)

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Molecular cloning and protein structure of a human blood group Rh polypeptide

International Nuclear Information System (INIS)

Cherif-Zahar, B.; Bloy, C.; Le Van Kim, C.; Blanchard, D.; Bailly, P.; Hermand, P.; Salmon, C.; Cartron, J.P.; Colin, Y.

1990-01-01

cDNA clones encoding a human blood group Rh polypeptide were isolated from a human bone marrow cDNA library by using a polymerase chain reaction-amplified DNA fragment encoding the known common N-terminal region of the Rh proteins. The entire primary structure of the Rh polypeptide has been deduced from the nucleotide sequence of a 1384-base-pair-long cDNA clone. Translation of the open reading frame indicates that the Rh protein is composed of 417 amino acids, including the initiator methionine, which is removed in the mature protein, lacks a cleavable N-terminal sequence, and has no consensus site for potential N-glycosylation. The predicted molecular mass of the protein is 45,500, while that estimated for the Rh protein analyzed in NaDodSO 4 /polyacrylamide gels is in the range of 30,000-32,000. These findings suggest either that the hydrophobic Rh protein behaves abnormally on NaDodSO 4 gels or that the Rh mRNA may encode a precursor protein, which is further matured by a proteolytic cleavage of the C-terminal region of the polypeptide. Hydropathy analysis and secondary structure predictions suggest the presence of 13 membrane-spanning domains, indicating that the Rh polypeptide is highly hydrophobic and deeply buried within the phospholipid bilayer. These results suggest that the expression of the Rh gene(s) might be restricted to tissues or cell lines expressing erythroid characters

Sequence analysis of the breakpoint regions of an X;5 translocation in a female with Duchenne muscular dystrophy

Energy Technology Data Exchange (ETDEWEB)

Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others

1995-08-01

X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.

Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences; FINAL

International Nuclear Information System (INIS)

Robb, Frank T.

2001-01-01

The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

Science.gov (United States)

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

Directory of Open Access Journals (Sweden)

Maíra C. M. Freire

2008-01-01

Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

Directory of Open Access Journals (Sweden)

S. S. Hasson

2010-01-01

Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

cDNA cloning, structural analysis, SNP detection and tissue ...