WorldWideScience

Sample records for classical sheep scrapie

  1. Sheep prions with molecular properties intermediate between classical scrapie, BSE and CH1641-scrapie

    NARCIS (Netherlands)

    Langeveld, J.P.M.; Jacobs, J.G.; Erkens, J.H.F.; Baron, T.; Andreoletti, O.; Yokoyama, T.; Keulen, van L.J.M.; Zijderveld, van F.G.; Davidse, A.; Hope, J.; Tang, Y.; Bossers, A.

    2014-01-01

    Efforts to differentiate bovine spongiform encephalopathy (BSE) from scrapie in prion infected sheep have resulted
    in effective methods to decide about the absence of BSE. In rare instances uncertainties remain due to assumptions
    that BSE, classical scrapie and CH1641–a rare scrapie variant–

  2. Objects in contact with classical scrapie sheep act as a reservoir for scrapie transmission

    Directory of Open Access Journals (Sweden)

    Timm eKonold

    2015-09-01

    Full Text Available Classical scrapie is an environmentally transmissible prion disease of sheep and goats. Prions can persist and remain potentially infectious in the environment for many years and thus pose a risk of infecting animals after re-stocking. In vitro studies using serial Protein Misfolding Cyclic Amplification (sPMCA have suggested that objects on a scrapie-affected sheep farm could contribute to disease transmission. This in vivo study aimed to determine the role of field furniture (water troughs, feeding troughs, fencing and other objects that sheep may rub against used by a scrapie-infected sheep flock as a vector for disease transmission to scrapie-free lambs with the prion protein genotype VRQ/VRQ, which is associated with high susceptibility to classical scrapie. When the field furniture was placed in clean accommodation sheep became infected when exposed to either a water trough (four out of five or to objects used for rubbing (four out of seven. This field furniture had been used by the scrapie-infected flock eight weeks earlier and had previously been shown to harbor scrapie prions by sPMCA. Sheep also became infected (20 out of 23 through exposure to contaminated field furniture placed within pasture not used by scrapie-infected sheep for 40 months, even though swabs from this furniture tested negative by PMCA. This infection rate decreased (1 out of 12 on the same paddock after replacement with clean field furniture. Twelve grazing sheep exposed to field furniture not in contact with scrapie-infected sheep for 18 months remained scrapie-free.The findings of this study highlight the role of field furniture used by scrapie-infected sheep to act as a reservoir for disease re-introduction although infectivity declines considerably if the field furniture has not been in contact with scrapie-infected sheep for several months. PMCA may not be as sensitive as VRQ/VRQ sheep to test for environmental contamination.

  3. Sheep prions with molecular properties intermediate between classical scrapie, BSE and CH1641-scrapie

    OpenAIRE

    Langeveld, Jan P. M.; Jacobs, Jorg G; Erkens, Jo H.F.; Baron, Thierry; Andreoletti, Olivier; Yokoyama, Takahashi; Van Keulen, Lucien J. M.; van Zijderveld, Fred G.; Davidse, Aart; Hope, Jim; Tang, Yue; Bossers, Alex

    2014-01-01

    Efforts to differentiate bovine spongiform encephalopathy (BSE) from scrapie in prion infected sheep have resulted in effective methods to decide about the absence of BSE. In rare instances uncertainties remain due to assumptions that BSE, classical scrapie and CH1641–a rare scrapie variant–could occur as mixtures. In field samples including those from fallen stock, triplex Western blotting analyses of variations in the molecular properties of the proteinase K resistant part of the disease‑as...

  4. Sheep prions with molecular properties intermediate between classical scrapie, BSE and CH1641-scrapie.

    Science.gov (United States)

    Langeveld, Jan P M; Jacobs, Jorg G; Erkens, Jo H F; Baron, Thierry; Andréoletti, Olivier; Yokoyama, Takahashi; van Keulen, Lucien J M; van Zijderveld, Fred G; Davidse, Aart; Hope, Jim; Tang, Yue; Bossers, Alex

    2014-01-01

    Efforts to differentiate bovine spongiform encephalopathy (BSE) from scrapie in prion infected sheep have resulted in effective methods to decide about the absence of BSE. In rare instances uncertainties remain due to assumptions that BSE, classical scrapie and CH1641-a rare scrapie variant-could occur as mixtures. In field samples including those from fallen stock, triplex Western blotting analyses of variations in the molecular properties of the proteinase K resistant part of the disease‑associated form of prion protein (PrP(res)) represents a powerful tool for quick discrimination purposes. In this study we examined 7 deviant ovine field cases of scrapie for some typical molecular aspects of PrP(res) found in CH1641‑scrapie, classical scrapie and BSE. One case was most close to scrapie with respect to molecular mass of its non-glycosylated fraction and N-terminally located 12B2‑epitope content. Two cases were unlike classical scrapie but too weak to differentiate between BSE or CH1641. The other 4 cases appeared intermediate between scrapie and CH1641 with a reduced molecular mass and 12B2‑epitope content, together with the characteristic presence of a second PrP(res) population. The existence of these 2 PrP(res) populations was further confirmed through deglycosylation by PNGaseF. The findings indicate that discriminatory diagnosis between classical scrapie, CH1641 and BSE can remain inconclusive with current biochemical methods. Whether such intermediate cases represent mixtures of TSE strains should be further investigated e.g. in bioassays with rodent lines that are varying in their susceptibility or other techniques suitable for strain typing.

  5. Evidence of in utero transmission of classical scrapie in sheep.

    Science.gov (United States)

    Spiropoulos, John; Hawkins, Stephen A C; Simmons, Marion M; Bellworthy, Susan J

    2014-04-01

    Classical scrapie is one of the transmissible spongiform encephalopathies (TSEs), a group of fatal infectious diseases that affect the central nervous system (CNS). Classical scrapie can transmit laterally from ewe to lamb perinatally or between adult animals. Here we report detection of infectivity in tissues of an unborn fetus, providing evidence that in utero transmission of classical scrapie is also possible.

  6. Discrepant epidemiological patterns between classical and atypical scrapie in sheep flocks under French TSE control measures.

    Science.gov (United States)

    Fediaevsky, Alexandre; Gasqui, Patrick; Calavas, Didier; Ducrot, Christian

    2010-09-01

    The occurrence of secondary cases of atypical and classical scrapie was examined in 340 outbreaks of atypical and 296 of classical sheep scrapie detected in France during active surveillance programmes between 2002 and 2007. The prevalence of atypical scrapie in these flocks was 0.05% under selective culling and 0.07% under intensified monitoring i.e. not significantly different from that detected during active surveillance of the general population (P>0.5), whereas these figures were much higher for classical scrapie (3.67% and 0.25%, respectively, P<10(-5)). In addition the number of atypical scrapie cases per outbreak did not indicate clustering. The results suggest that atypical scrapie occurs spontaneously or is not particularly contagious, and that the control measures in force allowed appropriate control of classical scrapie but were not more efficient than active surveillance in detecting cases of atypical scrapie.

  7. Detection of prions in the faeces of sheep naturally infected with classical scrapie

    Directory of Open Access Journals (Sweden)

    Terry Linda A

    2011-05-01

    Full Text Available Abstract Classical scrapie is a naturally transmitted prion disease of sheep and goats. Contaminated environments may contribute to the spread of disease and evidence from animal models has implicated urine, blood, saliva, placenta and faeces as possible sources of the infection. Here we sought to determine whether sheep naturally infected with classical scrapie shed prions in their faeces. We used serial protein misfolding cyclic amplification (sPMCA along with two extraction methods to examine faeces from sheep during both the clinical and preclinical phases of the disease and showed amplification of PrPSc in 7 of 15 and 14 of 14 sheep respectively. However PrPSc was not amplified from the faeces of 25 sheep not exposed to scrapie. These data represent the first demonstration of prion shedding in faeces from a naturally infected host and thus a likely source of prion contamination in the environment.

  8. Epidemiological characteristics of classical scrapie outbreaks in 30 sheep flocks in the United Kingdom.

    Directory of Open Access Journals (Sweden)

    K Marie McIntyre

    Full Text Available Most previous analyses of scrapie outbreaks have focused on flocks run by research institutes, which may not reflect the field situation. Within this study, we attempt to rectify this deficit by describing the epidemiological characteristics of 30 sheep flocks naturally-infected with classical scrapie, and by exploring possible underlying causes of variation in the characteristics between flocks, including flock-level prion protein (PrP genotype profile. In total, the study involved PrP genotype data for nearly 8600 animals and over 400 scrapie cases.We found that most scrapie cases were restricted to just two PrP genotypes (ARQ/VRQ and VRQ/VRQ, though two flocks had markedly different affected genotypes, despite having similar underlying genotype profiles to other flocks of the same breed; we identified differences amongst flocks in the age of cases of certain PrP genotypes; we found that the age-at-onset of clinical signs depended on peak incidence and flock type; we found evidence that purchasing infected animals is an important means of introducing scrapie to a flock; we found some evidence that flock-level PrP genotype profile and flock size account for variation in outbreak characteristics; identified seasonality in cases associated with lambing time in certain flocks; and we identified one case that was homozygous for phenylalanine at codon 141, a polymorphism associated with a very high risk of atypical scrapie, and 28 cases that were heterozygous at this codon.This paper presents the largest study to date on commercially-run sheep flocks naturally-infected with classical scrapie, involving 30 study flocks, more than 400 scrapie cases and over 8500 PrP genotypes. We show that some of the observed variation in epidemiological characteristics between farms is related to differences in their PrP genotype profile; although much remains unexplained and may instead be attributed to the stochastic nature of scrapie dynamics.

  9. A descriptive study of the prevalence of atypical and classical scrapie in sheep in 20 European countries

    Directory of Open Access Journals (Sweden)

    Calavas Didier

    2008-06-01

    Full Text Available Abstract Background The development of active surveillance programmes for transmissible spongiform encephalopathies of small ruminants across Europe has led to the recent identification of a previously undetected form of ovine prion disease, 'atypical' scrapie. Knowledge of the epidemiology of this disease is still limited, as is whether it represents a risk for animal and/or public health. The detection of atypical scrapie has been related to the use of only some of the EU agreed rapid tests. Information about the rapid tests used is not, as yet, available from public reports on the surveillance of transmissible spongiform encephalopathies in small ruminants. We collected detailed results of active surveillance from European countries to estimate and to compare the prevalence of atypical scrapie and classical scrapie in sheep for each country stratified by each surveillance stream; healthy slaughtered and found dead adult sheep. Results From the 20 participating countries, it appeared that atypical scrapie was detected in Europe wherever the conditions necessary for its diagnosis were present. In most countries, atypical scrapie and classical scrapie occurred at low prevalence level. The classical scrapie prevalence estimates were more variable than those for atypical scrapie, which appeared remarkably homogeneous across countries, surveillance streams and calendar years of surveillance. Differences were observed in the age and genotype of atypical scrapie and classical scrapie cases that are consistent with previous published findings. Conclusion This work suggests that atypical scrapie is not rare compared to classical scrapie. The homogeneity of its prevalence, whatever the country, stream of surveillance or year of detection, contrasts with the epidemiological pattern of classical scrapie. This suggests that the aetiology of atypical scrapie differs from that of classical scrapie.

  10. Incidence of infection in Prnp ARR/ARR sheep following experimental inoculation with or natural exposure to classical scrapie.

    Directory of Open Access Journals (Sweden)

    Martin Jeffrey

    Full Text Available The prion protein gene (Prnp is highly influential in determining risk and susceptibility of sheep exposed to classical scrapie. Sheep homozygous for alanine at codon 136 and arginine at codons 154 and 171 (ARR/ARR of the Prnp gene are historically considered to be highly resistant to classical scrapie, although they form a significant fraction of cases of atypical scrapie. To date, experimental transmission of prions to ARR/ARR sheep has only been achieved with the BSE agent and mostly by the intracerebral route. We summarise here the results of six separate studies, in which 95 sheep of the ARR/ARR genotype were naturally exposed to (n = 18 or experimentally challenged with (n = 77 natural or experimental sources of classical scrapie by the oral, intra-intestinal, subcutaneous or intracerebral routes and allowed to survive for periods of up to 94 months post-infection. Only the intracerebral route resulted in disease and/or amplification of disease associated PrP (PrPd, and only in two of 19 sheep that survived for longer than 36 months. Discriminatory immunohistochemistry and Western blot confirmed the scrapie, non-BSE signature of PrPd in those two sheep. However, the neuropathological phenotype was different from any other scrapie (classical or atypical or BSE source previously reported in sheep of any Prnp genotype. These studies confirm the widely held view that ARR/ARR sheep are highly resistant to classical scrapie infection, at least within their commercial lifespan. Moreover, within the constraints of the present studies (only two infected sheep, these results do not support the suggestion that atypical scrapie or BSE are generated by adaptation or mutation of classical scrapie in sheep of resistant ARR/ARR genotype.

  11. Incidence of infection in Prnp ARR/ARR sheep following experimental inoculation with or natural exposure to classical scrapie.

    Science.gov (United States)

    Jeffrey, Martin; Martin, Stuart; Chianini, Francesca; Eaton, Samantha; Dagleish, Mark P; González, Lorenzo

    2014-01-01

    The prion protein gene (Prnp) is highly influential in determining risk and susceptibility of sheep exposed to classical scrapie. Sheep homozygous for alanine at codon 136 and arginine at codons 154 and 171 (ARR/ARR) of the Prnp gene are historically considered to be highly resistant to classical scrapie, although they form a significant fraction of cases of atypical scrapie. To date, experimental transmission of prions to ARR/ARR sheep has only been achieved with the BSE agent and mostly by the intracerebral route. We summarise here the results of six separate studies, in which 95 sheep of the ARR/ARR genotype were naturally exposed to (n = 18) or experimentally challenged with (n = 77) natural or experimental sources of classical scrapie by the oral, intra-intestinal, subcutaneous or intracerebral routes and allowed to survive for periods of up to 94 months post-infection. Only the intracerebral route resulted in disease and/or amplification of disease associated PrP (PrPd), and only in two of 19 sheep that survived for longer than 36 months. Discriminatory immunohistochemistry and Western blot confirmed the scrapie, non-BSE signature of PrPd in those two sheep. However, the neuropathological phenotype was different from any other scrapie (classical or atypical) or BSE source previously reported in sheep of any Prnp genotype. These studies confirm the widely held view that ARR/ARR sheep are highly resistant to classical scrapie infection, at least within their commercial lifespan. Moreover, within the constraints of the present studies (only two infected sheep), these results do not support the suggestion that atypical scrapie or BSE are generated by adaptation or mutation of classical scrapie in sheep of resistant ARR/ARR genotype.

  12. Clinical Examination Protocol to Detect Atypical and Classical Scrapie in Sheep

    OpenAIRE

    Konold, Timm; Phelan, Laura

    2014-01-01

    The diagnosis of scrapie, a transmissible spongiform encephalopathy (TSEs) of sheep and goats, is currently based on the detection of disease-associated prion protein by post mortem tests. Unless a random sample of the sheep or goat population is actively monitored for scrapie, identification of scrapie cases relies on the reporting of clinical suspects, which is dependent on the individual's familiarization with the disease and ability to recognize clinical signs associated with scrapie. Scr...

  13. Presence of an acute phase response in sheep with clinical classical scrapie

    Directory of Open Access Journals (Sweden)

    Meling Siv

    2012-07-01

    Full Text Available Abstract Background Work with experimental scrapie in sheep has been performed on-site for many years including studies on PrPSc dissemination and histopathology of organs and tissues both at preclinical and clinical stages. In this work serum was sampled at regular intervals from lambs which were infected immediately after birth and from parallel healthy controls, and examined for acute phase proteins. In contrast to earlier experiments, which extensively studied PrPSc dissemination and histopathology in peripheral tissues and brain, this experiment is focusing on examination of serum for non-PrPSc markers that discriminates the two groups, and give insight into other on-going processes detectable in serum samples. Results There was clear evidence of an acute phase response in sheep with clinical scrapie, both experimental and natural. All the three proteins, ceruloplasmin, haptoglobin and serum amyloid A, were increased at the clinical stage of scrapie. Conclusion There was evidence of a systemic measurable acute phase response at the clinical terminal end-stage of classical scrapie.

  14. Role of PRNP S127 allele in experimental goat infection with classical caprine scrapie

    Science.gov (United States)

    Classical scrapie is a transmissible spongiform encephalopathy that affects domestic goats and sheep. Experimental inoculation studies in sheep confirmed that classical caprine scrapie can readily transmit to sheep. Therefore, even if current scrapie eradication measures are successful in sheep, goa...

  15. Clinical examination protocol to detect atypical and classical scrapie in sheep.

    Science.gov (United States)

    Konold, Timm; Phelan, Laura

    2014-01-19

    The diagnosis of scrapie, a transmissible spongiform encephalopathy (TSEs) of sheep and goats, is currently based on the detection of disease-associated prion protein by post mortem tests. Unless a random sample of the sheep or goat population is actively monitored for scrapie, identification of scrapie cases relies on the reporting of clinical suspects, which is dependent on the individual's familiarization with the disease and ability to recognize clinical signs associated with scrapie. Scrapie may not be considered in the differential diagnosis of neurological diseases in small ruminants, particularly in countries with low scrapie prevalence, or not recognized if it presents as nonpruritic form like atypical scrapie. To aid in the identification of clinical suspects, a short examination protocol is presented to assess the display of specific clinical signs associated with pruritic and nonpruritic forms of TSEs in sheep, which could also be applied to goats. This includes assessment of behavior, vision (by testing of the menace response), pruritus (by testing the response to scratching), and movement (with and without blindfolding). This may lead to a more detailed neurologic examination of reporting animals as scrapie suspects. It could also be used in experimental TSE studies of sheep or goats to evaluate disease progression or to identify clinical end-point.

  16. The evolution of the prevalence of classical scrapie in sheep in Great Britain using surveillance data between 2005 and 2012.

    Science.gov (United States)

    Arnold, Mark; Ortiz-Pelaez, Angel

    2014-11-01

    After the decline of the Bovine Spongiform Encephalopathy (BSE) epidemic in Great Britain (GB), scrapie remains the most prevalent animal Transmissible Spongiform Encephalopathy (TSE) present in GB. A number of control measures have been implemented for classical scrapie, and since 2005 there has been a large reduction in the number of observed cases. The objective of this study is to estimate two measures of disease frequency using up to date surveillance data collected during and after the implementation of different control measures established since 2004, and breeding for resistance schemes that ran from 2001 until 2009. This would enable an assessment of the effectiveness of both the breeding for resistance programme and the compulsory eradication measures in reducing the prevalence of scrapie in GB. Evaluation of the sensitivity of the rapid post-mortem test for scrapie indicated that it detected scrapie in the last 25% of the incubation period. A back-calculation model was developed to estimate the prevalence of infection at animal and flock-level. The results of the model indicated a mean drop of infection prevalence of 31% each year, leading to a 90% drop in infection prevalence between 2005, with an estimate of 5737 infected sheep in GB in 2012. The risks of classical scrapie infection in animals with genotypes of National Scrapie Plan Types I-IV (all other genotypes), relative to Type V (all genotypes containing V136 R154 Q171 and not A136 R154 R171), were estimated to be: 0, 0.0008, 0.07, and 0.21 respectively. The model estimated a very low rate of reporting of clinical suspects and a large decline from 2007 of the probability of a sheep being reported as a clinical suspect. The model also estimated that the expected number of sheep holdings with classical scrapie in 2012 was 215 (95% confidence interval: 33-437), out of a total of approximately 72,000 sheep holdings in GB. Model estimates indicate that the prevalence in 2012 has dropped to 10% of that

  17. A Bayesian framework to assess the potential for controlling classical scrapie in sheep flocks using a live diagnostic test.

    Science.gov (United States)

    Gryspeirt, Aiko; Gubbins, Simon

    2013-09-01

    Current strategies to control classical scrapie remove animals at risk of scrapie rather than those known to be infected with the scrapie agent. Advances in diagnostic tests, however, suggest that a more targeted approach involving the application of a rapid live test may be feasible in future. Here we consider the use of two diagnostic tests: recto-anal mucosa-associated lymphatic tissue (RAMALT) biopsies; and a blood-based assay. To assess their impact we developed a stochastic age- and prion protein (PrP) genotype-structured model for the dynamics of scrapie within a sheep flock. Parameters were estimated in a Bayesian framework to facilitate integration of a number of disparate datasets and to allow parameter uncertainty to be incorporated in model predictions. In small flocks a control strategy based on removal of clinical cases was sufficient to control disease and more stringent measures (including the use of a live diagnostic test) did not significantly reduce outbreak size or duration. In medium or large flocks strategies in which a large proportion of animals are tested with either live diagnostic test significantly reduced outbreak size, but not always duration, compared with removal of clinical cases. However, the current Compulsory Scrapie Flocks Scheme (CSFS) significantly reduced outbreak size and duration compared with both removal of clinical cases and all strategies using a live diagnostic test. Accordingly, under the assumptions made in the present study there is little benefit from implementing a control strategy which makes use of a live diagnostic test.

  18. Selective breeding for scrapie resistance in sheep

    Directory of Open Access Journals (Sweden)

    Cristina Santos Sotomaior

    2012-11-01

    Full Text Available It is well known that the susceptibility of sheep to scrapie is determined by the host’s prion protein gene (PRNP. PRNP polymorphisms at codons 136 (alanine, A/valine, V, 154 (histidine, H/arginine, R and 171 (glutamine, Q/histidine, H/arginine, R are the main determinants of sheep susceptibility/resistance to classical scrapie. There are four major variants of the wild-type ARQ allele: VRQ, AHQ, ARH and ARR. Breeding programs have been developed in the European Union and the USA to increase the frequency of the resistant ARR allele while decreasing the frequency of the susceptible VRQ allele in sheep populations. In Brazil, little PRNP genotyping data are available for sheep, and thus far, no controlled breeding scheme for scrapie has been implemented. This review will focus on important epidemiological aspects of scrapie and the use of genetic resistance as a tool in breeding programs to control the disease.

  19. Report of outbreaks of classical scrapie in Dorper sheep and associated prion protein gene polymorphisms in affected flocks.

    Science.gov (United States)

    de Andrade, Caroline Pinto; de Oliveira, Eduardo Conceição; Leal, Juliano Souza; de Almeida, Laura Lopes; de Castro, Luiza Amaral; da Silva, Sergio Ceroni; Driemeier, David

    2015-08-01

    Scrapie is an infectious neurodegenerative disease affecting sheep and goats, related with conformational alteration of an isoform of the prion protein that leads to deposition and aggregation in the host's central nervous system. Occurrence of the natural disease can be influenced by host genetic factors, such as a single nucleotide polymorphism of the prion protein gene. This study reports three scrapie-affected Dorper flocks located on three different farms in Brazil. The objective of this study was to analyze these three flocks using scrapie diagnostics, combining histology, immunohistochemistry, genotyping, and western blot assays. For immunohistochemistry, 192 sheep were selected and 308 sheep blood samples were taken for genotyping. A total of 22 sheep were scrapie positive by immunohistochemistry. Of these, four presented clinical signs and had scrapie immunoreactivity at the obex in western blot assays. The sheep without clinical signs were positive in lymphoid organs, such as the third eyelid and rectal mucosa. The major genotypes found on the flocks were ARQ/ARQ, ARQ/ARR, and ARQ/VRQ for codons 136, 154, and 171. Most of the sheep were considered to be at moderate to high risk, based on risk groups for developing scrapie. Some blood samples were sequenced, and polymorphisms were identified in other codons, such as 127, 142, and 143. Our data demonstrate the importance of preclinical scrapie diagnosis in Brazilian sheep, as most of the affected sheep showed no clinical signs, and emphasize the relevance of genotyping other Dorper sheep to determine the genotypic profile of the breed.

  20. Development of an assay to determine single nucleotide polymorphisms in the prion gene for the genetic diagnosis of relative susceptibility to classical scrapie in sheep.

    Science.gov (United States)

    Johnson, Mary Lynn; Evoniuk, Jessica M; Stoltenow, Charles L; O'rourke, Katherine I; Redmer, Dale A

    2007-01-01

    The objective of this study was to develop a reliable Taqman 5' Nuclease Assay for genotyping sheep for scrapie susceptibility. The sheep prion gene contains 2 single nucleotide polymorphisms (SNPs) that may mediate resistance to classical scrapie, one at codon 136, alanine (A) or valine (V), and another at codon 171, arginine (R) or glutamine (Q). The R allele appears to confer resistance to classical scrapie, with the AA(136) RR(171) genotype the most resistant to scrapie and QR(171) only rarely infected in the US sheep population. The Assays by Design protocol was used for development of probes and primers for codon 136 and Primer Express for codon 171. Commercially available kits were used to isolate genomic DNA from blood or muscle. For validation, 70 SNP determinations for each codon were compared to commercial testing with an error rate of less than 1%. Then, 935 samples from blood (n = 818) and muscle (n = 117) were tested for both codons with 928 successful determinations and only 7 samples (scrapie-resistant. This new Taqman 5' Nuclease SNP genotyping assay is accurate, easy to perform, and useful in the study of classical scrapie in sheep and its prevention through selective breeding programs to eliminate highly susceptible animals.

  1. Proteinase K-resistant material in ARR/VRQ sheep brain affected with classical scrapie is composed mainly of VRQ prion protein.

    Science.gov (United States)

    Jacobs, J G; Bossers, A; Rezaei, H; van Keulen, L J M; McCutcheon, S; Sklaviadis, T; Lantier, I; Berthon, P; Lantier, F; van Zijderveld, F G; Langeveld, J P M

    2011-12-01

    Classical scrapie is a prion disease in sheep and goats. In sheep, susceptibility to disease is genetically influenced by single amino acid substitutions. Genetic breeding programs aimed at enrichment of arginine-171 (171R) prion protein (PrP), the so-called ARR allele, in the sheep population have been demonstrated to be effective in reducing the occurrence of classical scrapie in the field. Understanding the molecular basis for this reduced prevalence would serve the assessment of ARR adaptation. The prion formation mechanism and conversion of PrP from the normal form (PrP(C)) to the scrapie-associated form (PrP(Sc)) could play a key role in this process. Therefore, we investigated whether the ARR allele substantially contributes to scrapie prion formation in naturally infected heterozygous 171Q/R animals. Two methods were applied to brain tissue of 171Q/R heterozygous sheep with natural scrapie to determine the relative amount of the 171R PrP fraction in PrP(res), the proteinase K-resistant PrP(Sc) core. An antibody test differentiating between 171Q and 171R PrP fragments showed that PrP(res) was mostly composed of the 171Q allelotype. Furthermore, using a novel tool for prion research, endoproteinase Lys-C-digested PrP(res) yielded substantial amounts of a nonglycosylated and a monoglycosylated PrP fragment comprising codons 114 to 188. Following two-dimensional gel electrophoresis, only marginal amounts (scrapie-infected animals. This is suggestive of a poor adaptation of classical scrapie to this resistance allele under these natural conditions.

  2. Genotyping and surveillance for scrapie in Finnish sheep

    Directory of Open Access Journals (Sweden)

    Hautaniemi Maria

    2012-07-01

    Full Text Available Abstract Background The progression of scrapie is known to be influenced by the amino acid polymorphisms of the host prion protein (PrP gene. There is no breeding programme for TSE resistance in sheep in Finland, but a scrapie control programme has been in place since 1995. In this study we have analysed PrP genotypes of total of 928 purebred and crossbred sheep together with the data of scrapie survey carried out in Finland during 2002–2008 in order to gain knowledge of the genotype distribution and scrapie prevalence in Finnish sheep. Results The ARQ/ARQ genotype was the most common genotype in all breeds studied. ARR allele frequency was less than 12% in purebred Finnish sheep and in most genotypes heterozygous for ARR, the second allele was ARQ. The VRQ allele was not detected in the Grey race sheep of Kainuu or in the Aland sheep, and it was present in less than 6% of the Finnish Landrace sheep. Leucine was the most prominent amino acid found in codon 141. In addition, one novel prion dimorphisms of Q220L was detected. During the scrapie survey of over 15 000 sheep in 2002–2008, no classical scrapie cases and only five atypical scrapie cases were detected. Conclusions The results indicate that the Finnish sheep populations have genetically little resistance to classical scrapie, but no classical scrapie was detected during an extensive survey in 2002–2008. However, five atypical scrapie cases emerged; thus, the disease is present in the Finnish sheep population at a low level.

  3. Epidemiological and genetical differences between classical and atypical scrapie cases

    OpenAIRE

    Lühken, Gesine; Buschmann, Anne; Brandt, Horst; Eiden, Martin; Groschup, Martin; Erhardt, Georg

    2007-01-01

    International audience; The aim of this study was to analyze the epidemiology and prion protein (PrP) genetics in scrapie-affected sheep flocks in Germany. For this purpose, 224 German scrapie cases in sheep diagnosed between January 2002 and February 2006 were classified as classical or atypical scrapie and the amino acids at codons 136, 141, 154 and 171 were determined. Likewise, representative numbers of flock mates were genotyped. Significant epidemiological differences were observed betw...

  4. Sheep Feed and Scrapie, France

    Science.gov (United States)

    Philippe, Sandrine; Ducrot, Christian; Roy, Pascal; Remontet, Laurent; Jarrige, Nathalie

    2005-01-01

    Scrapie is a small ruminant, transmissible spongiform encephalopathy (TSE). Although in the past scrapie has not been considered a zoonosis, the emergence of bovine spongiform encephalopathy, transmissible to humans and experimentally to sheep, indicates that risk exists for small ruminant TSEs in humans. To identify the risk factors for introducing scrapie into sheep flocks, a case-control study was conducted in France from 1999 to 2000. Ninety-four case and 350 control flocks were matched by location and main breed. Three main hypotheses were tested: direct contact between flocks, indirect environmental contact, and foodborne risk. Statistical analysis was performed by using adjusted generalized linear models with the complementary log-log link function, considering flock size as an offset. A notable effect of using proprietary concentrates and milk replacers was observed. The risk was heterogeneous among feed factories. Contacts between flocks were not shown to be a risk factor. PMID:16102318

  5. Archival search for historical atypical scrapie in sheep reveals evidence for mixed infections.

    Science.gov (United States)

    Chong, Angela; Kennedy, Iain; Goldmann, Wilfred; Green, Andrew; González, Lorenzo; Jeffrey, Martin; Hunter, Nora

    2015-10-01

    Natural scrapie in sheep occurs in classical and atypical forms, which may be distinguished on the basis of the associated neuropathology and properties of the disease-associated prion protein on Western blots. First detected in 1998, atypical scrapie is known to have occurred in UK sheep since the 1980s. However, its aetiology remains unclear and it is often considered as a sporadic, non-contagious disease unlike classical scrapie which is naturally transmissible. Although atypical scrapie tends to occur in sheep of prion protein (PRNP) genotypes that are different from those found predominantly in classical scrapie, there is some overlap so that there are genotypes in which both scrapie forms can occur. In this search for early atypical scrapie cases, we made use of an archive of fixed and frozen sheep samples, from both scrapie-affected and healthy animals (∼1850 individuals), dating back to the 1960s. Using a selection process based primarily on PRNP genotyping, but also on contemporaneous records of unusual clinical signs or pathology, candidate sheep samples were screened by Western blot, immunohistochemistry and strain-typing methods using tg338 mice. We identified, from early time points in the archive, three atypical scrapie cases, including one sheep which died in 1972 and two which showed evidence of mixed infection with classical scrapie. Cases with both forms of scrapie in the same animal as recognizable entities suggest that mixed infections have been around for a long time and may potentially contribute to the variety of scrapie strains.

  6. Clinical findings in two cases of atypical scrapie in sheep: a case report

    Directory of Open Access Journals (Sweden)

    Chaplin Melanie

    2007-02-01

    Full Text Available Abstract Background Atypical scrapie is a recently recognised form of transmissible spongiform encephalopathy of sheep that differs from classical scrapie in its neuropathological and biochemical features. Most cases are detected in apparently healthy sheep and information on the clinical presentation is limited. Case presentation This report describes the clinical findings in two sheep notified as scrapie suspects and confirmed as atypical scrapie cases by immunohistochemistry and Western immunoblotting. Although both sheep displayed signs suggestive of a cerebellar dysfunction there was considerable variation in the individual clinical signs, which were similar to classical scrapie. Conclusion Any sheep presenting with neurological gait deficits should be assessed more closely for other behavioural, neurological and physical signs associated with scrapie and their presence should lead to the suspicion of scrapie.

  7. Immunological characterization of abnormal prion protein from atypical scrapie cases in sheep using a panel of monoclonal antibodies

    NARCIS (Netherlands)

    Gretzschel, A.; Buschmann, A.; Langeveld, J.P.M.; Groschup, M.H.

    2006-01-01

    After the implementation of an active surveillance programme for scrapie in sheep in the EU, the number of diagnosed classical scrapie cases rose sharply and a novel kind of so-called atypical scrapie case was discovered. These atypical scrapie cases display unusual features concerning the distribut

  8. Early and late pathogenesis of natural scrapie infection in sheep

    NARCIS (Netherlands)

    Keulen, van L.J.M.; Vromans, M.E.W.; Zijderveld, van F.G.

    2002-01-01

    The pathogenesis of scrapie infection was studied in sheep carrying the PrPVRQ/PrPVRQ genotype, which is associated with a high susceptibility for natural scrapie. The sheep were killed at sequential time points during a scrapie infection covering both the early and late stages of scrapie pathogenes

  9. Oral inoculation of neonatal Suffolk sheep with the agent of classical scrapie results in PrPSc accumulation in sheep with the PRNP ARQ/ARQ but not the ARQ/ARR genotype

    Science.gov (United States)

    Background Scrapie is a transmissible spongiform encephalopathy that can be transmitted amongst susceptible sheep. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent. Findings This study reports the failure to detect PrPSc in nervous or lymphoid tis...

  10. Oral inoculation of neonatal Suffolk sheep with the agent of classical scrapie results in PrP(Sc) accumulation in sheep with the PRNP ARQ/ARQ but not the ARQ/ARR genotype.

    Science.gov (United States)

    Greenlee, Justin J; Smith, Jodi D; Hamir, Amir N

    2016-04-01

    Scrapie is a transmissible spongiform encephalopathy that can be transmitted amongst susceptible sheep. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent. This study reports the failure to detect PrP(Sc) in nervous or lymphoid tissues of Suffolk sheep of the PRNP ARQ/ARR genotype after oral inoculation with a U.S. scrapie isolate. Lambs were inoculated within the first 24 h of birth with 1 ml of a 10% (wt./vol.) brain homogenate derived from a clinically affected ARQ/ARQ sheep. The inoculated sheep were observed daily throughout the experiment for clinical signs suggestive of scrapie until they were necropsied at 86 months post inoculation. Tissues were collected for examination by immunohistochemistry and enzyme immunoassay, but all failed to demonstrate evidence of scrapie infection. Neonatal sheep of the ARQ/ARQ genotype receiving the same inoculum developed scrapie within 24 months. Lambs of the ARQ/ARR genotype that received the same inoculum by intracranial inoculation develop scrapie with a prolonged incubation period and with abnormal prion present within the central nervous system, but not peripheral lymphoid tissues. Results of this study suggest that ARQ/ARR sheep are resistant to oral infection with the scrapie isolate used even during the neonatal period.

  11. A descriptive study of the prevalence of atypical and classical scrapie in sheep in 20 European countries.

    OpenAIRE

    Calavas Didier; Nöremark Maria; Tongue Sue C; Fediaevsky Alexandre; Ru Giuseppe; Hopp Petter

    2008-01-01

    Abstract Background The development of active surveillance programmes for transmissible spongiform encephalopathies of small ruminants across Europe has led to the recent identification of a previously undetected form of ovine prion disease, 'atypical' scrapie. Knowledge of the epidemiology of this disease is still limited, as is whether it represents a risk for animal and/or public health. The detection of atypical scrapie has been related to the use of only some of the EU agreed rapid tests...

  12. Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

    2013-11-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

  13. Atypical/Nor98 scrapie infectivity in sheep peripheral tissues.

    Directory of Open Access Journals (Sweden)

    Olivier Andréoletti

    Full Text Available Atypical/Nor98 scrapie was first identified in 1998 in Norway. It is now considered as a worldwide disease of small ruminants and currently represents a significant part of the detected transmissible spongiform encephalopathies (TSE cases in Europe. Atypical/Nor98 scrapie cases were reported in ARR/ARR sheep, which are highly resistant to BSE and other small ruminants TSE agents. The biology and pathogenesis of the Atypical/Nor98 scrapie agent in its natural host is still poorly understood. However, based on the absence of detectable abnormal PrP in peripheral tissues of affected individuals, human and animal exposure risk to this specific TSE agent has been considered low. In this study we demonstrate that infectivity can accumulate, even if no abnormal PrP is detectable, in lymphoid tissues, nerves, and muscles from natural and/or experimental Atypical/Nor98 scrapie cases. Evidence is provided that, in comparison to other TSE agents, samples containing Atypical/Nor98 scrapie infectivity could remain PrP(Sc negative. This feature will impact detection of Atypical/Nor98 scrapie cases in the field, and highlights the need to review current evaluations of the disease prevalence and potential transmissibility. Finally, an estimate is made of the infectivity loads accumulating in peripheral tissues in both Atypical/Nor98 and classical scrapie cases that currently enter the food chain. The results obtained indicate that dietary exposure risk to small ruminants TSE agents may be higher than commonly believed.

  14. The placenta shed from goats with classical scrapie is infectious to goat kids and lambs.

    Science.gov (United States)

    Schneider, David A; Madsen-Bouterse, Sally A; Zhuang, Dongyue; Truscott, Thomas C; Dassanayake, Rohana P; O'Rourke, Katherine I

    2015-08-01

    The placenta of domestic sheep plays a key role in horizontal transmission of classical scrapie. Domestic goats are frequently raised with sheep and are susceptible to classical scrapie, yet potential routes of transmission from goats to sheep are not fully defined. Sparse accumulation of disease-associated prion protein in cotyledons casts doubt about the role of the goat's placenta. Thus, relevant to mixed-herd management and scrapie-eradication efforts worldwide, we determined if the goat's placenta contains prions orally infectious to goat kids and lambs. A pooled cotyledon homogenate, prepared from the shed placenta of a goat with naturally acquired classical scrapie disease, was used to orally inoculate scrapie-naïve prion genotype-matched goat kids and scrapie-susceptible lambs raised separately in a scrapie-free environment. Transmission was detected in all four goats and in two of four sheep, which importantly identifies the goat's placenta as a risk for horizontal transmission to sheep and other goats.

  15. Detection of classical and atypical/Nor98 scrapie by the paraffin-embedded tissue blot method.

    Science.gov (United States)

    Wemheuer, W M; Benestad, S L; Wrede, A; Wemheuer, W E; Brenig, B; Bratberg, B; Schulz-Schaeffer, W J

    2009-05-30

    The paraffin-embedded tissue (PET) blot method was used to investigate sections of the central nervous system and lymphatic tissues from 24 cases of classical scrapie and 25 cases of atypical/Nor98 scrapie in sheep and four healthy control sheep. The PET blot detected deposits of PrP(Sc) in the brain tissue of all 49 sheep with scrapie but no PrP(Sc) labelling could be detected in the control sheep. By contrast, not all the atypical/Nor98 scrapie cases were detectable by immunohistochemistry. The high sensitivity of the PET blot method made it possible to observe that in some atypical/Nor98 cases, deposits of PrP(Sc) may be restricted to supratentorial brain structures and that the diagnosis may be missed when only testing the obex area, where deposits are common in classical scrapie, and the cerebellar structures, where deposits are considered to be common in atypical/Nor98 cases.

  16. Experimental infection of meadow voles (Microtus pennsylvanicus) with sheep scrapie

    Science.gov (United States)

    Carlson, CM; Schneider, Jay R.; Pedersen, Janice C.; Heisey, Dennis M.; Johnson, Christopher J.

    2015-01-01

    Meadow voles (Microtus pennsylvanicus) are permissive to chronic wasting disease (CWD) infection, but their susceptibility to other transmissible spongiform encephalopathies (TSEs) is poorly characterized. In this initial study, we intracerebrally challenged 6 meadow voles with 2 isolates of sheep scrapie. Three meadow voles acquired a TSE after the scrapie challenge and an extended incubation period. The glycoform profile of proteinase K-resistant prion protein (PrP(res)) in scrapie-sick voles remained similar to the sheep inocula, but differed from that of voles clinically affected by CWD. Vacuolization patterns and disease-associated prion protein (PrP(Sc)) deposition were generally similar in all scrapie-affected voles, except in the hippocampus, where PrP(Sc) staining varied markedly among the animals. Our results demonstrate that meadow voles can acquire a TSE after intracerebral scrapie challenge and that this species could therefore prove useful for characterizing scrapie isolates.

  17. Experimental infection of meadow voles (Microtus pennsylvanicus) with sheep scrapie.

    Science.gov (United States)

    Carlson, Christina M; Schneider, Jay R; Pedersen, Joel A; Heisey, Dennis M; Johnson, Christopher J

    2015-01-01

    Meadow voles (Microtus pennsylvanicus) are permissive to chronic wasting disease (CWD) infection, but their susceptibility to other transmissible spongiform encephalopathies (TSEs) is poorly characterized. In this initial study, we intracerebrally challenged 6 meadow voles with 2 isolates of sheep scrapie. Three meadow voles acquired a TSE after the scrapie challenge and an extended incubation period. The glycoform profile of proteinase K-resistant prion protein (PrP(res)) in scrapie-sick voles remained similar to the sheep inocula, but differed from that of voles clinically affected by CWD. Vacuolization patterns and disease-associated prion protein (PrP(Sc)) deposition were generally similar in all scrapie-affected voles, except in the hippocampus, where PrP(Sc) staining varied markedly among the animals. Our results demonstrate that meadow voles can acquire a TSE after intracerebral scrapie challenge and that this species could therefore prove useful for characterizing scrapie isolates.

  18. Phenotype shift from atypical scrapie to CH1641 following experimental transmission in sheep.

    Science.gov (United States)

    Simmons, Marion M; Moore, S Jo; Lockey, Richard; Chaplin, Melanie J; Konold, Timm; Vickery, Christopher; Spiropoulos, John

    2015-01-01

    The interactions of host and infecting strain in ovine transmissible spongiform encephalopathies are known to be complex, and have a profound effect on the resulting phenotype of disease. In contrast to classical scrapie, the pathology in naturally-occurring cases of atypical scrapie appears more consistent, regardless of genotype, and is preserved on transmission within sheep homologous for the prion protein (PRNP) gene. However, the stability of transmissible spongiform encephalopathy phenotypes on passage across and within species is not absolute, and there are reports in the literature where experimental transmissions of particular isolates have resulted in a phenotype consistent with a different strain. In this study, intracerebral inoculation of atypical scrapie between two genotypes both associated with susceptibility to atypical forms of disease resulted in one sheep displaying an altered phenotype with clinical, pathological, biochemical and murine bioassay characteristics all consistent with the classical scrapie strain CH1641, and distinct from the atypical scrapie donor, while the second sheep did not succumb to challenge. One of two sheep orally challenged with the same inoculum developed atypical scrapie indistinguishable from the donor. This study adds to the range of transmissible spongiform encephalopathy phenotype changes that have been reported following various different experimental donor-recipient combinations. While these circumstances may not arise through natural exposure to disease in the field, there is the potential for iatrogenic exposure should current disease surveillance and feed controls be relaxed. Future sheep to sheep transmission of atypical scrapie might lead to instances of disease with an alternative phenotype and onward transmission potential which may have adverse implications for both public health and animal disease control policies.

  19. In vitro amplification of ovine prions from scrapie-infected sheep from Great Britain reveals distinct patterns of propagation

    Directory of Open Access Journals (Sweden)

    Thorne Leigh

    2012-11-01

    Full Text Available Abstract Background Protein misfolding cyclic amplification (PMCA is a method that facilitates the detection of prions from many sources of transmissible spongiform encephalopathy (TSE. Sheep scrapie represents a unique diversity of prion disease agents in a range of susceptible PRNP genotypes. In this study PMCA was assessed on a range of Great Britain (GB sheep scrapie isolates to determine the applicability to veterinary diagnosis of ovine TSE. Results PrPSc amplification by protein misfolding cyclic amplification (PMCA was assessed as a diagnostic tool for field cases of scrapie. The technique was initially applied to thirty-seven isolates of scrapie from diverse geographical locations around GB, and involved sheep of various breeds and PRNP genotypes. All samples were amplified in either VRQ and/or ARQ PrPC substrate. For PrPSc from sheep with at least one VRQ allele, all samples amplified efficiently in VRQ PrPC but only PrPSc from ARH/VRQ sheep amplified in both substrates. PrPSc from ARQ/ARQ sheep displayed two amplification patterns, one that amplified in both substrates and one that only amplified in ARQ PrPC. These amplification patterns were consistent for a further 14/15 flock/farm mates of these sheep. Furthermore experimental scrapie strains SSBP1, Dawson, CH1641 and MRI were analysed. SSBP1 and Dawson (from VRQ/VRQ sheep amplified in VRQ but not ARQ substrate. MRI scrapie (from ARQ/ARQ sheep nor CH1641 did not amplify in ARQ or VRQ substrate; these strains required an enhanced PMCA method incorporating polyadenylic acid (poly(A to achieve amplification. Conclusions PrPsc from 52 classical scrapie GB field isolates amplified in VRQ or ARQ or both substrates and supports the use of PMCA as a rapid assay for the detection of a wide range of ovine classical scrapie infections involving multiple PRNP genotypes and scrapie strains.

  20. Classical scrapie prions in ovine blood are associated with B lymphocytes and platelet-rich plasma

    Directory of Open Access Journals (Sweden)

    Dassanayake Rohana P

    2011-11-01

    Full Text Available Abstract Background Classical scrapie is a naturally occurring transmissible spongiform encephalopathy of sheep and goats characterized by cellular accumulation of abnormal isoforms of prion protein (PrPSc in the central nervous system and the follicles of peripheral lymphoid tissues. Previous studies have shown that the whole blood and buffy coat blood fraction of scrapie infected sheep harbor prion infectivity. Although PrPSc has been detected in peripheral blood mononuclear cells (PBMCs, plasma, and more recently within a subpopulation of B lymphocytes, the infectivity status of these cells and plasma in sheep remains unknown. Therefore, the objective of this study was to determine whether circulating PBMCs, B lymphocytes and platelets from classical scrapie infected sheep harbor prion infectivity using a sheep bioassay. Results Serial rectal mucosal biopsy and immunohistochemistry were used to detect preclinical infection in lambs transfused with whole blood or blood cell fractions from preclinical or clinical scrapie infected sheep. PrPSc immunolabeling was detected in antemortem rectal and postmortem lymphoid tissues from recipient lambs receiving PBMCs (15/15, CD72+ B lymphocytes (3/3, CD21+ B lymphocytes (3/3 or platelet-rich plasma (2/3 fractions. As expected, whole blood (11/13 and buffy coat (5/5 recipients showed positive PrPSc labeling in lymphoid follicles. However, at 549 days post-transfusion, PrPSc was not detected in rectal or other lymphoid tissues in three sheep receiving platelet-poor plasma fraction. Conclusions Prion infectivity was detected in circulating PBMCs, CD72+ pan B lymphocytes, the CD21+ subpopulation of B lymphocytes and platelet-rich plasma of classical scrapie infected sheep using a sheep bioassay. Combining platelets with B lymphocytes might enhance PrPSc detection levels in blood samples.

  1. Classical scrapie prions in ovine blood are associated with B lymphocytes and platelets-rich plasma

    Science.gov (United States)

    Classical scrapie is a naturally occurring fatal brain disease of sheep and goats which is caused by prions, a novel class of infectious agent, and is accompanied by the accumulation of abnormal isoforms of prion protein (PrP-Sc) in certain neural and lymphoid tissues. Although collection of a blood...

  2. A transfectant RK13 cell line permissive to classical caprine scrapie prion propagation

    Science.gov (United States)

    Classical scrapie is a form of transmissible spongiform encephalopathies (TSE) affecting domestic goats and sheep and disease is characterized by the accumulation of abnormal conformational isoform (PrP-Sc) of normal cellular prion protein (PrP-C) in the central nervous system and, in most cases, ly...

  3. Comparison of two US sheep scrapie isolates supports identification as separate strains

    Science.gov (United States)

    Scrapie is a naturally occurring transmissible spongiform encephalopathy (TSE) of sheep and goats. There are different strains of sheep scrapie that are associated with unique molecular, transmission, and phenotype characteristics, but very little is known about the potential presence of scrapie str...

  4. Lack of prion accumulation in lymphoid tissues of PRNP ARQ/ARR sheep intracranially inoculated with the agent of scrapie.

    Science.gov (United States)

    Greenlee, Justin J; Kunkle, Robert A; Richt, Jürgen A; Nicholson, Eric M; Hamir, Amir N

    2014-01-01

    Sheep scrapie is a transmissible spongiform encephalopathy that can be transmitted horizontally. The prion protein gene (PRNP) profoundly influences the susceptibility of sheep to the scrapie agent and the tissue levels and distribution of PrPSc in affected sheep. The purpose of this study was to compare the survival time and PrPSc tissue distribution in sheep with highly resistant and highly susceptible PRNP genotypes after intracranial inoculation of the agent of scrapie. Five sheep each of genotype VRQ/VRQ, VRQ/ARR or ARQ/ARR were inoculated. Sheep were euthanized when clinical signs of scrapie became severe. Clinical signs, microscopic lesions, and western blot profiles were uniform across genotypes and consistent with manifestations of classical scrapie. Mean survival time differences were associated with the 171 polymorphic site with VRQ/VRQ sheep surviving 18 months, whereas VRQ/ARR and ARQ/ARR sheep survived 60 and 56 months, respectively. Labeling of PrPSc by immunohistochemistry revealed similar accumulations in central nervous system tissues regardless of host genotype. Immunoreactivity for PrPSc in lymphoid tissue was consistently abundant in VRQ/VRQ, present but confined to tonsil or retropharyngeal lymph node in 4/5 VRQ/ARR, and totally absent in ARQ/ARR sheep. The results of this study demonstrate the susceptibility of sheep with the ARQ/ARR genotype to scrapie by the intracranial inoculation route with PrPSc accumulation in CNS tissues, but prolonged incubation times and lack of PrPSc in lymphoid tissue.

  5. Quantitating PrP polymorphisms present in prions from heterozygous scrapie-infected sheep

    Science.gov (United States)

    Scrapie is a prion (PrPSc) disease of sheep. The incubation period of sheep scrapie is strongly influenced by polymorphisms at positions 136, 154, and 171 of a sheep’s normal cellular prion protein (PrPC). Chymotrypsin was used to digest sheep recombinant PrP to identify a set of characteristic pept...

  6. The signature of scrapie: differences in the PrP genotype profile of scrapie-affected and scrapie-free UK sheep flocks.

    OpenAIRE

    Baylis, M.; Houston, Fiona; Goldmann, W.; Hunter, N.; McLean, A.R.

    2000-01-01

    The amino-acid sequence of the PrP protein plays an important role in determining whether sheep are susceptible to scrapie. Although the genetics of scrapie susceptibility are now well understood, there have been few studies of the PrP gene at the population level, especially in commercially farmed sheep. Here we describe the PrP genetic profiles of the breeding stock of four UK sheep flocks, comprising nearly 650 animals in total. Two flocks had been scrapie affected for about eight years an...

  7. Lipid profiles in brains from sheep with natural scrapie.

    Science.gov (United States)

    Rosa, Antonella; Scano, Paola; Incani, Alessandra; Pilla, Federica; Maestrale, Caterina; Manca, Matteo; Ligios, Ciriaco; Pani, Alessandra

    2013-01-01

    Prion diseases are fatal neurodegenerative disorders affecting many mammals, ovine scrapie being the archetypal prion disease. Several independent studies in murine and cell-based models of scrapie have highlighted the presence of a link between prion generation and lipid alterations; yet, no data on natural disease are available. In this study we investigated levels of total lipids and cholesterol as well as profiles of fatty acids in brain homogenates from symptomatic and asymptomatic scrapie-infected sheep vs. healthy sheep, all belonging to the same flock. Lipid extracts were analyzed by means of gas chromatography and high performance liquid chromatography. Data of fatty acids were submitted to multivariate statistical analysis to give a picture of the brain lipid profiles of sheep. Interestingly, results revealed abnormalities in the brain fatty acid unsaturation of infected/symptomatic animals. Significant reduction of monoene 18:1 n-9 was detected in brain lipids from infected/symptomatic sheep, as compared to healthy and infected/asymptomatic animals, and this alteration occurred in combination with a significant increase in 18:0 level. The unsupervised Principal Component Analysis showed that infected/symptomatic and healthy sheep samples lie in two different regions of the plot, infected/asymptomatic lie mostly next to healthy. The increase of cerebral saturated fatty acids provides a rough indication of presumed alterations in lipid raft domains of nervous cells during scrapie, suggesting that they may exist in a notable viscous liquid-ordered state. Such physicochemical alteration would have a profound impact on the raft thermodynamic properties, its spatial organization, and signal transduction, all potentially relevant for prion generation.

  8. Scrapie-specific pathology of sheep lymphoid tissues.

    Directory of Open Access Journals (Sweden)

    Gillian McGovern

    Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases often result in accumulation of disease-associated PrP (PrP(d in the lymphoreticular system (LRS, specifically in association with follicular dendritic cells (FDCs and tingible body macrophages (TBMs of secondary follicles. We studied the effects of sheep scrapie on lymphoid tissue in tonsils and lymph nodes by light and electron microscopy. FDCs of sheep were grouped according to morphology as immature, mature or regressing. Scrapie was associated with FDC dendrite hypertrophy and electron dense deposit or vesicles. PrP(d was located using immunogold labelling at the plasmalemma of FDC dendrites and, infrequently, mature B cells. Abnormal electron dense deposits surrounding FDC dendrites were identified as immunoglobulins suggesting that excess immune complexes are retained and are indicative of an FDC dysfunction. Within scrapie-affected lymph nodes, macrophages outside the follicle and a proportion of germinal centre TBMs accumulated PrP(d within endosomes and lysosomes. In addition, TBMs showed PrP(d in association with the cell membrane, non-coated pits and vesicles, and also with discrete, large and random endoplasmic reticulum networks, which co-localised with ubiquitin. These observations suggest that PrP(d is internalised via the caveolin-mediated pathway, and causes an abnormal disease-related alteration in endoplasmic reticulum structure. In contrast to current dogma, this study shows that sheep scrapie is associated with cytopathology of germinal centres, which we attribute to abnormal antigen complex trapping by FDCs and abnormal endocytic events in TBMs. The nature of the sub-cellular changes in FDCs and TBMs differs from those of scrapie infected neurones and glial cells suggesting that different PrP(d/cell membrane interactions occur in different cell types.

  9. Accumulation of PrP-Sc in hemal nodes of naturally and experimentally scrapie-infected sheep

    Science.gov (United States)

    Classical scrapie is a naturally occurring fatal disease of sheep and goats which is caused by prions, a novel class of infectious agent. Infection is accompanied by accumulation of abnormal isoforms of the prion protein (PrP-Sc) in certain neural and lymphoid tissues. Hemal nodes, which are unique ...

  10. Immunohistochemical detection of prion protein in lymphoid tissues of sheep with natural scrapie

    NARCIS (Netherlands)

    Keulen, van L.J.M.; Schreuder, B.E.C.; Meloen, R.H.; Mooij-Harkes, G.; Vromans, M.E.W.; Langeveld, J.P.M.

    1996-01-01

    The scrapie-associated form of the prion protein (PrP(Sc)) accumulates in the brain and lymphoid tissues of sheep with scrapie. In order to assess whether detecting PrP(Sc) in lymphoid tissue could he used as a diagnostic test for scrapie, we studied the localization and distribution of PrP(Sc) in v

  11. Lesion profiling at primary isolation in RIII mice is insufficient in distinguishing BSE from classical scrapie.

    Science.gov (United States)

    Beck, Katy E; Chaplin, Melanie; Stack, Michael; Sallis, Rosemary E; Simonini, Sarah; Lockey, Richard; Spiropoulos, John

    2010-03-01

    Primary isolation of bovine spongiform encephalopathy (BSE) in RIII mice generates a lesion profile believed to be reproducible and distinct from that produced by classical scrapie. This profile, which is characterized by peaks at gray matter areas 1, 4 and 7 (dorsal medulla, hypothalamus and septal nuclei), is used to diagnose BSE on primary isolation. The aim of this study was to investigate whether the BSE agent could be present in sheep diagnosed with classical scrapie, using lesion profiles in RIII mice as a discriminatory method. Sixty-two positive scrapie field cases were collected from individual farms between 1996 and 1999 and bioassayed in RIII mice. Fifty-five of these isolates transmitted successfully to at least one mouse. Of the 31 that produced adequate data to allow lesion profile analysis, 10 showed a consistent profile with peaks at brain areas 1, 4 and 7. All inocula for this subgroup were derived from sheep of genotype ARQ/ARQ. While the 1-4-7-scrapie profile exhibited similarities to BSE in RIII mice at primary isolation, it was distinguishable based on histopathology, immunohistochemistry and cluster analysis. We conclude that caution should be taken to distinguish this profile from BSE and that additional parameters should be considered to reach a final diagnosis.

  12. Scrapie e seu diagnóstico diferencial em ovinos no Mato Grosso do Sul Scrapie and differential diagnosis in sheep in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Héllen M. Martins

    2012-12-01

    Full Text Available Scrapie é uma doença infecciosa, neurodegenerativa fatal, causada pelo príon scrapie (PrPsc. Apresenta-se tanto na forma clássica em ovinos e caprinos geneticamente susceptíveis quanto na forma atípica em ovinos. A primeira notificação oficial do Brasil à Organização Mundial de Saúde Animal (OIE, um caso da forma clássica diagnosticado no Rio Grande do Sul ocorreu em 1985, mas a doença já havia sido diagnosticada no mesmo Estado em 1978. Este trabalho objetivou descrever dois surtos de Scrapie em ovinos em Mato Grosso do Sul (MS, Brasil e investigar, por meio de imuno-histoquímica (IHQ a presença de PrPsc no Sistema Nervoso Central (SNC de ovinos examinados entre 2003 e 2010. Na primeira parte observaram-se dois ovinos com sinais clínicos típicos de scrapie, detalhando-se os sinais neurológicos, dados epidemiológicos, histopatológicos e amostras teciduais em duplicata desses ovinos foram encaminhadas para realização de diagnóstico de Raiva e para diagnóstico IHQ para príon. Na segunda parte realizou-se levantamento de laudos de necropsia e diagnósticos histopatológicos de ovinos, no período de maio de 2003 a março de 2010. Amostras de sistema nervoso central de 51 casos foram selecionados, incluindo os dois já com diagnóstico de Scrapie mencionados acima; os tecido de todos esses ovinos foram submetidos à IHQ para detecção de proteína priônica. Os 49 ovinos avaliados apresentaram resultado negativo na IHQ para príon.Scrapie is a fatal neurodegenerative infectious disease, caused by the scrapie prion (PrPsc, that can both in the as the classic form in genetically susceptible sheep and goats and in the atypical form in sheep. The first official notification of scrapie from Brazil was made to the World Organization for Animal Health (OIE in 1985, in the state of Rio Grande do Sul, although the disease was first documented in this Brazilian state in 1978. The objective this paper was to describe two outbreaks

  13. Review: A review on classical and atypical scrapie in caprine: Prion protein gene polymorphisms and their role in the disease.

    Science.gov (United States)

    Curcio, L; Sebastiani, C; Di Lorenzo, P; Lasagna, E; Biagetti, M

    2016-10-01

    Scrapie is a naturally occurring transmissible spongiform encephalopathy in sheep and goat. It has been known for ~250 years and is characterised by the accumulation of an abnormal isoform of a host-encoded prion protein that leads to progressive neurodegeneration and death. Scrapie is recognised in two forms, classical and atypical scrapie. The susceptibility to both types of scrapie is influenced by polymorphisms of the prion protein gene (PRNP). Sheep susceptibility or resistance to classical scrapie is strongly regulated by the polymorphisms at codons 136, 154 and 171 of the PRNP. The genetic role in atypical scrapie in sheep has been defined by polymorphisms at codons 141, 154 and 171, which are associated with different degrees of risk in the occurrence of the ovine disease. Progress has been achieved in the prevention of scrapie in sheep due to efficient genetic breeding programmes based on eradication and control of the disease. In Europe, the success of these programmes has been verified by applying eradication and genetic selection plans. In general terms, the ovine selection plans aim to eliminate and reduce the susceptible allele and to enrich the resistant allele ARR. During outbreaks all susceptible animals are slaughtered, only ARR/ARR resistant rams and sheep and semi-resistant females are preserved. In the occurrence of scrapie positive goats a complete cull of the flock (stamping out) is performed with great economic loss and severe risk of extinction for the endangered breeds. The ability to select scrapie-resistant animals allows to define new breeding strategies aimed to boost genetic progress while reducing costs during scrapie outbreaks. Allelic variants of PRNP can be protective for caprine scrapie, and the knowledge of their distribution in goats has become very important. Over the past few years, the integration of genetic information on goat populations could be used to make selection decisions, commonly referred to as genetic selection

  14. Norwegian farmers' vigilance in reporting sheep showing scrapie-associated signs

    Directory of Open Access Journals (Sweden)

    Jarp Jorun

    2007-12-01

    Full Text Available Abstract Background Scrapie is a chronic neurodegenerative disease affecting small ruminants and belongs to the transmissible spongiform encephalopathies. Scrapie is considered a serious animal disease and it has been notifiable in Norway since 1965. The clinical signs of scrapie might be vague and the farmers, if familiar with the signs of scrapie, are often in the best position for detecting scrapie suspects. In 2002, an anonymous questionnaire survey was conducted in order to assess Norwegian sheep farmers' vigilance of scrapie. Results Although the potential detection of a scrapie-positive animal would lead to the destruction of the sheep flock concerned, almost all the farmers (97 % expressed their willingness to report scrapie suspects. This was most certainly dependent on the Government taking the economic responsibility for the control programme as nearly all the farmers responded that this was an important condition. Listeriosis is relatively common disease in Norwegian sheep and a differential diagnosis for scrapie. In a multinomial logistic regression the reporting behaviour for non-recovering listeriosis cases, used as a measurement of willingness to report scrapie, was examined. The reporting of non-recovering listeriosis cases increased as the knowledge of scrapie-associated signs increased, and the reporting behaviour was dependent on both economic and non-economic values. Conclusion The results indicate that in 2002 almost all sheep farmers showed willingness to report any scrapie suspects. Nevertheless there is an underreporting of scrapie suspects and the farmers' awareness and hence their vigilance of scrapie could be improved. Furthermore, the results suggest that to ensure the farmers' compliance to control programmes for serious infectious diseases, the farmers' concerns of non-economic as well as economic values should be considered.

  15. Evidence in sheep for pre-natal transmission of scrapie to lambs from infected mothers.

    Science.gov (United States)

    Foster, James D; Goldmann, Wilfred; Hunter, Nora

    2013-01-01

    Natural scrapie transmission from infected ewes to their lambs is thought to occur by the oral route around the time of birth. However the hypothesis that scrapie transmission can also occur before birth (in utero) is not currently favoured by most researchers. As scrapie is an opportunistic infection with multiple infection routes likely to be functional in sheep, definitive evidence for or against transmission from ewe to her developing fetus has been difficult to achieve. In addition the very early literature on maternal transmission of scrapie in sheep was compromised by lack of knowledge of the role of the PRNP (prion protein) gene in control of susceptibility to scrapie. In this study we experimentally infected pregnant ewes of known PRNP genotype with a distinctive scrapie strain (SSBP/1) and looked for evidence of transmission of SSBP/1 to the offspring. The sheep were from the NPU Cheviot flock, which has endemic natural scrapie from which SSBP/1 can be differentiated on the basis of histology, genetics of disease incidence and strain typing bioassay in mice. We used embryo transfer techniques to allow sheep fetuses of scrapie-susceptible PRNP genotypes to develop in a range of scrapie-resistant and susceptible recipient mothers and challenged the recipients with SSBP/1. Scrapie clinical disease, caused by both natural scrapie and SSBP/1, occurred in the progeny but evidence (including mouse strain typing) of SSBP/1 infection was found only in lambs born to fully susceptible recipient mothers. Progeny were not protected from transmission of natural scrapie or SSBP/1 by washing of embryos to International Embryo Transfer Society standards or by caesarean derivation and complete separation from their birth mothers. Our results strongly suggest that pre-natal (in utero) transmission of scrapie may have occurred in these sheep.

  16. Comparison of strategies for substantiating freedom from scrapie in a sheep flock

    Directory of Open Access Journals (Sweden)

    Ducrot Christian

    2009-04-01

    Full Text Available Abstract Background The public health threat represented by a potential circulation of bovine spongiform encephalopathy agent in sheep population has led European animal health authorities to launch large screening and genetic selection programmes. If demonstrated, such a circulation would have dramatic economic consequences for sheep breeding sector. In this context, it is important to evaluate the feasibility of qualification procedures that would allow sheep breeders demonstrating their flock is free from scrapie. Classical approaches, based on surveys designed to detect disease presence, do not account for scrapie specificities: the genetic variations of susceptibility and the absence of live diagnostic test routinely available. Adapting these approaches leads to a paradoxical situation in which a greater amount of testing is needed to substantiate disease freedom in genetically resistant flocks than in susceptible flocks, whereas probability of disease freedom is a priori higher in the former than in the latter. The goal of this study was to propose, evaluate and compare several qualification strategies for demonstrating a flock is free from scrapie. Results A probabilistic framework was defined that accounts for scrapie specificities and allows solving the preceding paradox. Six qualification strategies were defined that combine genotyping data, diagnostic tests results and flock pedigree. These were compared in two types of simulated flocks: resistant and susceptible flocks. Two strategies allowed demonstrating disease freedom in several years, for the majority of simulated flocks: a strategy in which all the flock animals are genotyped, and a strategy in which only founders animals are genotyped, the flock pedigree being known. In both cases, diagnostic tests are performed on culled animals. The less costly strategy varied according to the genetic context (resistant or susceptible and to the relative costs of a genotyping exam and of a

  17. Clinical, electroretinographic and histomorphometric evaluation of the retina in sheep with natural scrapie

    Directory of Open Access Journals (Sweden)

    Toutain Pierre-Louis

    2011-06-01

    Full Text Available Abstract Background The retina is part of the diencephalon in a peripheral location and may be involved in prion diseases. Retinal function and structural changes were assessed in naturally scrapie-affected red face Manech ewes presenting the classical signs of the disease, and clinically healthy age-matched subjects for controls. Ophthalmic examination was done prior to electroretinography (ERG, which was carried out under conditions that allowed photopic and scotopic activities to be assessed. Histomorphometry of the inner and outer retinal layers was performed post-mortem, and retinas were also examined for evidence of abnormal prion protein (PrPSc accumulation and glial fibrillary acidic protein (GFAP upregulation as a marker of gliosis. Scrapie status was determined by examination of brain tissue Results Ocular reflexes and ophthalmoscopy did not reveal any difference between scrapie affected and control animals. Although the light-and dark-adapted ERG responses of both rod-and cone-mediated functions had a similar waveform in scrapie-affected and control sheep, a significant reduction in the amplitude of the ERG a-and b-waves was observed in affected animals compared to controls. These functional alterations were correlated with a substantial loss of cells in the outer nuclear layer (ONL, lengthening and disorganization in photoreceptor segments, and substantial reduction in cellularity and thickness of the inner nuclear layer (INL. The degenerative changes in the INL and ONL were most marked in the central and paracentral areas of the scrapie retinas, and were accompanied in all scrapie retinas by PrPSc deposition in the ganglion cell and synaptic layers. GFAP immunoreactivity was mainly increased in the ganglion cell and inner plexiform layers. Conclusions No appreciable fundoscopic changes were observed in the scrapie-affected ewes although reproducible changes in retinal function as measured by ERG were observed in these animals. The

  18. A case-control study on scrapie in Norwegian sheep flocks.

    Science.gov (United States)

    Hopp, P; Ulvund, M J; Jarp, J

    2001-10-11

    Scrapie first was detected in indigenous sheep in Norway in 1981, and from 1995 to 1997 an increase in the number of flocks with scrapie cases was recorded. These flocks were mainly in one geographical region. A study to identify risk factors for scrapie was conducted. The study had three frequency-matched controls selected for every case within the same Veterinary District. A questionnaire was submitted to 176 sheep flocks (42 had been scrapie flocks). The data obtained by the questionnaire were linked to data collected from governmental and industry registers. After imputing missing data using single random imputation, the statistical analysis was performed using multivariable conditional logistic regression. Purchase of female sheep from scrapie flocks, sharing of rams, or sharing of pastures between different flocks were the risk factors associated with the occurrence of scrapie. Of factors potentially sustaining and promoting the infection in the flock, number of winter-fed sheep, number of buildings for housing sheep, rams and ewes shared room during mating period and increase in the flock size were associated with scrapie. We interpret these findings to show that factors involving transfer of sheep between flocks or direct contact between sheep of different flocks are important for the spread of scrapie. Management factors are important for the development of scrapie. However, it was not possible to discriminate between the different management factors in this study at the flock level. Also, factors indicating awareness and interest of the farmer (as well as willingness to contact a veterinarian for diseased sheep) were related to the detection of scrapie in the flock.

  19. Resistance to classical scrapie in experimentally challenged goats carrying mutation K222 of the prion protein gene.

    Science.gov (United States)

    Acutis, Pier Luigi; Martucci, Francesca; D'Angelo, Antonio; Peletto, Simone; Colussi, Silvia; Maurella, Cristiana; Porcario, Chiara; Iulini, Barbara; Mazza, Maria; Dell'atti, Luana; Zuccon, Fabio; Corona, Cristiano; Martinelli, Nicola; Casalone, Cristina; Caramelli, Maria; Lombardi, Guerino

    2012-02-01

    Susceptibility of sheep to scrapie, a transmissible spongiform encephalopathy of small ruminants, is strongly influenced by polymorphisms of the prion protein gene (PRNP). Breeding programs have been implemented to increase scrapie resistance in sheep populations; though desirable, a similar approach has not yet been applied in goats. European studies have now suggested that several polymorphisms can modulate scrapie susceptibility in goats: in particular, PRNP variant K222 has been associated with resistance in case-control studies in Italy, France and Greece. In this study we investigated the resistance conferred by this variant using a natural Italian goat scrapie isolate to intracerebrally challenge five goats carrying genotype Q/Q 222 (wild type) and five goats carrying genotype Q/K 222. By the end of the study, all five Q/Q 222 goats had died of scrapie after a mean incubation period of 19 months; one of the five Q/K 222 goats died after 24 months, while the other four were alive and apparently healthy up to the end of the study at 4.5 years post-challenge. All five of these animals were found to be scrapie negative. Statistical analysis showed that the probability of survival of the Q/K 222 goats versus the Q/Q 222 goats was significantly higher (p = 0.002). Our study shows that PRNP gene mutation K222 is strongly associated with resistance to classical scrapie also in experimental conditions, making it a potentially positive target for selection in the frame of breeding programs for resistance to classical scrapie in goats.

  20. Resistance to classical scrapie in experimentally challenged goats carrying mutation K222 of the prion protein gene

    Directory of Open Access Journals (Sweden)

    Acutis Pier Luigi

    2012-02-01

    Full Text Available Abstract Susceptibility of sheep to scrapie, a transmissible spongiform encephalopathy of small ruminants, is strongly influenced by polymorphisms of the prion protein gene (PRNP. Breeding programs have been implemented to increase scrapie resistance in sheep populations; though desirable, a similar approach has not yet been applied in goats. European studies have now suggested that several polymorphisms can modulate scrapie susceptibility in goats: in particular, PRNP variant K222 has been associated with resistance in case-control studies in Italy, France and Greece. In this study we investigated the resistance conferred by this variant using a natural Italian goat scrapie isolate to intracerebrally challenge five goats carrying genotype Q/Q 222 (wild type and five goats carrying genotype Q/K 222. By the end of the study, all five Q/Q 222 goats had died of scrapie after a mean incubation period of 19 months; one of the five Q/K 222 goats died after 24 months, while the other four were alive and apparently healthy up to the end of the study at 4.5 years post-challenge. All five of these animals were found to be scrapie negative. Statistical analysis showed that the probability of survival of the Q/K 222 goats versus the Q/Q 222 goats was significantly higher (p = 0.002. Our study shows that PRNP gene mutation K222 is strongly associated with resistance to classical scrapie also in experimental conditions, making it a potentially positive target for selection in the frame of breeding programs for resistance to classical scrapie in goats.

  1. Immunohistochemical distinction between preclinical bovine spongiform encephalopathy and scrapie infection in sheep.

    Science.gov (United States)

    Thuring, C M A; van Keulen, L J M; Langeveld, J P M; Vromans, M E W; van Zijderveld, F G; Sweeney, T

    2005-01-01

    Sheep are susceptible experimentally to bovine spongiform encephalopathy (BSE), the clinical signs being indistinguishable from those of scrapie. Because of the possibility of natural ovine BSE infection, laboratory tests are needed to distinguish between scrapie and BSE infection. The objectives of this study were to determine whether (1) PrPSc accumulates in biopsy samples of the tonsil or third eyelid, or both, of BSE-infected sheep before the appearance of clinical disease, and (2) such samples from BSE- and scrapie-infected sheep differ in respect of PrPSc accumulations. Homozygous ARQ sheep (n = 10) were dosed orally at 4-5 months of age with a brain homogenate from BSE-infected cattle. Third eyelid and tonsillar biopsy samples were taken at macrophages (TBMs) between BSE- and scrapie-infected sheep were detected with anti-peptide antibodies directed towards amino acids 93-106 of the ovine prion protein: thus, PrPSc appeared as single granules in TBMs of tonsillar sections from BSE-infected sheep, whereas clusters of PrPSc granules were observed within TBMs in the tonsils of scrapie-infected sheep. In contrast, antibodies against epitopes situated N- and C-terminally from the 93-106 region of the ovine prion protein revealed no differences between BSE- and scrapie-infected sheep in terms of PrPSc granules in TBMs.

  2. Immunohistochemical distinction between preclinical bovine spongiform encephalopathy and scrapie infection in sheep

    NARCIS (Netherlands)

    Thuring, C.M.A.; Keulen, van L.J.M.; Langeveld, J.P.M.; Vromans, M.E.W.; Zijderveld, van F.G.; Sweeney, T.

    2005-01-01

    Sheep are susceptible experimentally to bovine spongiform encephalopathy (BSE), the clinical signs being indistinguishable from those of scrapie. Because of the possibility of natural ovine BSE infection, laboratory tests are needed to distinguish between scrapie and BSE infection. The objectives of

  3. PrP(Sc) detection and infectivity in semen from scrapie-infected sheep.

    Science.gov (United States)

    Rubenstein, Richard; Bulgin, Marie S; Chang, Binggong; Sorensen-Melson, Sharon; Petersen, Robert B; LaFauci, Giuseppe

    2012-06-01

    A scrapie-positive ewe was found in a flock that had been scrapie-free for 13 years, but housed adjacent to scrapie-positive animals, separated by a wire fence. Live animal testing of the entire flock of 24 animals revealed seven more subclinical scrapie-positive ewes. We hypothesized that they may have contracted the disease from scrapie-positive rams used for breeding 4 months prior, possibly through the semen. The genotypes of the ewe flock were highly scrapie-susceptible and the rams were infected with the 'Caine' scrapie strain having a short incubation time of 4.3-14.6 months in sheep with 136/171 VQ/VQ and AQ/VQ genotypes. PrP(Sc) accumulates in a variety of tissues in addition to the central nervous system. Although transmission of prion diseases, or transmissible spongiform encephalopathies, has been achieved via peripheral organ or tissue homogenates as well as by blood transfusion, neither infectivity nor PrP(Sc) have been found in semen from scrapie-infected animals. Using serial protein misfolding cyclic amplification followed by a surround optical fibre immunoassay, we demonstrate that semen from rams infected with a short-incubation-time scrapie strain contains prion disease-associated-seeding activity that generated PrP(Sc) in sPMCA (serial protein misfolding cyclic amplification). Injection of the ovinized transgenic mouse line TgSShpPrP with semen from scrapie-infected sheep resulted in PrP(Sc)-seeding activity in clinical and, probably as a result of the low titre, non-clinical mouse brain. These results suggest that the transmissible agent, or at least the seeding activity, for sheep scrapie is present in semen. This may be a strain-specific phenomenon.

  4. Enhancement of immunohistochemical staining of scrapie proteins and immune cells within lymph nodes of early scrapie-infected sheep.

    Science.gov (United States)

    Furr, Annissa; Knudsen, David; Hildreth, Michael B; Young, Alan J

    2011-08-31

    Transmissible spongiform encephalopathies (TSE) are a group of fatal neurodegenerative diseases that affect animals as well as humans. The oldest of these diseases is Scrapie seen in sheep. Scrapie is caused by an altered form (PrP(sc)), capable of inducing "self-replication" of the normal host prion protein (PrP(c)). There is currently no universal standard for antigen retrieval when using immunohistochemistry to simultaneously stain the PrP(c) protein and other cellular markers. The use of formalin-fixed tissue creates a challenge by concealing the antigenic sites where an antibody would bind, and lengthy antigen retrieval methods must be applied in order to facilitate staining. Further complicating sheep tissue immunohistochemistry is a significant lack of commercial antibodies to sheep cell markers available in research. Here we developed a novel immunohistochemical technique using trypsin, formic acid, and hydrated autoclaving using citraconic anhydride buffer to increase sensitivity of staining for scrapie proteins and immune cell subsets. This allowed us to stain and identify cells within lymphoid tissue associated with early lymphoid pathogenesis in scrapie.

  5. Diagnosis and PrP genotype target of scrapie in clinically healthy sheep of Massese breed in the framework of a scrapie eradication programme.

    Science.gov (United States)

    Vascellari, M; Aufiero, G M; Nonno, R; Agrimi, U; Vaccari, G; Basilicata, L; Falcaro, C; Mancin, M; Marcon, S; Mutinelli, F

    2005-10-01

    The application of a selective culling programme in two scrapie affected flocks of Massese breed sheep is described. The genetic susceptibility of this breed and the sensitivity of different diagnostic methods in the pre-clinical diagnosis of scrapie were also investigated. Overall, 2,068 clinically healthy sheep underwent PrP genotyping, providing the basis for selective culling. The prevalence of scrapie infection was investigated in susceptible sheep by two independent diagnostic methods. All the sheep older than 18 months (n = 620) were tested by Prionics Check Western rapid test on the obex, with a prevalence of infection of 3.9%. Furthermore, 385 sheep underwent immunohistochemistry (IHC) on retropharyngeal lymph node (RPLN), with a prevalence of infection of 5.2%. Overall, 32 sheep were diagnosed with pre-clinical scrapie. Of these, 31 were positive by Western blot on the spleen, 29 by IHC on the RPLN and tonsil, 28 by IHC on the obex, 24 by rapid test, and only 18 by IHC on the third eyelid. All the scrapie positive sheep were of the ARQ/ARQ, ARQ/AHQ or ARQ/VRQ genotypes. No significant differences in scrapie prevalence were observed among these genotypes. The estimated risk of the three targeted alleles was also similar, suggesting that in this breed the VRQ allele was not at higher risk for scrapie, compared to the ARQ and AHQ alleles.

  6. The natural atypical scrapie phenotype is preserved on experimental transmission and sub-passage in PRNP homologous sheep

    Directory of Open Access Journals (Sweden)

    Bellworthy Susan J

    2010-03-01

    Full Text Available Abstract Background Atypical scrapie was first identified in Norwegian sheep in 1998 and has subsequently been identified in many countries. Retrospective studies have identified cases predating the initial identification of this form of scrapie, and epidemiological studies have indicated that it does not conform to the behaviour of an infectious disease, giving rise to the hypothesis that it represents spontaneous disease. However, atypical scrapie isolates have been shown to be infectious experimentally, through intracerebral inoculation in transgenic mice and sheep. The first successful challenge of a sheep with 'field' atypical scrapie from an homologous donor sheep was reported in 2007. Results This study demonstrates that atypical scrapie has distinct clinical, pathological and biochemical characteristics which are maintained on transmission and sub-passage, and which are distinct from other strains of transmissible spongiform encephalopathies in the same host genotype. Conclusions Atypical scrapie is consistently transmissible within AHQ homozygous sheep, and the disease phenotype is preserved on sub-passage.

  7. 76 FR 43649 - Notice of Request for Extension of Approval of an Information Collection; Scrapie in Sheep and...

    Science.gov (United States)

    2011-07-21

    ... Collection; Scrapie in Sheep and Goats; Interstate Movement Restrictions and Indemnity Program AGENCY: Animal... indemnity program to control the spread of scrapie. DATES: We will consider all comments that we receive on... regulations to control the spread of scrapie, contact Dr. Diane Sutton, Senior Staff Veterinarian,...

  8. Accumulation of Cholesterol Esters in ex vivo Lymphocytes from Scrapie-susceptible Sheep and in Scrapie-infected Mouse Neuroblastoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Alessandra Pani

    2007-01-01

    Full Text Available Our studies on the role of cholesterol homeostasis in the pathogenesis of scrapie in sheep, revealed abnormal accumulation of cholesterol esters in brains and in ex vivo skin fibroblasts from genetically scrapie-susceptible, as compared to sheep with resistant genotype. We now report that PBMCs isolated from scrapie-susceptible sheep, as well as mouse neuroblastoma cell lines persistently infected with two different mouse-adapted strains of scrapie, showed similar alterations with up to 3-fold higher cholesterol ester levels than their resistant or uninfected counterparts. Treatments with drugs that interfere with intracellular cholesterol metabolism strongly reduced accumulation of cholesterol esters in scrapie-infected cell lines, whereas had significantly lower, or no effect, in uninfected cell line. These data add support to our hypothesis that accumulation of cholesterol esters may represent a biological marker of susceptibility to prion infection and a potential molecular target for prion inhibitors.

  9. Rapid and discriminatory diagnosis of scrapie and BSE in retro-pharyngeal lymph nodes of sheep

    Directory of Open Access Journals (Sweden)

    van Zijderveld Fred G

    2006-06-01

    Full Text Available Abstract Background Diagnosis based on prion detection in lymph nodes of sheep and goats can improve active surveillance for scrapie and, if it were circulating, for bovine spongiform encephalopathy (BSE. With sizes that allow repetitive testing and a location that is easily accessible at slaughter, retropharyngeal lymph nodes (RLN are considered suitable organs for testing. Western blotting (WB of brain homogenates is, in principle, a technique well suited to both detect and discriminate between scrapie and BSE. In this report, WB is developed for rapid diagnosis in RLN and to study biochemical characteristics of PrPres. Results Optimal PrPres detection in RLN by WB was achieved by proper tissue processing, antibody choice and inclusion of a step for PrPresconcentration. The analyses were performed on three different sheep sources. Firstly, in a study with preclinical scrapie cases, WB of RLN from infected sheep of VRQ/VRQ genotype – VRQ represents, respectively, polymorphic PrP amino acids 136, 154, and 171 – allowed a diagnosis 14 mo earlier compared to WB of brain stem. Secondly, samples collected from sheep with confirmed scrapie in the course of passive and active surveillance programmes in the period 2002–2003 yielded positive results depending on genotype: all sheep with genotypes ARH/VRQ, VRQ/VRQ, and ARQ/VRQ scored positive for PrPres, but ARQ/ARQ and ARR/VRQ were not all positive. Thirdly, in an experimental BSE study, detection of PrPres in all 11 ARQ/ARQ sheep, including 7 preclinical cases, was possible. In all instances, WB and IHC were almost as sensitive. Moreover, BSE infection could be discriminated from scrapie infection by faster electrophoretic migration of the PrPres bands. Using dual antibody staining with selected monoclonal antibodies like 12B2 and L42, these differences in migration could be employed for an unequivocal differentiation between BSE and scrapie. With respect to glycosylation of PrPres, BSE cases

  10. Immunohistochemical studies of scrapie archival material from Irish ARQ/ARQ sheep for evidence of bovine spongiform encephalopathy-derived disease

    NARCIS (Netherlands)

    Sharpe, A.; McElroy, M.; Langeveld, J.P.M.; Bassett, H.; O'Donoghue, A.M.; Sweeney, T.

    2005-01-01

    Since scrapie and bovine spongiform encephalopathy (BSE) in sheep are clinicopathologically indistinguishable, BSE in sheep may have been misdiagnosed as scrapie. Disease-specific prion protein (PrPd) patterns in archival tissues of 38 Irish ARQ/ARQ sheep diagnosed as scrapie-affected were compared

  11. Factors influencing temporal variation of scrapie incidence within a closed Suffolk sheep flock.

    Science.gov (United States)

    González, Lorenzo; Dagleish, Mark P; Martin, Stuart; Finlayson, Jeanie; Sisó, Sílvia; Eaton, Samantha L; Goldmann, Wilfred; Witz, Janey; Hamilton, Scott; Stewart, Paula; Pang, Yvonne; Steele, Philip; Reid, Hugh W; Chianini, Francesca; Jeffrey, Martin

    2012-01-01

    Several studies have shown that transmission of natural scrapie can occur vertically and horizontally, and that variations in scrapie incidence between and within infected flocks are mostly due to differences in the proportion of sheep with susceptible and resistant PRNP genotypes. This report presents the results of a 12-year period of scrapie monitoring in a closed flock of Suffolk sheep, in which only animals of the ARQ/ARQ genotype developed disease. Among a total of 120 of these, scrapie attack rates varied between birth cohorts from 62.5 % (5/8) to 100 % (9/9), and the incidence of clinical disease among infected sheep from 88.9 % (8/9) to 100 % (in five birth cohorts). Susceptible sheep born to scrapie-infected ewes showed a slightly higher risk of becoming infected (97.2 %), produced earlier biopsy-positive results (mean 354 days) and developed disease at a younger age (median 736 days) than those born to non-infected dams (80.3 %, 451 and 782 days, respectively). Taken together, this was interpreted as evidence of maternal transmission. However, it was also observed that, for the birth cohorts with the highest incidence of scrapie (90-100 %), sheep born to infected and non-infected dams had a similar risk of developing scrapie (97.1 and 95.3 %, respectively). Compared with moderate-attack-rate cohorts (62.5-66.7 %), high-incidence cohorts had greater numbers of susceptible lambs born to infected ewes, suggesting that increased rates of horizontal transmission in these cohorts could have been due to high levels of environmental contamination caused by infected placentas.

  12. EFSA Panel on Biological Hazards (BIOHAZ); Scientific Opinion on the risk of transmission of classical scrapie via in vivo derived embryo transfer in ovine animals

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    impact of PrP genotype of the embryo and/or of the ram and donor ewe on this risk was also assessed. The new data made available over the last three years further reinforce the view that classical scrapie could be vertically transmitted in sheep. Since the possibility of such vertical transmission....... Under natural exposure conditions, animals that are heterozygous or homozygous A136R154R171 display respectively a low or negligible risk of being infected. The genetic control of the susceptibility to classical scrapie is also likely to impact on the risk of transmitting the disease via embryo transfer...

  13. Quantitative estimation of genetic risk for atypical scrapie in French sheep and potential consequences of the current breeding programme for resistance to scrapie on the risk of atypical scrapie

    Directory of Open Access Journals (Sweden)

    Laurent Pascal

    2010-05-01

    Full Text Available Abstract Background Since 2002, active surveillance programmes have detected numerous atypical scrapie (AS and classical scrapie cases (CS in French sheep with almost all the PrP genotypes. The aim of this study was 1 to quantify the genetic risk of AS in French sheep and to compare it with the risk of CS, 2 to quantify the risk of AS associated with the increase of the ARR allele frequency as a result of the current genetic breeding programme against CS. Methods We obtained genotypes at codons 136, 141, 154 and 171 of the PRNP gene for representative samples of 248 AS and 245 CS cases. We used a random sample of 3,317 scrapie negative animals genotyped at codons 136, 154 and 171 and we made inferences on the position 141 by multiple imputations, using external data. To estimate the risk associated with PrP genotypes, we fitted multivariate logistic regression models and we estimated the prevalence of AS for the different genotypes. Then, we used the risk of AS estimated for the ALRR-ALRR genotype to analyse the risk of detecting an AS case in a flock homogenous for this genotype. Results Genotypes most at risk for AS were those including an AFRQ or ALHQ allele while genotypes including a VLRQ allele were less commonly associated with AS. Compared to ALRQ-ALRQ, the ALRR-ALRR genotype was significantly at risk for AS and was very significantly protective for CS. The prevalence of AS among ALRR-ALRR animals was 0.6‰ and was not different from the prevalence in the general population. Conclusion In conclusion, further selection of ALRR-ALRR animals will not result in an overall increase of AS prevalence in the French sheep population although this genotype is clearly susceptible to AS. However the probability of detecting AS cases in flocks participating in genetic breeding programme against CS should be considered.

  14. Intraepithelial and interstitial deposition of pathological prion protein in kidneys of scrapie-affected sheep.

    Directory of Open Access Journals (Sweden)

    Ciriaco Ligios

    Full Text Available Prions have been documented in extra-neuronal and extra-lymphatic tissues of humans and various ruminants affected by Transmissible Spongiform Encephalopathy (TSE. The presence of prion infectivity detected in cervid and ovine blood tempted us to reason that kidney, the organ filtrating blood derived proteins, may accumulate disease associated PrP(Sc. We collected and screened kidneys of experimentally, naturally scrapie-affected and control sheep for renal deposition of PrP(Sc from distinct, geographically separated flocks. By performing Western blot, PET blot analysis and immunohistochemistry we found intraepithelial (cortex, medulla and papilla and occasional interstitial (papilla deposition of PrP(Sc in kidneys of scrapie-affected sheep. Interestingly, glomerula lacked detectable signals indicative of PrP(Sc. PrP(Sc was also detected in kidneys of subclinical sheep, but to significantly lower degree. Depending on the stage of the disease the incidence of PrP(Sc in kidney varied from approximately 27% (subclinical to 73.6% (clinical in naturally scrapie-affected sheep. Kidneys from flocks without scrapie outbreak were devoid of PrP(Sc. Here we demonstrate unexpectedly frequent deposition of high levels of PrP(Sc in ovine kidneys of various flocks. Renal deposition of PrP(Sc is likely to be a pre-requisite enabling prionuria, a possible co-factor of horizontal prion-transmission in sheep.

  15. Prion protein gene polymorphism and genetic risk evaluation for scrapie in all Turkish native sheep breeds.

    Science.gov (United States)

    Meydan, H; Yüceer, B; Degirmenci, R; Özkan, M M; Yildiz, M A

    2012-08-01

    The aim of this study was to identify the prion protein (PrP) gene polymorphism in a total of 1,110 healthy sheep from 18 Turkish native sheep breeds. There were nine alleles and 22 genotypes observed based on codons 136, 154, and 171 of the PrP gene. The ARQ allele was predominant for all breeds. The most resistant allele to scrapie, ARR, was present in all breeds. The VRQ allele, associated with the highest susceptibility to scrapie, was detected at low frequencies in İvesi (0.06), Kıvırcık (0.021), Sakız (0.010), Karayaka (0.011), Çine Çaparı (0.012), and Güneykaraman (0.017). In general, the ARQ/ARQ genotype was predominant in all breeds. The most resistant genotype to scrapie, ARR/ARR, was found with the frequency lower than 0.180. The most susceptible genotype, VRQ/VRQ, was found in only Kıvırcık. The TRR and TRH alleles and the genotypes of ARR/TRR, ARR/ARK, and ARH/TRH have been found for the first time in Turkish native sheep breeds. According to these results, all breeds belong to risk group R3 followed by R2. It is propounded that the susceptibility to scrapie increased from eastern to western part of Turkey. Our findings of Turkish native sheep breeds with PrP gene polymorphisms will assist the sheep breeding program for selection of scrapie resistance genotypes to reduce the risk of scrapie.

  16. INCREASING FOOD CHAIN SECURITY FOR SCRAPIE BY MARKER ASSISTED SELECTION IN SHEEP POPULATIONS

    Directory of Open Access Journals (Sweden)

    VIORICA COŞIER

    2013-12-01

    Full Text Available Romania, by its genetic found made up of over 7.4 millions sheep and 1.8 millionsyoung sheep exported in EU countries, represents an important mark in bothEuropean and World sheep breeding sector, in last years marked by many ESSTcenters. The apparition of this disease and its high risk of danger for reared effectiveconstraint EEC countries to interfere by law regulations concerning scrapie controland stopping disease spreading. In our country, controls identified the presence ofscrapie in livestock. The international reference laboratories post mortem certifiedthe presence of disease. Immunohistochemical detection of PrPSc is a standarddiagnostic method for sheep scrapie. By immunohistochemistry (IHC, PrPSc isdetected in lymphoid tissues during preclinical and clinical disease. Aftergenotypization at PrnP locus, the marker assisted selection is compulsory, and flocksinclude only genotypes with high disease resistance.

  17. INCREASING FOOD CHAIN SECURITY FOR SCRAPIE BY MARKER ASSISTED SELECTION IN SHEEP POPULATIONS

    Directory of Open Access Journals (Sweden)

    COŞIER VIORICA

    2007-01-01

    Full Text Available Romania, by its genetic found made up of over 7.4 millions sheep and 1.8 millionsyoung sheep exported in EU countries, represents an important mark in bothEuropean and World sheep breeding sector, in last years marked by many ESSTcenters. The apparition of this disease and its high risk of danger for reared effectiveconstraint EEC countries to interfere by law regulations concerning scrapie controland stopping disease spreading. In our country, controls identified the presence ofscrapie in livestock. The international reference laboratories post mortem certifiedthe presence of disease. Immunohistochemical detection of PrPSc is a standarddiagnostic method for sheep scrapie. By immunohistochemistry (IHC, PrPSc isdetected in lymphoid tissues during preclinical and clinical disease. Aftergenotypization at PrnP locus, the marker assisted selection is compulsory, and flocksinclude only genotypes with high disease resistance.

  18. Prenatal transmission of scrapie in sheep and goats: A case study for veterinary public health

    Directory of Open Access Journals (Sweden)

    D.B. Adams

    2016-11-01

    Full Text Available Unsettled knowledge as to whether scrapie transmits prenatally in sheep and goats and transmits by semen and preimplantation embryos has a potential to compromise measures for controlling, preventing and eliminating the disease. The remedy may be analysis according to a systematic review, allowing comprehensive and accessible treatment of evidence and reasoning, clarifying the issue and specifying the uncertainties. Systematic reviews have clearly formulated questions, can identify relevant studies and appraise their quality and can summarise evidence and reasoning with an explicit methodology. The present venture lays a foundation for a possible systematic review and applies three lines of evidence and reasoning to two questions. The first question is whether scrapie transmits prenatally in sheep and goats. It leads to the second question, which concerns the sanitary safety of artificial breeding technologies, and is whether scrapie transmits in sheep and goats by means of semen and washed or unwashed in vivo derived embryos. The three lines of evidence derive from epidemiological, field and clinical studies, experimentation, and causal reasoning, where inferences are made from the body of scientific knowledge and an understanding of animal structure and function. Evidence from epidemiological studies allow a conclusion that scrapie transmits prenatally and that semen and embryos are presumptive hazards for the transmission of scrapie. Evidence from experimentation confirms that semen and washed or unwashed in vivo derived embryos are hazards for the transmission of scrapie. Evidence from causal reasoning, including experience from other prion diseases, shows that mechanisms exist for prenatal transmission and transmission by semen and embryos in both sheep and goats.

  19. Prenatal transmission of scrapie in sheep and goats: A case study for veterinary public health

    Science.gov (United States)

    Adams, D.B.

    2016-01-01

    Unsettled knowledge as to whether scrapie transmits prenatally in sheep and goats and transmits by semen and preimplantation embryos has a potential to compromise measures for controlling, preventing and eliminating the disease. The remedy may be analysis according to a systematic review, allowing comprehensive and accessible treatment of evidence and reasoning, clarifying the issue and specifying the uncertainties. Systematic reviews have clearly formulated questions, can identify relevant studies and appraise their quality and can summarise evidence and reasoning with an explicit methodology. The present venture lays a foundation for a possible systematic review and applies three lines of evidence and reasoning to two questions. The first question is whether scrapie transmits prenatally in sheep and goats. It leads to the second question, which concerns the sanitary safety of artificial breeding technologies, and is whether scrapie transmits in sheep and goats by means of semen and washed or unwashed in vivo derived embryos. The three lines of evidence derive from epidemiological, field and clinical studies, experimentation, and causal reasoning, where inferences are made from the body of scientific knowledge and an understanding of animal structure and function. Evidence from epidemiological studies allow a conclusion that scrapie transmits prenatally and that semen and embryos are presumptive hazards for the transmission of scrapie. Evidence from experimentation confirms that semen and washed or unwashed in vivo derived embryos are hazards for the transmission of scrapie. Evidence from causal reasoning, including experience from other prion diseases, shows that mechanisms exist for prenatal transmission and transmission by semen and embryos in both sheep and goats. PMID:27928518

  20. Rapid and discriminatory diagnosis of scrapie and BSE in retro-pharyngeal lymph nodes of sheep

    NARCIS (Netherlands)

    Langeveld, J.P.M.; Jacobs, J.G.; Erkens, J.H.F.; Bossers, A.; Zijderveld, van F.G.; Keulen, van L.J.M.

    2006-01-01

    Background Diagnosis based on prion detection in lymph nodes of sheep and goats can improve active surveillance for scrapie and, if it were circulating, for bovine spongiform encephalopathy (BSE). With sizes that allow repetitive testing and a location that is easily accessible at slaughter, retroph

  1. An economic evaluation of preclinical testing strategies compared to the compulsory scrapie flock scheme in the control of classical scrapie.

    Science.gov (United States)

    Boden, Lisa; Handel, Ian; Hawkins, Neil; Houston, Fiona; Fryer, Helen; Kao, Rowland

    2012-01-01

    Cost-benefit is rarely combined with nonlinear dynamic models when evaluating control options for infectious diseases. The current strategy for scrapie in Great Britain requires that all genetically susceptible livestock in affected flocks be culled (Compulsory Scrapie Flock Scheme or CSFS). However, this results in the removal of many healthy sheep, and a recently developed pre-clinical test for scrapie now offers a strategy based on disease detection. We explore the flock level cost-effectiveness of scrapie control using a deterministic transmission model and industry estimates of costs associated with genotype testing, pre-clinical tests and the value of a sheep culled. Benefit was measured in terms of the reduction in the number of infected sheep sold on, compared to a baseline strategy of doing nothing, using Incremental Cost Effectiveness analysis to compare across strategies. As market data was not available for pre-clinical testing, a threshold analysis was used to set a unit-cost giving equal costs for CSFS and multiple pre-clinical testing (MT, one test each year for three consecutive years). Assuming a 40% within-flock proportion of susceptible genotypes and a test sensitivity of 90%, a single test (ST) was cheaper but less effective than either the CSFS or MT strategies (30 infected-sales-averted over the lifetime of the average epidemic). The MT strategy was slightly less effective than the CSFS and would be a dominated strategy unless preclinical testing was cheaper than the threshold price of £6.28, but may be appropriate for flocks with particularly valuable livestock. Though the ST is not currently recommended, the proportion of susceptible genotypes in the national flock is likely to continue to decrease; this may eventually make it a cost-effective alternative to the MT or CSFS.

  2. An economic evaluation of preclinical testing strategies compared to the compulsory scrapie flock scheme in the control of classical scrapie.

    Directory of Open Access Journals (Sweden)

    Lisa Boden

    Full Text Available Cost-benefit is rarely combined with nonlinear dynamic models when evaluating control options for infectious diseases. The current strategy for scrapie in Great Britain requires that all genetically susceptible livestock in affected flocks be culled (Compulsory Scrapie Flock Scheme or CSFS. However, this results in the removal of many healthy sheep, and a recently developed pre-clinical test for scrapie now offers a strategy based on disease detection. We explore the flock level cost-effectiveness of scrapie control using a deterministic transmission model and industry estimates of costs associated with genotype testing, pre-clinical tests and the value of a sheep culled. Benefit was measured in terms of the reduction in the number of infected sheep sold on, compared to a baseline strategy of doing nothing, using Incremental Cost Effectiveness analysis to compare across strategies. As market data was not available for pre-clinical testing, a threshold analysis was used to set a unit-cost giving equal costs for CSFS and multiple pre-clinical testing (MT, one test each year for three consecutive years. Assuming a 40% within-flock proportion of susceptible genotypes and a test sensitivity of 90%, a single test (ST was cheaper but less effective than either the CSFS or MT strategies (30 infected-sales-averted over the lifetime of the average epidemic. The MT strategy was slightly less effective than the CSFS and would be a dominated strategy unless preclinical testing was cheaper than the threshold price of £6.28, but may be appropriate for flocks with particularly valuable livestock. Though the ST is not currently recommended, the proportion of susceptible genotypes in the national flock is likely to continue to decrease; this may eventually make it a cost-effective alternative to the MT or CSFS.

  3. The oral secretion of infectious scrapie prions occurs in preclinical sheep with a range of PRNP genotypes.

    Science.gov (United States)

    Gough, Kevin C; Baker, Claire A; Rees, Helen C; Terry, Linda A; Spiropoulos, John; Thorne, Leigh; Maddison, Ben C

    2012-01-01

    Preclinical sheep with the highly scrapie-susceptible VRQ/VRQ PRNP genotype secrete prions from the oral cavity. In order to further understand the significance of orally available prions, buccal swabs were taken from sheep with a range of PRNP genotypes and analyzed by serial protein misfolding cyclic amplification (sPMCA). Prions were detected in buccal swabs from scrapie-exposed sheep of genotypes linked to high (VRQ/VRQ and ARQ/VRQ) and low (ARR/VRQ and AHQ/VRQ) lymphoreticular system involvement in scrapie pathogenesis. For both groups, the level of prion detection was significantly higher than that for scrapie-resistant ARR/ARR sheep which were kept in the same farm environment and acted as sentinel controls for prions derived from the environment which might contaminate the oral cavity. In addition, sheep with no exposure to the scrapie agent did not contain any measurable prions within the oral cavity. Furthermore, prions were detected in sheep over a wide age range representing various stages of preclinical disease. These data demonstrate that orally available scrapie prions may be a common feature in sheep incubating scrapie, regardless of the PRNP genotype and any associated high-level accumulation of PrP(Sc) within lymphoreticular tissues. PrP(Sc) was present in buccal swabs from a large proportion of sheep with PRNP genotypes associated with relatively low disease penetrance, indicating that subclinical scrapie infection is likely to be a common occurrence. The significance of positive sPMCA reactions was confirmed by the transmission of infectivity in buccal swab extracts to Tg338 mice, illustrating the likely importance of orally available prions in the horizontal transmission of scrapie.

  4. Evaluation of two commercial, rapid, ELISA kits testing or scrapie in retro-pharyngeal lymph nodes in sheep

    NARCIS (Netherlands)

    Kittelberger, R.; McIntuyre, L.; Watts, S.; MacDiarmid, S.; Hannah, M.J.; Jenner, J.; Bueno, R.; Swainsbury, R.; Langeveld, J.P.M.; Keulen, van L.J.M.; Zijderveld, van F.G.; Wemheuer, W.M.; Richt, J.A.; Sorenson, S.J.; Pigott, C.J.; O'Keefe, J.S.

    2014-01-01

    AIMS: To estimate the number of cases of scrapie that would occur in sheep of different prion protein (PrP) genotypes if scrapie was to become established in New Zealand, and to compare the performance of two commercially available, rapid ELISA kits using ovine retro-pharyngeal lymph nodes (RLN) fro

  5. Scrapie prevalence in sheep of susceptible genotype is declining in a population subject to breeding for resistance

    NARCIS (Netherlands)

    Hagenaars, T.H.J.; Melchior, M.B.; Bossers, A.; Davidse, A.; Engel, B.; Zijderveld, van F.G.

    2010-01-01

    Background - Susceptibility of sheep to scrapie infection is known to be modulated by the PrP genotype of the animal. In the Netherlands an ambitious scrapie control programme was started in 1998, based on genetic selection of animals for breeding. From 2002 onwards EU regulations required intensive

  6. Scrapie diagnosis in a goat and four Santa Inês sheep from the same herd in Brazil

    Directory of Open Access Journals (Sweden)

    J.S. Leal

    2015-12-01

    Full Text Available Scrapie is a fatal and progressive transmissible spongiform encephalopathy (TSE of natural occurrence in sheep and goats. The suspicion of scrapie may be based on clinical signs; however, the detection of pathological features of the prionic protein (PrP in target tissues is necessary to diagnose the disease. The presence of an abnormal protein form (PrPSc in lymphoreticular and nervous tissues is an important characteristic in diagnosis. This paper reports a case of scrapie in a flock of 55 Suffolk crossbred sheep, 19 Santa Inês sheep and 21 goats in the Mato Grosso state, midwestern Brazil. The animals were euthanized after the confirmation of a scrapie case with clinical signs in a Suffolk sheep in the same farm. Samples of brainstem at the level of the obex and lymphoid issues like palatine tonsils, mesenteric lymph nodes, third eyelid fixed in formalin 10% were processed for histological examination. Histological examination with hematoxylin and eosin did not show any microscopic changes in samples. Immunohistochemistry (IHC examination to detect anti-prion PrPSc was performed in lymphoid tissues. Scrapie diagnosis was confirmed based on IHC positive results for PrPSc in lymphoid tissues of a crossbreed goat and four Santa Inês sheep, without any clinical scrapie signs. IHC showed positive staining in at least three lymphoid germinal centers in goat mesenteric lymph node, palatine tonsil, and third eyelid samples. The mesenteric lymph node, and tonsil samples of all sheep showed positive immunostaining, and only one sheep showed positive staining in lymphoid follicles in the third eyelid. Scrapie diagnosis using IHC in fixed samples of lymphoreticular tissue is technically feasible to detect the disease in both goats and sheep, as a form of pre-clinical diagnosis. The results indicate that the herd was infected by a sheep coming from another herd where scrapie had been diagnosed before.

  7. Characterization of mesenchymal stem cells in sheep naturally infected with scrapie.

    Science.gov (United States)

    Mediano, Diego R; Sanz-Rubio, David; Bolea, Rosa; Belén, Marín; Vázquez, Francisco J; Remacha, Ana R; López-Pérez, Oscar; Fernández-Borges, Natalia; Castilla, Joaquin; Zaragoza, Pilar

    2015-12-01

    Mesenchymal stem cells (MSCs) can be infected with prions and have been proposed as in vitro cell-based models for prion replication. In addition, autologous MSCs are of interest for cell therapy in neurodegenerative diseases. To the best of our knowledge, the effect of prion diseases on the characteristics of these cells has never been investigated. Here, we analysed the properties of MSCs obtained from bone marrow (BM-MSCs) and peripheral blood (PB-MSCs) of sheep naturally infected with scrapie — a large mammal model for the study of prion diseases. After three passages of expansion, MSCs derived from scrapie animals displayed similar adipogenic, chondrogenic and osteogenic differentiation ability as cells from healthy controls, although a subtle decrease in the proliferation potential was observed. Exceptionally, mesenchymal markers such as CD29 were significantly upregulated at the transcript level compared with controls. Scrapie MSCs were able to transdifferentiate into neuron-like cells, but displayed lower levels of neurogenic markers at basal conditions, which could limit this potential .The expression levels of cellular prion protein (PrPC) were highly variable between cultures, and no significant differences were observed between control and scrapie-derived MSCs. However, during neurogenic differentiation the expression of PrPC was upregulated in MSCs. This characteristic could be useful for developing in vitro models for prion replication. Despite the infectivity reported for MSCs obtained from scrapie-infected mice and Creutzfeldt–Jakob disease patients, protein misfolding cyclic amplification did not detect PrPSc in BM- or PB-MSCs from scrapie-infected sheep, which limits their use for in vivo diagnosis for scrapie.

  8. Sensitive and specific detection of classical scrapie prions in the brains of goats by real-time quaking-induced conversion.

    Science.gov (United States)

    Dassanayake, Rohana P; Orrú, Christina D; Hughson, Andrew G; Caughey, Byron; Graça, Telmo; Zhuang, Dongyue; Madsen-Bouterse, Sally A; Knowles, Donald P; Schneider, David A

    2016-03-01

    Real-time quaking-induced conversion (RT-QuIC) is a rapid, specific and highly sensitive prion seeding activity detection assay that uses recombinant prion protein (rPrPSen) to detect subinfectious levels of the abnormal isoforms of the prion protein (PrPSc). Although RT-QuIC has been successfully used to detect PrPSc in various tissues from humans and animals, including sheep, tissues from goats infected with classical scrapie have not yet been tested. Therefore, the aims of the present study were to (1) evaluate whether prion seeding activity could be detected in the brain tissues of goats with scrapie using RT-QuIC, (2) optimize reaction conditions to improve scrapie detection in goats, and (3) compare the performance of RT-QuIC for the detection of PrPSc with the more commonly used ELISA and Western blot assays. We further optimized RT-QuIC conditions for sensitive and specific detection of goat scrapie seeding activity in brain tissue from clinical animals. When used with 200  mM sodium chloride, both full-length sheep rPrPSen substrates (PrP genotypes A136R154Q171 and V136R154Q171) provided good discrimination between scrapie-infected and normal goat brain samples at 10(- )3 dilution within 15  h. Our findings indicate that RT-QuIC was at least 10,000-fold more sensitive than ELISA and Western blot assays for the detection of scrapie seeding activity in goat brain samples. In addition to PRNP WT samples, positive RT-QuIC reactions were also observed with three PRNP polymorphic goat brain samples (G/S127, I/M142 and H/R143) tested. Taken together, these findings demonstrate that RT-QuIC sensitively detects prion seeding activity in classical scrapie-infected goat brain samples.

  9. Discrimination between scrapie and bovine spongiform encephalopathy in sheep by molecular size, immunoreactivity, and glycoprofile of prion protein

    NARCIS (Netherlands)

    Thuring, C.M.A.; Erkens, J.H.F.; Jacobs, J.G.; Bossers, A.; Keulen, van L.J.M.; Garssen, G.J.; Zijderveld, van F.G.; Ryder, S.J.; Groschup, M.H.; Sweeney, T.; Langeveld, J.P.M.

    2004-01-01

    A procedure for discrimination between scrapie and bovine spongiform encephalopathy (BSE) in sheep is of importance for establishing whether BSE has entered the sheep population. Since BSE has not yet been found in sheep at the farm level, such discrimination procedures can be developed only with ex

  10. Histopathological studies of "CH1641-like" scrapie sources versus classical scrapie and BSE transmitted to ovine transgenic mice (TgOvPrP4.

    Directory of Open Access Journals (Sweden)

    Anna Bencsik

    Full Text Available The possibility of the agent causing bovine spongiform encephalopathy (BSE infecting small ruminants is of serious concern for human health. Among scrapie cases, the CH1641 source in particular appears to have certain biochemical properties similar to the BSE strain. In France, several natural scrapie cases were identified as "CH1641-like" natural scrapie isolates in sheep and goats. The Tg(OvPrP4 mouse line expressing the ovine prion protein is a sensitive model for studying and identifying strains of agents responsible for scrapie and BSE. This model is also very useful when studying specific scrapie source CH1641, known to be not transmissible to wild-type mice despite the similarity of some of its biochemical properties to those of the BSE strain. As it is important to be able to fully distinguish CH1641 from BSE, we herein report the histopathological data from CH1641 scrapie transmission experiments compared to specific cases of "CH1641-like" natural scrapie isolates in sheep, murine scrapie strains and BSE. In addition to the conventional vacuolar lesion profile approach and PrP(d brain mappings, an innovative differential PET-blot analysis was introduced to classify the different strains of agent and revealed the first direct concordance between ways of grouping strains on the basis of PrP(d biochemical characteristics.

  11. Histopathological studies of "CH1641-like" scrapie sources versus classical scrapie and BSE transmitted to ovine transgenic mice (TgOvPrP4).

    Science.gov (United States)

    Bencsik, Anna; Baron, Thierry

    2011-01-01

    The possibility of the agent causing bovine spongiform encephalopathy (BSE) infecting small ruminants is of serious concern for human health. Among scrapie cases, the CH1641 source in particular appears to have certain biochemical properties similar to the BSE strain. In France, several natural scrapie cases were identified as "CH1641-like" natural scrapie isolates in sheep and goats. The Tg(OvPrP4) mouse line expressing the ovine prion protein is a sensitive model for studying and identifying strains of agents responsible for scrapie and BSE. This model is also very useful when studying specific scrapie source CH1641, known to be not transmissible to wild-type mice despite the similarity of some of its biochemical properties to those of the BSE strain. As it is important to be able to fully distinguish CH1641 from BSE, we herein report the histopathological data from CH1641 scrapie transmission experiments compared to specific cases of "CH1641-like" natural scrapie isolates in sheep, murine scrapie strains and BSE. In addition to the conventional vacuolar lesion profile approach and PrP(d) brain mappings, an innovative differential PET-blot analysis was introduced to classify the different strains of agent and revealed the first direct concordance between ways of grouping strains on the basis of PrP(d) biochemical characteristics.

  12. White-tailed deer are susceptible to the agent of sheep scrapie by intracerebral inoculation.

    Science.gov (United States)

    Greenlee, Justin J; Smith, Jodi D; Kunkle, Robert A

    2011-10-11

    Interspecies transmission studies afford the opportunity to better understand the potential host range and origins of prion diseases. The purpose of this experiment was to determine susceptibility of white-tailed deer to the agent of scrapie after intracerebral inoculation and to compare clinical signs and lesions to those reported for chronic wasting disease (CWD). Deer (n = 5) were inoculated with 1 mL of a 10% (wt/vol) brain homogenate derived from a sheep clinically affected with scrapie. A non-inoculated deer was maintained as a negative control. Deer were observed daily for clinical signs of disease and euthanized and necropsied when unequivocal signs of scrapie were noted. One animal died 7 months post inoculation (pi) due to intercurrent disease. Examinations of brain tissue for the presence of the disease-associated abnormal prion protein (PrP(Sc)) by western blot (WB) and immunohistochemistry (IHC) were negative whereas IHC of lymphoid tissues was positive. Deer necropsied at 15-22 months pi were positive for scrapie by IHC and WB. Deer necropsied after 20 months pi had clinical signs of depression and progressive weight loss. Tissues with PrP(Sc) immunoreactivity included brain (at levels of cerebrum, hippocampus, colliculus, cerebellum, and brainstem), trigeminal ganglion, neurohypophysis, retina, spinal cord, and various lymphoid tissues including tonsil, retropharyngeal and mesenteric lymph nodes, Peyer's patches, and spleen. This work demonstrates for the first time that white-tailed deer are susceptible to sheep scrapie by intracerebral inoculation. To further test the susceptibility of white-tailed deer to scrapie these experiments will be repeated with a more natural route of inoculation.

  13. A Case–Control Study on the Origin of Atypical Scrapie in Sheep, France

    Science.gov (United States)

    Morignat, Eric; Ducrot, Christian; Calavas, Didier

    2009-01-01

    A matched case–control study (95 cases and 220 controls) was designed to study risk factors for atypical scrapie in sheep in France. We analyzed contacts with animals from other flocks, lambing and feeding practices, and exposure to toxic substances. Data on the prnp genotype were collected for some case and control animals and included in a complementary analysis. Sheep dairy farms had a higher risk for scrapie (odds ratio [OR] 15.1, 95% confidence interval [CI] 3.3–69.7). Lower risk was associated with organic farms (OR 0.15, 95% CI 0.02–1.26), feeding corn silage (OR 0.16, 95% CI 0.05–0.53), and feeding vitamin and mineral supplements (OR 0.6, 95% CI 0.32–1.14). Genetic effects were quantitatively important but only marginally changed estimates of other variables. We did not find any risk factor associated with an infectious origin of scrapie. Atypical scrapie could be a spontaneous disease influenced by genetic and metabolic factors. PMID:19402956

  14. Classical natural ovine scrapie prions are detected in practical volumes of blood by lamb and transgenic mouse bioassay

    Science.gov (United States)

    In vitro ligand-based immunoassay studies revealed abnormal isoforms of prion protein (PrP-Sc) are primarily associated with B lymphocytes of scrapie-infected sheep. Our recent study also demonstrated efficient transmission of scrapie to lambs following a transfusion of B lymphocytes isolated from 5...

  15. Stability of murine scrapie strain 87V after passage in sheep and comparison with the CH1641 ovine strain.

    Science.gov (United States)

    González, Lorenzo; Chianini, Francesca; Hunter, Nora; Hamilton, Scott; Gibbard, Louise; Martin, Stuart; Dagleish, Mark P; Sisó, Sílvia; Eaton, Samantha L; Chong, Angela; Algar, Lynne; Jeffrey, Martin

    2015-12-01

    Breed- and prion protein (PRNP) genotype-related disease phenotype variability has been observed in sheep infected with the 87V murine scrapie strain. Therefore, the stability of this strain was tested by inoculating sheep-derived 87V brain material back into VM mice. As some sheep-adapted 87V disease phenotypes were reminiscent of CH1641 scrapie, transgenic mice (Tg338) expressing ovine prion protein (PrP) were inoculated with the same sheep-derived 87V sources and with CH1641. Although at first passage in VM mice the sheep-derived 87V sources showed some divergence from the murine 87V control, all the characteristics of murine 87V infection were recovered at second passage from all sheep sources. These included 100 % attack rates and indistinguishable survival times, lesion profiles, immunohistochemical features of disease-associated PrP accumulation in the brain and PrP biochemical properties. All sheep-derived 87V sources, as well as CH1641, were transmitted to Tg338 mice with identical clinical, pathological, immunohistochemical and biochemical features. While this might potentially indicate that sheep-adapted 87V and CH1641 are the same strain, profound divergences were evident, as murine 87V was unable to infect Tg338 mice but was lethal for VM mice, while the reverse was true for CH1641. These combined data suggest that: (i) murine 87V is stable and retains its properties after passage in sheep; (ii) it can be isolated from sheep showing a CH1641-like or a more conventional scrapie phenotype; and (iii) sheep-adapted 87V scrapie, with conventional or CH1641-like phenotype, is biologically distinct from experimental CH1641 scrapie, despite the fact that they behave identically in a single transgenic mouse line.

  16. Distribution of Peripheral PrPSc in Sheep with Naturally Acquired Scrapie

    Science.gov (United States)

    Garza, María Carmen; Monzón, Marta; Marín, Belén; Badiola, Juan José; Monleón, Eva

    2014-01-01

    Accumulation of prion protein (PrPSc) in the central nervous system is the hallmark of transmissible spongiform encephalopathies. However, in some of these diseases such as scrapie or chronic wasting disease, the PrPSc can also accumulate in other tissues, particularly in the lymphoreticular system. In recent years, PrPSc in organs other than nervous and lymphoid have been described, suggesting that distribution of this protein in affected individuals may be much larger than previously thought. In the present study, 11 non-nervous/non-lymphoid organs from 16 naturally scrapie infected sheep in advanced stages of the disease were examined for the presence of PrPSc. Fourteen infected sheep were of the ARQ/ARQ PRNP genotype and 2 of the VRQ/VRQ, where the letters A, R, Q, and V represent the codes for amino-acids alanine, arginine, glutamine and valine, respectively. Adrenal gland, pancreas, heart, skin, urinary bladder and mammary gland were positive for PrPSc by immunohistochemistry and IDEXX HerdChek scrapie/BSE Antigen EIA Test in at least one animal. Lung, liver, kidney and skeletal muscle exhibited PrPSc deposits by immunohistochemistry only. To our knowledge, this is the first report regarding the presence of PrPSc in the heart, pancreas and urinary bladder in naturally acquired scrapie infections. In some other organs examined, in which PrPSc had been previously detected, PrPSc immunolabeling was observed to be associated with new structures within those organs. The results of the present study illustrate a wide dissemination of PrPSc in both ARQ/ARQ and VRQ/VRQ infected sheep, even when the involvement of the lymphoreticular system is scarce or absent, thus highlighting the role of the peripheral nervous system in the spread of PrPSc. PMID:24828439

  17. Distribution of peripheral PrP(Sc in sheep with naturally acquired scrapie.

    Directory of Open Access Journals (Sweden)

    María Carmen Garza

    Full Text Available Accumulation of prion protein (PrPSc in the central nervous system is the hallmark of transmissible spongiform encephalopathies. However, in some of these diseases such as scrapie or chronic wasting disease, the PrPSc can also accumulate in other tissues, particularly in the lymphoreticular system. In recent years, PrPSc in organs other than nervous and lymphoid have been described, suggesting that distribution of this protein in affected individuals may be much larger than previously thought. In the present study, 11 non-nervous/non-lymphoid organs from 16 naturally scrapie infected sheep in advanced stages of the disease were examined for the presence of PrPSc. Fourteen infected sheep were of the ARQ/ARQ PRNP genotype and 2 of the VRQ/VRQ, where the letters A, R, Q, and V represent the codes for amino-acids alanine, arginine, glutamine and valine, respectively. Adrenal gland, pancreas, heart, skin, urinary bladder and mammary gland were positive for PrPSc by immunohistochemistry and IDEXX HerdChek scrapie/BSE Antigen EIA Test in at least one animal. Lung, liver, kidney and skeletal muscle exhibited PrPSc deposits by immunohistochemistry only. To our knowledge, this is the first report regarding the presence of PrPSc in the heart, pancreas and urinary bladder in naturally acquired scrapie infections. In some other organs examined, in which PrPSc had been previously detected, PrPSc immunolabeling was observed to be associated with new structures within those organs. The results of the present study illustrate a wide dissemination of PrPSc in both ARQ/ARQ and VRQ/VRQ infected sheep, even when the involvement of the lymphoreticular system is scarce or absent, thus highlighting the role of the peripheral nervous system in the spread of PrPSc.

  18. Differential gene expression and apoptosis markers in presymptomatic scrapie affected sheep.

    Science.gov (United States)

    Hedman, Carlos; Lyahyai, Jaber; Filali, Hicham; Marín, Belén; Serrano, Carmen; Monleón, Eva; Moreno, Bernardino; Zaragoza, Pilar; Badiola, Juan José; Martín-Burriel, Inmaculada; Bolea, Rosa

    2012-09-14

    Neuronal loss is one of the characteristics of scrapie neuropathology. Previous analysis of brains from sheep naturally infected with scrapie that were in a terminal stage did not detect a clear induction of apoptosis, although molecular changes were evidenced. As neuronal death could be occurring early in scrapie, we developed a neuropathological and gene expression study of sheep infected with scrapie in a presymptomatic stage. The histopathology, immunolabelling of PrP(Sc), Bax and activated caspase-3, and the analysis of the expression of 7 genes involved in the regulation of the mitochondrial pathway of apoptosis were investigated in the following 4 central nervous system areas: medulla oblongata, diencephalon, frontal cortex and cerebellum. Moreover, TUNEL and NeuN immunolabelling was performed in the medulla oblongata. The PrP(Sc) immunolabelling in the four areas, as well as a neuropil spongiform change, were more evident in the terminal stage than in presymptomatic animals. Cytoplasmic Bax immunostaining was observed in the presymptomatic medulla oblongata. In contrast to symptomatic animals, the immunostaining was not extended to the hypothalamus, indicating the progression of Bax induction during the course of the disease. Although neither caspase-3 immunostaining nor the TUNEL technique detected neurons with apoptosis, NeuN-immunolabelled cell counting determined that presymptomatic animals have already suffered neuronal loss in a lower or equal degree than symptomatic animals. Finally, the gene expression profiles indicated that the mitochondrial pathway of apoptosis was activated with higher intensity in presymptomatic animals than in symptomatic sheep and confirmed the implication of genes such as BAX or AIF in the disease.

  19. Distribution of peripheral PrP(Sc) in sheep with naturally acquired scrapie.

    Science.gov (United States)

    Garza, María Carmen; Monzón, Marta; Marín, Belén; Badiola, Juan José; Monleón, Eva

    2014-01-01

    Accumulation of prion protein (PrPSc) in the central nervous system is the hallmark of transmissible spongiform encephalopathies. However, in some of these diseases such as scrapie or chronic wasting disease, the PrPSc can also accumulate in other tissues, particularly in the lymphoreticular system. In recent years, PrPSc in organs other than nervous and lymphoid have been described, suggesting that distribution of this protein in affected individuals may be much larger than previously thought. In the present study, 11 non-nervous/non-lymphoid organs from 16 naturally scrapie infected sheep in advanced stages of the disease were examined for the presence of PrPSc. Fourteen infected sheep were of the ARQ/ARQ PRNP genotype and 2 of the VRQ/VRQ, where the letters A, R, Q, and V represent the codes for amino-acids alanine, arginine, glutamine and valine, respectively. Adrenal gland, pancreas, heart, skin, urinary bladder and mammary gland were positive for PrPSc by immunohistochemistry and IDEXX HerdChek scrapie/BSE Antigen EIA Test in at least one animal. Lung, liver, kidney and skeletal muscle exhibited PrPSc deposits by immunohistochemistry only. To our knowledge, this is the first report regarding the presence of PrPSc in the heart, pancreas and urinary bladder in naturally acquired scrapie infections. In some other organs examined, in which PrPSc had been previously detected, PrPSc immunolabeling was observed to be associated with new structures within those organs. The results of the present study illustrate a wide dissemination of PrPSc in both ARQ/ARQ and VRQ/VRQ infected sheep, even when the involvement of the lymphoreticular system is scarce or absent, thus highlighting the role of the peripheral nervous system in the spread of PrPSc.

  20. Detection of PrPres in Genetically Susceptible Fetuses from Sheep with Natural Scrapie

    Science.gov (United States)

    Garza, María Carmen; Fernández-Borges, Natalia; Bolea, Rosa; Badiola, Juan José; Castilla, Joaquín; Monleón, Eva

    2011-01-01

    Scrapie is a transmissible spongiform encephalopathy with a wide PrPres dissemination in many non-neural tissues and with high levels of transmissibility within susceptible populations. Mechanisms of transmission are incompletely understood. It is generally assumed that it is horizontally transmitted by direct contact between animals or indirectly through the environment, where scrapie can remain infectious for years. In contrast, in utero vertical transmission has never been demonstrated and has rarely been studied. Recently, the use of the protein misfolding cyclic amplification technique (PMCA) has allowed prion detection in various tissues and excretions in which PrPres levels have been undetectable by traditional assays. The main goal of this study was to detect PrPres in fetal tissues and the amniotic fluid from natural scrapie infected ewes using the PMCA technique. Six fetuses from three infected pregnant ewes in an advanced clinical stage of the disease were included in the study. From each fetus, amniotic fluid, brain, spleen, ileo-cecal valve and retropharyngeal lymph node samples were collected and analyzed using Western blotting and PMCA. Although all samples were negative using Western blotting, PrPres was detected after in vitro amplification. Our results represent the first time the biochemical detection of prions in fetal tissues, suggesting that the in utero transmission of scrapie in natural infected sheep might be possible. PMID:22194786

  1. Detection of PrPres in genetically susceptible fetuses from sheep with natural scrapie.

    Directory of Open Access Journals (Sweden)

    María Carmen Garza

    Full Text Available Scrapie is a transmissible spongiform encephalopathy with a wide PrPres dissemination in many non-neural tissues and with high levels of transmissibility within susceptible populations. Mechanisms of transmission are incompletely understood. It is generally assumed that it is horizontally transmitted by direct contact between animals or indirectly through the environment, where scrapie can remain infectious for years. In contrast, in utero vertical transmission has never been demonstrated and has rarely been studied. Recently, the use of the protein misfolding cyclic amplification technique (PMCA has allowed prion detection in various tissues and excretions in which PrPres levels have been undetectable by traditional assays. The main goal of this study was to detect PrPres in fetal tissues and the amniotic fluid from natural scrapie infected ewes using the PMCA technique. Six fetuses from three infected pregnant ewes in an advanced clinical stage of the disease were included in the study. From each fetus, amniotic fluid, brain, spleen, ileo-cecal valve and retropharyngeal lymph node samples were collected and analyzed using Western blotting and PMCA. Although all samples were negative using Western blotting, PrPres was detected after in vitro amplification. Our results represent the first time the biochemical detection of prions in fetal tissues, suggesting that the in utero transmission of scrapie in natural infected sheep might be possible.

  2. The interpretation of disease phenotypes to identify TSE strains following murine bioassay: characterisation of classical scrapie.

    Science.gov (United States)

    Beck, Katy E; Vickery, Christopher M; Lockey, Richard; Holder, Thomas; Thorne, Leigh; Terry, Linda A; Denyer, Margaret; Webb, Paul; Simmons, Marion M; Spiropoulos, John

    2012-11-01

    Mouse bioassay can be readily employed for strain typing of naturally occurring transmissible spongiform encephalopathy cases. Classical scrapie strains have been characterised historically based on the established methodology of assessing incubation period of disease and the distribution of disease-specific vacuolation across the brain following strain stabilisation in a given mouse line. More recent research has shown that additional methods could be used to characterise strains and thereby expand the definition of strain "phenotype". Here we present the phenotypic characteristics of classical scrapie strains isolated from 24 UK ovine field cases through the wild-type mouse bioassay. PrPSc immunohistochemistry (IHC), paraffin embedded tissue blots (PET-blot) and Western blotting approaches were used to determine the neuroanatomical distribution and molecular profile of PrPSc associated with each strain, in conjunction with traditional methodologies. Results revealed three strains isolated through each mouse line, including a previously unidentified strain. Moreover IHC and PET-blot methodologies were effective in characterising the strain-associated types and neuroanatomical locations of PrPSc. The use of Western blotting as a parameter to define classical scrapie strains was limited. These data provide a comprehensive description of classical scrapie strain phenotypes on isolation through the mouse bioassay that can provide a reference for further scrapie strain identification.

  3. Transcriptional profiling of peripheral lymphoid tissue reveals genes and networks linked to SSBP/1 scrapie pathology in sheep.

    Science.gov (United States)

    Gossner, Anton; Roupaka, Sofia; Foster, Jim; Hunter, Nora; Hopkins, John

    2011-12-15

    Transmissible spongiform encephalopathies (TSEs) are slow and progressive neurodegenerative diseases of humans and animals. The major target organ for all TSEs is the brain but some TSE agents are associated with prior accumulation within the peripheral lymphoid system. Many studies have examined the effects of scrapie infection on the expression of central nervous system (CNS) genes, but this study examines the progression of scrapie pathology in the peripheral lymphoid system and how scrapie infection affects the transcriptome of the lymph nodes and spleen. Infection of sheep with SSBP/1 scrapie resulted in PrP(Sc) deposition in the draining prescapular lymph node (PSLN) by 25 days post infection (dpi) in VRQ/VRQ genotype sheep and 75 dpi in tonsils and spleen. Progression of PrP(Sc) deposition in VRQ/ARR animals was 25 dpi later in the PSLN and 250 dpi later in spleen. Microarray analysis of 75 dpi tissues from VRQ/VRQ sheep identified 52 genes in PSLN and 37 genes in spleen cells that showed significant difference (P ≤ 0.05) between scrapie-infected and mock-infected animals. Transcriptional pathway analysis highlighted immunological disease, cell death and neurological disease as the biological pathways associated with scrapie pathogenesis in the peripheral lymphoid system. PrP(Sc) accumulation of lymphoid tissue resulted in the repression of genes linked to inflammation and oxidative stress, and the up-regulation of genes related to apoptosis.

  4. 78 FR 25943 - Changes to Scrapie Flock Certification Program

    Science.gov (United States)

    2013-05-03

    ... Animal and Plant Health Inspection Service Changes to Scrapie Flock Certification Program AGENCY: Animal... giving notice of changes to the Scrapie Flock Certification Program (SFCP), a voluntary program for sheep and goat flock owners who wish to reduce and/or eliminate the risk of introducing classical...

  5. A bovine cell line that can be infected by natural sheep scrapie prions.

    Science.gov (United States)

    Oelschlegel, Anja M; Geissen, Markus; Lenk, Matthias; Riebe, Roland; Angermann, Marlies; Schatzl, Herman; Schaetzl, Hermann; Groschup, Martin H

    2015-01-01

    Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice). We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.

  6. A bovine cell line that can be infected by natural sheep scrapie prions.

    Directory of Open Access Journals (Sweden)

    Anja M Oelschlegel

    Full Text Available Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice. We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.

  7. Comparative Susceptibility of Sheep of Different Origins, Breeds and PRNP Genotypes to Challenge with Bovine Spongiform Encephalopathy and Scrapie.

    Directory of Open Access Journals (Sweden)

    Fiona Houston

    Full Text Available Sheep are natural hosts of the prion disease, scrapie. They are also susceptible to experimental challenge with various scrapie strains and with bovine spongiform encephalopathy (BSE, which affects cattle and has been accidentally transmitted to a range of other species, including man. Incidence and incubation period of clinical disease in sheep following inoculation is controlled by the PRNP gene, which has different alleles defined on the basis of polymorphisms, particularly at codons 136, 154 and 171, although other codons are associated with survival time, and the exact responses of the sheep may be influenced by other breed-related differences. Here we report the results of a long term single study of experimental scrapie and BSE susceptibility of sheep of Cheviot, Poll Dorset and Suffolk breeds, originating from New Zealand and of a wide range of susceptible and resistant PRNP genotypes. Responses were compared with those of sheep from a closed Cheviot flock of UK origin (Roslin Cheviot flock. The unusually long observation period (6-8 years for most, but up to 12 years for others allows us to draw robust conclusions about rates of survival of animals previously regarded as resistant to infection, particularly PRNP heterozygotes, and is the most comprehensive such study reported to date. BSE inoculation by an intracerebral route produced disease in all genotype groups with differing incubation periods, although M112T and L141F polymorphisms seemed to give some protection. Scrapie isolate SSBP/1, which has the shortest incubation period in sheep with at least one VRQ PRNP allele, also produced disease following sub-cutaneous inoculation in ARQ/ARQ animals of New Zealand origin, but ARQ/ARQ sheep from the Roslin flock survived the challenge. Our results demonstrate that the links between PRNP genotype and clinical prion disease in sheep are much less secure than previously thought, and may break down when, for example, a different breed of

  8. Comparative Susceptibility of Sheep of Different Origins, Breeds and PRNP Genotypes to Challenge with Bovine Spongiform Encephalopathy and Scrapie.

    Science.gov (United States)

    Houston, Fiona; Goldmann, Wilfred; Foster, James; González, Lorenzo; Jeffrey, Martin; Hunter, Nora

    2015-01-01

    Sheep are natural hosts of the prion disease, scrapie. They are also susceptible to experimental challenge with various scrapie strains and with bovine spongiform encephalopathy (BSE), which affects cattle and has been accidentally transmitted to a range of other species, including man. Incidence and incubation period of clinical disease in sheep following inoculation is controlled by the PRNP gene, which has different alleles defined on the basis of polymorphisms, particularly at codons 136, 154 and 171, although other codons are associated with survival time, and the exact responses of the sheep may be influenced by other breed-related differences. Here we report the results of a long term single study of experimental scrapie and BSE susceptibility of sheep of Cheviot, Poll Dorset and Suffolk breeds, originating from New Zealand and of a wide range of susceptible and resistant PRNP genotypes. Responses were compared with those of sheep from a closed Cheviot flock of UK origin (Roslin Cheviot flock). The unusually long observation period (6-8 years for most, but up to 12 years for others) allows us to draw robust conclusions about rates of survival of animals previously regarded as resistant to infection, particularly PRNP heterozygotes, and is the most comprehensive such study reported to date. BSE inoculation by an intracerebral route produced disease in all genotype groups with differing incubation periods, although M112T and L141F polymorphisms seemed to give some protection. Scrapie isolate SSBP/1, which has the shortest incubation period in sheep with at least one VRQ PRNP allele, also produced disease following sub-cutaneous inoculation in ARQ/ARQ animals of New Zealand origin, but ARQ/ARQ sheep from the Roslin flock survived the challenge. Our results demonstrate that the links between PRNP genotype and clinical prion disease in sheep are much less secure than previously thought, and may break down when, for example, a different breed of sheep is moved

  9. A C-terminal protease-resistant prion fragment distinguishes ovine "CH1641-like" scrapie from bovine classical and L-Type BSE in ovine transgenic mice.

    Directory of Open Access Journals (Sweden)

    Thierry Baron

    Full Text Available The protease-resistant prion protein (PrP(res of a few natural scrapie isolates identified in sheep, reminiscent of the experimental isolate CH1641 derived from a British natural scrapie case, showed partial molecular similarities to ovine bovine spongiform encephalopathy (BSE. Recent discovery of an atypical form of BSE in cattle, L-type BSE or BASE, suggests that also this form of BSE might have been transmitted to sheep. We studied by Western blot the molecular features of PrP(res in four "CH1641-like" natural scrapie isolates after transmission in an ovine transgenic model (TgOvPrP4, to see if "CH1641-like" isolates might be linked to L-type BSE. We found less diglycosylated PrP(res than in classical BSE, but similar glycoform proportions and apparent molecular masses of the usual PrP(res form (PrP(res #1 to L-type BSE. However, the "CH1641-like" isolates differed from both L-type and classical BSE by an abundant, C-terminally cleaved PrP(res product (PrP(res #2 specifically recognised by a C-terminal antibody (SAF84. Differential immunoprecipitation of PrP(res #1 and PrP(res #2 resulted in enrichment in PrP(res #2, and demonstrated the presence of mono- and diglycosylated PrP(res products. PrP(res #2 could not be obtained from several experimental scrapie sources (SSBP1, 79A, Chandler, C506M3 in TgOvPrP4 mice, but was identified in the 87V scrapie strain and, in lower and variable proportions, in 5 of 5 natural scrapie isolates with different molecular features to CH1641. PrP(res #2 identification provides an additional method for the molecular discrimination of prion strains, and demonstrates differences between "CH1641-like" ovine scrapie and bovine L-type BSE transmitted in an ovine transgenic mouse model.

  10. A C-terminal protease-resistant prion fragment distinguishes ovine "CH1641-like" scrapie from bovine classical and L-Type BSE in ovine transgenic mice.

    Science.gov (United States)

    Baron, Thierry; Bencsik, Anna; Vulin, Johann; Biacabe, Anne-Gaëlle; Morignat, Eric; Verchere, Jérémy; Betemps, Dominique

    2008-08-29

    The protease-resistant prion protein (PrP(res)) of a few natural scrapie isolates identified in sheep, reminiscent of the experimental isolate CH1641 derived from a British natural scrapie case, showed partial molecular similarities to ovine bovine spongiform encephalopathy (BSE). Recent discovery of an atypical form of BSE in cattle, L-type BSE or BASE, suggests that also this form of BSE might have been transmitted to sheep. We studied by Western blot the molecular features of PrP(res) in four "CH1641-like" natural scrapie isolates after transmission in an ovine transgenic model (TgOvPrP4), to see if "CH1641-like" isolates might be linked to L-type BSE. We found less diglycosylated PrP(res) than in classical BSE, but similar glycoform proportions and apparent molecular masses of the usual PrP(res) form (PrP(res) #1) to L-type BSE. However, the "CH1641-like" isolates differed from both L-type and classical BSE by an abundant, C-terminally cleaved PrP(res) product (PrP(res) #2) specifically recognised by a C-terminal antibody (SAF84). Differential immunoprecipitation of PrP(res) #1 and PrP(res) #2 resulted in enrichment in PrP(res) #2, and demonstrated the presence of mono- and diglycosylated PrP(res) products. PrP(res) #2 could not be obtained from several experimental scrapie sources (SSBP1, 79A, Chandler, C506M3) in TgOvPrP4 mice, but was identified in the 87V scrapie strain and, in lower and variable proportions, in 5 of 5 natural scrapie isolates with different molecular features to CH1641. PrP(res) #2 identification provides an additional method for the molecular discrimination of prion strains, and demonstrates differences between "CH1641-like" ovine scrapie and bovine L-type BSE transmitted in an ovine transgenic mouse model.

  11. Classical natural ovine scrapie prions detected in practical volumes of blood by lamb and transgenic mouse bioassays.

    Science.gov (United States)

    Dassanayake, Rohana P; Truscott, Thomas C; Zhuang, Dongyue; Schneider, David A; Madsen-Bouterse, Sally A; Young, Alan J; Stanton, James B; Davis, William C; O'Rourke, Katherine I

    2015-01-01

    Scrapie is diagnosed antemortem in sheep by detecting misfolded isoforms of prion protein (PrP(Sc)) in lymphoid follicles of the rectal mucosa and nictitating membranes. Assay sensitivity is limited if (a) the biopsy is collected early during disease development, (b) an insufficient number of follicles is collected, or (c) peripheral accumulation of PrP(Sc) is reduced or delayed. A blood test would be convenient for mass live animal scrapie testing. Currently approved techniques, however, have their own detection limits. Novel detection methods may soon offer a non-animal-based, rapid platform with detection sensitivities that rival the prion bioassay. In anticipation, we sought to determine if diseased animals could be routinely identified with a bioassay using B lymphocytes isolated from blood sample volumes commonly collected for diagnostic purposes in small ruminants. Scrapie transmission was detected in five of six recipient lambs intravenously transfused with B lymphocytes isolated from 5~10 mL of blood from a naturally scrapie-infected sheep. Additionally, scrapie transmission was observed in 18 ovinized transgenic Tg338 mice intracerebrally inoculated with B lymphocytes isolated from 5~10 mL of blood from two naturally scrapie-infected sheep. Based on our findings, we anticipate that these blood sample volumes should be of diagnostic value.

  12. PrP genotype frequencies and risk evaluation for scrapie in dairy sheep breeds from southern Italy.

    Science.gov (United States)

    Martemucci, Giovanni; Iamartino, Daniela; Blasi, Michele; D'Alessandro, Angela Gabriella

    2015-12-01

    Concerns regarding scrapie in sheep breeding have increased in the last few decades. The present study was carried out in dairy sheep breeds from southern Italy. In order to find breeding animals resistant to scrapie, the PrP genes of 1,205 animals from entire flocks of dairy native Apulian Leccese and Altamurana breeds, and Sicilian Comisana breed, were analysed for polymorphisms at codons 136, 154, and 171 related to scrapie resistance/susceptibility. The Altamurana breed was considered as two populations (Alt-Cav and Alt-Cra-Zoe), based on presumed cross-breeding. A total of five alleles and ten different genotypes were found. The ARQ allele was predominant for all breeds followed by ARR, the most resistant allele to scrapie, which was highly prevalent in Comisana (50%) and in native Alt-Cav (42.4%). The VRQ allele, associated with the highest susceptibility to scrapie, was detected at not negligeable levels in allocthonous Comisana (3.5%), at a low frequency (0.2%) in native Leccese and Alt-Cra-Zoe, while it was absent in Alt-Cav. The frequencies of PrP genotypes with a very low susceptibility risk to scrapie (R1) was higher in Comisana and Alt-Cav. The most susceptible genotype, ARQ/VRQ, was found only in Comisana. Within the Altamurana breed, there were notable differences between Alt-Cav and Alt-Cra-Zoe sheep. The Alt-Cav was characterised by the absence of VRQ and AHQ alleles and by the higher frequency of the ARR/ARR genotype (18.7%). Breeding programs, mainly in endangered breeds such as Altamurana, should be conducted gradually, combining resistance to scrapie, maintenance of genetic variability, and production.

  13. Clinical signs, histopathology and genetics of experimental transmission of BSE and natural scrapie to sheep and goats.

    Science.gov (United States)

    Foster, J D; Parnham, D; Chong, A; Goldmann, W; Hunter, N

    2001-02-10

    This paper compares the dinical signs, histopathology, detection of PrPSc protein and PrP genetics of the transmission of BSE to sheep and goats, with the effects of the transmission of natural scrapie from a brain homogenate from a single sheep. After intracerebral and oral inoculations there were similarities in the clinical signs due to the two sources of infection, but there were differences in pathology at the end stage of disease and in the genotypes of the sheep which succumbed to the challenges. The incubation period of BSE was associated with the sheep PrP codon 171 genotype, but the natural scrapie source, despite inducing disease only in known susceptible genotypes, showed no clear association with PrP genotype.

  14. Detection of prion protein particles in blood plasma of scrapie infected sheep.

    Directory of Open Access Journals (Sweden)

    Oliver Bannach

    Full Text Available Prion diseases are transmissible neurodegenerative diseases affecting humans and animals. The agent of the disease is the prion consisting mainly, if not solely, of a misfolded and aggregated isoform of the host-encoded prion protein (PrP. Transmission of prions can occur naturally but also accidentally, e.g. by blood transfusion, which has raised serious concerns about blood product safety and emphasized the need for a reliable diagnostic test. In this report we present a method based on surface-FIDA (fluorescence intensity distribution analysis, that exploits the high state of molecular aggregation of PrP as an unequivocal diagnostic marker of the disease, and show that it can detect infection in blood. To prepare PrP aggregates from blood plasma we introduced a detergent and lipase treatment to separate PrP from blood lipophilic components. Prion protein aggregates were subsequently precipitated by phosphotungstic acid, immobilized on a glass surface by covalently bound capture antibodies, and finally labeled with fluorescent antibody probes. Individual PrP aggregates were visualized by laser scanning microscopy where signal intensity was proportional to aggregate size. After signal processing to remove the background from low fluorescence particles, fluorescence intensities of all remaining PrP particles were summed. We detected PrP aggregates in plasma samples from six out of ten scrapie-positive sheep with no false positives from uninfected sheep. Applying simultaneous intensity and size discrimination, ten out of ten samples from scrapie sheep could be differentiated from uninfected sheep. The implications for ante mortem diagnosis of prion diseases are discussed.

  15. Transmission of the agent of sheep scrapie to deer results in PrPSc with two distinct molecular profiles

    Science.gov (United States)

    The purpose of this work was to determine susceptibility of white-tailed deer (WTD) to the agent of sheep scrapie and to compare the resultant PrPSc to that of the original inoculum and chronic wasting disease (CWD). We inoculated WTD by a natural route of exposure (concurrent oral and intranasal (I...

  16. Evidence for co-infection of ovine prion strains in classical scrapie isolates.

    Science.gov (United States)

    Thackray, A M; Lockey, R; Beck, K E; Spiropoulos, J; Bujdoso, R

    2012-01-01

    The diversity of strains of ovine prions within classical scrapie isolates was investigated by transmission studies in wild type mice. To determine the maximum diversity of prion strains present in each ovine scrapie isolate examined, isolates from mice having the shortest and longest incubation times for terminal disease after primary inoculation were passaged serially. Serial passage of ARQ/ARQ scrapie isolates in RIII mice revealed the ME7 prion strain in mice with short incubation times for terminal prion disease and the 87A strain in those mice with long incubation times. Serial passage of VRQ/VRQ scrapie isolates in RIII mice led to emergence of the 221C prion strain in mice with short incubation times and a variant of the 221C strain in those mice with long incubation times. RIII mice with short incubation times had higher levels of total and proteinase K-resistant PrP(Sc) compared with those RIII mice with long incubation times, while mice with long incubation times had large aggregates and plaques of PrP(Sc). ME7 PrP(Sc) differed in stability compared with the 87A prion strain, while PrP(Sc) associated with 221C had similar stability to that of the 221C variant. Serial passage in VM mice led to identification of ME7 and 87V in the same scrapie isolate. The data show that different prion strains can emerge from the same ovine scrapie isolate following serial passage in wild type mice and that the transmission properties of these strains correlate with distinct patterns of PrP(Sc) deposition.

  17. Different prion disease phenotypes result from inoculation of cattle with two temporally separated sources of sheep scrapie from Great Britain

    Directory of Open Access Journals (Sweden)

    Hawkins Steve AC

    2006-10-01

    Full Text Available Abstract Background Given the theoretical proposal that bovine spongiform encephalopathy (BSE could have originated from sheep scrapie, this study investigated the pathogenicity for cattle, by intracerebral (i.c. inoculation, of two pools of scrapie agents sourced in Great Britain before and during the BSE epidemic. Two groups of ten cattle were each inoculated with pools of brain material from sheep scrapie cases collected prior to 1975 and after 1990. Control groups comprised five cattle inoculated with sheep brain free from scrapie, five cattle inoculated with saline, and for comparison with BSE, naturally infected cattle and cattle i.c. inoculated with BSE brainstem homogenate from a parallel study. Phenotypic characterisation of the disease forms transmitted to cattle was conducted by morphological, immunohistochemical, biochemical and biological methods. Results Disease occurred in 16 cattle, nine inoculated with the pre-1975 inoculum and seven inoculated with the post-1990 inoculum, with four cattle still alive at 83 months post challenge (as at June 2006. The different inocula produced predominantly two different disease phenotypes as determined by histopathological, immunohistochemical and Western immunoblotting methods and biological characterisation on transmission to mice, neither of which was identical to BSE. Whilst the disease presentation was uniform in all scrapie-affected cattle of the pre-1975 group, the post-1990 inoculum produced a more variable disease, with two animals sharing immunohistochemical and molecular profile characteristics with animals in the pre-1975 group. Conclusion The study has demonstrated that cattle inoculated with different pooled scrapie sources can develop different prion disease phenotypes, which were not consistent with the phenotype of BSE of cattle and whose isolates did not have the strain typing characteristics of the BSE agent on transmission to mice.

  18. Establishment of the Method of Immunohistochemistry Assay for the Detection of Scrapie in Chinese Short-Tailed Han Sheep by Monoclonal Antibody

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The method of immunohistochemistry assay for the detection of scrapie in Chinese Short-tailed Han sheep was established using monoclonal antibody. Genomic DNA was isolated from Chinese Short-tailed Han sheep blood. Using the polymerase chain reaction technique, PrP27-30 gene sequence was amplified from Chinese Short-tailed Han sheep genomic DNA. By recombinant DNA technology, the recombinant protein of Chinese Short-tailed Han sheep PrP27-30 was obtained. Then, using standard methodology of myeloma cell fusion, a panel of monoclonal antibodies was generated. With mAbs, scrapie in Chinese Short-tailed Han sheep was detected by immunohistochemistry assay. The recombinant protein of Chinese Short-tailed Han sheep PrP27-30 was obtained and a panel of six hybridoma cell lines secreting specific antibodies to Chinese Short-tailed Han sheep PrP27-30 related to scrapie was obtained with one fusion between myeloma Sp2/0 and spleen cells from mice immunized with the purified recombinant protein. Four hybridoma cell lines can be used in immunohistochemistry assay for the detection of scrapie in Chinese Short-tailed Han sheep. So that the special monoclonal antibody developed in author's institute can be used to detect PrPsc of scrapie in Chinese Short-tailed Han sheep by immunohistochemistry in China.

  19. Assessment of inbreeding resulting from selection for scrapie resistance: a model for rare sheep breeds.

    Science.gov (United States)

    Brown, C; Orford, M; Tzamaloukas, O; Mavrogenis, A P; Miltiadou, D

    Inbreeding in a small population of Chios sheep undergoing intense selection for the PrP gene was assessed 10 years after the beginning of a scrapie resistance selection programme. Inbreeding in this stock, already under selection for production traits, was analysed by using pedigree records containing 10,492 animals from 1968 to 2008, and also by genotyping 192 individuals with a panel of 15 microsatellites. Genetic markers indicated a loss of heterozygosity (FIS over all loci was 0.059) and allelic diversity (mean effective number of alleles was 3.075±0.275). The annual rate of inbreeding increased significantly after the start of the scrapie resistance programme, ΔF=0.005 compared with ΔF=0.001 before 1999, and was subjected to several genetic bottlenecks, mainly due to the low initial frequency of resistant animals. However, the mean individual inbreeding coefficient estimated from the pedigree - in this closed stock resembling the case of a rare breed - stood at the level of 4.5 per cent, five generations after the implementation of selection for the PrP gene. The inbreeding coefficient estimated by genetic markers was 4.37 per cent, implying that such a marker panel could be a useful and cost-effective tool for estimating inbreeding in unrecorded populations.

  20. Norwegian farmers' vigilance in reporting sheep showing scrapie-associated signs

    OpenAIRE

    Jarp Jorun; Vatn Synnøve; Hopp Petter

    2007-01-01

    Abstract Background Scrapie is a chronic neurodegenerative disease affecting small ruminants and belongs to the transmissible spongiform encephalopathies. Scrapie is considered a serious animal disease and it has been notifiable in Norway since 1965. The clinical signs of scrapie might be vague and the farmers, if familiar with the signs of scrapie, are often in the best position for detecting scrapie suspects. In 2002, an anonymous questionnaire survey was conducted in order to assess Norweg...

  1. Active surveillance for scrapie in the Netherlands: effect of a breeding programme on the prevalence of scrapie in sheep (2002-2010)? = Acht jaar actieve scrapie-surveillance in Nederland: het effect van het fokprogramma op de prevalentie van schrapie bij het schaap (2002-2010)

    NARCIS (Netherlands)

    Melchior, M.B.; Hagenaars, T.H.J.; Davidse, A.; Keulen, van L.J.M.; Bossers, A.; Zijderveld, van F.G.

    2011-01-01

    The susceptibility of sheep to scrapie is modulated by the prion protein (PrP) genotype of the animal. An ambitious voluntary scrapie control programme was started in the Netherlands in 1998, based on selection of rams with theARR/ARR genotype for breeding. This programme was followed by an obligato

  2. Caprine prion genen polymorphisms are associated with decreased incidence of classical scrapie in goat herds in the United Kingdom.

    NARCIS (Netherlands)

    Goldmann, W.; Ryan, K.; Stewart, P.; Parnham, D.; Xicohtencatl, R.; Fernandez, N.; Saunders, G.; Windl, O.; Gonzalez, L.; Bossers, A.

    2011-01-01

    The application of genetic breeding programmes to eradicate transmissible spongiform encephalopathies in goats is an important aim for reasons of animal welfare as well as human food safety and food security. Based on the positive impact of Prnp genetics on sheep scrapie in Europe in the past decade

  3. Membrane toxicity of abnormal prion protein in adrenal chromaffin cells of scrapie infected sheep.

    Science.gov (United States)

    McGovern, Gillian; Jeffrey, Martin

    2013-01-01

    Transmissible spongiform encephalopathies (TSEs) or prion diseases are associated with accumulations of disease specific PrP (PrP(d)) in the central nervous system (CNS) and often the lymphoreticular system (LRS). Accumulations have additionally been recorded in other tissues including the peripheral nervous system and adrenal gland. Here we investigate the effect of sheep scrapie on the morphology and the accumulation of PrP(d) in the adrenal medulla of scrapie affected sheep using light and electron microscopy. Using immunogold electron microscopy, non-fibrillar forms of PrP(d) were shown to accumulate mainly in association with chromaffin cells, occasional nerve endings and macrophages. PrP(d) accumulation was associated with distinctive membrane changes of chromaffin cells including increased electron density, abnormal linearity and invaginations. Internalisation of PrP(d) from the chromaffin cell plasma membrane occurred in association with granule recycling following hormone exocytosis. PrP(d) accumulation and internalisation from membranes is similarly associated with perturbations of membrane structure and trafficking in CNS neurons and tingible body macrophages of the LRS. These data suggest that a major toxic effect of PrP(d) is at the level of plasma membranes. However, the precise nature of PrP(d)-membrane toxicity is tissue and cell specific suggesting that the normal protein may act as a multi-functional scaffolding molecule. We further suggest that the co-localisation of PrP(d) with exocytic granules of the hormone trafficking system may provide an additional source of infectivity in blood.

  4. Membrane toxicity of abnormal prion protein in adrenal chromaffin cells of scrapie infected sheep.

    Directory of Open Access Journals (Sweden)

    Gillian McGovern

    Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases are associated with accumulations of disease specific PrP (PrP(d in the central nervous system (CNS and often the lymphoreticular system (LRS. Accumulations have additionally been recorded in other tissues including the peripheral nervous system and adrenal gland. Here we investigate the effect of sheep scrapie on the morphology and the accumulation of PrP(d in the adrenal medulla of scrapie affected sheep using light and electron microscopy. Using immunogold electron microscopy, non-fibrillar forms of PrP(d were shown to accumulate mainly in association with chromaffin cells, occasional nerve endings and macrophages. PrP(d accumulation was associated with distinctive membrane changes of chromaffin cells including increased electron density, abnormal linearity and invaginations. Internalisation of PrP(d from the chromaffin cell plasma membrane occurred in association with granule recycling following hormone exocytosis. PrP(d accumulation and internalisation from membranes is similarly associated with perturbations of membrane structure and trafficking in CNS neurons and tingible body macrophages of the LRS. These data suggest that a major toxic effect of PrP(d is at the level of plasma membranes. However, the precise nature of PrP(d-membrane toxicity is tissue and cell specific suggesting that the normal protein may act as a multi-functional scaffolding molecule. We further suggest that the co-localisation of PrP(d with exocytic granules of the hormone trafficking system may provide an additional source of infectivity in blood.

  5. Iron and iron/manganese ratio in forage from Icelandic sheep farms: relation to scrapie

    Directory of Open Access Journals (Sweden)

    Jóhannesson T

    2006-08-01

    Full Text Available Abstract This study was undertaken in order to examine whether any connection existed between the amounts of iron in forage and the sporadic occurrence of scrapie observed in certain parts of Iceland. As iron and manganese are considered antagonistic in plants, calculation of the Fe/Mn ratios was also included by using results from Mn determination earlier performed in the same samples. Forage samples (n = 170 from the summer harvests of 2001–2003, were collected from 47 farms for iron and manganese analysis. The farms were divided into four categories: 1. Scrapie-free farms in scrapie-free areas (n = 9; 2. Scrapie-free farms in scrapie-afflicted areas (n = 17; 3. Scrapie-prone farms (earlier scrapie-afflicted, restocked farms (n = 12; 4. Scrapie-afflicted farms (n = 9. Farms in categories 1 and 2 are collectively referred to as scrapie-free farms. The mean iron concentration in forage samples from scrapie-afflicted farms was significantly higher than in forage samples from farms in the other scrapie categories (P = 0.001. The mean Fe/Mn ratio in forage from scrapie-afflicted farms was significantly higher than in forage from scrapie-free and scrapie-prone farms (P

  6. Human variant Creutzfeldt-Jakob disease and sheep scrapie PrP(res) detection using seeded conversion of recombinant prion protein.

    Science.gov (United States)

    Orrú, Christina D; Wilham, Jason M; Hughson, Andrew G; Raymond, Lynne D; McNally, Kristin L; Bossers, Alex; Ligios, Ciriaco; Caughey, Byron

    2009-08-01

    The pathological isoform of the prion protein (PrP(res)) can serve as a marker for prion diseases, but more practical tests are needed for preclinical diagnosis and sensitive detection of many prion infections. Previously we showed that the quaking-induced conversion (QuIC) assay can detect sub-femtogram levels of PrP(res) in scrapie-infected hamster brain tissue and distinguish cerebral spinal fluid (CSF) samples from normal and scrapie-infected hamsters. We now report the adaptation of the QuIC reaction to prion diseases of medical and agricultural interest: human variant Creutzfeldt-Jakob disease (vCJD) and sheep scrapie. PrP(res)-positive and -negative brain homogenates from humans and sheep were discriminated within 1-2 days with a sensitivity of 10-100 fg PrP(res). More importantly, in as little as 22 h we were able to distinguish CSF samples from scrapie-infected and uninfected sheep. These results suggest the presence of prions in CSF from scrapie-infected sheep. This new method enables the relatively rapid and sensitive detection of human CJD and sheep scrapie PrP(res) and may facilitate the development of practical preclinical diagnostic and high-throughput interference tests.

  7. [From the Scrapie syndrome of sheep and goat to the mad cow disease - the history of the discovery of prion].

    Science.gov (United States)

    Liu, Rui; Weng, Yi

    2009-05-01

    Since the discovery of Scrapie Syndrome in sheep and goats in 1730, there emerged a series of diseases such as Creutzfeldt-Jakob disease, kuru disease and mad cow disease etc. In the research of kuru disease, the American scientist D. Carlteton Gajdusek found a new virus without the characteristic of DNA and RNA, which was awarded the Nobel Prize in physiology in 1976. Since then another American scientist, Stanley B. Prusiner, found a new virus-prion, taking protein as the genetic medium, which was awarded the Nobel prize in physiology and medicine in 1997. The discovery of prion is a great landmark in the research of life science, which laid a theoretical foundation for people to conquer a series of diseases such as Scrapie syndrome in sheep and goats, Creutzfeldt-Jakob disease, kuru disease and mad cow disease etc.

  8. Adaptation and evaluation of a rapid test for the diagnosis of sheep scrapie in samples of rectal mucosa.

    Science.gov (United States)

    González, Lorenzo; Horton, Robert; Ramsay, Drew; Toomik, Reet; Leathers, Valerie; Tonelli, Quentin; Dagleish, Mark P; Jeffrey, Martin; Terry, Linda

    2008-03-01

    In recent publications, it was shown that disease-associated prion protein (PrP(d)) accumulates in the lymphoid tissue of the rectal mucosa of a high proportion of scrapie-infected sheep at clinical and preclinical stages, regardless of several host factors; PrP(d) can also be detected in biopsy specimens of rectal mucosa, with an increased probability proportional to age or incubation period and with an efficiency almost identical to that of tonsil biopsies. Rectal biopsies have the advantages of providing higher numbers of lymphoid follicles and of being simpler to perform, which makes them suitable for scrapie screening in the field. In biopsy samples, PrP(d) could be demonstrated by immunohistochemical (IHC) and Western immunoblotting methods, and the purpose of the present study was to optimize and evaluate a "rapid test" for the diagnosis of scrapie in rectal biopsy samples. The HerdChek CWD (chronic wasting disease) antigen EIA (enzyme immunoassay) test was chosen and, once optimized, provided specificity and sensitivity figures of 99.2% and 93.5%, respectively, compared with IHC results in the same samples obtained at a postmortem. The sensitivity of the assay increased from 82.1%, when a single rectal mucosa sample was tested to 99.4% for those sheep in which 3 or more samples were analyzed. Similarly, sensitivity values of the HerdChek CWD antigen EIA test on biopsy samples increased from 95% to 100% for sheep subjected to 1 or 2 sequential biopsies 4 months apart, respectively. Thus, a preclinical diagnosis of scrapie in live sheep can be achieved by a combination of a simple sampling procedure, which can be repeated several times with no detrimental effect for the animals, and a rapid and efficient laboratory method.

  9. Characterization of PRNP and SPRN coding regions from atypical scrapie cases diagnosed in Poland.

    Science.gov (United States)

    Piestrzyńska-Kajtoch, Agata; Gurgul, Artur; Polak, Mirosław P; Smołucha, Grzegorz; Zmudziński, Jan F; Rejduch, Barbara

    2012-03-01

    Scrapie, a fatal transmissible spongiform encephalopathy (TSE) occurs in two phenotypes: classical and atypical. Many authors point out that the polymorphism of three codons (136, 154, 171) of the PRNP (PrP gene) is associated with a sheep susceptibility to classical scrapie. Until now, only one PRNP gene variant coding phenylalanine at codon 141 has been found to be associated with atypical scrapie. Another recently identified and interesting candidate gene for scrapie susceptibility in sheep is an SPRN gene coding for Shadoo protein (Sho). Sho is a highly interspecies conserved protein and an insertion/deletion (indel) found in a sheep Sho gene was associated with classical scrapie occurrence. Here we determined the polymorphism of PRNP and SPRN genes in nine atypical scrapie cases (six in native born sheep and three in imported sheep) and compared these results with a control group of healthy animals comprising six corresponding Polish sheep breeds. In atypical scrapie cases five PRNP diplotypes were identified: A(136)R(154)Q(171)/ARQ, AHQ/ARQ, ARR/ARQ, ARR/AHQ and AHQ/AHQ. The ARR/AHQ diplotype was found only in imported sheep. A previously unobserved SNP in PRNP (E224K) was also found in both atypical scrapie and in a few control animals. In the ORF of the SPRN gene, six SNPs and one indel were identified. None of these variations was exclusive for scrapie animals and they were probably, naturally occurring polymorphisms. Special attention was given to the 6-bp indel SPRN polymorphism which was previously associated with classical scrapie occurrence.

  10. Comparison of detergent and protease enzyme combinations for the detection of scrapie-associated fibrils from the central nervous system of sheep naturally affected with scrapie.

    Science.gov (United States)

    Stack, M J; Aldrich, A M; Davis, L A

    1997-02-01

    Standardized samples of tissue from the central nervous system of four sheep naturally affected with scrapie and from four healthy control sheep were subjected to a centrifugal extraction technique used to obtain scrapie-associated fibrils; the latter were then demonstrated by negative-contrast transmission electron microscopy. This regime was used to evaluate the fibril yield obtained from the 25 possible combinations of five different detergents and five different proteolytic enzymes. N-lauroylsarcosine detergent was found to be the most efficient detergent for all five enzymes, followed by sulphabetaine 3-14. Sodium dodecyl sulphate detergent was successful only in combination with a subtilisin Carlsberg enzyme. Octylglucoside and nonidet P40 detergents did not produce fibrils with any of the enzymes. Proteinase K was the least efficient of the five enzymes when used in combination with N-lauroylsarcosine; subtilisin Carlsberg, clostripain, pronase and trypsin enzymes all gave higher fibril yields. A combination of N-lauroylsarcosine detergent and subtilisin Carlsberg proteolytic enzyme gave the highest fibril yield.

  11. Accumulation and dissemination of prion protein in experimental sheep scrapie in the natural host

    Directory of Open Access Journals (Sweden)

    Warner Richard

    2009-02-01

    Full Text Available Abstract Background In order to study the sites of uptake and mechanisms of dissemination of scrapie prions in the natural host under controlled conditions, lambs aged 14 days and homozygous for the VRQ allele of the PrP gene were infected by the oral route. Infection occurred in all lambs with a remarkably short and highly consistent incubation period of approximately 6 months. Challenge of lambs at approximately eight months of age resulted in disease in all animals, but with more variable incubation periods averaging significantly longer than those challenged at 14 days. This model provides an excellent system in which to study the disease in the natural host by virtue of the relatively short incubation period and close resemblance to natural infection. Results Multiple sites of prion uptake were identified, of which the most important was the Peyer's patch of the distal ileum. Neuroinvasion was detected initially in the enteric nervous system prior to infection of the central nervous system. At end stage disease prion accumulation was widespread throughout the entire neuraxis, but vacuolar pathology was absent in most animals that developed disease at 6–7 months of age. Conclusion Initial spread of detectable PrP was consistent with drainage in afferent lymph to dependent lymph nodes. Subsequent accumulation of prions in lymphoid tissue not associated with the gut is consistent with haematogenous spread. In addition to macrophages and follicular dendritic cells, prion containing cells consistent with afferent lymph dendritic cells were identified and are suggested as a likely vehicle for carriage of prions from initial site of uptake to the lymphoreticular system, and as potential carriers of prion protein in blood. It is apparent that spongiform change, the characteristic lesion of scrapie and other prion diseases, is not responsible for the clinical signs in sheep, but may develop in an age dependent manner.

  12. Scientific and technical assistance on the provisional results of the study on genetic resistance to Classical scrapie in goats in Cyprus

    Directory of Open Access Journals (Sweden)

    European Food Safety Authority

    2012-11-01

    Full Text Available This EFSA Scientific Report reviews and discusses the provisional results of a study (EURL/Cypriot study on genetic resistance to Classical scrapie in goats in Cyprus. It is concluded that the provisional results obtained in the study further support the lower susceptibility to Classical scrapie in goats carrying the D146 and S146 alleles compared to wild type (N146N goats. The results from intracerebral challenge are not compatible with a level of resistance as high as the one observed in sheep carrying the ARR allele or in goats carrying the K222 allele. Final results from the oral challenge will be crucial in determining the level of resistance associated with the D146 and S146 alleles. Furthermore, it is concluded that the provisional results obtained in the study are compatible with the possibility to use the D146 and S146 alleles to build a genetic strategy to control and eradicate Classical scrapie in goats in Cyprus. However, the success of such a strategy will be determined by the level of resistance associated with the D146 and S146 alleles against infection with all the different TSE agents proved to be circulating in Cyprus, which at this stage of the EURL/Cypriot study remains to be definitively assessed. In addition, as compared to the results of the model developed in the study, it is concluded that the efficiency of the implementation in the field of a breeding strategy selecting for the D146 and S146 alleles may be lower due to potential practical constraints related to the management of genetic diversity, to the selection for production and health traits and to the need of moving animals for breeding purposes in Cyprus. Recommendations on aspects that may be considered when completing the study are formulated.

  13. Diversity in neuroanatomical distribution of abnormal prion protein in atypical scrapie.

    Directory of Open Access Journals (Sweden)

    Alice Nentwig

    2007-06-01

    Full Text Available Scrapie is a transmissible spongiform encephalopathy (TSE in sheep and goats. In recent years, atypical scrapie cases were identified that differed from classical scrapie in the molecular characteristics of the disease-associated pathological prion protein (PrP(sc. In this study, we analyze the molecular and neuropathological phenotype of nine Swiss TSE cases in sheep and goats. One sheep was identified as classical scrapie, whereas six sheep, as well as two goats, were classified as atypical scrapie. The latter revealed a uniform electrophoretic mobility pattern of the proteinase K-resistant core fragment of PrP(sc distinct from classical scrapie regardless of the genotype, the species, and the neuroanatomical structure. Remarkably different types of neuroanatomical PrP(sc distribution were observed in atypical scrapie cases by both western immunoblotting and immunohistochemistry. Our findings indicate that the biodiversity in atypical scrapie is larger than expected and thus impacts on current sampling and testing strategies in small ruminant TSE surveillance.

  14. Extended scrapie incubation time in goats singly heterozygous for PRNP S146 or K222.

    Science.gov (United States)

    White, Stephen N; Reynolds, James O; Waldron, Daniel F; Schneider, David A; O'Rourke, Katherine I

    2012-06-10

    Scrapie is the transmissible spongiform encephalopathy (TSE) of sheep and goats, and scrapie eradication in sheep is based in part on strong genetic resistance to classical scrapie. Goats may serve as a scrapie reservoir, and to date there has been no experimental inoculation confirming strong genetic resistance in goats. Two prion protein variants (amino acid substitutions S146 and K222) in goats have been significantly underrepresented in scrapie cases though present in scrapie-exposed flocks, and have demonstrated low cell-free protein conversion efficiency to the disease form (PrP(D)). To test degree of genetic resistance conferred in live animals with consistent exposure, we performed the first oral scrapie challenge of goats singly heterozygous for either PRNP S146 or K222. All N146-Q222 homozygotes became clinically scrapie positive by an average of 24months, but all S146 and K222 heterozygotes remain scrapie negative by both rectal biopsy and clinical signs at significantly longer incubation times (Pscrapie, suggesting these alleles do not confer complete resistance in the heterozygous state but rather extend incubation. The oral challenge results presented here confirm extended incubation observed in a recent intracerebral challenge of K222 heterozygotes, and to our knowledge provide the first demonstration of extended incubation in S146 heterozygotes. These results suggest longer relevant trace-back histories in scrapie-eradication programs for animals bearing these alleles and strengthen the case for additional challenge experiments in both homozygotes to assess potential scrapie resistance.

  15. Influence of polymorphisms in the prion protein gene on the pathogenesis and neuropathological phenotype of sheep scrapie after oral infection.

    Science.gov (United States)

    González, L; Pitarch, J L; Martin, S; Thurston, L; Simmons, H; Acín, C; Jeffrey, M

    2014-01-01

    The prion protein gene (Prnp) plays a crucial role in the susceptibility of sheep to scrapie in terms of attack rate and/or incubation period. However, the influence of Prnp on the pathogenesis of the disease, specifically the involvement of tissues of the lymphoreticular system (LRS), pathways of neuroinvasion and neuropathological phenotypes, remains controversial. This study reports the onset and progression of disease-associated prion protein (PrP(d)) accumulation in the LRS and nervous tissues of sheep of six different Prnp genotypes infected by oral administration of the same mixed scrapie brain homogenate. Sheep homozygous for glutamine (Q) at codon 171 of PrP, with either valine (V) or alanine (A) at codon 136 (i.e. VRQ/VRQ, VRQ/ARQ and ARQ/ARQ), showed early and consistent PrP(d) accumulation in LRS tissues of the pharynx and gut. In contrast, LRS involvement was minimal, inconsistent and occurred late in the incubation period in sheep heterozygous for arginine (R) at codon 171 (i.e. VRQ/ARR and ARQ/ARR). Despite this difference, all five groups were susceptible to infection and developed clinical disease, albeit with significantly different incubation periods (shortest in VRQ/VRQ and longest in ARQ/ARR sheep). The remaining group of ARR/ARR homozygous sheep did not show evidence of infection at the end of the experiment or at previous predetermined time points. As for LRS tissues, the sites of initial PrP(d) accumulation in the brain were determined immunohistochemically. These were the same in all susceptible sheep (except for ARR/ARR sheep), regardless of their Prnp genotype which, together with an early and consistent accumulation of PrP(d) in circumventricular organs and a late or inconsistent involvement of the enteric and autonomic nervous system and of the spinal cord, suggests neuroinvasion occurring via the blood. The neuropathological phenotype (PrP(d) profile in the central nervous system) of clinically affected sheep was similar in the three V

  16. Caprine prion gene polymorphisms are associated with decreased incidence of classical scrapie in goat herds in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Goldmann Wilfred

    2011-10-01

    Full Text Available Abstract The application of genetic breeding programmes to eradicate transmissible spongiform encephalopathies in goats is an important aim for reasons of animal welfare as well as human food safety and food security. Based on the positive impact of Prnp genetics on sheep scrapie in Europe in the past decade, we have established caprine Prnp gene variation in more than 1100 goats from the United Kingdom and studied the association of Prnp alleles with disease phenotypes in 150 scrapie-positive goats. This investigation confirms the association of the Met142 encoding Prnp allele with increased resistance to preclinical and clinical scrapie. It reveals a novel association of the Ser127 encoding allele with a reduced probability to develop clinical signs of scrapie in goats that are already positive for the accumulation of disease-specific prion protein in brain or periphery. A United Kingdom survey of Prnp genotypes in eight common breeds revealed eleven alleles in over thirty genotypes. The Met142 encoding allele had a high overall mean allele frequency of 22.6%, whereas the Ser127 encoding allele frequency was considerably lower with 6.4%. In contrast, a well known resistance associated allele encoding Lys222 was found to be rare (0.9% in this survey. The analysis of Prnp genotypes in Mexican Criollas goats revealed nine alleles, including a novel Phe to Leu substitution in codon 201, confirming that high genetic variability of Prnp can be found in scrapie-free populations. Our study implies that it should be feasible to lower scrapie prevalence in goat herds in the United Kingdom by genetic selection.

  17. Caprine prion gene polymorphisms are associated with decreased incidence of classical scrapie in goat herds in the United Kingdom.

    Science.gov (United States)

    Goldmann, Wilfred; Ryan, Kelly; Stewart, Paula; Parnham, David; Xicohtencatl, Rosa; Fernandez, Nora; Saunders, Ginny; Windl, Otto; González, Lorenzo; Bossers, Alex; Foster, James

    2011-10-31

    The application of genetic breeding programmes to eradicate transmissible spongiform encephalopathies in goats is an important aim for reasons of animal welfare as well as human food safety and food security. Based on the positive impact of Prnp genetics on sheep scrapie in Europe in the past decade, we have established caprine Prnp gene variation in more than 1100 goats from the United Kingdom and studied the association of Prnp alleles with disease phenotypes in 150 scrapie-positive goats. This investigation confirms the association of the Met142 encoding Prnp allele with increased resistance to preclinical and clinical scrapie. It reveals a novel association of the Ser127 encoding allele with a reduced probability to develop clinical signs of scrapie in goats that are already positive for the accumulation of disease-specific prion protein in brain or periphery. A United Kingdom survey of Prnp genotypes in eight common breeds revealed eleven alleles in over thirty genotypes. The Met142 encoding allele had a high overall mean allele frequency of 22.6%, whereas the Ser127 encoding allele frequency was considerably lower with 6.4%. In contrast, a well known resistance associated allele encoding Lys222 was found to be rare (0.9%) in this survey. The analysis of Prnp genotypes in Mexican Criollas goats revealed nine alleles, including a novel Phe to Leu substitution in codon 201, confirming that high genetic variability of Prnp can be found in scrapie-free populations. Our study implies that it should be feasible to lower scrapie prevalence in goat herds in the United Kingdom by genetic selection.

  18. A distinct proteinase K resistant prion protein fragment in goats with no signs of disease in a classical scrapie outbreak

    NARCIS (Netherlands)

    Bouzalas, I.; Lörtscher, F.; Dovas, C.; Oevermann, A.; Langeveld, J.P.M.; Papanastassopoulou, M.; Papadopoulos, O.; Zurbriggen, A.; Seuberlich, T.

    2011-01-01

    Considerable efforts have been directed toward the identification of small-ruminant prion diseases, i.e., classical and atypical scrapie as well as bovine spongiform encephalopathy (BSE). Here we report the in-depth molecular analysis of the proteinase K-resistant prion protein core fragment (PrPres

  19. Selection for scrapie resistance decreased inbreeding rates in two rare sheep breeds in the Netherlands

    NARCIS (Netherlands)

    Windig, J.J.; Hoving-Bolink, A.H.; Hiemstra, S.J.

    2010-01-01

    An attempt to balance selection intensity and conservation of genetic diversity was made in the national program for breeding for scrapie resistance in the Netherlands. The ARR allele is associated with resistance to scrapie. In the Netherlands a breeding program was started on a voluntary basis in

  20. Selection for scrapie resistance and simultaneous restriction of inbreeding in the rare sheep breed "Mergellander"

    NARCIS (Netherlands)

    Windig, J.J.; Meuleman, H.; Lansbergen, L.M.T.E.

    2007-01-01

    Scrapie is a fatal infectious neurodegenerative disease for which susceptibility is associated with polymorphisms in the ovine prion protein (PrP) gene. Scrapie-eradication programmes are based on eliminating the susceptible VRQ allele and/or breeding for the resistant ARR allele. In rare breeds or

  1. Postmortem diagnosis of preclinical and clinical scrapie in sheep by the detection of disease-associated PrP in their rectal mucosa.

    Science.gov (United States)

    González, L; Dagleish, M P; Bellworthy, S J; Sisó, S; Stack, M J; Chaplin, M J; Davis, L A; Hawkins, S A C; Hughes, J; Jeffrey, M

    2006-03-11

    Samples of tissue from the central nervous system (cns), the lymphoreticular system (lrs) and the rectal mucosa of a large number of scrapie-exposed sheep, with and without signs of clinical disease, were examined immunohistochemically for evidence of disease-associated prion protein (PrP(d)). The rectal mucosa has received almost no attention so far in scrapie diagnosis, despite its abundant rectoanal mucosa-associated lymphoid tissue, and its accessibility. The scrapie-confirmed cases included 244 with clinical disease, of which 237 (97.1 per cent) were positive in the rectal mucosa, and 121 apparently healthy sheep, of which 104 (86 per cent) were positive in the rectal mucosa. PrP(d) was detected in 86.4 to 91.5 per cent of the other lrs tissues of the healthy sheep examined and in 77.7 per cent of their cns tissues. The stage of infection, therefore, affected the probability of a positive result in the rectal mucosa, whereas the breed, PrP genotype, age and sex had little or no independent effect. Accumulations of PrP(d) were observed in the rectal mucosa and other lrs tissues of vrq/arr sheep with preclinical and clinical scrapie, albeit with a lower frequency and magnitude than in sheep of other PrP genotypes. Western immunoblotting analyses of samples of rectal mucosa gave the characteristic PrP glycoprofile, with a sensitivity similar to that of immunohistochemistry.

  2. Transcriptome analysis of CNS immediately before and after the detection of PrP(Sc) in SSBP/1 sheep scrapie.

    Science.gov (United States)

    Gossner, Anton G; Hopkins, John

    2014-10-10

    Sheep scrapie is a transmissible spongiform encephalopathy (TSE), progressive and fatal neurodegenerative diseases of the central nervous system (CNS) linked to the accumulation of misfolded prion protein, PrP(Sc). New Zealand Cheviot sheep, homozygous for the VRQ genotype of the PRNP gene are most susceptible with an incubation period of 193 days with SSBP/1 scrapie. However, the earliest time point that PrP(Sc) can be detected in the CNS is 125 days (D125). The aim of this study was to quantify changes to the transcriptome of the thalamus and obex (medulla) at times immediately before (D75) and after (D125) PrP(Sc) was detected. Affymetrix gene arrays were used to quantify gene expression in the thalamus and Illumina DGE-tag profiling for obex. Ingenuity Pathway Analysis was used to help describe the biological processes of scrapie pathology. Neurological disease and Cancer were common Bio Functions in each tissue at D75; inflammation and cell death were major processes at D125. Several neurological receptors were significantly increased at D75 (e.g. CHRNA6, GRM1, HCN2), which might be clues to the molecular basis of psychiatric changes associated with TSEs. No genes were significantly differentially expressed at both D75 and D125 and there was no progression of events from earlier to later time points. This implies that there is no simple linear progression of pathological or molecular events. There seems to be a step-change between D75 and D125, correlating with the detection of PrP(Sc), resulting in the involvement of different pathological processes in later TSE disease.

  3. Discovery of a novel, monocationic, small-molecule inhibitor of scrapie prion accumulation in cultured sheep microglia and rov cells PLoS one

    Science.gov (United States)

    Prion diseases, including sheep scrapie are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrPC) to disease-associated prion protein (PrPSc). An aromatic monocationic furamidine analogue (DB772), which has previously demonstrated a...

  4. Relationship of PrPSc molecular properties with incubation time in a natural prion disease host: a characterization of three isolates of U.S. sheep scrapie

    Science.gov (United States)

    Determination of aspects of tertiary and quaternary structure of PrPSc associated with differences in disease presentation in the host is a key area of interest in the prion field. Previously, we determined that a U.S. scrapie isolate (136-VDEP) with a short incubation time upon passage in sheep als...

  5. A lympho-follicular microenvironment is required for pathological prion protein deposition in chronically inflamed tissues from scrapie-affected sheep.

    Directory of Open Access Journals (Sweden)

    Caterina Maestrale

    Full Text Available In sheep scrapie, pathological prion protein (PrP(Sc deposition occurs in the lymphoreticular and central nervous systems. We investigated PrP(Sc distribution in scrapie-affected sheep showing simultaneous evidence of chronic lymphofollicular, lymphoproliferative/non-lymphofollicular, and/or granulomatous inflammations in their mammary gland, lung, and ileum. To do this, PrP(Sc detection was carried out via immunohistochemistry and Western Blotting techniques, as well as through inflammatory cell immunophenotyping. Expression studies of gene coding for biological factors modulating the host's inflammatory response were also carried out. We demonstrated that ectopic PrP(Sc deposition occurs exclusively in the context of lymphofollicular inflammatory sites, inside newly formed and well-organized lymphoid follicles harboring follicular dendritic cells. On the contrary, no PrP(Sc deposition was detected in granulomas, even when they were closely located to newly formed lymphoid follicles. A significantly more consistent expression of lymphotoxin α and β mRNA was detected in lymphofollicular inflammation compared to the other two types, with lymphotoxin α and β signaling new lymphoid follicles' formation and, likely, the occurrence of ectopic PrP(Sc deposition inside them. Our findings suggest that, in sheep co-affected by scrapie and chronic inflammatory conditions, only newly formed lymphoid follicles provide a suitable micro-environment that supports the scrapie agent's replication in inflammatory sites, with an increased risk of prion shedding through body secretions/excretions.

  6. A lympho-follicular microenvironment is required for pathological prion protein deposition in chronically inflamed tissues from scrapie-affected sheep.

    Science.gov (United States)

    Maestrale, Caterina; Di Guardo, Giovanni; Cancedda, Maria Giovanna; Marruchella, Giuseppe; Masia, Mariangela; Sechi, Stefania; Macciocu, Simonetta; Santucciu, Cinzia; Petruzzi, Mara; Ligios, Ciriaco

    2013-01-01

    In sheep scrapie, pathological prion protein (PrP(Sc)) deposition occurs in the lymphoreticular and central nervous systems. We investigated PrP(Sc) distribution in scrapie-affected sheep showing simultaneous evidence of chronic lymphofollicular, lymphoproliferative/non-lymphofollicular, and/or granulomatous inflammations in their mammary gland, lung, and ileum. To do this, PrP(Sc) detection was carried out via immunohistochemistry and Western Blotting techniques, as well as through inflammatory cell immunophenotyping. Expression studies of gene coding for biological factors modulating the host's inflammatory response were also carried out. We demonstrated that ectopic PrP(Sc) deposition occurs exclusively in the context of lymphofollicular inflammatory sites, inside newly formed and well-organized lymphoid follicles harboring follicular dendritic cells. On the contrary, no PrP(Sc) deposition was detected in granulomas, even when they were closely located to newly formed lymphoid follicles. A significantly more consistent expression of lymphotoxin α and β mRNA was detected in lymphofollicular inflammation compared to the other two types, with lymphotoxin α and β signaling new lymphoid follicles' formation and, likely, the occurrence of ectopic PrP(Sc) deposition inside them. Our findings suggest that, in sheep co-affected by scrapie and chronic inflammatory conditions, only newly formed lymphoid follicles provide a suitable micro-environment that supports the scrapie agent's replication in inflammatory sites, with an increased risk of prion shedding through body secretions/excretions.

  7. Strain typing of classical scrapie by transgenic mouse bioassay using protein misfolding cyclic amplification to replace primary passage.

    Directory of Open Access Journals (Sweden)

    Katy E Beck

    Full Text Available According to traditional murine bioassay methodology, prions must be serially passaged within a new host before a stable phenotype, and therefore a strain, can be assigned. Prions often transmit with difficulty from one species to another; a property termed the transmission barrier. Transgenic mouse lines that over express prion protein (PrP genes of different species can circumvent the transmission barrier but serial passages may still be required, particularly if unknown strains are encountered. Here we sought to investigate whether protein misfolding cyclic amplification (PMCA, an in-vitro method of PrP(Sc replication, could be used to replace serial passage of VRQ/VRQ classical scrapie isolates undergoing strain typing in ovine transgenic tg338 mice. Two classical scrapie field isolates that do not readily transmit to wild-type mice underwent bioassay in tg338 mice pre- and post- PMCA and the phenotype of disease in inoculated mice was compared. For one of the sources investigated, the PMCA product gave rise to the same disease phenotypes in tg338 mice as traditional bioassay, as indicated by lesion profile, IHC analysis and Western blot, whilst the second source produced phenotypic characteristics which were not identical with those that arose through traditional bioassay. These data show that differences in the efficiency of PMCA as a strain-typing tool may vary between ovine classical scrapie isolates and therefore suggest that the ability of PMCA to replace serial passage of classical scrapie in tg338 mice may depend on the strain present in the initial source.

  8. The effects of selective breeding against scrapie susceptibility on the genetic variability of the Latxa Black-Faced sheep breed

    Directory of Open Access Journals (Sweden)

    Legarra Andrés

    2006-09-01

    Full Text Available Abstract Breeding sheep populations for scrapie resistance could result in a loss of genetic variability. In this study, the effect on genetic variability of selection for increasing the ARR allele frequency was estimated in the Latxa breed. Two sources of information were used, pedigree and genetic polymorphisms (fifteen microsatellites. The results based on the genealogical information were conditioned by a low pedigree completeness level that revealed the interest of also using the information provided by the molecular markers. The overall results suggest that no great negative effect on genetic variability can be expected in the short time in the population analysed by selection of only ARR/ARR males. The estimated average relationship of ARR/ARR males with reproductive females was similar to that of all available males whatever its genotype: 0.010 vs. 0.012 for a genealogical relationship and 0.257 vs. 0.296 for molecular coancestry, respectively. However, selection of only ARR/ARR males implied important losses in founder animals (87 percent and low frequency alleles (30 percent in the ram population. The evaluation of mild selection strategies against scrapie susceptibility based on the use of some ARR heterozygous males was difficult because the genetic relationships estimated among animals differed when pedigree or molecular information was used, and the use of more molecular markers should be evaluated.

  9. Pathogenesis of scrapie in ARQ/ARQ sheep after subcutaneous infection: effect of lymphadenectomy and immune cell subset changes in relation to prion protein accumulation.

    Science.gov (United States)

    Chianini, F; Sisó, S; Ricci, E; Eaton, S L; Finlayson, J; Pang, Y; Hamilton, S; Steele, P; Reid, H W; Cantile, C; Sales, J; Jeffrey, M; Dagleish, M P; González, L

    2013-04-15

    It is well established that the infectious agent of scrapie can replicate in the lymphoreticular system (LRS). However, the effects of removal of LRS target tissues on the pathogenesis of the infection and the accumulation of disease-associated prion protein (PrP(d)) in LRS tissues on specific immune cell subsets are poorly understood aspects. To address these questions 16 ARQ/ARQ sheep were subcutaneously inoculated in the drainage area of the prefemoral lymph node with brain homogenate derived from Suffolk sheep naturally infected with scrapie. Fourteen sheep were then subjected to either early (14-17 days post-inoculation [dpi]) or late (175-201 dpi) lymphadenectomy and culled at preclinical or clinical stages of infection. Neither late nor even early lymphadenectomy prevented infection or had any effect on the accumulation of PrP(d) in the LRS or CNS suggesting a rapid organic dissemination of the infectious agent after inoculation. Lymph nodes from eight scrapie inoculated sheep selected on the basis of the amount of PrP(d) in their LRS tissues (negative, low or high) were examined for six different immune cell markers. The PrP(d) negative lymph nodes from two sheep with no evidence of scrapie infection showed lower numbers of cluster of determination (CD) 21 positive cells than PrP(d) positive nodes, irrespective of their location (hind leg or head). However, quantitative differences in the expression of this marker were not detected when comparing lymph nodes with low and high levels of PrP(d) accumulation, suggesting that proliferation of CD21 positive cells is related to scrapie infection, but not directly linked to the magnitude of PrP(d) accumulation. An additional observation of the study was that sheep that were methionin-threonine at codon 112 of the prion protein gene showed lower attack rates than methionine homozygotes (67% and 100%, respectively) and also generally lower levels of PrP(d) accumulation in the LRS and brain and increased survival

  10. Neuroanatomical distribution of abnormal prion protein in naturally occurring atypical scrapie cases in Great Britain.

    Science.gov (United States)

    Moore, Sarah Jo; Simmons, Marion; Chaplin, Melanie; Spiropoulos, John

    2008-11-01

    Scrapie belongs to a group of diseases known as the transmissible spongiform encephalopathies or prion diseases. Two different categories of naturally occurring scrapie have been identified: classical scrapie, which was first recorded around 1750, and atypical scrapie or 'Nor-98', which was first identified in Norway in 1998. The molecular characteristics of atypical scrapie have been well defined, but detailed descriptions of the neuropathological phenotype are rare since the majority of cases have been detected through active surveillance programmes where only brainstem and cerebellum are collected for statutory diagnosis. In order to characterise the neuropathology of naturally occurring atypical scrapie in sheep, we examined multiple brain levels from 15 whole brains from field cases of atypical scrapie, both clinical suspects and fallen stock, collected in Great Britain between 2004 and 2006. We found that the distribution of disease-associated prion protein (PrP(Sc)) and vacuolation in atypical scrapie cases are very different to both classical scrapie and experimental bovine spongiform encephalopathy in sheep. Immunolabelling for PrP(Sc) is mild and restricted at the obex and more intense and widespread rostrally, particularly in the cerebellum, substantia nigra, thalamus and basal nuclei. Intracellular immunolabelling types are not seen, but distinctive white matter immunolabelling is widespread. Vacuolation associated with PrP(Sc) deposits was not observed in the brainstem neuroanatomical areas commonly affected in classical scrapie and bovine spongiform encephalopathy, but was instead most prominent in the cerebellar cortex and neocortex. This is the largest comprehensive descriptive study of atypical scrapie pathology to date, and provides baseline data against which other natural or experimental cases can be compared. It also reinforces the current recommendation to collect cerebellum in addition to brainstem to enable confident confirmation of this

  11. PrP-associated resistance to scrapie in five highly infected goat herds.

    Science.gov (United States)

    Corbière, Fabien; Perrin-Chauvineau, Cécile; Lacroux, Caroline; Costes, Pierrette; Thomas, Myriam; Brémaud, Isabelle; Martin, Samuel; Lugan, Séverine; Chartier, Christophe; Schelcher, François; Barillet, Francis; Andreoletti, Olivier

    2013-01-01

    The PrP gene polymorphisms at codons 142 (I/M), 154 (R/H), 211 (R/Q), 222 (Q/K) and 240 (S/P) and their association with susceptibility to classical scrapie infection were investigated in five French goat herds displaying a high disease prevalence (>10%). On the basis of PrP(Sc) detection in the central nervous system and in various lymphoid tissues, 301 of 1343 goats were found to be scrapie infected. The statistical analyses indicated that while P(240) mutation had no direct impact on scrapie infection risk, the H(154), Q(211) and K(222) mutations were associated with high resistance to scrapie. The M(142) mutated allele was associated with a limited protection level against the disease. These results further reinforce the view that, like in sheep, the control and eradication of classical scrapie through the selection of certain PrP alleles could be envisaged in commercial goat population.

  12. Evidence of effective scrapie transmission via colostrum and milk in sheep

    OpenAIRE

    Konold, T.; Moore, SJ; Bellworthy, SJ; Terry, LA; Thorne, L.; Ramsay, A.; Salguero, FJ; Simmons, MM; Simmons, HA

    2013-01-01

    Background: Evidence for scrapie transmission from VRQ/VRQ ewes to lambs via milk was first reported in 2008 but in that study there were concerns that lateral transmission may have contributed to the high transmission rate observed since five control lambs housed with the milk recipients also became infected. This report provides further information obtained from two follow-up studies, one where milk recipients were housed separately after milk consumption to confirm the validity of the high...

  13. Identical pathogenesis and neuropathological phenotype of scrapie in valine, arginine, glutamine/valine, arginine, glutamine sheep infected experimentally by the oral and conjunctival routes.

    Science.gov (United States)

    González, L; Pitarch, J L; Martin, S; Thurston, L; Moore, J; Acín, C; Jeffrey, M

    2014-01-01

    The pathogenesis of scrapie in sheep after natural or oral exposure to the infectious agent generally involves the early accumulation of disease-associated prion protein (PrP(d)) in the lymphoreticular system (LRS). This phase is followed by neuroinvasion, for which two routes, ascending neural and haematogenous, have been postulated. The present study reports the use of immunohistochemistry to track the tissue progression of PrP(d) deposition in sheep of a single, highly scrapie-susceptible PrP genotype administered by the oral or conjunctival routes. Regardless of the route of infection, the earliest detection of PrP(d) was in gut- and pharynx-associated LRS tissues. Subsequently, the brain became PrP(d) positive simultaneously with other LRS tissues, but before the spinal cord and peripheral nervous tissues of the enteric, parasympathetic and sympathetic systems. The sites of initial PrP(d) accumulation in the brain were the dorsal motor nucleus of the vagus and the hypothalamus and their related circumventricular organs (the area postrema and the median eminence, respectively). These were the same for both routes of infection. Rapid progression to clinical disease was observed in sheep infected orally or conjunctivally, with definite signs of scrapie recorded at around 6 and 8 months after infection, respectively. Longer incubation periods in sheep infected by the conjunctival route were probably due to them receiving a lower dose than those infected orally. Irrespective of the route of infection, clinically affected sheep showed the same pathological phenotype (PrP(d) profile) and PrP(d) distribution throughout the brain. The identical peripheral and central pathogenesis observed in sheep of both groups suggests early dissemination of the infectious agent in the bloodstream and a common neuroinvasion pathway. The late involvement of the enteric and autonomic nervous system supports a haematogenous route of infection to the brain.

  14. Prion Protein Gene Variability in Spanish Goats. Inference through Susceptibility to Classical Scrapie Strains and Pathogenic Distribution of Peripheral PrPsc

    Science.gov (United States)

    Acín, Cristina; Martín-Burriel, Inmaculada; Monleón, Eva; Lyahyai, Jaber; Pitarch, José Luis; Serrano, Carmen; Monzón, Marta; Zaragoza, Pilar; Badiola, Juan José

    2013-01-01

    Classical scrapie is a neurological disorder of the central nervous system (CNS) characterized by the accumulation of an abnormal, partially protease resistant prion protein (PrPsc) in the CNS and in some peripheral tissues in domestic small ruminants. Whereas the pathological changes and genetic susceptibility of ovine scrapie are well known, caprine scrapie has been less well studied. We report here a pathological study of 13 scrapie-affected goats diagnosed in Spain during the last 9 years. We used immunohistochemical and biochemical techniques to discriminate between classical and atypical scrapie and bovine spongiform encephalopathy (BSE). All the animals displayed PrPsc distribution patterns and western blot characteristics compatible with classical scrapie. In addition, we determined the complete open reading frame sequence of the PRNP in these scrapie-affected animals. The polymorphisms observed were compared with those of the herd mates (n = 665) and with the frequencies of healthy herds (n = 581) of native Spanish goats (Retinta, Pirenaica and Moncaina) and other worldwide breeds reared in Spain (Saanen, Alpine and crossbreed). In total, sixteen polymorphic sites were identified, including the known amino acid substitutions at codons G37V, G127S, M137I, I142M, H143R, R151H, R154H, R211Q, Q222K, G232W, and P240S, and new polymorphisms at codons G74D, M112T, R139S, L141F and Q215R. In addition, the known 42, 138 and 179 silent mutations were detected, and one new one is reported at codon 122. The genetic differences observed in the population studied have been attributed to breed and most of the novel polymorphic codons show frequencies lower than 5%. This work provides the first basis of polymorphic distribution of PRNP in native and worldwide goat breeds reared in Spain. PMID:23580248

  15. Prion protein gene variability in Spanish goats. Inference through susceptibility to classical scrapie strains and pathogenic distribution of peripheral PrP(sc..

    Directory of Open Access Journals (Sweden)

    Cristina Acín

    Full Text Available Classical scrapie is a neurological disorder of the central nervous system (CNS characterized by the accumulation of an abnormal, partially protease resistant prion protein (PrP(sc in the CNS and in some peripheral tissues in domestic small ruminants. Whereas the pathological changes and genetic susceptibility of ovine scrapie are well known, caprine scrapie has been less well studied. We report here a pathological study of 13 scrapie-affected goats diagnosed in Spain during the last 9 years. We used immunohistochemical and biochemical techniques to discriminate between classical and atypical scrapie and bovine spongiform encephalopathy (BSE. All the animals displayed PrP(sc distribution patterns and western blot characteristics compatible with classical scrapie. In addition, we determined the complete open reading frame sequence of the PRNP in these scrapie-affected animals. The polymorphisms observed were compared with those of the herd mates (n = 665 and with the frequencies of healthy herds (n = 581 of native Spanish goats (Retinta, Pirenaica and Moncaina and other worldwide breeds reared in Spain (Saanen, Alpine and crossbreed. In total, sixteen polymorphic sites were identified, including the known amino acid substitutions at codons G37V, G127S, M137I, I142M, H143R, R151H, R154H, R211Q, Q222K, G232W, and P240S, and new polymorphisms at codons G74D, M112T, R139S, L141F and Q215R. In addition, the known 42, 138 and 179 silent mutations were detected, and one new one is reported at codon 122. The genetic differences observed in the population studied have been attributed to breed and most of the novel polymorphic codons show frequencies lower than 5%. This work provides the first basis of polymorphic distribution of PRNP in native and worldwide goat breeds reared in Spain.

  16. Prion protein gene variability in Spanish goats. Inference through susceptibility to classical scrapie strains and pathogenic distribution of peripheral PrP(sc.).

    Science.gov (United States)

    Acín, Cristina; Martín-Burriel, Inmaculada; Monleón, Eva; Lyahyai, Jaber; Pitarch, José Luis; Serrano, Carmen; Monzón, Marta; Zaragoza, Pilar; Badiola, Juan José

    2013-01-01

    Classical scrapie is a neurological disorder of the central nervous system (CNS) characterized by the accumulation of an abnormal, partially protease resistant prion protein (PrP(sc)) in the CNS and in some peripheral tissues in domestic small ruminants. Whereas the pathological changes and genetic susceptibility of ovine scrapie are well known, caprine scrapie has been less well studied. We report here a pathological study of 13 scrapie-affected goats diagnosed in Spain during the last 9 years. We used immunohistochemical and biochemical techniques to discriminate between classical and atypical scrapie and bovine spongiform encephalopathy (BSE). All the animals displayed PrP(sc) distribution patterns and western blot characteristics compatible with classical scrapie. In addition, we determined the complete open reading frame sequence of the PRNP in these scrapie-affected animals. The polymorphisms observed were compared with those of the herd mates (n = 665) and with the frequencies of healthy herds (n = 581) of native Spanish goats (Retinta, Pirenaica and Moncaina) and other worldwide breeds reared in Spain (Saanen, Alpine and crossbreed). In total, sixteen polymorphic sites were identified, including the known amino acid substitutions at codons G37V, G127S, M137I, I142M, H143R, R151H, R154H, R211Q, Q222K, G232W, and P240S, and new polymorphisms at codons G74D, M112T, R139S, L141F and Q215R. In addition, the known 42, 138 and 179 silent mutations were detected, and one new one is reported at codon 122. The genetic differences observed in the population studied have been attributed to breed and most of the novel polymorphic codons show frequencies lower than 5%. This work provides the first basis of polymorphic distribution of PRNP in native and worldwide goat breeds reared in Spain.

  17. Eradication of scrapie with selective breeding: are we nearly there?

    Directory of Open Access Journals (Sweden)

    Davidse Aart

    2010-05-01

    Full Text Available Abstract Background Following EU decision 2003/100/EC Member States have recently implemented sheep breeding programmes to reduce the prevalence of sheep with TSE susceptible prion genotypes. The present paper investigates the progress of the breeding programme in the Netherlands. The PrP genotype frequencies were monitored through time using two sets of random samples: one set covers the years 2005 to 2008 and is taken from national surveillance programme; the other is taken from 168 random sheep farms in 2007. The data reveal that although the level of compliance to the breeding programme has been high, the frequency of susceptible genotypes varies substantially between farms. The 168 sheep farms are a subset of 689 farms participating in a postal survey inquiring about management and breeding strategies. This survey aimed to identify how much these strategies varied between farms, in order to inform assessment of the expected future progress towards eradication of classical scrapie. Results On the one hand, we found that compliance to the national breeding program has been high, and the frequency of resistant genotypes is expected to increase further in the next few years. On the other hand, we observed a large variation in prevalence of the scrapie resistant PrP genotype ARR between farms, implicating a large variation of genetic resistance between farms. Substantial between-flock differences in management and breeding strategies were found in the postal survey, suggesting considerable variation in risk of scrapie transmission between farms. Conclusions Our results show that although there has been a good progress in the breeding for scrapie resistance and the average farm-level scrapie susceptibility in the Netherlands has been significantly reduced, still a considerable proportion of farms contain high frequencies of susceptible genotypes in their sheep population. Since 2007 the breeding for genetic resistance is voluntarily again, and

  18. Prion disease detection, PMCA kinetics, and IgG in urine from sheep naturally/experimentally infected with scrapie and deer with preclinical/clinical chronic wasting disease.

    Science.gov (United States)

    Rubenstein, Richard; Chang, Binggong; Gray, Perry; Piltch, Martin; Bulgin, Marie S; Sorensen-Melson, Sharon; Miller, Michael W

    2011-09-01

    Prion diseases, also known as transmissible spongiform encephalopathies, are fatal neurodegenerative disorders. Low levels of infectious agent and limited, infrequent success of disease transmissibility and PrP(Sc) detection have been reported with urine from experimentally infected clinical cervids and rodents. We report the detection of prion disease-associated seeding activity (PASA) in urine from naturally and orally infected sheep with clinical scrapie agent and orally infected preclinical and infected white-tailed deer with clinical chronic wasting disease (CWD). This is the first report on PASA detection of PrP(Sc) from the urine of naturally or preclinical prion-diseased ovine or cervids. Detection was achieved by using the surround optical fiber immunoassay (SOFIA) to measure the products of limited serial protein misfolding cyclic amplification (sPMCA). Conversion of PrP(C) to PrP(Sc) was not influenced by the presence of poly(A) during sPMCA or by the homogeneity of the PrP genotypes between the PrP(C) source and urine donor animals. Analysis of the sPMCA-SOFIA data resembled a linear, rather than an exponential, course. Compared to uninfected animals, there was a 2- to 4-log increase of proteinase K-sensitive, light chain immunoglobulin G (IgG) fragments in scrapie-infected sheep but not in infected CWD-infected deer. The higher-than-normal range of IgG levels found in the naturally and experimentally infected clinical scrapie-infected sheep were independent of their genotypes. Although analysis of urine samples throughout the course of infection would be necessary to determine the usefulness of altered IgG levels as a disease biomarker, detection of PrP(Sc) from PASA in urine points to its potential value for antemortem diagnosis of prion diseases.

  19. Healthy sheep that differ in scrapie associated PRNP genotypes exhibit significant differences of expression pattern associated with immune response and cell-to-cell signalling in retropharyngeal lymph nodes.

    Science.gov (United States)

    Komolka, Katrin; Ponsuksili, Siriluck; Schwerin, Manfred

    2013-04-15

    The present study was conducted to test the hypothesis whether prion protein gene (PRNP) associated scrapie susceptibility is connected with physiological changes in tissue involved in pathogen uptake, migration and propagation. Jejunum, ileal Peyer's patches, retropharyngeal lymph nodes, brain stem and liver of healthy and non scrapie-infected sheep with PRNP genotypes representing the scrapie risk class R1 (scrapie-resistant) and R5 (scrapie-susceptible), respectively, were comparatively analysed by microarray technology and quantitative reverse transcriptase polymerase chain reaction (RT qPCR). Significantly higher expression levels of genes involved in immune response and cell communication pathways in retropharyngeal lymph nodes of R1 sheep in comparison with R5 animals strongly suggest PRNP associated physiological processes with impact as an early barrier in pathogen defence. Equal expression patterns in brain stem suggest no physiological differences in brain of healthy R1 and R5 animals. In addition, similar expression pattern in liver indicates that there are no transcriptional differences in genes of the hepatic energy metabolism between animals of scrapie classes R1 and R5.

  20. Infectious titres of sheep scrapie and bovine spongiform encephalopathy agents cannot be accurately predicted from quantitative laboratory test results.

    Science.gov (United States)

    González, Lorenzo; Thorne, Leigh; Jeffrey, Martin; Martin, Stuart; Spiropoulos, John; Beck, Katy E; Lockey, Richard W; Vickery, Christopher M; Holder, Thomas; Terry, Linda

    2012-11-01

    It is widely accepted that abnormal forms of the prion protein (PrP) are the best surrogate marker for the infectious agent of prion diseases and, in practice, the detection of such disease-associated (PrP(d)) and/or protease-resistant (PrP(res)) forms of PrP is the cornerstone of diagnosis and surveillance of the transmissible spongiform encephalopathies (TSEs). Nevertheless, some studies question the consistent association between infectivity and abnormal PrP detection. To address this discrepancy, 11 brain samples of sheep affected with natural scrapie or experimental bovine spongiform encephalopathy were selected on the basis of the magnitude and predominant types of PrP(d) accumulation, as shown by immunohistochemical (IHC) examination; contra-lateral hemi-brain samples were inoculated at three different dilutions into transgenic mice overexpressing ovine PrP and were also subjected to quantitative analysis by three biochemical tests (BCTs). Six samples gave 'low' infectious titres (10⁶·⁵ to 10⁶·⁷ LD₅₀ g⁻¹) and five gave 'high titres' (10⁸·¹ to ≥ 10⁸·⁷ LD₅₀ g⁻¹) and, with the exception of the Western blot analysis, those two groups tended to correspond with samples with lower PrP(d)/PrP(res) results by IHC/BCTs. However, no statistical association could be confirmed due to high individual sample variability. It is concluded that although detection of abnormal forms of PrP by laboratory methods remains useful to confirm TSE infection, infectivity titres cannot be predicted from quantitative test results, at least for the TSE sources and host PRNP genotypes used in this study. Furthermore, the near inverse correlation between infectious titres and Western blot results (high protease pre-treatment) argues for a dissociation between infectivity and PrP(res).

  1. A retrospective immunohistochemical study reveals atypical scrapie has existed in the United Kingdom since at least 1987.

    Science.gov (United States)

    Webb, Paul R; Powell, Linda; Denyer, Margaret; Marsh, Sarah; Weaver, Colin; Simmons, Marion M; Johns, Elizabeth; Sheehan, John; Horsfield, Peter; Lyth, Chris; Wilson, Christina; Long, Ann; Cawthraw, Saira; Saunders, Ginny C; Spencer, Yvonne I

    2009-11-01

    Atypical scrapie is a relatively recent discovery, and it was unknown whether it was a new phenomenon or whether it had existed undetected in the United Kingdom national flock. Before 1998, the routine statutory diagnosis of transmissible spongiform encephalopathy (TSE) in sheep relied on the presence of TSE vacuolation in the brainstem. This method would not have been effective for the detection of atypical scrapie. Currently, immunohistochemistry (IHC) and Western blot are commonly used for the differential diagnosis of classical and atypical scrapie. The IHC pattern of PrPd deposition in atypical scrapie is very different from that in classical scrapie using the same antibody. It is thus possible that because of a lack of suitable diagnostic techniques and awareness of this form of the disease, historic cases of atypical scrapie remain undiagnosed. Immunohistochemistry was performed on selected formalin-fixed, paraffin-embedded (FFPE) blocks of ovine brain from the Veterinary Laboratories Agency archives that were submitted for various reasons, including suspect neurological disorders, between 1980 and 1989. It was found that PrPd deposits in a single case were consistent with atypical scrapie. A method was developed to obtain a PrP genotype from FFPE tissues and was applied to material from this single case, which was shown to be AHQ/AHQ. This animal was a scrapie suspect from 1987, but diagnosis was not confirmed by the available techniques at that time.

  2. Prion protein and scrapie susceptibility

    NARCIS (Netherlands)

    Smits, M.A.; Bossers, A.; Schreuder, B.E.C.

    1997-01-01

    This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a

  3. Cell surface expression of PrP-c and the presence of scrapie prions in the blood of goats

    Science.gov (United States)

    Classical scrapie is a naturally occurring fatal brain disease of goats and sheep which is caused by prions, a novel class of infectious agent, and is accompanied by the accumulation of abnormal isoforms of prion protein (PrP-Sc) in certain neural and lymphoid tissues. Although collection of a blood...

  4. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine or cervid prion protein.

    Science.gov (United States)

    Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I

    2016-09-01

    Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.

  5. Cell-surface expression of PrPC and the presence of scrapie prions in the blood of goats.

    Science.gov (United States)

    Dassanayake, Rohana P; Schneider, David A; Herrmann-Hoesing, Lynn M; Truscott, Thomas C; Davis, William C; O'Rourke, Katherine I

    2012-05-01

    Although host-encoded prion protein (PrP(C)) expression in ovine PBMCs and prion infectivity in scrapie-infected sheep blood have been demonstrated, such studies have not been reported in goats. Therefore, this study characterized cell-surface expression of PrP(C) on PBMC subsets derived from normal goats and sheep, by flow cytometry, and determined prion infectivity in blood from a scrapie-infected goat using a transfusion bioassay in goat kids. Cell-surface PrP(C) expression was detected on all subsets of goat PBMCs. The highest PrP(C) cell-surface expression was found in CD2(+) T lymphocytes in goats. Transmission of infection was detected in all three recipients who received whole blood from a goat with classical scrapie. It was concluded that caprine PBMCs express PrP(C) similarly to sheep but with relative differences among PBMCs subsets, and that blood-borne infectious prions can be detected in scrapie-infected goats. Thus, similar to sheep, goat blood may be a suitable diagnostic target for the detection of scrapie infection.

  6. The limits of test-based scrapie eradication programs in goats.

    Science.gov (United States)

    Corbière, Fabien; Chauvineau-Perrin, Cécile; Lacroux, Caroline; Lugan, Séverine; Costes, Pierrette; Thomas, Myriam; Brémaud, Isabelle; Chartier, Christophe; Barillet, Francis; Schelcher, François; Andréoletti, Olivier

    2013-01-01

    Small ruminant post-mortem testing programs were initially designed for monitoring the prevalence of prion disease. They are now considered as a potential alternative to genetic selection for eradicating/controlling classical scrapie at population level. If such policy should be implemented, its success would be crucially dependent on the efficiency of the surveillance system used to identify infected flocks. In this study, we first determined the performance of post-mortem classical scrapie detection in eight naturally affected goat herds (total n = 1961 animals) according to the age at culling. These results provided us with necessary parameters to estimate, through a Monte Carlo simulation model, the performance of scrapie detection in a commercial population. According to this model, whatever the number of tests performed, post mortem surveillance will have limited success in identifying infected herds. These data support the contention that scrapie eradication programs relying solely on post mortem testing in goats will probably fail. Considering the epidemiological and pathological similarities of scrapie in sheep and goats, the efficiency of scrapie surveillance in both species is likely to be similar.

  7. Circulation of prions within dust on a scrapie affected farm.

    Science.gov (United States)

    Gough, Kevin C; Baker, Claire A; Simmons, Hugh A; Hawkins, Steve A; Maddison, Ben C

    2015-04-16

    Prion diseases are fatal neurological disorders that affect humans and animals. Scrapie of sheep/goats and Chronic Wasting Disease (CWD) of deer/elk are contagious prion diseases where environmental reservoirs have a direct link to the transmission of disease. Using protein misfolding cyclic amplification we demonstrate that scrapie PrP(Sc) can be detected within circulating dusts that are present on a farm that is naturally contaminated with sheep scrapie. The presence of infectious scrapie within airborne dusts may represent a possible route of infection and illustrates the difficulties that may be associated with the effective decontamination of such scrapie affected premises.

  8. A Targeted Survey for Scrapie in Jos Plateau State, Nigeria

    OpenAIRE

    Nwankiti, O. O.; Ikeh, E. I.; Arowolo, O. A.; Nwankiti, A. J.; M. O. Odugbo; T. Seuberlich

    2013-01-01

    Scrapie, a disease of sheep and goats with a progressive course and fatal outcome, has not been identified in Nigeria. Anecdotal scrapie reports by livestock workers abound. Livestock diseases like scrapie form huddles in livestock economics of countries. For 8 months we surveyed for scrapie targeting emergency/casualty slaughter sheep and goats in Jos, Nigeria. We clinically examined 510 sheep and 608 goats of local breeds, aged from 12 months to 5 years. In total 31 (5.10%) goats and no she...

  9. Fluorescence spectroscopy of the retina from scrapie-infected mice.

    Science.gov (United States)

    Bose, Sayantan; Schönenbrücher, Holger; Richt, Jürgen A; Casey, Thomas A; Rasmussen, Mark A; Kehrli, Marcus E; Petrich, Jacob W

    2013-01-01

    Recently, we have proposed that the fluorescence spectra of sheep retina can be well correlated with the presence or absence of scrapie. Scrapie is the most widespread TSE (transmissible spongiform encephalopathy) affecting sheep and goats worldwide. Mice eyes have been previously reported as a model system to study age-related accumulation of lipofuscin, which has been investigated by monitoring the increasing fluorescence with age covering its entire life span. The current work aims at developing mice retina as a convenient model system to diagnose scrapie and other fatal TSE diseases in animals such as sheep and cows. The objective of the research reported here was to determine whether the spectral features are conserved between two different species namely mice and sheep, and whether an appropriate small animal model system could be identified for diagnosis of scrapie based on the fluorescence intensity in retina. The results were consistent with the previous reports on fluorescence studies of healthy and scrapie-infected retina of sheep. The fluorescence from the retinas of scrapie-infected sheep was significantly more intense and showed more heterogeneity than that from the retinas of uninfected mice. Although the structural characteristics of fluorescence spectra of scrapie-infected sheep and mice eyes are slightly different, more importantly, murine retinas reflect the enhancement of fluorescence intensity upon infecting the mice with scrapie, which is consistent with the observations in sheep eyes.

  10. EFSA BIOHAZ Panel (EFSA Panel on Biological Hazards), 2014. Scientific Opinion on the scrapie situation in the EU after 10 years of monitoring and control in sheep and goats

    DEFF Research Database (Denmark)

    Hald, Tine; Baggesen, Dorte Lau

    To assess the effectiveness of the strategies implemented in the European Union (EU) to control Classical scrapie (CS), epidemiological data have been compared in the context of the efforts in terms of control measures applied over time. Official EU surveillance data and results from questionnaire...

  11. 9 CFR 79.4 - Designation of scrapie-positive animals, high-risk animals, exposed animals, suspect animals...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Designation of scrapie-positive... (INCLUDING POULTRY) AND ANIMAL PRODUCTS SCRAPIE IN SHEEP AND GOATS § 79.4 Designation of scrapie-positive..., noncompliant flocks, and source flocks; notice to owners. (a) Designation. A designated scrapie...

  12. CD21-positive follicular dendritic cells: A possible source of PrPSc in lymph node macrophages of scrapie-infected sheep.

    Science.gov (United States)

    Herrmann, Lynn M; Cheevers, William P; Davis, William C; Knowles, Donald P; O'Rourke, Katherine I

    2003-04-01

    Natural sheep scrapie is a prion disease characterized by the accumulation of PrP(Sc) in brain and lymphoid tissues. Previous studies suggested that lymph node macrophages and follicular dendritic cells (FDC) accumulate PrP(Sc). In this study, lymph nodes were analyzed for the presence of PrP(Sc) and macrophage or FDC markers using dual immunohistochemistry. A monoclonal antibody (mAb) to the C-terminus of PrP reacted with CD172a+ macrophages and CD21+ FDC processes in secondary follicles. However, a PrP N-terminus-specific mAb reacted with CD21+ FDC processes but not CD172a+ macrophages in secondary follicles. Neither the PrP N-terminus nor C-terminus-specific mAb reacted with CD172a+ macrophages in the medulla. These results indicate that lymph node follicular macrophages acquire PrP(Sc) by phagocytosis of CD21+ FDC processes. The results also suggest that follicular macrophages have proteases that process full-length PrP(Sc) to N-terminally truncated PrP(Sc).

  13. Evidence of scrapie transmission via milk

    Directory of Open Access Journals (Sweden)

    Moore S Jo

    2008-04-01

    Full Text Available Abstract Background The risk of scrapie infection increases with increased duration and proximity of contact between sheep at lambing. Scrapie infectivity has not been detected in milk but cellular prion protein, the precursor of disease-associated prion protein PrPd, has been found in milk from ruminants. To determine whether milk is able to transmit scrapie, 18 lambs with a prion protein genotype associated with high susceptibility to scrapie (VRQ/VRQ were fed milk from twelve scrapie-affected ewes of the same genotype, and 15 VRQ/VRQ sheep reared on scrapie-free dams served as controls. Results Three lambs fed milk from scrapie-affected ewes were culled due to intercurrent diseases at 43, 44 and 105 days of age respectively, and PrPd was detected in the distal ileum of the first two lambs, whilst PrPd was not found in lymphoreticular tissues in the third lamb. A control lamb, housed in a separate pen and culled at 38 days of age, was also negative for PrPd in a range of tissues. Samples of recto-anal mucosa associated lymphoid tissue collected from the remaining 15 live lambs at seven months of age (between five to seven months after mixing were positive for PrPd in the scrapie milk recipients, whereas PrPd was not detected in the remaining 14 controls at that time. A subsequent sample collected from control lambs revealed PrPd accumulation in two of five lambs eight months after mixing with scrapie milk recipients suggestive of an early stage of infection via lateral transmission. By contrast, the control sheep housed in the same building but not mixed with the scrapie milk recipients were still negative for PrPd. Conclusion The presence of PrPd in distal ileum and rectal mucosa indicates transmission of scrapie from ewe to lamb via milk (or colostrum although it is not yet clear if such cases would go on to develop clinical disease. The high level of infection in scrapie-milk recipients revealed by rectal mucosal testing at approximately

  14. Advanced survival models for risk-factor analysis in scrapie. : PrP genotype influence on scrapie infection risk and incubation period.

    OpenAIRE

    Corbière, Fabien; Barillet, Francis; Andréoletti, Olivier; Fidelle, Francis; Laphitz-Bordet, Nathalie; Schelcher, François; Joly, Pierre

    2007-01-01

    International audience; Because of the confounding effects of long incubation duration and flock management, accurate epidemiological studies of scrapie outbreaks are difficult to carry out. In this study, 641 Manech red-faced sheep from six scrapie-affected field flocks in Pyr?es Atlantiques, France, were monitored for clinical scrapie over a 6-9 year period. Over this period, 170 scrapie clinical cases were recorded and half of the culled animals were submitted for post-mortem transmissible...

  15. 9 CFR 79.7 - Waiver of requirements for scrapie control pilot projects.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Waiver of requirements for scrapie... PRODUCTS SCRAPIE IN SHEEP AND GOATS § 79.7 Waiver of requirements for scrapie control pilot projects. (a) The Administrator may waive the following requirements of this part for participants in a...

  16. Epidemiological analysis of data for scrapie in Great Britain

    NARCIS (Netherlands)

    Hagenaars, T.H.J.; Donnelly, C.; Ferguson, N.M.

    2006-01-01

    In recent years, the control or eradication of scrapie and any other transmissible spongiform encephalopathies (TSEs) possibly circulating in the sheep population has become a priority in Britain and elsewhere in Europe. A better understanding of the epidemiology of scrapie would greatly aid the dev

  17. A Targeted Survey for Scrapie in Jos Plateau State, Nigeria

    Directory of Open Access Journals (Sweden)

    O. O. Nwankiti

    2013-01-01

    Full Text Available Scrapie, a disease of sheep and goats with a progressive course and fatal outcome, has not been identified in Nigeria. Anecdotal scrapie reports by livestock workers abound. Livestock diseases like scrapie form huddles in livestock economics of countries. For 8 months we surveyed for scrapie targeting emergency/casualty slaughter sheep and goats in Jos, Nigeria. We clinically examined 510 sheep and 608 goats of local breeds, aged from 12 months to 5 years. In total 31 (5.10% goats and no sheep were clinically suspicious for scrapie. Caudal brainstem tissues of suspect animals collected postmortem were analyzed for the disease specific form of the prion protein, PrPSc, using Bio-Rad’s TeSeE ELISA rapid test kit. No sample was positive for scrapie. Fluorescent antibody test for rabies and H&E staining on samples were carried out for differential diagnosis. These showed no pathological lesions indicative for neurological disease. While our findings do not exclude the presence of scrapie in Jos, we demonstrate that targeted sampling of small ruminants for neuroinfectious disease is feasible in developing countries, pointing to the possibility of implementing such a monitoring scheme in Nigeria to prevent economic losses in small ruminant livestock as scrapie caveats from endemic countries have shown.

  18. Comparison of two automated immunohistochemical procedures for the diagnosis of scrapie in domestic sheep and chronic wasting disease in North American white-tailed deer (Odocoileus virginianus) and mule deer (Odocoileus hemionus).

    Science.gov (United States)

    Baszler, T V; Kiupel, M; Williams, E S; Thomsen, B V; Gidlewski, T; Montgomery, D L; O'Rourke, K I; Hall, S M

    2006-03-01

    Two commercially available automated immunohistochemistry platforms, Ventana NexES and DakoCytomation Autostainer Universal Staining System, were compared for diagnosing sheep scrapie and cervid chronic wasting disease. Both automated platforms used the same antiprion protein monoclonal primary antibodies, but different platform-specific linker and amplification reagents and procedures. Duplicate sections of brainstem (at the level of the obex) and lymphoid tissue (retropharyngeal lymph node or tonsil) from the same tissue block were immunostained for the comparison. Examination of 1,020 tissues from 796 sheep revealed 100% concordance of results between the Ventana NexES and DakoCytomation platforms for diagnosing sheep scrapie from lymphoid tissue (103/103 positive; 405/405 negative) and brainstem (120/120 positive; 392/392 negative). Similarly, examination of 1,008 tissues from 504 white-tailed deer revealed 100% concordance between the Ventana NexES and DakoCytomation platforms for diagnosing chronic wasting disease from lymphoid tissue (104/104 positive; 400/400 negative) and brainstem (104/104 positive; 400/400 negative). Examination of 1,152 tissues from 482 mule deer revealed a concordance of 98.6% in lymphoid tissue and 99.9% in brainstem between the Ventana NexES and DakoCytomation platforms for diagnosing chronic wasting disease. The results indicate equivalence or near equivalence between the DakoCytomation and Ventana NexES autostainer platforms for identification of the disease-associated prion protein (PrPd)-positive and PrPd-negative brain and lymphoid tissues in sheep, white-tailed deer, and mule deer.

  19. Advanced survival models for risk-factor analysis in scrapie

    OpenAIRE

    2007-01-01

    Because of the confounding effects of long incubation duration and flock management, accurate epidemiological studies of scrapie outbreaks are difficult to carry out. In this study, 641 Manech red-faced sheep from six scrapie-affected field flocks in Pyrénées Atlantiques, France, were monitored for clinical scrapie over a 6–9 year period. Over this period, 170 scrapie clinical cases were recorded and half of the culled animals were submitted for post-mortem transmissible spongiform encephalop...

  20. Changes in HSP gene and protein expression in natural scrapie with brain damage

    Directory of Open Access Journals (Sweden)

    Serrano Carmen

    2011-01-01

    Full Text Available Abstract Heat shock proteins (Hsp perform cytoprotective functions such as apoptosis regulation and inflammatory response control. These proteins can also be secreted to the extracellular medium, acting as inflammatory mediators, and their chaperone activity permits correct folding of proteins and avoids the aggregation of anomalous isoforms. Several studies have proposed the implication of Hsp in prion diseases. We analysed the gene expression and protein distribution of different members of the Hsp27, Hsp70, and Hsp90 families in the central nervous system of sheep naturally infected with scrapie. Different expression profiles were observed in the areas analysed. Whereas changes in transcript levels were not observed in the cerebellum or medulla oblongata, a significant decrease in HSP27 and HSP90 was detected in the prefrontal cortex. In contrast, HSP73 was over-expressed in diencephalons of scrapie animals. Western blotting did not reveal significant differences in Hsp90 and Hsp70 protein expression between scrapie and control animals. Expression rates identified by real-time RT-PCR and western blotting were compared with the extent of classical scrapie lesions using stepwise regression. Changes in Hsp gene and protein expression were associated with prion protein deposition, gliosis and spongiosis rather than with apoptosis. Finally, immunohistochemistry revealed intense Hsp70 and Hsp90 immunolabelling in Purkinje cells of scrapie sheep. In contrast, controls displayed little or no staining in these cells. The observed differences in gene expression and protein distribution suggest that the heat shock proteins analysed play a role in the natural form of the disease.

  1. Propagation of ovine prions from "poor" transmitter scrapie isolates in ovine PrP transgenic mice.

    Science.gov (United States)

    Thackray, Alana M; Hopkins, Lee; Lockey, Richard; Spiropoulos, John; Bujdoso, Raymond

    2012-02-01

    Ovine prion strains have typically been identified by their transmission properties, which include incubation time and lesion profile, in wild type mice. The existence of scrapie isolates that do not propagate in wild type mice, defined here as "poor" transmitters, are problematic for conventional prion strain typing studies as no incubation time or neuropathology can be recorded. This may arise because of the presence of an ovine prion strain within the original inoculum that does not normally cross the species barrier into wild type mice or the presence of a low dose of an infectious ovine prion strain that does. Here we have used tg59 and tg338 mouse lines, which are transgenic for ovine ARQ or VRQ PrP, respectively, to strain type "poor" transmitter ovine scrapie isolates. ARQ and VRQ homozygous "poor" transmitter scrapie isolates were successfully propagated in both ovine PrP transgenic mouse lines. We have used secondary passage incubation time, PrPSc immunohistochemistry and molecular profile, to show that different prion strains can be isolated from different "poor" transmitter samples during serial passage in ovine PrP transgenic mice. Our observations show that poor or inadequate transmissibility of some classical scrapie isolates in wild type mice is associated with unique ovine prion strains in these particular sheep scrapie samples. In addition, the analysis of the scrapie isolates used here revealed that the tg338 mouse line was more versatile and more robust at strain typing ovine prions than tg59 mice. These novel observations in ovine PrP transgenic mice highlight a new approach to ovine prion strain typing.

  2. Polymorphisms of PRNP and their effects on litter size and risk estimation for scrapie in Hu sheep%湖羊PRNP多态性及其对产羔数影响和抗痒病风险评价

    Institute of Scientific and Technical Information of China (English)

    朱庆丰; 刁俊超; 潘磊; 刘怡孝; 石国庆; 管峰

    2012-01-01

    It has been confirmed that the polymorphisms of prion protein gene (PRNP) have a strong correlation to scrapie in sheep. In this study, the polymorphisms of PRNP encoding region at 136, 154 and 171 site in Hu sheep were analyzed by PCR-RFLP and sequencing. The genotypes and their effects on litter size were analyzed and the risk levels for scrapie were estimated simultaneously. The results showed that all the reported polymorphisms were detected at 120 in Hu sheep, the domain alleles were A136 (94.2%), R154 (99.2%) and Q171 (62.9%), respectively. There were 8 different haplotypes were detected and the ARQ (56.6%) had the highest frequency, the second was ARR (21.3%). A new found haplotype TRK had low frequency of 0.4%. The genotypes ARQ/ARQ (29.2%) and ARR/ARQ (27.5%) had the significant higher frequencies than other genotypes. The resistant ARR/ARR had a low frequency of 4.2%, no VRQ/VRQ genotype was detected which regarded as the highest susceptible. The predominant genotypes were corresponded to the scrapie risk score of R1 (4.2%) and R2 (35.0%), R3 (47.5%). It can be concluded that Hu sheep has a middle or low susceptibility to natural scrapie and the predominant PRNP genotype has no significant effects on litter size.%为了对湖羊的抗痒病选育提供实验依据,本研究采用PCR-RFLP和测序方法,对120只湖羊PRNP编码区136位、154位和171位密码子多样性进行检测,分析PRNP多样性和基因型对产羔数的影响,并对湖羊痒病易感性进行评估.结果表明,在湖羊中发现了之前研究报道的3个位点所有突变,其优势等位基因分别为A136 (94.2%),R154 (99.2%)和Q171 (62.9%).在检测的8种单倍型中,ARQ (56.6%)和ARR (21.3%)为主要单倍型.本研究还在湖羊中发现新的单倍型TRK (HM639758),但比例仅为0.4%.群体中ARQ/ARQ (29.2%)和ARR/ARQ (27.5%)为优势基因型,而抗病性基因型ARR/ARR仅占4.2%,未发现VRQ/VRQ基因型.湖羊主要隶属于抗病力较高的R1

  3. Sheep scrapie susceptibility-linked polymorphisms do not modulate the initial binding of cellular to disease-associated prion protein prior to conversion

    NARCIS (Netherlands)

    Rigter, A.; Bossers, A.

    2005-01-01

    Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and susceptibilit

  4. RECTAL BIOPSY IN SHEEP AND GOATS FOR MONITORING AND ANTE-MORTEM DIAGNOSIS OF SCRAPIE: NUMBER OF LYMPHOID FOLLICLES IN TWO CONSECUTIVE COLLECTIONS

    Directory of Open Access Journals (Sweden)

    Helen Caroline Raksa

    2016-07-01

    O acúmulo da PrPSc em tecidos linfoides levou ao desenvolvimento de procedimentos de biopsia para o diagnóstico ante mortem da scrapie em ovinos, utilizando tecidos acessíveis como a tonsila(5 e terceira pálpebra(6, e a técnica de imuno-histoquímica (IHQ. Por outro lado, a grande área de folículos linfoides presente no reto de ovinos(7 tornou a biopsia retal uma possibilidade de diagnóstico ante mortem da scrapie. Amostras da mucosa retal têm sido colhidas e analisadas por meio de provas de IHQ para avaliar a presença de PrPSc no tecido linfoide associado à mucosa retoanal (RAMALT, do inglês Recto-Anal Mucosa Associated Lymphoid Tissue(8,9. No Brasil, o primeiro relato de scrapie foi em 1978, em um ovino Hampshire Down, importado da Inglaterra(10. Segundo a OIE, de 2008 a 2014 foram sacrificados 41 animais no país, em surtos de scrapie(11. Desde 2008, o diagnóstico de scrapie é realizado por meio da técnica de IHQ a partir de amostras do SNC e tecidos linfoides(12. Porém, no caso de tecidos linfoides associados à mucosa retal, pode haver necessidade de novas colheitas em curtos intervalos de tempo devido à escassez de tecido para o diagnóstico da doença que, segundo Leal et al.(13, deve ser de no mínimo três folículos linfoides (FL por amostra. Visando ao reconhecimento de boas técnicas para o monitoramento e o diagnóstico ante mortem da scrapie, o presente estudo teve por objetivo avaliar a quantidade de tecido linfoide associado à mucosa retal obtido pela técnica de biopsia retal e com vistas à avaliação imuno-histoquímica, bem como a possibilidade de se realizarem dois procedimentos de biopsia consecutivos, em diferentes intervalos de tempo, em ovinos e caprinos.

  5. Heart rate variability analysis in sheep affected by transmissible spongiform encephalopathies

    Directory of Open Access Journals (Sweden)

    Konold Timm

    2011-12-01

    Full Text Available Abstract Background The function of the autonomic nervous system can be assessed by determining heart rate variability (HRV, which is impaired in some brainstem diseases in humans. Transmissible spongiform encephalopathies (TSEs in sheep are diseases characterised by accumulation of disease-associated prion protein in the brainstem, including nuclei of the parasympathetic nervous system. This study was undertaken to assess whether analysis of HRV can be used as an aid in the diagnosis of TSEs in clinically affected, naturally or experimentally infected sheep. Findings When HRV indices were compared between 41 clinical TSE cases (18 sheep infected with scrapie and 23 sheep infected with bovine spongiform encephalopathy, 11 control sheep and six sheep reported as scrapie suspects or dosed with BSE brain homogenate, which were not confirmed as TSE cases by postmortem tests, no significant differences were found between the groups. Median heart rate was significantly different but only when sheep were grouped by gender: it was higher in female TSE cases than in control sheep and higher in female than castrated male ovine classical BSE cases. Conclusions HRV analysis was not useful as a diagnostic aid for TSEs of sheep.

  6. Scrapie : in vitro- and in vivo-separation of infectivity and scrapie-associated fibrils (SAFs)

    NARCIS (Netherlands)

    Braig, Henk Ronald

    1995-01-01

    The sheep and goat disease scrapie adapted to hamsters was studied as a model for unconventionals low virus diseases which are rare, fatal, spongiform encephalopathies of animals and man characterized by sometimes extreme long incubation periods, an apparent absence of any host immune reaction, and

  7. Abnormalities in Brainstem Auditory Evoked Potentials in Sheep with Transmissible Spongiform Encephalopathies and Lack of a Clear Pathological Relationship

    Directory of Open Access Journals (Sweden)

    Timm Konold

    2016-08-01

    Full Text Available Scrapie is a transmissible spongiform encephalopathy (TSE, which causes neurological signs in sheep but confirmatory diagnosis is usually made postmortem on examination of the brain for TSE-associated markers like vacuolar changes and disease-associated prion protein (PrPSc. The objective of this study was to evaluate whether testing of brainstem auditory evoked potentials (BAEPs at two different sound levels could aid in the clinical diagnosis of TSEs in sheep naturally or experimentally infected with different TSE strains [classical and atypical scrapie and bovine spongiform encephalopathy (BSE] and whether any BAEP abnormalities were associated with TSE-associated markers in the auditory pathways.BAEPs were recorded from 141 clinically healthy sheep of different breeds and ages that tested negative for TSEs on postmortem tests to establish a reference range and to allow comparison with 30 sheep clinically affected or exposed to classical scrapie without disease confirmation (test group 1 and 182 clinically affected sheep with disease confirmation (test group 2. Abnormal BAEPs were found in seven sheep (23% of group 1 and 42 sheep (23% of group 2. The proportion of sheep with abnormalities did not appear to be influenced by TSE strain or prion protein gene polymorphisms. When the magnitude of TSE-associated markers in the auditory pathways was compared between a subset of 12 sheep with and 12 sheep without BAEP abnormalities in group 2, no significant differences in the total PrPSc or vacuolation scores in the auditory pathways could be found. However, the data suggested that there was a difference in the PrPSc scores depending on the TSE strain because PrPSc scores were significantly higher in sheep with BAEP abnormalities infected with classical and L-type BSE but not with classical scrapie.The results indicated that BAEPs may be abnormal in sheep infected with TSEs but the test is not specific for TSEs, and that neither vacuolation nor Pr

  8. 从羊瘙痒症到疯牛病——朊病毒发现史%From the Scrapie Syndrome of sheep and goats to the mad cow disease-the history of the discovery of prion

    Institute of Scientific and Technical Information of China (English)

    刘锐; 翁屹

    2009-01-01

    从1730年人们发现羊瘙痒症开始,克-雅氏症、库鲁病、疯牛病等一系列疾病随之出现.在库鲁病的研究中,美国科学家盖达塞克发现其病原体不具有DNA或RNA特性,并因此获得了1976年的诺贝尔生理学医学奖.其后,另一位美国科学家普鲁塞纳在进一步研究中,发现了以蛋白质为遗传媒介的新型病毒--朊病毒,并因此获得了1997年诺贝尔生理学医学奖.朊病毒的发现是生命科学研究中的重大事件,为人类战胜羊瘙痒症、克-雅氏症、库鲁病和疯牛病等一系列疾病奠定了理论基础.%Since the discovery of Scrapie Syndrome in sheep and goats in 1730, there emerged a series of diseases such as Creutzfeldt-Jakob disease, kuru disease and mad cow disease etc. In the research of kuru disease, the American scientist D. Carlteton Gajdusek found a new virus without the characteristic of DNA and RNA, which was awarded the Nobel Prize in physiology in 1976. Since then another American sci-entist, Stanley B. Prusiner, found a new virus-prion, taking protein as the genetic medium, which was awar-ded the Nobel prize in physiology and medicine in 1997. The discovery of prion is a great landmark in the re-search of life science, which laid a theoretical foundation for people to conquer n series of diseases such as Scrapie syndrome in sheep and goats, Creutzfeldt-Jakob disease, kuru disease and mad cow disease etc.

  9. Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks

    NARCIS (Netherlands)

    Acutis, P.L.; Bossers, A.; Priem, J.; Riina, M.V.; Peletto, S.; Mazza, M.; Casalone, C.; Forloni, G.; Ru, G.; Caramelli, M.

    2006-01-01

    Susceptibility to scrapie in sheep is influenced by polymorphisms of the prion protein (PrP) gene, whereas no strong association between genetics and scrapie has yet been determined in goats due to the limited number of studies on these animals. In this case¿control study on 177 goats from six Itali

  10. Pruritus is a common feature in sheep infected with the BSE agent

    Directory of Open Access Journals (Sweden)

    Jeffrey Martin

    2008-04-01

    Full Text Available Abstract Background The variability in the clinical or pathological presentation of transmissible spongiform encephalopathies (TSEs in sheep, such as scrapie and bovine spongiform encephalopathy (BSE, has been attributed to prion protein genotype, strain, breed, clinical duration, dose, route and type of inoculum and the age at infection. The study aimed to describe the clinical signs in sheep infected with the BSE agent throughout its clinical course to determine whether the clinical signs were as variable as described for classical scrapie in sheep. The clinical signs were compared to BSE-negative sheep to assess if disease-specific clinical markers exist. Results Forty-seven (34% of 139 sheep, which comprised 123 challenged sheep and 16 undosed controls, were positive for BSE. Affected sheep belonged to five different breeds and three different genotypes (ARQ/ARQ, VRQ/VRQ and AHQ/AHQ. None of the controls or BSE exposed sheep with ARR alleles were positive. Pruritus was present in 41 (87% BSE positive sheep; the remaining six were judged to be pre-clinically infected. Testing of the response to scratching along the dorsum of a sheep proved to be a good indicator of clinical disease with a test sensitivity of 85% and specificity of 98% and usually coincided with weight loss. Clinical signs that were displayed significantly earlier in BSE positive cases compared to negative cases were behavioural changes, pruritic behaviour, a positive scratch test, alopecia, skin lesions, teeth grinding, tremor, ataxia, loss of weight and loss of body condition. The frequency and severity of each specific clinical sign usually increased with the progression of disease over a period of 16–20 weeks. Conclusion Our results suggest that BSE in sheep presents with relatively uniform clinical signs, with pruritus of increased severity and abnormalities in behaviour or movement as the disease progressed. Based on the studied sheep, these clinical features appear to

  11. Evidence for zoonotic potential of ovine scrapie prions.

    Science.gov (United States)

    Cassard, Hervé; Torres, Juan-Maria; Lacroux, Caroline; Douet, Jean-Yves; Benestad, Sylvie L; Lantier, Frédéric; Lugan, Séverine; Lantier, Isabelle; Costes, Pierrette; Aron, Naima; Reine, Fabienne; Herzog, Laetitia; Espinosa, Juan-Carlos; Beringue, Vincent; Andréoletti, Olivier

    2014-12-16

    Although Bovine Spongiform Encephalopathy (BSE) is the cause of variant Creutzfeldt Jakob disease (vCJD) in humans, the zoonotic potential of scrapie prions remains unknown. Mice genetically engineered to overexpress the human prion protein (tgHu) have emerged as highly relevant models for gauging the capacity of prions to transmit to humans. These models can propagate human prions without any apparent transmission barrier and have been used used to confirm the zoonotic ability of BSE. Here we show that a panel of sheep scrapie prions transmit to several tgHu mice models with an efficiency comparable to that of cattle BSE. The serial transmission of different scrapie isolates in these mice led to the propagation of prions that are phenotypically identical to those causing sporadic CJD (sCJD) in humans. These results demonstrate that scrapie prions have a zoonotic potential and raise new questions about the possible link between animal and human prions.

  12. hTERT-immortalized ovine microglia propagate natural scrapie isolates

    Science.gov (United States)

    Scrapie is a transmissible fatal neurodegenerative disease of sheep that is caused by a novel infectious agent called a prion. The study of prions under controlled culture conditions is crucial to advancing knowledge regarding prion processes of replication and accumulation within cells. Unfortunate...

  13. Diagnosis of the first cases of scrapie in Poland

    NARCIS (Netherlands)

    Polak, M.P.; Larska, M.; Langeveld, J.P.M.; Buschmann, A.; Groschup, M.H.; Zmudzinski, J.F.

    2010-01-01

    This is the first report of cases of scrapie in Poland. The disease was an atypical phenotype, diagnosed in two aged sheep which were found dead. Brainstem samples from both animals were positive on the applied ELISA rapid test, while the confirmatory immunoblot indicated abnormal banding patterns o

  14. In vitro prion protein conversion suggests risk of bighorn sheep (Ovis canadensis) to transmissible spongiform encephalopathies

    Science.gov (United States)

    Johnson, Christopher J.; Morawski, A.R.; Carlson, C.M.; Chang, H.

    2013-01-01

    Background: Transmissible spongiform encephalopathies (TSEs) affect both domestic sheep (scrapie) and captive and free-ranging cervids (chronic wasting disease; CWD). The geographical range of bighorn sheep (Ovis canadensis; BHS) overlaps with states or provinces that have contained scrapie-positive sheep or goats and areas with present epizootics of CWD in cervids. No TSEs have been documented in BHS, but the susceptibility of this species to TSEs remains unknown. Results: We acquired a library of BHS tissues and found no evidence of preexisting TSEs in these animals. The prion protein gene (Prnp) in all BHS in our library was identical to scrapie-susceptible domestic sheep (A136R 154Q171). Using an in vitro prion protein conversion assay, which has been previously used to assess TSE species barriers and, in our study appears to recollect known species barriers in mice, we assessed the potential transmissibility of TSEs to BHS. As expected based upon Prnp genotype, we observed BHS prion protein conversion by classical scrapie agent and evidence for a species barrier between transmissible mink encephalopathy (TME) and BHS. Interestingly, our data suggest that the species barrier of BHS to white-tailed deer or wapiti CWD agents is likely low. We also used protein misfolding cyclic amplification to confirm that CWD, but not TME, can template prion protein misfolding in A136R 154Q171genotype sheep. Conclusions: Our results indicate the in vitro conversion assay used in our study does mimic the species barrier of mice to the TSE agents that we tested. Based on Prnp genotype and results from conversion assays, BHS are likely to be susceptible to infection by classical scrapie. Despite mismatches in amino acids thought to modulate prion protein conversion, our data indicate that A136R154Q171 genotype sheep prion protein is misfolded by CWD agent, suggesting that these animals could be susceptible to CWD. Further investigation of TSE transmissibility to BHS, including

  15. Abnormalities in Brainstem Auditory Evoked Potentials in Sheep with Transmissible Spongiform Encephalopathies and Lack of a Clear Pathological Relationship

    Science.gov (United States)

    Konold, Timm; Phelan, Laura J.; Cawthraw, Saira; Simmons, Marion M.; Chaplin, Melanie J.; González, Lorenzo

    2016-01-01

    Scrapie is transmissible spongiform encephalopathy (TSE), which causes neurological signs in sheep, but confirmatory diagnosis is usually made postmortem on examination of the brain for TSE-associated markers like vacuolar changes and disease-associated prion protein (PrPSc). The objective of this study was to evaluate whether testing of brainstem auditory evoked potentials (BAEPs) at two different sound levels could aid in the clinical diagnosis of TSEs in sheep naturally or experimentally infected with different TSE strains [classical and atypical scrapie and bovine spongiform encephalopathy (BSE)] and whether any BAEP abnormalities were associated with TSE-associated markers in the auditory pathways. BAEPs were recorded from 141 clinically healthy sheep of different breeds and ages that tested negative for TSEs on postmortem tests to establish a reference range and to allow comparison with 30 sheep clinically affected or exposed to classical scrapie (CS) without disease confirmation (test group 1) and 182 clinically affected sheep with disease confirmation (test group 2). Abnormal BAEPs were found in 7 sheep (23%) of group 1 and 42 sheep (23%) of group 2. The proportion of sheep with abnormalities did not appear to be influenced by TSE strain or PrPSc gene polymorphisms. When the magnitude of TSE-associated markers in the auditory pathways was compared between a subset of 12 sheep with and 12 sheep without BAEP abnormalities in group 2, no significant differences in the total PrPSc or vacuolation scores in the auditory pathways could be found. However, the data suggested that there was a difference in the PrPSc scores depending on the TSE strain because PrPSc scores were significantly higher in sheep with BAEP abnormalities infected with classical and L-type BSE, but not with CS. The results indicated that BAEPs may be abnormal in sheep infected with TSEs but the test is not specific for TSEs and that neither vacuolation nor PrPSc accumulation appears to be

  16. Diagnosis of the first cases of scrapie in Poland.

    Science.gov (United States)

    Polak, Miroslaw P; Larska, Magdalena; Langeveld, Jan P M; Buschmann, Anne; Groschup, Martin H; Zmudzinski, Jan F

    2010-10-01

    This is the first report of cases of scrapie in Poland. The disease was an atypical phenotype, diagnosed in two aged sheep which were found dead. Brainstem samples from both animals were positive on the applied ELISA rapid test, while the confirmatory immunoblot indicated abnormal banding patterns of protease resistant prion protein (PrP(res)). The genotypes of these sheep were ALRQ/ALHQ and ALRQ/ALRR. The absence of premonitory clinical signs, the advanced age of the affected sheep, the higher concentration of PrP(res) in the cerebellum relative to the obex, the unusual banding profile of the prion protein and its relatively low resistance to proteolytic degradation confirmed the diagnosis of atypical scrapie (Nor98-like) in both cases.

  17. Scrapie prion liposomes and rods exhibit target sizes of 55,000 Da

    Energy Technology Data Exchange (ETDEWEB)

    Bellinger-Kawahara, C.G.; Kempner, E.; Groth, D.; Gabizon, R.; Prusiner, S.B.

    1988-06-01

    Scrapie is a degenerative neurologic disease in sheep and goats which can be experimentally transmitted to laboratory rodents. Considerable evidence suggests that the scrapie agent is composed largely, if not entirely, of an abnormal isoform of the prion protein (PrPSc). Inactivation of scrapie prions by ionizing radiation exhibited single-hit kinetics and gave a target size of 55,000 +/- 9000 mol wt. The inactivation profile was independent of the form of the prion. Scrapie agent infectivity in brain homogenates, microsomal fractions, detergent-extracted microsomes, purified amyloid rods, and liposomes exhibited the same inactivation profile. Our data are consistent with the hypothesis that the infectious particle causing scrapie contains approximately 2 PrPSc molecules.

  18. Persistence of ovine scrapie infectivity in a farm environment following cleaning and decontamination.

    Science.gov (United States)

    Hawkins, Steve A C; Simmons, Hugh A; Gough, Kevin C; Maddison, Ben C

    2015-01-24

    Scrapie of sheep/goats and chronic wasting disease of deer/elk are contagious prion diseases where environmental reservoirs are directly implicated in the transmission of disease. In this study, the effectiveness of recommended scrapie farm decontamination regimens was evaluated by a sheep bioassay using buildings naturally contaminated with scrapie. Pens within a farm building were treated with either 20,000 parts per million free chorine solution for one hour or were treated with the same but were followed by painting and full re-galvanisation or replacement of metalwork within the pen. Scrapie susceptible lambs of the PRNP genotype VRQ/VRQ were reared within these pens and their scrapie status was monitored by recto-anal mucosa-associated lymphoid tissue. All animals became infected over an 18-month period, even in the pen that had been subject to the most stringent decontamination process. These data suggest that recommended current guidelines for the decontamination of farm buildings following outbreaks of scrapie do little to reduce the titre of infectious scrapie material and that environmental recontamination could also be an issue associated with these premises.

  19. Ovine progressive pneumonia provirus levels are unaffected by the prion 171R allele in an Idaho sheep flock

    Directory of Open Access Journals (Sweden)

    Herrmann-Hoesing Lynn M

    2009-01-01

    Full Text Available Abstract Selective breeding of sheep for arginine (R at prion gene (PRNP codon 171 confers resistance to classical scrapie. However, other effects of 171R selection are uncertain. Ovine progressive pneumonia/Maedi-Visna virus (OPPV may infect up to 66% of a flock thus any affect of 171R selection on OPPV susceptibility or disease progression could have major impact on the sheep industry. Hypotheses that the PRNP 171R allele is 1 associated with the presence of OPPV provirus and 2 associated with higher provirus levels were tested in an Idaho ewe flock. OPPV provirus was found in 226 of 358 ewes by quantitative PCR. The frequency of ewes with detectable provirus did not differ significantly among the 171QQ, 171QR, and 171RR genotypes (p > 0.05. Also, OPPV provirus levels in infected ewes were not significantly different among codon 171 genotypes (p > 0.05. These results show that, in the flock examined, the presence of OPPV provirus and provirus levels are not related to the PRNP 171R allele. Therefore, a genetic approach to scrapie control is not expected to increase or decrease the number of OPPV infected sheep or the progression of disease. This study provides further support to the adoption of PRNP 171R selection as a scrapie control measure.

  20. Atypisk scrapie i Danmark

    DEFF Research Database (Denmark)

    Lind, Peter; Jensen, Tim Kåre; Mølbak, Lars

    2010-01-01

    Testningen af ca. 35.000 danske får og geder for TSE i perioden 2006-2010 har medført fund af syv tilfælde hos får, som alle er karakteriseret som atypisk scrapie......Testningen af ca. 35.000 danske får og geder for TSE i perioden 2006-2010 har medført fund af syv tilfælde hos får, som alle er karakteriseret som atypisk scrapie...

  1. Minder BSE en scrapie

    NARCIS (Netherlands)

    Zijderveld, van F.G.

    2011-01-01

    De dierziekte BSE is gevaarlijk voor de mens. Onderzoekers van het Central Veterinary Institute (CVI) hebben daarom snelle diagnostische tests ontwikkeld en ingezet bij rundvee, schapen en geiten. Ook hebben ze ervoor gezorgd dat schapen minder vatbaar zijn voor de verwante prionziekte scrapie.

  2. Atypical scrapie isolates involve a uniform prion species with a complex molecular signature.

    Directory of Open Access Journals (Sweden)

    Dorothea R Götte

    Full Text Available The pathobiology of atypical scrapie, a prion disease affecting sheep and goats, is still poorly understood. In a previous study, we demonstrated that atypical scrapie affecting small ruminants in Switzerland differs in the neuroanatomical distribution of the pathological prion protein (PrP(d. To investigate whether these differences depend on host-related vs. pathogen-related factors, we transmitted atypical scrapie to transgenic mice over-expressing the ovine prion protein (tg338. The clinical, neuropathological, and molecular phenotype of tg338 mice is similar between mice carrying the Swiss atypical scrapie isolates and the Nor98, an atypical scrapie isolate from Norway. Together with published data, our results suggest that atypical scrapie is caused by a uniform type of prion, and that the observed phenotypic differences in small ruminants are likely host-dependant. Strikingly, by using a refined SDS-PAGE technique, we established that the prominent proteinase K-resistant prion protein fragment in atypical scrapie consists of two separate, unglycosylated peptides with molecular masses of roughly 5 and 8 kDa. These findings show similarities to those for other prion diseases in animals and humans, and lay the groundwork for future comparative research.

  3. Atypical scrapie isolates involve a uniform prion species with a complex molecular signature.

    Science.gov (United States)

    Götte, Dorothea R; Benestad, Sylvie L; Laude, Hubert; Zurbriggen, Andreas; Oevermann, Anna; Seuberlich, Torsten

    2011-01-01

    The pathobiology of atypical scrapie, a prion disease affecting sheep and goats, is still poorly understood. In a previous study, we demonstrated that atypical scrapie affecting small ruminants in Switzerland differs in the neuroanatomical distribution of the pathological prion protein (PrP(d)). To investigate whether these differences depend on host-related vs. pathogen-related factors, we transmitted atypical scrapie to transgenic mice over-expressing the ovine prion protein (tg338). The clinical, neuropathological, and molecular phenotype of tg338 mice is similar between mice carrying the Swiss atypical scrapie isolates and the Nor98, an atypical scrapie isolate from Norway. Together with published data, our results suggest that atypical scrapie is caused by a uniform type of prion, and that the observed phenotypic differences in small ruminants are likely host-dependant. Strikingly, by using a refined SDS-PAGE technique, we established that the prominent proteinase K-resistant prion protein fragment in atypical scrapie consists of two separate, unglycosylated peptides with molecular masses of roughly 5 and 8 kDa. These findings show similarities to those for other prion diseases in animals and humans, and lay the groundwork for future comparative research.

  4. Atypical/Nor98 scrapie in the Basque Country: a case report of eight outbreaks

    Directory of Open Access Journals (Sweden)

    Minguijón Esmeralda

    2010-03-01

    Full Text Available Abstract Background Since 2002, an active surveillance program for transmissible spongiform encephalopathy in small ruminants in European Union countries allowed identification of a considerable number of atypical cases with similarities to the previously identified atypical scrapie cases termed Nor98. Case presentation Here we report molecular and neuropathological features of eight atypical/Nor98 scrapie cases detected between 2002 and 2009. Significant features of the affected sheep included: their relatively high ages (mean age 7.9 years, range between 4.3 and 12.8, their breed (all Latxa and their PRNP genotypes (AFRQ/ALRQ, ALRR/ALRQ, AFRQ/AFRQ, AFRQ/AHQ, ALRQ/ALRH, ALRQ/ALRQ. All the sheep were confirmed as atypical scrapie by immunohistochemistry and immunoblotting. Two cases presented more PrP immunolabelling in cerebral cortex than in cerebellum. Conclusions This work indicates that atypical scrapie constitutes the most common small ruminant transmissible spongiform encephalopathy form in Latxa sheep in the Spanish Basque Country. Moreover, a new genotype (ALRQ/ALRH was found associated to atypical scrapie.

  5. Lack of relationship between Visna/maedi infection and scrapie resistance genetic markers

    Directory of Open Access Journals (Sweden)

    Eider Salazar

    2014-06-01

    Full Text Available The relationship between Visna/maedi virus (VMV antibody status and scrapie genetic resistance of 10,611 Rasa Aragonesa sheep from 17 flocks in Aragón (Spain was investigated. The fifteen most common PRNP gene haplotypes and genotypes were identified and the genotypes were classified into the corresponding scrapie risk groups (groups 1 to 5. ARQ (93.3% and ARR (31.8% were the most common haplotypes and ARQ/ARQ (56% and ARR/ARQ (25.6% were the most common genotypes. The frequencies of scrapie risk groups 1, 2, 3, 4 and 5 were 3.3%, 27.3%, 63.5%, 1.2% and 4.8%, respectively. Overall Visna/maedi seroprevalence was 53% and flock seroprevalence ranged between 21-86%. A random effects logistic regression model indicated that sheep VMV serological status (outcome variable was not associated with any particular scrapie risk group. Instead, VMV seropositivity progressively increased with age, was significantly greater in females compared to males and varied between flocks. The absence of a relationship between VMV infection and scrapie genotypes is important for VMV control and specifically for sheep participating in an ELISA-based Visna/maedi control program.

  6. Investigation of a Simple Model for Within-Flock Transmission of Scrapie.

    Science.gov (United States)

    Hagenaars, Thomas J; Windig, Jack J

    2015-01-01

    Genetic control programs for scrapie in sheep build on solid knowledge of how susceptibility to scrapie is modulated by the prion protein genotype at the level of an individual sheep. In order to satisfactorily analyze the effectivity of control programs at the population level, insight is needed at the flock level, i.e., how the grouping of sheep in flocks affects the population-level transmission risk. In particular, one would like to understand how this risk is affected by between-flock differences in genotype frequency distribution. A first step is to model the scrapie transmission risk within a flock as a function of the flock genotype profile. Here we do so by estimating parameters for a model of within-flock transmission using genotyping data on Dutch flocks affected by scrapie. We show that the data are consistent with a relatively simple transmission model assuming horizontal transmission and homogeneous mixing between animals. The model expresses the basic reproduction number for within-flock scrapie as a weighted average of genotype-specific susceptibilities, multiplied by a single overall transmission parameter. The value of the overall transmission parameter may vary between flocks to account for random between-flock variation in non-genetic determinants such as management practice. Here we provide an estimate of its mean value and variation for Dutch flocks.

  7. The "Ram Effect": A "Non-Classical" Mechanism for Inducing LH Surges in Sheep.

    Science.gov (United States)

    Fabre-Nys, Claude; Chanvallon, Audrey; Dupont, Joëlle; Lardic, Lionel; Lomet, Didier; Martinet, Stéphanie; Scaramuzzi, Rex J

    2016-01-01

    During spring sheep do not normally ovulate but exposure to a ram can induce ovulation. In some ewes an LH surge is induced immediately after exposure to a ram thus raising questions about the control of this precocious LH surge. Our first aim was to determine the plasma concentrations of oestradiol (E2) E2 in anoestrous ewes before and after the "ram effect" in ewes that had a "precocious" LH surge (starting within 6 hours), a "normal" surge (between 6 and 28h) and "late» surge (not detected by 56h). In another experiment we tested if a small increase in circulating E2 could induce an LH surge in anoestrus ewes. The concentration of E2 significantly was not different at the time of ram introduction among ewes with the three types of LH surge. "Precocious" LH surges were not preceded by a large increase in E2 unlike "normal" surges and small elevations of circulating E2 alone were unable to induce LH surges. These results show that the "precocious" LH surge was not the result of E2 positive feedback. Our second aim was to test if noradrenaline (NA) is involved in the LH response to the "ram effect". Using double labelling for Fos and tyrosine hydroxylase (TH) we showed that exposure of anoestrous ewes to a ram induced a higher density of cells positive for both in the A1 nucleus and the Locus Coeruleus complex compared to unstimulated controls. Finally, the administration by retrodialysis into the preoptic area, of NA increased the proportion of ewes with an LH response to ram odor whereas treatment with the α1 antagonist Prazosin decreased the LH pulse frequency and amplitude induced by a sexually active ram. Collectively these results suggest that in anoestrous ewes NA is involved in ram-induced LH secretion as observed in other induced ovulators.

  8. Gene Expression Profiling and Association with Prion-Related Lesions in the Medulla Oblongata of Symptomatic Natural Scrapie Animals

    Science.gov (United States)

    Filali, Hicham; Martin-Burriel, Inmaculada; Harders, Frank; Varona, Luis; Lyahyai, Jaber; Zaragoza, Pilar; Pumarola, Martí; Badiola, Juan J.; Bossers, Alex; Bolea, Rosa

    2011-01-01

    The pathogenesis of natural scrapie and other prion diseases remains unclear. Examining transcriptome variations in infected versus control animals may highlight new genes potentially involved in some of the molecular mechanisms of prion-induced pathology. The aim of this work was to identify disease-associated alterations in the gene expression profiles of the caudal medulla oblongata (MO) in sheep presenting the symptomatic phase of natural scrapie. The gene expression patterns in the MO from 7 sheep that had been naturally infected with scrapie were compared with 6 controls using a Central Veterinary Institute (CVI) custom designed 4×44K microarray. The microarray consisted of a probe set on the previously sequenced ovine tissue library by CVI and was supplemented with all of the Ovis aries transcripts that are currently publicly available. Over 350 probe sets displayed greater than 2-fold changes in expression. We identified 148 genes from these probes, many of which encode proteins that are involved in the immune response, ion transport, cell adhesion, and transcription. Our results confirm previously published gene expression changes that were observed in murine models with induced scrapie. Moreover, we have identified new genes that exhibit differential expression in scrapie and could be involved in prion neuropathology. Finally, we have investigated the relationship between gene expression profiles and the appearance of the main scrapie-related lesions, including prion protein deposition, gliosis and spongiosis. In this context, the potential impacts of these gene expression changes in the MO on scrapie development are discussed. PMID:21629698

  9. hTERT-immortalized ovine microglia propagate natural scrapie isolates.

    Science.gov (United States)

    Muñoz-Gutiérrez, Juan F; Schneider, David A; Baszler, Timothy V; Greenlee, Justin J; Nicholson, Eric M; Stanton, James B

    2015-02-16

    Ex vivo propagation of natural prion isolates (i.e., propagated solely in the natural host) is crucial for the characterization and study of transmissible spongiform encephalopathies (TSEs). Several well-established, prion-permissive cell culture systems are available; however, only a few cell lines are permissive to natural prion isolates and these cells are not pathophysiologically relevant (e.g., renal epithelium and fibroblast-like cells). Therefore, a pathophysiologically relevant cell line derived from a natural TSE host could be used for propagation of natural prion isolates. In this study, ovine brain macrophages (microglia) were immortalized by transfection with the human telomerase reverse transcriptase (hTERT) gene to identify cell lines (hTERT-microglia) permissive to natural scrapie prion isolates. Following transfection, hTERT-microglia were passaged up to 100 times and their lifespan was significantly longer compared to parental cells (Fisher's exact test, Pscrapie isolates (i.e., derived from brain homogenates of sheep infected with scrapie). Prion infectivity and partial protease resistance of the prion protein were maintained in hTERT-microglia. Comparisons between scrapie-permissive and non-permissive hTERT-microglia sublines revealed that overall quantity of the normal cellular prion protein was not associated with prion permissiveness. The use of hTERT-microglia in future TSE studies may be more germane to the characterization of the cellular and subcellular pathophysiology of natural scrapie prion isolates and to investigate host-specific factors involved in prion replication.

  10. Distinct spatial activation of intrinsic and extrinsic apoptosis pathways in natural scrapie: association with prion-related lesions

    Science.gov (United States)

    Serrano, Carmen; Lyahyai, Jaber; Bolea, Rosa; Varona, Luis; Monleón, Eva; Badiola, Juan J.; Zaragoza, Pilar; Martín-Burriel, Inmaculada

    2009-01-01

    Neurodegeneration and gliosis are the main neuropathological features of prion diseases. However, the molecular mechanisms involved in these processes remain unclear. Several studies have demonstrated changes in the expression of apoptotic factors and inflammatory cytokines in animals with experimental infection. Here we present the expression profiles of 15 genes implicated in the intrinsic and extrinsic apoptotic pathways in the central nervous systems of sheep naturally infected with scrapie. Expression changes obtained by real-time RT-PCR were also compared with the extent of classical scrapie lesions, such as prion deposition, neuronal vacuolisation, spongiosis, and astrogliosis as well as with the activation of caspase-3, using a stepwise regression. The results suggest that the factors assessed participate in apoptotic or inflammatory functions, depending on the affected area. The mitochondrial apoptosis pathway was associated with prion deposition in the prefrontal cortex (the less affected area), and with activation of caspase-3-mediated cell death via over-expression of BAK. In addition to its known association with astroglial activation, the extrinsic apoptosis pathway was also related to cell death and neuronal vacuolisation. PMID:19401142

  11. A single step multiplex immunofluorometric assay for differential diagnosis of BSE and scrapie

    NARCIS (Netherlands)

    Tang, Y.; Thorne, J.; Whatling, K.L.; Jacobs, J.G.; Langeveld, J.P.M.; Sauer, M.

    2010-01-01

    Although there is no evidence that the European sheep population has been infected with bovine spongiform encephalopathy (BSE), distinguishing this from scrapie is paramount, given the association between BSE exposure and the human transmissible spongiform encephalopathy (TSE), variant Creutzfeldt–J

  12. The time-course of a scrapie outbreak

    Directory of Open Access Journals (Sweden)

    Stevenson Emily

    2006-06-01

    Full Text Available Abstract Background Because the incubation period of scrapie has a strong host genetic component and a dose-response relationship, it is possible that changes will occur during an outbreak, especially in the genotypes of cases, age-at-onset of disease and, perhaps, the clinical signs displayed. We investigated these factors for a large outbreak of natural scrapie, which yielded sufficient data to detect temporal trends. Results Cases occurred mostly in two genotypes, VRQ/VRQ and VRQ/ARQ, with those early in the outbreak more likely to be of the VRQ/VRQ genotype. As the epidemic progressed, the age-at-onset of disease increased, which reflected changes in the genotypes of cases rather than changes in the age-at-onset within genotypes. Clinical signs of cases changed over the course of the outbreak. As the epidemic progressed VRQ/VRQ and VRQ/ARQ sheep were more likely to be reported with behavioural changes, while VRQ/VRQ sheep only were less likely to be reported with loss of condition. Conclusion This study of one of the largest scrapie outbreaks in the UK allowed investigation of the effect of PrP genotype on other epidemiological parameters. Our analysis indicated that, although age-at-onset and clinical signs changed over time, the observed changes were largely, but not exclusively, driven by the time course of the PrP genotypes of cases.

  13. Genetic resistance to scrapie infection in experimentally challenged goats.

    Science.gov (United States)

    Lacroux, Caroline; Perrin-Chauvineau, Cécile; Corbière, Fabien; Aron, Naima; Aguilar-Calvo, Patricia; Torres, Juan Maria; Costes, Pierrette; Brémaud, Isabelle; Lugan, Séverine; Schelcher, François; Barillet, Francis; Andréoletti, Olivier

    2014-03-01

    In goats, several field studies have identified coding mutations of the gene encoding the prion protein (I/M142, N/D146, S/D146, R/Q211, and Q/K222) that are associated with a lower risk of developing classical scrapie. However, the data related to the levels of resistance to transmissible spongiform encephalopathies (TSEs) of these different PRNP gene mutations are still considered insufficient for developing large-scale genetic selection against scrapie in this species. In this study, we inoculated wild-type (WT) PRNP (I142R154R211Q222) goats and homozygous and/or heterozygous I/M142, R/H154, R/Q211, and Q/K222 goats with a goat natural scrapie isolate by either the oral or the intracerebral (i.c.) route. Our results indicate that the I/M142 PRNP polymorphism does not provide substantial resistance to scrapie infection following intracerebral or oral inoculation. They also demonstrate that H154, Q211, and K222 PRNP allele carriers are all resistant to scrapie infection following oral exposure. However, in comparison to WT animals, the H154 and Q211 allele carriers displayed only moderate increases in the incubation period following i.c. challenge. After i.c. challenge, heterozygous K222 and a small proportion of homozygous K222 goats also developed the disease, but with incubation periods that were 4 to 5 times longer than those in WT animals. These results support the contention that the K222 goat prion protein variant provides a strong but not absolutely protective effect against classical scrapie.

  14. The effect of non-standard heat treatment of sheep's milk on physico-chemical properties, sensory characteristics, and the bacterial viability of classical and probiotic yogurt.

    Science.gov (United States)

    Zamberlin, Šimun; Samaržija, Dubravka

    2017-06-15

    Classical and probiotic set yogurt were made using non-standard heat treatment of sheep's milk at 60°C/5min. Physico-chemical properties, sensory characteristics, and the viability of bacteria that originated from cultures in classical and probiotic yogurt were analysed during 21days of storage at 4°C. For the production of yogurt, a standard yogurt culture and a probiotic strain Lactobacillus rhamnosus GG were used. At the end of storage time of the classical and probiotic yogurt the totals of non-denatured whey proteins were 92.31 and 91.03%. The viability of yogurt culture bacteria and Lactobacillus rhamnosus GG were higher than 10(6)cfu/g. The total sensory score (maximum - 20) was 18.49 for the classical and 18.53 for the probiotic. In nutritional and functional terms it is possible to produce classical and probiotic sheep's milk yogurt by using a non-standard temperature of heat treatment with a shelf life of 21days.

  15. Transmission of scrapie prions to primate after an extended silent incubation period.

    Science.gov (United States)

    Comoy, Emmanuel E; Mikol, Jacqueline; Luccantoni-Freire, Sophie; Correia, Evelyne; Lescoutra-Etchegaray, Nathalie; Durand, Valérie; Dehen, Capucine; Andreoletti, Olivier; Casalone, Cristina; Richt, Juergen A; Greenlee, Justin J; Baron, Thierry; Benestad, Sylvie L; Brown, Paul; Deslys, Jean-Philippe

    2015-06-30

    Classical bovine spongiform encephalopathy (c-BSE) is the only animal prion disease reputed to be zoonotic, causing variant Creutzfeldt-Jakob disease (vCJD) in humans and having guided protective measures for animal and human health against animal prion diseases. Recently, partial transmissions to humanized mice showed that the zoonotic potential of scrapie might be similar to c-BSE. We here report the direct transmission of a natural classical scrapie isolate to cynomolgus macaque, a highly relevant model for human prion diseases, after a 10-year silent incubation period, with features similar to those reported for human cases of sporadic CJD. Scrapie is thus actually transmissible to primates with incubation periods compatible with their life expectancy, although fourfold longer than BSE. Long-term experimental transmission studies are necessary to better assess the zoonotic potential of other prion diseases with high prevalence, notably Chronic Wasting Disease of deer and elk and atypical/Nor98 scrapie.

  16. 9 CFR 54.22 - State scrapie certification boards.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false State scrapie certification boards. 54... SCRAPIE Scrapie Flock Certification Program § 54.22 State scrapie certification boards. An area... a State scrapie certification board for the purpose of coordinating activities for the Scrapie...

  17. Differential immunoreactivity of goat derived scrapie following in vitro misfolding versus mouse bioassay.

    Science.gov (United States)

    Madsen-Bouterse, Sally A; Zhuang, Dongyue; O'Rourke, Katherine I; Schneider, David A

    2012-07-13

    The protein misfolding cyclic amplification (PMCA) assay allows for detection of prion protein misfolding activity in tissues and fluids from sheep with scrapie where it was previously undetected by conventional western blot and immunohistochemistry assays. Studies of goats with scrapie have yet to take advantage of PMCA, which could aid in discerning the risk of transmission between goats and goats to sheep. The aim of the current study was to adapt PMCA for evaluation of scrapie derived from goats. Diluted brain homogenate from scrapie-infected goats (i.e., the scrapie seed, PrP(Sc)) was subjected to PMCA using normal brain homogenate from ovinized transgenic mice (tg338) as the source of normal cellular prion protein (the substrate, PrP(C)). The assay end-point was detection of the proteinase K-resistant misfolded prion protein core (PrP(res)) by western blot. Protein misfolding activity was consistently observed in caprine brain homogenate diluted 10,000-fold after 5 PMCA rounds. Epitope mapping by western blot analyses demonstrated that PrP(res) post-PMCA was readily detected with an N-terminus anti-PrP monoclonal antibody (P4), similar to scrapie inoculum from goats. This was in contrast to limited detection of PrP(res) with P4 following mouse bioassay. The inverse was observed with a monoclonal antibody to the C-terminus (F99/97.6.1). Thus, brain homogenate prepared from uninoculated tg338 served as an appropriate substrate for serial PMCA of PrP(Sc) derived from goats. These observations suggest that concurrent PMCA and bioassay with tg338 could improve characterization of goat derived scrapie.

  18. 9 CFR 79.2 - Identification of sheep and goats in interstate commerce.

    Science.gov (United States)

    2010-01-01

    ... interstate commerce. 79.2 Section 79.2 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... SCRAPIE IN SHEEP AND GOATS § 79.2 Identification of sheep and goats in interstate commerce. (a) No sheep..., transported, received for transportation, or offered for sale or transportation in interstate commerce...

  19. All major prion types recognised by a multiplex immunofluorometric assay for disease screening and confirmation in sheep

    NARCIS (Netherlands)

    Tang, Y.; gielbert, A.; Jacobs, J.G.; Baron, T.; Andreoletti, O.; Langeveld, J.P.M.; Sauer, M.J.

    2012-01-01

    Prion diseases or transmissible spongiform encephalopathies (TSEs) in small ruminants are presented in many forms: classical scrapie, Nor98/atypical scrapie, CH1641 scrapie and bovine spongiform encephalopathy (BSE). We previously described a multiplex immunofluorometric assay (mIFMA), based on a be

  20. A single step multiplex immunofluorometric assay for differential diagnosis of BSE and scrapie.

    Science.gov (United States)

    Tang, Yue; Thorne, Jemma; Whatling, Kirsty; Jacobs, Jorg G; Langeveld, Jan; Sauer, Maurice J

    2010-04-30

    Although there is no evidence that the European sheep population has been infected with bovine spongiform encephalopathy (BSE), distinguishing this from scrapie is paramount, given the association between BSE exposure and the human transmissible spongiform encephalopathy (TSE), variant Creutzfeldt-Jakob disease. The capability to differentially diagnose TSEs in sheep is thus essential in order to safeguard the food chain and human health. Biochemical methods for differentiating BSE and scrapie are largely reliant on assessment by Western blot (WB) analysis of the abnormal disease associated prion protein PrP(D) following partial proteolytic digestion. WB banding patterns obtained using a panel of antibodies enable different strain specific conformations of PrP(D) to be distinguished. This approach provides a robust confirmatory test but one which is not appropriate for high throughput screening. A simple, one step, bead array flow cytometry based multiplex immunofluorometric assay has been developed which is suitable for simultaneous screening and confirmation. Using a combination of antibodies directed towards three PrP epitopes enabled differential diagnosis of scrapie and BSE. Proof of principle studies indicated a high predictive value (100%) when applied to brain samples from control animals, BSE infected cattle and sheep naturally infected with scrapie or experimentally infected with BSE.

  1. Pathogenesis of bovine spongiform encephalopathy in sheep

    NARCIS (Netherlands)

    Keulen, van L.J.M.; Vromans, M.E.W.; Dolstra, C.H.; Bossers, A.; Zijderveld, van F.G.

    2008-01-01

    The pathogenesis of bovine spongiform encephalopathy (BSE) in sheep was studied by immunohistochemical detection of scrapie-associated prion protein (PrPSc) in the gastrointestinal, lymphoid and neural tissues following oral inoculation with BSE brain homogenate. First accumulation of PrPSc was dete

  2. Relationships between PrPSc stability and incubation time for United States scrapie strains in a natural host system

    Science.gov (United States)

    Transmissible spongiform encephalopathies (TSEs), including scrapie in sheep (Ovis aries), are fatal neurodegenerative diseases caused by the misfolding of the cellular prion protein (PrP**C) into a beta-rich conformer (PrP**Sc) that accumulates into higher-order structures in the brain and other ti...

  3. Transcriptomic Determinants of Scrapie Prion Propagation in Cultured Ovine Microglia.

    Science.gov (United States)

    Muñoz-Gutiérrez, Juan F; Pierlé, Sebastián Aguilar; Schneider, David A; Baszler, Timothy V; Stanton, James B

    2016-01-01

    Susceptibility to infection by prions is highly dependent on the amino acid sequence and host expression of the cellular prion protein (PrPC); however, cellular expression of a genetically susceptible PrPC is insufficient. As an example, it has been shown in cultured cells that permissive and resistant sublines derived from the same parental population often have similar expression levels of PrPC. Thus, additional cellular factors must influence susceptibility to prion infection. The aim of this study was to elucidate the factors associated with relative permissiveness and resistance to scrapie prions in cultured cells derived from a naturally affected species. Two closely related ovine microglia clones with different prion susceptibility, but no detectable differences in PrPC expression levels, were inoculated with either scrapie-positive or scrapie-negative sheep brainstem homogenates. Five passages post-inoculation, the transcriptional profiles of mock and infected clones were sequenced using Illumina technology. Comparative transcriptional analyses identified twenty-two differentially transcribed genes, most of which were upregulated in poorly permissive microglia. This included genes encoding for selenoprotein P, endolysosomal proteases, and proteins involved in extracellular matrix remodeling. Furthermore, in highly permissive microglia, transforming growth factor β-induced, retinoic acid receptor response 1, and phosphoserine aminotranspherase 1 gene transcripts were upregulated. Gene Set Enrichment Analysis identified proteolysis, translation, and mitosis as the most affected pathways and supported the upregulation trend of several genes encoding for intracellular proteases and ribosomal proteins in poorly permissive microglia. This study identifies new genes potentially involved in scrapie prion propagation, corroborates results from other studies, and extends those results into another cell culture model.

  4. Salivary prions in sheep and deer.

    Science.gov (United States)

    Tamgüney, Gültekin; Richt, Jürgen A; Hamir, Amir N; Greenlee, Justin J; Miller, Michael W; Wolfe, Lisa L; Sirochman, Tracey M; Young, Alan J; Glidden, David V; Johnson, Natrina L; Giles, Kurt; DeArmond, Stephen J; Prusiner, Stanley B

    2012-01-01

    Scrapie of sheep and chronic wasting disease (CWD) of cervids are transmissible prion diseases. Milk and placenta have been identified as sources of scrapie prions but do not explain horizontal transmission. In contrast, CWD prions have been reported in saliva, urine and feces, which are thought to be responsible for horizontal transmission. While the titers of CWD prions have been measured in feces, levels in saliva or urine are unknown. Because sheep produce ~17 L/day of saliva, and scrapie prions are present in tongue and salivary glands of infected sheep, we asked if scrapie prions are shed in saliva. We inoculated transgenic (Tg) mice expressing ovine prion protein, Tg(OvPrP) mice, with saliva from seven Cheviot sheep with scrapie. Six of seven samples transmitted prions to Tg(OvPrP) mice with titers of -0.5 to 1.7 log ID₅₀ U/ml. Similarly, inoculation of saliva samples from two mule deer with CWD transmitted prions to Tg(ElkPrP) mice with titers of -1.1 to -0.4 log ID₅₀ U/ml. Assuming similar shedding kinetics for salivary prions as those for fecal prions of deer, we estimated the secreted salivary prion dose over a 10-mo period to be as high as 8.4 log ID₅₀ units for sheep and 7.0 log ID₅₀ units for deer. These estimates are similar to 7.9 log ID₅₀ units of fecal CWD prions for deer. Because saliva is mostly swallowed, salivary prions may reinfect tissues of the gastrointestinal tract and contribute to fecal prion shedding. Salivary prions shed into the environment provide an additional mechanism for horizontal prion transmission.

  5. Immunological comparison of scrapie-associated fibrils isolated from animals infected with four different scrapie strains.

    OpenAIRE

    Kascsak, R J; Rubenstein, R; Merz, P A; Carp, R I; Robakis, N. K.; Wisniewski, H M; Diringer, H

    1986-01-01

    Scrapie-associated fibrils (SAFs) are abnormal filamentous structures that are uniquely associated with unconventional slow virus diseases. The antigenic relationships of SAFs from animals infected with four biologically distinct scrapie strains were investigated by using antisera raised to purified SAF proteins. Rabbit antisera were raised to SAFs isolated from mice infected with the ME7 scrapie strain and to SAFs isolated from hamsters infected with the 263K scrapie strain. A strong antigen...

  6. The evaluation of exposure risks for natural transmission of scrapie within an infected flock

    Directory of Open Access Journals (Sweden)

    Davis Andrew

    2009-10-01

    Full Text Available Abstract Background Although the epidemiology of scrapie has been broadly understood for many years, attempts to introduce voluntary or compulsory controls to eradicate the disease have frequently failed. Lack of precision in defining the risk factors on farm has been one of the challenges to designing control strategies. This study attempted to define which parts of the annual flock management cycle represented the greatest risk of infection to naive lambs exposed to the farm environment at different times. Results In VRQ/VRQ lambs exposed to infected sheep at pasture or during lambing, and exposed to the buildings in which lambing took place, the attack rate was high and survival times were short. Where exposure was to pasture alone the number of sheep affected in each experimental group was reduced, and survival times were longer and related to length of exposure. Conclusion At the flock level, eradication and control strategies for scrapie must take into account the need to decontaminate buildings used for lambing, and to reduce (or prevent the exposure of lambs to infected sheep, especially in the later stages of incubation, and at lambing. The potential for environmental contamination from pasture should also be considered. Genotype selection may still prove to be the only viable tool to prevent infection from contaminated pasture, reduce environmental contamination and limit direct transmission from sheep to sheep.

  7. 9 CFR 54.10 - Tests for scrapie.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Tests for scrapie. 54.10 Section 54.10... COOPERATIVE CONTROL AND ERADICATION OF LIVESTOCK OR POULTRY DISEASES CONTROL OF SCRAPIE Scrapie Indemnification Program § 54.10 Tests for scrapie. (a) The Administrator may approve new tests for the...

  8. Prions in milk from ewes incubating natural scrapie.

    Directory of Open Access Journals (Sweden)

    Caroline Lacroux

    2008-12-01

    Full Text Available Since prion infectivity had never been reported in milk, dairy products originating from transmissible spongiform encephalopathy (TSE-affected ruminant flocks currently enter unrestricted into the animal and human food chain. However, a recently published study brought the first evidence of the presence of prions in mammary secretions from scrapie-affected ewes. Here we report the detection of consistent levels of infectivity in colostrum and milk from sheep incubating natural scrapie, several months prior to clinical onset. Additionally, abnormal PrP was detected, by immunohistochemistry and PET blot, in lacteal ducts and mammary acini. This PrP(Sc accumulation was detected only in ewes harbouring mammary ectopic lymphoid follicles that developed consequent to Maedi lentivirus infection. However, bioassay revealed that prion infectivity was present in milk and colostrum, not only from ewes with such lympho-proliferative chronic mastitis, but also from those displaying lesion-free mammary glands. In milk and colostrum, infectivity could be recovered in the cellular, cream, and casein-whey fractions. In our samples, using a Tg 338 mouse model, the highest per ml infectious titre measured was found to be equivalent to that contained in 6 microg of a posterior brain stem from a terminally scrapie-affected ewe. These findings indicate that both colostrum and milk from small ruminants incubating TSE could contribute to the animal TSE transmission process, either directly or through the presence of milk-derived material in animal feedstuffs. It also raises some concern with regard to the risk to humans of TSE exposure associated with milk products from ovine and other TSE-susceptible dairy species.

  9. Prions in milk from ewes incubating natural scrapie.

    Science.gov (United States)

    Lacroux, Caroline; Simon, Stéphanie; Benestad, Sylvie L; Maillet, Séverine; Mathey, Jacinthe; Lugan, Séverine; Corbière, Fabien; Cassard, Hervé; Costes, Pierrette; Bergonier, Dominique; Weisbecker, Jean-Louis; Moldal, Torffin; Simmons, Hugh; Lantier, Frederic; Feraudet-Tarisse, Cécile; Morel, Nathalie; Schelcher, François; Grassi, Jacques; Andréoletti, Olivier

    2008-12-01

    Since prion infectivity had never been reported in milk, dairy products originating from transmissible spongiform encephalopathy (TSE)-affected ruminant flocks currently enter unrestricted into the animal and human food chain. However, a recently published study brought the first evidence of the presence of prions in mammary secretions from scrapie-affected ewes. Here we report the detection of consistent levels of infectivity in colostrum and milk from sheep incubating natural scrapie, several months prior to clinical onset. Additionally, abnormal PrP was detected, by immunohistochemistry and PET blot, in lacteal ducts and mammary acini. This PrP(Sc) accumulation was detected only in ewes harbouring mammary ectopic lymphoid follicles that developed consequent to Maedi lentivirus infection. However, bioassay revealed that prion infectivity was present in milk and colostrum, not only from ewes with such lympho-proliferative chronic mastitis, but also from those displaying lesion-free mammary glands. In milk and colostrum, infectivity could be recovered in the cellular, cream, and casein-whey fractions. In our samples, using a Tg 338 mouse model, the highest per ml infectious titre measured was found to be equivalent to that contained in 6 microg of a posterior brain stem from a terminally scrapie-affected ewe. These findings indicate that both colostrum and milk from small ruminants incubating TSE could contribute to the animal TSE transmission process, either directly or through the presence of milk-derived material in animal feedstuffs. It also raises some concern with regard to the risk to humans of TSE exposure associated with milk products from ovine and other TSE-susceptible dairy species.

  10. Scrapie Agent (Strain 263K can transmit disease via the oral route after persistence in soil over years.

    Directory of Open Access Journals (Sweden)

    Bjoern Seidel

    Full Text Available The persistence of infectious biomolecules in soil constitutes a substantial challenge. This holds particularly true with respect to prions, the causative agents of transmissible spongiform encephalopathies (TSEs such as scrapie, bovine spongiform encephalopathy (BSE, or chronic wasting disease (CWD. Various studies have indicated that prions are able to persist in soil for years without losing their pathogenic activity. Dissemination of prions into the environment can occur from several sources, e.g., infectious placenta or amniotic fluid of sheep. Furthermore, environmental contamination by saliva, excrements or non-sterilized agricultural organic fertilizer is conceivable. Natural transmission of scrapie in the field seems to occur via the alimentary tract in the majority of cases, and scrapie-free sheep flocks can become infected on pastures where outbreaks of scrapie had been observed before. These findings point to a sustained contagion in the environment, and notably the soil. By using outdoor lysimeters, we simulated a contamination of standard soil with hamster-adapted 263K scrapie prions, and analyzed the presence and biological activity of the soil-associated PrP(Sc and infectivity by Western blotting and hamster bioassay, respectively. Our results showed that 263K scrapie agent can persist in soil at least over 29 months. Strikingly, not only the contaminated soil itself retained high levels of infectivity, as evidenced by oral administration to Syrian hamsters, but also feeding of aqueous soil extracts was able to induce disease in the reporter animals. We could also demonstrate that PrP(Sc in soil, extracted after 21 months, provides a catalytically active seed in the protein misfolding cyclic amplification (PMCA reaction. PMCA opens therefore a perspective for considerably improving the detectability of prions in soil samples from the field.

  11. Scrapie transmits to white-tailed deer by the oral route and has a molecular profile similar to chronic wasting disease

    Science.gov (United States)

    The purpose of this work was to determine susceptibility of white-tailed deer (WTD) to the agent of sheep scrapie and to compare the resultant PrPSc to that of the original inoculum and chronic wasting disease (CWD). We inoculated WTD by a natural route of exposure (concurrent oral and intranasal (I...

  12. Isolation of a Defective Prion Mutant from Natural Scrapie

    Science.gov (United States)

    Migliore, Sergio; Cosseddu, Gian Mario; Pirisinu, Laura; Riccardi, Geraldina; Nonno, Romolo

    2016-01-01

    It is widely known that prion strains can mutate in response to modification of the replication environment and we have recently reported that prion mutations can occur in vitro during amplification of vole-adapted prions by Protein Misfolding Cyclic Amplification on bank vole substrate (bvPMCA). Here we exploited the high efficiency of prion replication by bvPMCA to study the in vitro propagation of natural scrapie isolates. Although in vitro vole-adapted PrPSc conformers were usually similar to the sheep counterpart, we repeatedly isolated a PrPSc mutant exclusively when starting from extremely diluted seeds of a single sheep isolate. The mutant and faithful PrPSc conformers showed to be efficiently autocatalytic in vitro and were characterized by different PrP protease resistant cores, spanning aa ∼155–231 and ∼80–231 respectively, and by different conformational stabilities. The two conformers could thus be seen as different bona fide PrPSc types, putatively accounting for prion populations with different biological properties. Indeed, once inoculated in bank vole the faithful conformer was competent for in vivo replication while the mutant was unable to infect voles, de facto behaving like a defective prion mutant. Overall, our findings confirm that prions can adapt and evolve in the new replication environments and that the starting population size can affect their evolutionary landscape, at least in vitro. Furthermore, we report the first example of “authentic” defective prion mutant, composed of brain-derived PrPC and originating from a natural scrapie isolate. Our results clearly indicate that the defective mutant lacks of some structural characteristics, that presumably involve the central region ∼90–155, critical for infectivity but not for in vitro replication. Finally, we propose a molecular mechanism able to account for the discordant in vitro and in vivo behavior, suggesting possible new paths for investigating the molecular bases of

  13. Sheep-passaged bovine spongiform encephalopathy agent exhibits altered pathobiological properties in bovine-PrP transgenic mice

    NARCIS (Netherlands)

    Espinosa, J.C.; Andreoletti, O.; Castilla, J.; Herva, M.E.; Morales, M.; Alamillo, E.; San-Segundo, F.D.; Lacroux, C.; Lugan, S.; Salguero, F.J.; Langeveld, J.P.M.; Torres, J.M.

    2007-01-01

    Sheep can be experimentally infected with bovine spongiform encephalopathy (BSE), and the ensuing disease is similar to scrapie in terms of pathogenesis and clinical signs. BSE infection in sheep is an animal and human health concern. In this study, the transmission in BoPrP-Tg110 mice of prions fro

  14. Medulla oblongata transcriptome changes during presymptomatic natural scrapie and their association with prion-related lesions

    Directory of Open Access Journals (Sweden)

    Filali Hicham

    2012-08-01

    Full Text Available Abstract Background The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new biomarkers for diagnosis and therapy. This study is the first to focus on the identification of genes regulated during the preclinical phases of natural scrapie in the ovine medulla oblongata (MO and the association of these genes with prion deposition, astrocytosis and spongiosis. Results A custom microarray platform revealed that 86 significant probes had expression changes greater than 2-fold. From these probes, we identified 32 genes with known function; the highest number of regulated genes was included in the phosphoprotein-encoding group. Genes encoding extracellular marker proteins and those involved in the immune response and apoptosis were also differentially expressed. In addition, we investigated the relationship between the gene expression profiles and the appearance of the main scrapie-associated brain lesions. Quantitative Real-time PCR was used to validate the expression of some of the regulated genes, thus showing the reliability of the microarray hybridization technology. Conclusions Genes involved in protein and metal binding and oxidoreductase activity were associated with prion deposition. The expression of glial fibrillary acidic protein (GFAP was associated with changes in the expression of genes encoding proteins with oxidoreductase and phosphatase activity, and the expression of spongiosis was related to genes encoding extracellular matrix components or transmembrane transporters. This is the first genome-wide expression study performed in naturally infected sheep with preclinical scrapie. As in previous studies, our findings confirm the close relationship between scrapie and other neurodegenerative diseases.

  15. White blood cell-based detection of asymptomatic scrapie infection by ex vivo assays.

    Directory of Open Access Journals (Sweden)

    Sophie Halliez

    Full Text Available Prion transmission can occur by blood transfusion in human variant Creutzfeldt-Jakob disease and in experimental animal models, including sheep. Screening of blood and its derivatives for the presence of prions became therefore a major public health issue. As infectious titer in blood is reportedly low, highly sensitive and robust methods are required to detect prions in blood and blood derived products. The objectives of this study were to compare different methods--in vitro, ex vivo and in vivo assays--to detect prion infectivity in cells prepared from blood samples obtained from scrapie infected sheep at different time points of the disease. Protein misfolding cyclic amplification (PMCA and bioassays in transgenic mice expressing the ovine prion protein were the most efficient methods to identify infected animals at any time of the disease (asymptomatic to terminally-ill stages. However scrapie cell and cerebellar organotypic slice culture assays designed to replicate ovine prions in culture also allowed detection of prion infectivity in blood cells from asymptomatic sheep. These findings confirm that white blood cells are appropriate targets for preclinical detection and introduce ex vivo tools to detect blood infectivity during the asymptomatic stage of the disease.

  16. Transmissibility of atypical scrapie in ovine transgenic mice: major effects of host prion protein expression and donor prion genotype.

    Directory of Open Access Journals (Sweden)

    Jean-Noël Arsac

    Full Text Available Atypical scrapie or Nor98 has been identified as a transmissible spongiform encephalopathy (TSE that is clearly distinguishable from classical scrapie and BSE, notably regarding the biochemical features of the protease-resistant prion protein PrP(res and the genetic factors involved in susceptibility to the disease. In this study we transmitted the disease from a series of 12 French atypical scrapie isolates in a transgenic mouse model (TgOvPrP4 overexpressing in the brain approximately 0.25, 1.5 or 6x the levels of the PrP(ARQ ovine prion protein under the control of the neuron-specific enolase promoter. We used an approach based on serum PrP(c measurements that appeared to reflect the different PrP(c expression levels in the central nervous system. We found that transmission of atypical scrapie, much more than in classical scrapie or BSE, was strongly influenced by the PrP(c expression levels of TgOvPrP4 inoculated mice. Whereas TgOvPrP4 mice overexpressing approximately 6x the normal PrP(c level died after a survival periods of 400 days, those with approximately 1.5x the normal PrP(c level died at around 700 days. The transmission of atypical scrapie in TgOvPrP4 mouse line was also strongly influenced by the prnp genotypes of the animal source of atypical scrapie. Isolates carrying the AF(141RQ or AHQ alleles, associated with increased disease susceptibility in the natural host, showed a higher transmissibility in TgOvPrP4 mice. The biochemical analysis of PrP(res in TgOvPrP4 mouse brains showed a fully conserved pattern, compared to that in the natural host, with three distinct PrP(res products. Our results throw light on the transmission features of atypical scrapie and suggest that the risk of transmission is intrinsically lower than that of classical scrapie or BSE, especially in relation to the expression level of the prion protein.

  17. Elevated manganese levels in blood and central nervous system occur before onset of clinical signs in scrapie and bovine spongiform encephalopathy.

    Science.gov (United States)

    Hesketh, S; Sassoon, J; Knight, R; Hopkins, J; Brown, D R

    2007-06-01

    Prion diseases, or transmissible spongiform encephalopathies, are neurodegenerative diseases that can only be accurately diagnosed by analysis of central nervous system tissue for the presence of an abnormal isoform of the prion protein known as PrP(Sc). Furthermore, these diseases have long incubation periods during which there are no clear symptoms but where the infectious agent could still be present in the tissues. Therefore, the development of diagnostic assays to detect a surrogate marker for the presence of prion disease is essential. Previous studies on mice experimentally infected with scrapie, an ovine spongiform encephalopathy, suggested that changes in the levels of Mn occur in the blood and brain before the onset of symptoms of the disease. To assess whether these findings have relevance to the animal diseases scrapie and bovine spongiform encephalopathy, tissues from bovine spongiform encephalopathy- and scrapie-infected cattle and sheep were analyzed for their metal content and compared with values for noninfected animals. In field cases and experimentally infected animals, elevated Mn was associated with prion infection. Although some central nervous system regions showed elevated Mn, other regions did not. The most consistent finding was an elevation of Mn in blood. This change was present in experimentally infected animals before the onset of symptoms. In scrapie-infected sheep, elevated Mn levels occurred regardless of the genotype of the sheep and were even detected in scrapie-resistant sheep in which no symptoms of disease were detected. These findings suggest that elevated blood Mn could be a potential diagnostic marker for prion infection even in the absence of apparent clinical disease.

  18. Gene expression alterations in brains of mice infected with three strains of scrapie

    Directory of Open Access Journals (Sweden)

    Race Richard E

    2006-05-01

    Full Text Available Abstract Background Transmissible spongiform encephalopathies (TSEs or prion diseases are fatal neurodegenerative disorders which occur in humans and various animal species. Examples include Creutzfeldt-Jakob disease (CJD in humans, bovine spongiform encephalopathy (BSE in cattle, chronic wasting disease (CWD in deer and elk, and scrapie in sheep, and experimental mice. To gain insights into TSE pathogenesis, we made and used cDNA microarrays to identify disease-associated alterations in gene expression. Brain gene expression in scrapie-infected mice was compared to mock-infected mice at pre-symptomatic and symptomatic time points. Three strains of mouse scrapie that show striking differences in neuropathology were studied: ME7, 22L, and Chandler/RML. Results In symptomatic mice, over 400 significant gene expression alterations were identified. In contrast, only 22 genes showed significant alteration in the pre-symptomatic animals. We also identified genes that showed significant differences in alterations in gene expression between strains. Genes identified in this study encode proteins that are involved in many cellular processes including protein folding, endosome/lysosome function, immunity, synapse function, metal ion binding, calcium regulation and cytoskeletal function. Conclusion These studies shed light on the complex molecular events that occur during prion disease, and identify genes whose further study may yield new insights into strain specific neuropathogenesis and ante-mortem tests for TSEs.

  19. Mitochondrial dysfunction induced by oxidative stress in the brains of hamsters infected with the 263 K scrapie agent.

    Science.gov (United States)

    Choi, S I; Ju, W K; Choi, E K; Kim, J; Lea, H Z; Carp, R I; Wisniewski, H M; Kim, Y S

    1998-09-01

    Scrapie, one of the prion diseases, is a transmissible neurodegenerative disease of sheep and other animals. Clinical symptoms of prion diseases are characterized by a long latent period, followed by progressive ataxia, tremor, and death. To study the induction of neurodegeneration during scrapie infection, we have analyzed the activities of various antioxidant enzymes and mitochondrial enzymes in cerebral cortex, brain stem, and cerebellum of scrapie-infected hamsters. The activity of mitochondrial Mn-superoxide dismutase (SOD) was decreased, while the activities of cytosolic Cu/Zn-SOD and catalase were not altered in infected brains. The activities of glutathione peroxidase and glutathione reductase were increased in scrapie-infected hamsters. The decreased activity of Mn-SOD might result in increasing oxidative stress in the mitochondria of infected brain; this concept is supported by our findings of a high level of lipid peroxidation, and low levels of ATPase and cytochrome c oxidase activity in the infected cerebral mitochondria. In addition, structural abnormalities of mitochondria have been observed in the neurons of hippocampus and cerebral cortex of infected brain. These results suggest that mitochondrial dysfunction caused by oxidative stress gives rise to neurodegeneration in prion disease.

  20. Epidemiological implications of the susceptibility to BSE of putatively resistant sheep.

    Science.gov (United States)

    Kao, R R; Houston, F; Baylis, M; Chihota, C M; Goldmann, W; Gravenor, M B; Hunter, N; McLean, A R

    2003-12-01

    The experimental infection of sheep with bovine spongiform encephalopathy (BSE) by the oral route and the likelihood that sheep were fed BSE-infected meat and bone meal has led to extensive speculation as to whether or not sheep are naturally infected with BSE. In response, the UK government has initiated the National Scrapie Plan (NSP), an ambitious pound 120 million per year project to create a BSE- and scrapie-resistant national sheep flock, by selectively breeding for a genotype of sheep believed to be resistant to both diseases. This genotype has recently been shown to be susceptible to BSE by intracerebral (i.c.) inoculation. Should these sheep be sufficiently susceptible to BSE via natural transmission, the NSP might fail. Here we estimate the susceptibility of this genotype to horizontal (sheep-to-sheep) transmission of BSE by comparison with more extensive oral and i.c. exposure data for other sheep genotypes. We show that a previous estimate of the risk of BSE transmission to sheep via the feedborne route remains robust. However, using a mathematical model for the within-flock transmission of BSE, we show that, while the best estimate indicates that the NSP should be successful, current data cannot exclude the failure of the NSP.

  1. Scrapie affects the maturation cycle and immune complex trapping by follicular dendritic cells in mice.

    Directory of Open Access Journals (Sweden)

    Gillian McGovern

    Full Text Available Transmissible spongiform encephalopathies (TSEs or prion diseases are infectious neurological disorders of man and animals, characterised by abnormal disease-associated prion protein (PrP(d accumulations in the brain and lymphoreticular system (LRS. Prior to neuroinvasion, TSE agents often accumulate to high levels within the LRS, apparently without affecting immune function. However, our analysis of scrapie-affected sheep shows that PrP(d accumulations within the LRS are associated with morphological changes to follicular dendritic cells (FDCs and tingible body macrophages (TBMs. Here we examined FDCs and TBMs in the mesenteric lymph nodes (MLNs of scrapie-affected mice by light and electron microscopy. In MLNs from uninfected mice, FDCs could be morphologically categorised into immature, mature and regressing forms. However, in scrapie-affected MLNs this maturation cycle was adversely affected. FDCs characteristically trap and retain immune complexes on their surfaces, which they display to B-lymphocytes. In scrapie-affected MLNs, some FDCs were found where areas of normal and abnormal immune complex retention occurred side by side. The latter co-localised with PrP(d plasmalemmal accumulations. Our data suggest this previously unrecognised morphology represents the initial stage of an abnormal FDC maturation cycle. Alterations to the FDCs included PrP(d accumulation, abnormal cell membrane ubiquitin and excess immunoglobulin accumulation. Regressing FDCs, in contrast, appeared to lose their membrane-attached PrP(d. Together, these data suggest that TSE infection adversely affects the maturation and regression cycle of FDCs, and that PrP(d accumulation is causally linked to the abnormal pathology observed. We therefore support the hypothesis that TSEs cause an abnormality in immune function.

  2. Susceptibility of GT1-7 cells to mouse-passaged field scrapie isolates with a long incubation.

    Science.gov (United States)

    Miyazawa, Kohtaro; Okada, Hiroyuki; Iwamaru, Yoshifumi; Masujin, Kentaro; Yokoyama, Takashi

    2014-01-01

    A typical feature of scrapie in sheep and goats is the accumulation of disease-associated prion protein. Scrapie consists of many strains with different biological properties. Nine natural sheep scrapie cases were transmitted to wild-type mice and mouse-passaged isolates were classified into 2 types based on incubation time: short and long. These 2 types displayed a distinct difference in their pathology. We attempted to transmit these mouse-passaged isolates to 2 murine cell lines (GT1-7 and L929) to compare their properties. All of the isolates were transmitted to L929 cells. However, only mouse-passaged field isolates with a long incubation time were transmitted to GT1-7 cells. This specific susceptibility of GT1-7 cells was also confirmed with a primary-passaged isolate that was not completely adapted to the new host species. Characterization of the mechanisms of the specific susceptibility of GT1-7 cells to isolates with a long incubation time may lead to a greater understanding of the differences among prion strains.

  3. Scrapie-associated prion protein accumulates in astrocytes during scrapie infection.

    OpenAIRE

    Diedrich, J F; Bendheim, P E; Kim, Y. S.; Carp, R. I.; Haase, A T

    1991-01-01

    In the course of scrapie, a transmissible spongiform encephalopathy caused by an unconventional agent, a normal cellular protein is converted to an abnormal form that copurifies with infectivity and aggregates to form deposits of amyloid. We have used immunocytochemistry and methods that enhance detection of amyloidogenic proteins to investigate the types of cells in the central nervous system which are involved in the formation of the abnormal scrapie-associated protein. We show that this pr...

  4. Scrapie infectivity is quickly cleared in tissues of orally-infected farmed fish

    Directory of Open Access Journals (Sweden)

    Faoro Franco

    2006-06-01

    Full Text Available Abstract Background Scrapie and bovine spongiform encephalopathy (BSE belongs to the group of animal transmissible spongiform encephalopathy (TSE. BSE epidemic in the UK and elsewhere in Europe has been linked to the use of bovine meat and bone meals (MBM in the feeding of cattle. There is concern that pigs, poultry and fish bred for human consumption and fed with infected MBM would eventually develop BSE or carry residual infectivity without disease. Although there has been no evidence of infection in these species, experimental data on the susceptibility to the BSE agent of farm animals other than sheep and cow are limited only to pigs and domestic chicken. In the framework of a EU-granted project we have challenged two species of fish largely used in human food consumption, rainbow trout (Oncorhynchus mykiss and turbot (Scophthalmus maximus, with a mouse-adapted TSE strain (scrapie 139A, to assess the risk related to oral consumption of TSE contaminated food. In trout, we also checked the "in vitro" ability of the pathological isoform of the mouse prion protein (PrPSc to cross the intestinal epithelium when added to the mucosal side of everted intestine. Results Fish challenged with a large amount of scrapie mouse brain homogenate by either oral or parenteral routes, showed the ability to clear the majority of infectivity load. None of the fish tissues taken at different time points after oral or parenteral inoculation was able to provoke scrapie disease after intracerebral inoculation in recipient mice. However, a few recipient mice were positive for PrPSc and spongiform lesions in the brain. We also showed a specific binding of PrPSc to the mucosal side of fish intestine in the absence of an active uptake of the prion protein through the intestinal wall. Conclusion These results indicate that scrapie 139A, and possibly BSE, is quickly removed from fish tissues despite evidence of a prion like protein in fish and of a specific binding of Pr

  5. Scrapie strain-specific interactions with endogenous murine leukaemia virus.

    Science.gov (United States)

    Carp, R I; Meeker, H C; Caruso, V; Sersen, E

    1999-01-01

    The finding that a senescence-accelerated mouse (SAMP8) shows early brain ageing, with histopathological changes resembling those seen in scrapie, combined with the discovery of high levels of endogenous murine leukaemia virus (MuLV) in brains of SAMP8 mice prompted us to examine the effect of scrapie infection on MuLV titres in this strain and in one of its progenitors, the AKR strain. Three scrapie strains (ME7, 22L and 139A) that had a comparatively short incubation period in SAMP8 and AKR mice caused an increase in brain MuLV titres that was scrapie strain-specific: in each mouse strain, the greatest effect was with 1 39A, and the least with ME7. The 22A scrapie strain, which has a long incubation period in SAMP8 mice, did not affect MuLV titres in brains of this mouse strain. Previous analyses of scrapie incubation periods in AKR, SAMP8 and another strain derived from an AKR cross (SAMR1) showed an inverse relationship between brain MuLV titres and scrapie incubation periods. This finding, combined with the effect of scrapie on MuLV titres, suggests an interaction between the scrapie infectious process and MuLV replication.

  6. Surveillance and simulation of bovine spongiform encephalopathy and scrapie in small ruminants in Switzerland

    Directory of Open Access Journals (Sweden)

    Zurbriggen Andreas

    2010-04-01

    Full Text Available Abstract Background After bovine spongiform encephalopathy (BSE emerged in European cattle livestock in 1986 a fundamental question was whether the agent established also in the small ruminants' population. In Switzerland transmissible spongiform encephalopathies (TSEs in small ruminants have been monitored since 1990. While in the most recent TSE cases a BSE infection could be excluded, for historical cases techniques to discriminate scrapie from BSE had not been available at the time of diagnosis and thus their status remained unclear. We herein applied state-of-the-art techniques to retrospectively classify these animals and to re-analyze the affected flocks for secondary cases. These results were the basis for models, simulating the course of TSEs over a period of 70 years. The aim was to come to a statistically based overall assessment of the TSE situation in the domestic small ruminant population in Switzerland. Results In sum 16 TSE cases were identified in small ruminants in Switzerland since 1981, of which eight were atypical and six were classical scrapie. In two animals retrospective analysis did not allow any further classification due to the lack of appropriate tissue samples. We found no evidence for an infection with the BSE agent in the cases under investigation. In none of the affected flocks, secondary cases were identified. A Bayesian prevalence calculation resulted in most likely estimates of one case of BSE, five cases of classical scrapie and 21 cases of atypical scrapie per 100'000 small ruminants. According to our models none of the TSEs is considered to cause a broader epidemic in Switzerland. In a closed population, they are rather expected to fade out in the next decades or, in case of a sporadic origin, may remain at a very low level. Conclusions In summary, these data indicate that despite a significant epidemic of BSE in cattle, there is no evidence that BSE established in the small ruminant population in

  7. Antiprion activity of cholesterol esterification modulators: a comparative study using ex vivo sheep fibroblasts and lymphocytes and mouse neuroblastoma cell lines.

    Science.gov (United States)

    Pani, Alessandra; Norfo, Claudia; Abete, Claudia; Mulas, Claudia; Putzolu, Marirosa; Laconi, Sergio; Orrù, Christina Doriana; Cannas, M Dolores; Vascellari, Sarah; La Colla, Paolo; Dessì, Sandra

    2007-11-01

    Our studies on the role of cholesterol homeostasis in the pathogenesis of scrapie revealed abnormal accumulation of cholesterol esters in ex vivo peripheral blood mononuclear cells (PBMCs) and skin fibroblasts from healthy and scrapie-affected sheep carrying a scrapie-susceptible genotype compared to sheep with a resistant genotype. Similar alterations were observed in mouse neuroblastoma N2a cell lines persistently infected with mouse-adapted 22L and RML strains of scrapie that showed up to threefold-higher cholesterol ester levels than parental N2a cells. We now report that proteinase K-resistant prion protein (PrPres)-producing cell populations of subclones from scrapie-infected cell lines were characterized by higher cholesterol ester levels than clone populations not producing PrPres. Treatments with a number of drugs known to interfere with different steps of cholesterol metabolism strongly reduced the accumulation of cholesterol esters in ex vivo PBMCs and skin fibroblasts from scrapie-affected sheep but had significantly less or no effect in their respective scrapie-resistant or uninfected counterparts. In scrapie-infected N2a cells, inhibition of cholesterol esters was associated with selective antiprion activity. Effective antiprion concentrations of cholesterol modulators (50% effective concentration [EC(50)] range, 1.4 to 40 microM) were comparable to those of antiprion reference compounds (EC(50) range, 0.6 to 10 microM). These data confirm our hypothesis that abnormal accumulation of cholesterol esters may represent a biological marker of susceptibility to prion infection/replication and a novel molecular target of potential clinical importance.

  8. On the question of proportionality of the count of observed Scrapie cases and the size of holding

    Directory of Open Access Journals (Sweden)

    Del Rio Vilas Victor J

    2009-05-01

    Full Text Available Abstract Background The present paper investigates the question of a suitable basic model for the number of scrapie cases in a holding and applications of this knowledge to the estimation of scrapie-affected holding population sizes and adequacy of control measures within holding. Is the number of scrapie cases proportional to the size of the holding in which case it should be incorporated into the parameter of the error distribution for the scrapie counts? Or, is there a different – potentially more complex – relationship between case count and holding size in which case the information about the size of the holding should be better incorporated as a covariate in the modeling? Methods We show that this question can be appropriately addressed via a simple zero-truncated Poisson model in which the hypothesis of proportionality enters as a special offset-model. Model comparisons can be achieved by means of likelihood ratio testing. The procedure is illustrated by means of surveillance data on classical scrapie in Great Britain. Furthermore, the model with the best fit is used to estimate the size of the scrapie-affected holding population in Great Britain by means of two capture-recapture estimators: the Poisson estimator and the generalized Zelterman estimator. Results No evidence could be found for the hypothesis of proportionality. In fact, there is some evidence that this relationship follows a curved line which increases for small holdings up to a maximum after which it declines again. Furthermore, it is pointed out how crucial the correct model choice is when applied to capture-recapture estimation on the basis of zero-truncated Poisson models as well as on the basis of the generalized Zelterman estimator. Estimators based on the proportionality model return very different and unreasonable estimates for the population sizes. Conclusion Our results stress the importance of an adequate modelling approach to the association between holding

  9. 9 CFR 54.9 - Waiver of requirements for scrapie control pilot projects.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Waiver of requirements for scrapie... CONTROL OF SCRAPIE Scrapie Indemnification Program § 54.9 Waiver of requirements for scrapie control pilot projects. The Administrator may waive the following requirements of this part for participants in a...

  10. Accumulation of pathological prion protein PrPSc in the skin of animals with experimental and natural scrapie.

    Directory of Open Access Journals (Sweden)

    Achim Thomzig

    2007-05-01

    Full Text Available Prion infectivity and its molecular marker, the pathological prion protein PrP(Sc, accumulate in the central nervous system and often also in lymphoid tissue of animals or humans affected by transmissible spongiform encephalopathies. Recently, PrP(Sc was found in tissues previously considered not to be invaded by prions (e.g., skeletal muscles. Here, we address the question of whether prions target the skin and show widespread PrP(Sc deposition in this organ in hamsters perorally or parenterally challenged with scrapie. In hamsters fed with scrapie, PrP(Sc was detected before the onset of symptoms, but the bulk of skin-associated PrP(Sc accumulated in the clinical phase. PrP(Sc was localized in nerve fibres within the skin but not in keratinocytes, and the deposition of PrP(Sc in skin showed no dependence from the route of infection and lymphotropic dissemination. The data indicated a neurally mediated centrifugal spread of prions to the skin. Furthermore, in a follow-up study, we examined sheep naturally infected with scrapie and detected PrP(Sc by Western blotting in skin samples from two out of five animals. Our findings point to the skin as a potential reservoir of prions, which should be further investigated in relation to disease transmission.

  11. Enzymatic formulation capable of degrading scrapie prion under mild digestion conditions.

    Directory of Open Access Journals (Sweden)

    Emeka A Okoroma

    Full Text Available The prion agent is notoriously resistant to common proteases and conventional sterilisation procedures. The current methods known to destroy prion infectivity such as incineration, alkaline and thermal hydrolysis are harsh, destructive, environmentally polluting and potentially hazardous, thus limit their applications for decontamination of delicate medical and laboratory devices, remediation of prion contaminated environment and for processing animal by-products including specified risk materials and carcases. Therefore, an environmentally friendly, non-destructive enzymatic degradation approach is highly desirable. A feather-degrading Bacillus licheniformis N22 keratinase has been isolated which degraded scrapie prion to undetectable level of PrP(Sc signals as determined by Western Blot analysis. Prion infectivity was verified by ex vivo cell-based assay. An enzymatic formulation combining N22 keratinase and biosurfactant derived from Pseudomonas aeruginosa degraded PrP(Sc at 65 °C in 10 min to undetectable level -. A time-course degradation analysis carried out at 50 °C over 2 h revealed the progressive attenuation of PrP(Sc intensity. Test of residual infectivity by standard cell culture assay confirmed that the enzymatic formulation reduced PrP(Sc infectivity to undetectable levels as compared to cells challenged with untreated standard scrapie sheep prion (SSBP/1 (p-value = 0.008 at 95% confidence interval. This novel enzymatic formulation has significant potential application for prion decontamination in various environmentally friendly systems under mild treatment conditions.

  12. Replication of the Scrapie Agent in Ocular Neural Tissues

    Science.gov (United States)

    Buyukmihci, Ned; Rorvik, Marie; Marsh, Richard F.

    1980-02-01

    Optic nerves and retinas removed from hamsters experimentally inoculated with the scrapie agent contain a high titer of infectivity. Ophthalmoscopic examination of these animals revealed gross lesions of retinopathy as early as 3 weeks before the onset of clinical signs of brain degeneration. These results suggest that the scrapie agent may spread centrifugally in nerve fibers after intracerebral inoculation and that the scrapie-associated retinopathy seen in hamsters is directly induced by the agent rather than the result of retrograde degeneration from central neural damage.

  13. Genotype-dependent molecular evolution of sheep bovine spongiform encephalopathy (BSE) prions in vitro affects their zoonotic potential.

    Science.gov (United States)

    Krejciova, Zuzana; Barria, Marcelo A; Jones, Michael; Ironside, James W; Jeffrey, Martin; González, Lorenzo; Head, Mark W

    2014-09-19

    Prion diseases are rare fatal neurological conditions of humans and animals, one of which (variant Creutzfeldt-Jakob disease) is known to be a zoonotic form of the cattle disease bovine spongiform encephalopathy (BSE). What makes one animal prion disease zoonotic and others not is poorly understood, but it appears to involve compatibility between the prion strain and the host prion protein sequence. Concerns have been raised that the United Kingdom sheep flock may have been exposed to BSE early in the cattle BSE epidemic and that serial BSE transmission in sheep might have resulted in adaptation of the agent, which may have come to phenotypically resemble scrapie while maintaining its pathogenicity for humans. We have modeled this scenario in vitro. Extrapolation from our results suggests that if BSE were to infect sheep in the field it may, with time and in some sheep genotypes, become scrapie-like at the molecular level. However, the results also suggest that if BSE in sheep were to come to resemble scrapie it would lose its ability to affect humans.

  14. Glycidol degrades scrapie mouse prion protein.

    Science.gov (United States)

    Yamamoto, M; Horiuchi, M; Ishiguro, N; Shinagawa, M; Matsuo, T; Kaneko, K

    2001-09-01

    Agents of transmissible spongiform encephalopathy (prion) are known to be extremely resistant to physicochemical inactivation procedures such as heat, radiation, chemical disinfectants such as detergents, alcohols, glutaraldehyde, formalin, and so on. Because of its remarkable resistance, it is difficult to inactivate prion. Chemical inactivation seems to be a practical method because it is applicable to large or fixed surfaces and complicated equipment. Here, three epoxides: beta-propiolactone, propylene oxide, and glycidol (GLD) were examined of their inactivation ability against scrapie-mouse prion protein (PrP(Sc)) under various conditions of chemical concentration, incubation time, and temperature. Among these chemicals, GLD worked most effectively and degraded PrP into small fragments. As a result of the bioassay, treatment with 3% GLD for 5 hr and 5% GLD for 2, 5 hr or 12 hr at room temperature prolonged the mean incubation time by 44, 30, 110 and 73 days, respectively. From dose-incubation time standard curve, the decrease in infectivity titers were estimated as 10(3) or more. Therefore, degradation of PrP(Sc) by GLD decreased the scrapie infectivity. It is also suggested that pH and salt concentrations influence the effect of GLD. Although further study is necessary to determine the optimal condition, GLD may be a potential prion disinfectant.

  15. Paradox of Genetic Diversity in the Case of Prionic Diseases in Sheep Breeds from Romania

    Directory of Open Access Journals (Sweden)

    Gheorghe Hrinca

    2016-05-01

    Full Text Available The main target of this debate is the revaluation of the biodiversity concept and especially of its significance in the animal husbandry field. The paper analyzes the genetic diversity at the determinant locus of scrapie (PrP in the sheep breeds from Romania: Palas Merino, Tsigai, Tsurcana, Botosani Karakul, Palas Meat Breed and Palas Milk Breed. The prionic genetic diversity (d has been quantified by means of informational energy (e. This study highlights the impact of increasing the genetic diversity from the PrP locus level on the health status of ovine species and especially on human food safety. The informational statistics processing shows that the resistance / susceptibility to scrapie is in relation to the degree of prionic genetic diversity. The limitation of genetic diversity by selecting the individuals possessing the ARR allele in both homozygous status and in combination with alleles ARQ, ARH AHQ confers to sheep herds certain levels of resistance to contamination with scrapie disease. Instead, promoting to reproduction also individuals possessing the VRQ allele in all possible genotypic combinations (including ARR allele increases genetic diversity but also has as effect increasing the susceptibility of sheep to prion disease onset. From the point of view of morbid phenomenon, the Botosani Karakul breed is clearly advantaged compared to all other indigenous sheep breeds from Romania. For methodological coherency in the interpretative context of this issue, the genetic diversity was analyzed in association with the heterozygosity degree of breeds and their Hardy-Weinberg genetic equilibrium at the PrP locus level. Finally, the paper refers to decisions that the improvers must take to achieve the genetic prophylaxis in the scrapie case taking into account the polymorphism degree of prion protein.

  16. Invited review: Current state of genetic improvement in dairy sheep.

    Science.gov (United States)

    Carta, A; Casu, Sara; Salaris, S

    2009-12-01

    Dairy sheep have been farmed traditionally in the Mediterranean basin in southern Europe, central Europe, eastern Europe, and in Near East countries. Currently, dairy sheep farming systems vary from extensive to intensive according to the economic relevance of the production chain and the specific environment and breed. Modern breeding programs were conceived in the 1960s. The most efficient selection scheme for local dairy sheep breeds is based on pyramidal management of the population with the breeders of nucleus flocks at the top, where pedigree and official milk recording, artificial insemination, controlled natural mating, and breeding value estimation are carried out to generate genetic progress. The genetic progress is then transferred to the commercial flocks through artificial insemination or natural-mating rams. Increasing milk yield is still the most profitable breeding objective for several breeds. Almost all milk is used for cheese production and, consequently, milk content traits are very important. Moreover, other traits are gaining interest for selection: machine milking ability and udder morphology, resistance to diseases (mastitis, internal parasites, scrapie), and traits related to the nutritional value of milk (fatty acid composition). Current breeding programs based on the traditional quantitative approach have achieved appreciable genetic gains for milk yield. In many cases, further selection goals such as milk composition, udder morphology, somatic cell count, and scrapie resistance have been implemented. However, the possibility of including other traits of selective interest is limited by high recording costs. Also, the organizational effort needed to apply the traditional quantitative approach limits the diffusion of current selection programs outside the European Mediterranean area. In this context, the application of selection schemes assisted by molecular information, to improve either traditional dairy traits or traits costly to record

  17. Explaining the heterogeneous scrapie surveillance figures across Europe: a meta-regression approach

    Directory of Open Access Journals (Sweden)

    Ru Giuseppe

    2007-06-01

    Full Text Available Abstract Background Two annual surveys, the abattoir and the fallen stock, monitor the presence of scrapie across Europe. A simple comparison between the prevalence estimates in different countries reveals that, in 2003, the abattoir survey appears to detect more scrapie in some countries. This is contrary to evidence suggesting the greater ability of the fallen stock survey to detect the disease. We applied meta-analysis techniques to study this apparent heterogeneity in the behaviour of the surveys across Europe. Furthermore, we conducted a meta-regression analysis to assess the effect of country-specific characteristics on the variability. We have chosen the odds ratios between the two surveys to inform the underlying relationship between them and to allow comparisons between the countries under the meta-regression framework. Baseline risks, those of the slaughtered populations across Europe, and country-specific covariates, available from the European Commission Report, were inputted in the model to explain the heterogeneity. Results Our results show the presence of significant heterogeneity in the odds ratios between countries and no reduction in the variability after adjustment for the different risks in the baseline populations. Three countries contributed the most to the overall heterogeneity: Germany, Ireland and The Netherlands. The inclusion of country-specific covariates did not, in general, reduce the variability except for one variable: the proportion of the total adult sheep population sampled as fallen stock by each country. A large residual heterogeneity remained in the model indicating the presence of substantial effect variability between countries. Conclusion The meta-analysis approach was useful to assess the level of heterogeneity in the implementation of the surveys and to explore the reasons for the variation between countries.

  18. Evaluation of the possible transmission of BSE and scrapie to gilthead sea bream (Sparus aurata.

    Directory of Open Access Journals (Sweden)

    Evgenia Salta

    Full Text Available In transmissible spongiform encephalopathies (TSEs, a group of fatal neurodegenerative disorders affecting many species, the key event in disease pathogenesis is the accumulation of an abnormal conformational isoform (PrP(Sc of the host-encoded cellular prion protein (PrP(C. While the precise mechanism of the PrP(C to PrP(Sc conversion is not understood, it is clear that host PrP(C expression is a prerequisite for effective infectious prion propagation. Although there have been many studies on TSEs in mammalian species, little is known about TSE pathogenesis in fish. Here we show that while gilthead sea bream (Sparus aurata orally challenged with brain homogenates prepared either from a BSE infected cow or from scrapie infected sheep developed no clinical prion disease, the brains of TSE-fed fish sampled two years after challenge did show signs of neurodegeneration and accumulation of deposits that reacted positively with antibodies raised against sea bream PrP. The control groups, fed with brains from uninfected animals, showed no such signs. Remarkably, the deposits developed much more rapidly and extensively in fish inoculated with BSE-infected material than in the ones challenged with the scrapie-infected brain homogenate, with numerous deposits being proteinase K-resistant. These plaque-like aggregates exhibited congophilia and birefringence in polarized light, consistent with an amyloid-like component. The neurodegeneration and abnormal deposition in the brains of fish challenged with prion, especially BSE, raises concerns about the potential risk to public health. As fish aquaculture is an economically important industry providing high protein nutrition for humans and other mammalian species, the prospect of farmed fish being contaminated with infectious mammalian PrP(Sc, or of a prion disease developing in farmed fish is alarming and requires further evaluation.

  19. Evaluation of the possible transmission of BSE and scrapie to gilthead sea bream (Sparus aurata).

    Science.gov (United States)

    Salta, Evgenia; Panagiotidis, Cynthia; Teliousis, Konstantinos; Petrakis, Spyros; Eleftheriadis, Eleftherios; Arapoglou, Fotis; Grigoriadis, Nikolaos; Nicolaou, Anna; Kaldrymidou, Eleni; Krey, Grigorios; Sklaviadis, Theodoros

    2009-07-28

    In transmissible spongiform encephalopathies (TSEs), a group of fatal neurodegenerative disorders affecting many species, the key event in disease pathogenesis is the accumulation of an abnormal conformational isoform (PrP(Sc)) of the host-encoded cellular prion protein (PrP(C)). While the precise mechanism of the PrP(C) to PrP(Sc) conversion is not understood, it is clear that host PrP(C) expression is a prerequisite for effective infectious prion propagation. Although there have been many studies on TSEs in mammalian species, little is known about TSE pathogenesis in fish. Here we show that while gilthead sea bream (Sparus aurata) orally challenged with brain homogenates prepared either from a BSE infected cow or from scrapie infected sheep developed no clinical prion disease, the brains of TSE-fed fish sampled two years after challenge did show signs of neurodegeneration and accumulation of deposits that reacted positively with antibodies raised against sea bream PrP. The control groups, fed with brains from uninfected animals, showed no such signs. Remarkably, the deposits developed much more rapidly and extensively in fish inoculated with BSE-infected material than in the ones challenged with the scrapie-infected brain homogenate, with numerous deposits being proteinase K-resistant. These plaque-like aggregates exhibited congophilia and birefringence in polarized light, consistent with an amyloid-like component. The neurodegeneration and abnormal deposition in the brains of fish challenged with prion, especially BSE, raises concerns about the potential risk to public health. As fish aquaculture is an economically important industry providing high protein nutrition for humans and other mammalian species, the prospect of farmed fish being contaminated with infectious mammalian PrP(Sc), or of a prion disease developing in farmed fish is alarming and requires further evaluation.

  20. Issues and perspectives in dairy sheep breeding

    Directory of Open Access Journals (Sweden)

    Pierlorenzo Secchiari

    2010-01-01

    Full Text Available The present review consists of two parts. In the first part, the authors briefly describe the state of the art of breedingprogrammes for Italian dairy sheep; then they report new models for genetic evaluation and consider the problem ofgenotype x environment interaction and the impact of farming systems on the genetic merit of animals. In the secondpart new breeding goals regarding the evolution of milk quality concept and the increasing importance of functional traitsare reported. Regarding milk quality, the authors especially focus on the traits related to cheese-making ability and onthe nutraceutical aspects of milk. Among functional traits, resistance to diseases (mastitis and Scrapie has been highlightedfor its great importance in livestock species. Finally, the perspectives of marker-assisted selection have also beenreported.

  1. Prion protein gene frequencies in three Sicilian dairy sheep populations

    Directory of Open Access Journals (Sweden)

    Santo Caracappa

    2010-01-01

    Full Text Available The objective of this paper was to investigate the prion protein (PrP genotype and haplotype frequencies in three Sicilian dairy sheep populations. The three populations were: (1 1096 Valle del Belice animals, (2 1143 Comisana animals, and (3 1771 individuals from 5 flocks with scrapie outbreaks, in which the animals were crossbreds derived from indigenous Sicilian dairy breeds. PrP genotypes are described for the three codons 136 (Alanine or Valine; A, V, 154 (Histidine or Arginine; H, R, and 171 (Glutamine, Arginine or Histidine; Q, R, H which represent polymorphisms known to be linked with scrapie susceptibility. The Valle del Belice haplotype frequencies were 32.3% ARR, 6.5% AHQ, 1.0% ARH, 58.8% ARQ, and 1.4% VRQ. The Comisana frequencies were 39.4% ARR, 2.9% AHQ, 2.9% ARH, 50.9% ARQ, and 3.9% VRQ. In the flocks with scrapie outbreaks the frequencies were 32.8% ARR, 2.4% AHQ, 1.7% ARH, 59.1% ARQ, and 3.9% VRQ. In all three populations ARQ and ARR were the most frequent haplotypes. Multiple generations of strong selection will be needed to fixate the most resistant ARR haplotype.

  2. Analysis of host genetic control of scrapie-induced obesity.

    Science.gov (United States)

    Carp, R I; Callahan, S M; Yu, Y; Sersen, E

    1993-01-01

    The potential for induction of obesity during the preclinical phase of scrapie disease in mice was previously shown to be a function of both the strain of scrapie and the strain of inbred mouse. In the present study, host control of obesity induction by a scrapie strain was examined to determine if the effect were dependent on a single gene or multiple genes. The approach used was assessment of the pattern of weight induction in F1 and F2 crosses of parental inbred mouse strains that did or did not show a weight increase with a specific scrapie strain. Analyses of these data indicated that the induction of obesity was controlled by multiple host genes. In an unrelated observation, there was a correlation between the incubation period of a strain of scrapie in F2 generation mice and their coat color, i.e., the average incubation period of yellow-brown mice was significantly less than those of either black or white mice.

  3. Preclinical changes in weight of scrapie-infected mice as a function of scrapie agent-mouse strain combination.

    Science.gov (United States)

    Carp, R I; Callahan, S M; Sersen, E A; Moretz, R C

    1984-01-01

    Several inbred strains of mice were injected with different scrapie agents and their total body weight was monitored throughout the incubation period. As a control, mice were injected with normal mouse brain homogenate. For most combinations of scrapie agent and mouse strain, weights during the preclinical phase were similar to or lower than the average weight of controls. For some combinations there was a significant increase in weight (compared to controls) during the latter part of the preclinical phase of disease. The effect was dependent on both agent and mouse strain, i.e., in some cases a mouse strain showed the increase with one scrapie agent but not another and some scrapie agents caused the increase in one inbred strain of mouse but not in another strain. The increase in weight was due to accumulations of fat rather than a generalized increase in weight of various organs. With one mouse strain (SJL), there was increased vacuolation seen in the hypothalamus of mice injected with scrapie agents that showed the increase in weight compared to the lesion intensity with an agent which did not cause the weight increase.

  4. Synthetic scrapie infectivity: interaction between recombinant PrP and scrapie brain-derived RNA.

    Science.gov (United States)

    Simoneau, Steve; Thomzig, Achim; Ruchoux, Marie-Madeleine; Vignier, Nicolas; Daus, Martin L; Poleggi, Anna; Lebon, Pierre; Freire, Sophie; Durand, Valerie; Graziano, Silvia; Galeno, Roberta; Cardone, Franco; Comoy, Emmanuel; Pocchiari, Maurizio; Beekes, Michael; Deslys, Jean-Philippe; Fournier, Jean-Guy

    2015-01-01

    The key molecular event in human cerebral proteinopathies, which include Alzheimer's, Parkinson's and Huntington's diseases, is the structural conversion of a specific host protein into a β-sheet-rich conformer. With regards to this common mechanism, it appears difficult to explain the outstanding infectious properties attributed to PrP(Sc), the hallmark of another intriguing family of cerebral proteinopathies known as transmissible spongiform encephalopathies (TSE) or prion diseases. The infectious PrP(Sc) or "prion" is thought to be composed solely of a misfolded form of the otherwise harmless cellular prion protein (PrP(c)). To gain insight into this unique situation, we used the 263K scrapie hamster model to search for a putative PrP(Sc)-associated factor that contributes to the infectivity of PrP(Sc) amyloid. In a rigorously controlled set of experiments that included several bioassays, we showed that originally innocuous recombinant prion protein (recPrP) equivalent to PrP(c) is capable of initiating prion disease in hamsters when it is converted to a prion-like conformation (β-sheet-rich) in the presence of RNA purified from scrapie-associated fibril (SAF) preparations. Analysis of the recPrP-RNA infectious mixture reveals the presence of 2 populations of small RNAs of approximately 27 and 55 nucleotides. These unprecedented findings are discussed in light of the distinct relationship that may exist between this RNA material and the 2 biological properties, infectivity and strain features, attributed to prion amyloid.

  5. Glutathione peroxidase (GPX activity in blood of ewes on farms in different scrapie categories in Iceland

    Directory of Open Access Journals (Sweden)

    Eiríksson Tryggvi

    2008-06-01

    Full Text Available Abstract Background Preliminary studies indicated decreased glutathione peroxidase (GPX activity in blood of ewes on scrapie-afflicted farms. Other studies have shown decreased GPX activity in brain of prion-infected mice and in prion-infected cells in vitro. The aim of this study was to examine the GPX activity in blood as well as the distribution of GPX-activity levels from ewes on farms in scrapie-afflicted areas in Iceland. Methods Blood samples were collected from 635 ewes (non-pregnant [n = 297] and pregnant [n = 338] on 40 farms in scrapie-afflicted areas during the years 2001–2005, for analysis of GPX activity. The farms were divided into three categories: 1. Scrapie-free farms (n = 14; 2. Scrapie-prone farms (earlier scrapie-afflicted, restocked farms (n = 12; 3. Scrapie-afflicted farms (n = 14. For comparison, 121 blood samples were also collected from non-pregnant ewes on one farm (farm A in a scrapie-free area (scrapie never registered. Chi-square test was used to test for normal distribution of GPX-results, and Kruskal-Wallis test to compare GPX-results between categories. Results The GPX-results appeared to be biphasically distributed in ewes in all three scrapie categories and on farm A. The presumptive breaking point was about 300 units g Hb-1. About 30–50% of the GPX-results from ewes in all three scrapie categories were below 300 units g Hb-1 but only about 13% of the GPX-results from ewes on farm A. The mean GPX activity was highest on farm A, and was significantly lower on scrapie-prone farms than on scrapie-free or scrapie-afflicted farms (non-pregnant and pregnant ewes: P Conclusions 1 the distribution of GPX-results in blood of Icelandic ewes apparently has a biphasic character; 2 the GPX-results were higher in ewes on one farm in a scrapie-free area than in ewes on farms in the scrapie-afflicted areas; 3 GPX-activity levels were significantly lowest on earlier scrapie-afflicted, restocked farms, which might have a

  6. Transcriptomic determinants of scrapie prion propagation in cultured ovine microglia

    Science.gov (United States)

    While infection by scrapie prions is dependent on expression of cellular prion protein (PrP-C), other factors must play a role since not all cells that express equivalent levels of PrP-C are permissive to infection. The aim of this study was to determine the cellular factors associated with permissi...

  7. Pathogenesis of bovine spongiform encephalopathy in sheep.

    Science.gov (United States)

    van Keulen, L J M; Vromans, M E W; Dolstra, C H; Bossers, A; van Zijderveld, F G

    2008-01-01

    The pathogenesis of bovine spongiform encephalopathy (BSE) in sheep was studied by immunohistochemical detection of scrapie-associated prion protein (PrP(Sc)) in the gastrointestinal, lymphoid and neural tissues following oral inoculation with BSE brain homogenate. First accumulation of PrP(Sc) was detected after 6 months in the tonsil and the ileal Peyer's patches. At 9 months postinfection, PrP(Sc) accumulation involved all gut-associated lymphoid tissues and lymph nodes as well as the spleen. At this time point, PrP(Sc) accumulation in the peripheral neural tissues was first seen in the enteric nervous system of the caudal jejunum and ileum and in the coeliac-mesenteric ganglion. In the central nervous system, PrP(Sc) was first detected in the dorsal motor nucleus of the nervus Vagus in the medulla oblongata and in the intermediolateral column in the spinal cord segments T7-L1. At subsequent time points, PrP(Sc) was seen to spread within the lymphoid system to also involve all non-gut-associated lymphoid tissues. In the enteric nervous system, further spread of PrP(Sc) involved the neural plexi along the entire gastrointestinal tract and in the CNS the complete neuraxis. These findings indicate a spread of the BSE agent in sheep from the enteric nervous system through parasympathetic and sympathetic nerves to the medulla oblongata and the spinal cord.

  8. Selectie tegen gevoeligheid voor scrapie met behoud van genetische variatie = Selection against scrapie susceptibility while maintaining within breed genetic variation

    NARCIS (Netherlands)

    Windig, J.J.; Hoving, A.H.

    2009-01-01

    In 2007 is de nationale regelgeving, gericht op selectie tegen scrapie gevoeligheid, gewijzigd. De verplichte inzet van ARR/ARR rammen is beëindigd. In dit rapport geven we een algemeen advies hoe het beste tegen scrapiegevoeligheid kan worden geselecteerd. In dit kader is ook een themadag over fokk

  9. Sensitivity and specificity of a commercial BSE kit for the detection of ovine scrapie.

    Science.gov (United States)

    Yamamoto, Takuji; Ushiki-Kaku, Yuko; Yokoyama, Takashi; Hattori, Shunji

    2013-06-01

    To examine the sensitivity of a commercially available bovine spongiform encephalopathy (BSE) kit (NippIBL) for the detection of ovine scrapie, 50 scrapie-positive ovine samples from the UK, and 54 scrapie-negative ovine samples from Japan were obtain and tested using this kit. The sensitivity and specificity of NippIBL for ovine samples were 96% and 100%, respectively. The detection limit of the abnormal isoform of prion protein (PrP(Sc) ) of NippIBL was examined using diluted scrapie-positive samples. The sensitivity of NippIBL to ovine scrapie was 3-10 times superior to that of another commercial BSE diagnosis kit. Thus, the NippIBL kit proved more effective for the detection of ovine scrapie.

  10. Identification of the first case of atypical scrapie in Japan

    Science.gov (United States)

    IMAMURA, Morikazu; MIYAZAWA, Kohtaro; IWAMARU, Yoshifumi; MATSUURA, Yuichi; YOKOYAMA, Takashi; OKADA, Hiroyuki

    2016-01-01

    A Corriedale ewe was confirmed as the first atypical scrapie case during an active surveillance program for transmissible spongiform encephalopathies in small ruminants in Japan. The animal was homozygous for the AF141RQ haplotype of PRNP. The animal showed clinical neurological signs possibly due to listeriosis before culling. Western blot analysis showed an unusual multiple banded pattern with a low-molecular fragment at ~7 kDa. Histopathology revealed suppurative meningoencephalitis caused by listeriosis in the brainstem. Fine granular to globular immunostaining of disease-associated prion proteins was mainly detected in the neuropil of the spinal tract of the trigeminal nerve and in the white matter of the spinocerebellar tract. Based on these results, this case was conclusively diagnosed as atypical scrapie with encephalitic listeriosis. PMID:27616556

  11. BSE inoculation to prion diseases-resistant sheep reveals tricky silent carriers.

    Science.gov (United States)

    Ronzon, Frédéric; Bencsik, Anna; Lezmi, Stéphane; Vulin, Johann; Kodjo, Angeli; Baron, Thierry

    2006-12-01

    The possible transmission of bovine spongiform encephalopathy (BSE) agent to sheep contributed to select genetically sheep considered as resistant to prion diseases i.e., with PrP ARR/ARR genotype. Here, we report the infection of two PrP ARR/ARR genotype sheep using the cattle BSE agent inoculated by peripheral routes. Disease-associated prion protein (PrP(d)) was detected in the brain for one case (at 2191 days post-infection (dpi)) and only in the nervous enteric system for the other one (at 673dpi). The electrophoretic pattern of PrP(d) from the obex region in this BSE challenged sheep was shown to be closer from that found in naturally scrapie-affected sheep with regard to the apparent molecular mass of the unglycosylated PrP(d). Importantly, the absence of any clinical symptoms up to 6 years following experimental challenge suggests that silent carriers of the BSE agent may exist among ARR homozygous sheep.

  12. Prion protein genotype survey confirms low frequency of scrapie-resistant K222 allele in British goat herds.

    Science.gov (United States)

    Goldmann, W; Marier, E; Stewart, P; Konold, T; Street, S; Langeveld, J; Windl, O; Ortiz-Pelaez, A

    2016-02-13

    Scrapie in goats is a transmissible, fatal prion disease, which is endemic in the British goat population. The recent success in defining caprine PRNP gene variants that provide resistance to experimental and natural classical scrapie has prompted the authors to conduct a survey of PRNP genotypes in 10 goat breeds and 52 herds to find goats with the resistant K222 allele. They report here the frequencies in 1236 tested animals of the resistance-associated K222 and several other alleles by breed and herd. Eight animals were found to be heterozygous QK222 goats (0.64 per cent genotype frequency, 95 per cent CI 0.28 to 1.27 per cent) but no homozygous KK222 goats were detected. The K222 allele was found in Saanen, Toggenburg and Anglo-Nubian goats. The fact that only a few goats with the K222 allele have been identified does not preclude the possibility to design and implement successful breeding programmes at national level.

  13. Expression patterns of prion protein gene in differential genotypes sheep: quantification using molecular beacon real-time RT-PCR.

    Science.gov (United States)

    Wang, Chuan; Wu, Run; Li, Fa-Di; Liu, Lei; Zhang, Xiao-Li; Zhao, Chun-Lin; Diao, Xiao-Long; Guan, Hong-Wei

    2011-06-01

    Determination of the transcription level of cellular prion protein (PrP(C)) is essential for understanding its role in organisms and revealing mechanism of susceptibility and resistance to scrapie. However, the expression of prion protein (PrP) mRNA in sheep has not been quantified in great detail in digestive tract which is important during scrapie spread through oral route. Herein, we report on measurement of sheep PrP mRNA using absolute quantitative real-time RT-PCR. Total RNA was isolated from five different regions of the central nervous system (CNS), four regions of lymphoid system, eleven regions of digestive tract, and two reproductive organ tissues of eight sheep of two different genotypes (ARR/ARQ and ARH/ARQ) and PrP mRNA was quantified by real-time RT-PCR using molecular beacon. The results showed that highest levels of PrP mRNA were expressed in thalamus and cerebrum (P mRNA expression in sheep for further studies of pathogenesis of prion diseases.

  14. Methodological approach for substantiating disease freedom in a heterogeneous small population. Application to ovine scrapie, a disease with a strong genetic susceptibility.

    Science.gov (United States)

    Martinez, Marie-José; Durand, Benoit; Calavas, Didier; Ducrot, Christian

    2010-06-01

    Demonstrating disease freedom is becoming important in different fields including animal disease control. Most methods consider sampling only from a homogeneous population in which each animal has the same probability of becoming infected. In this paper, we propose a new methodology to calculate the probability of detecting the disease if it is present in a heterogeneous population of small size with potentially different risk groups, differences in risk being defined using relative risks. To calculate this probability, for each possible arrangement of the infected animals in the different groups, the probability that all the animals tested are test-negative given this arrangement is multiplied by the probability that this arrangement occurs. The probability formula is developed using the assumption of a perfect test and hypergeometric sampling for finite small size populations. The methodology is applied to scrapie, a disease affecting small ruminants and characterized in sheep by a strong genetic susceptibility defining different risk groups. It illustrates that the genotypes of the tested animals influence heavily the confidence level of detecting scrapie. The results present the statistical power for substantiating disease freedom in a small heterogeneous population as a function of the design prevalence, the structure of the sample tested, the structure of the herd and the associated relative risks.

  15. In-situ spectroscopic investigation of transmissible spongiform encephalopathies: application of Fourier-transform infrared spectroscopy to a scrapie-hamster model

    Science.gov (United States)

    Kneipp, Janina; Lasch, Peter; Beekes, Michael; Naumann, Dieter

    2002-03-01

    Transmissible spongiform encephalopathies (TSE), such as BSE in cattle, scrapie in sheep and goats, and Creutzfeldt-Jakob disease in man are a group of fatal infectious diseases of the central nervous system that are far from being fully understood. Presuming the pathological changes to originate from small disease-specific compositional and structural modifications at the molecular level, Fourier-transform infrared (FTIR) spectroscopy can be used to achieve insight into biochemical parameters underlying pathogenesis. We have developed an FTIR microspectroscopy-based strategy which, as a combination of image reconstruction and multivariate pattern recognition methods, permitted the comparison of identical substructures in the cerebellum of healthy and TSE-infected Syrian hamsters in the terminal stage of the disease. Here we present FTIR data about the pathological changes of scrapie-infected and normal tissue of the gray matter structures stratum granulosum and stratum moleculare. IR spectroscopy was also applied to tissue pieces of the medulla oblongata of infected and control Syrian hamsters. Mapping data were analyzed with cluster analysis and imaging methods. We found variations in the spectra of the infected tissue, which are due to changes in carbohydrates, nucleic acids, phospholipids, and proteins.

  16. Polymorphism of the PrP prion protein gene in national sheep breeds with mixed wool, polish merino and european mouflon (Ovis aries musimon

    Directory of Open Access Journals (Sweden)

    Roman Niżnikowski

    2013-12-01

    Full Text Available The study was carried out on the material of 1787 sheep (1169♀ i 618♂ originating from European mouflon (Ovis aries musimon, its hybrids with Polish heat sheep and four sheep breeds with mixed wool, compared to Polish merino. All animals were subjected to the identification of the PrP prion protein gene. Based on performed research work it has been identified from two alleles in European mouflon and mouflon – Polish heat sheep to six alleles in Polish colour mountain sheep and Polish merino (in establishing the presence of 14 genotypes. Analysis of the distribution of prion protein PrP genotypes showed the least amount in European mouflon (three genotypes and mouflon – Polish heat sheep (two genotypes, and most in Polish merino (12 genotypes and the Polish mountain sheep of white variety (10 genotypes, as well as of colour variety (nine genotypes. It was also noted in the distribution of alleles and genotypes of scrapie a significant increase in their number, depending on the utility of higher specialisation of the studied sheep groups. Generally, allele ALRQ (also in the form of homozygotic genotype dominated in mouflon, while in cultural breeds – ALRR. Identification of conditions associated with the occurrence of VLRQ allele in the genotype indicates the need to eliminate it from individual populations (except for Polish heat sheep, in which this allele was not stated. It requires an elaboration of appropriate breeding programs.

  17. Detection of Prion Protein Particles in Blood Plasma of Scrapie Infected Sheep

    NARCIS (Netherlands)

    Bannach, O.; Birkmann, E.; Reinartz, E.; Karl-Erich, J.; Langeveld, J.P.M.; Rohwer, R.G.; Gregori, L.; Terry, L.A.; Willbold, D.; Riesner, D.

    2012-01-01

    Prion diseases are transmissible neurodegenerative diseases affecting humans and animals. The agent of the disease is the prion consisting mainly, if not solely, of a misfolded and aggregated isoform of the host-encoded prion protein (PrP). Transmission of prions can occur naturally but also acciden

  18. Chronic wasting disease and atypical forms of bovine spongiform encephalopathy and scrapie are not transmissible to mice expressing wild-type levels of human prion protein.

    Science.gov (United States)

    Wilson, Rona; Plinston, Chris; Hunter, Nora; Casalone, Cristina; Corona, Cristiano; Tagliavini, Fabrizio; Suardi, Silvia; Ruggerone, Margherita; Moda, Fabio; Graziano, Silvia; Sbriccoli, Marco; Cardone, Franco; Pocchiari, Maurizio; Ingrosso, Loredana; Baron, Thierry; Richt, Juergen; Andreoletti, Olivier; Simmons, Marion; Lockey, Richard; Manson, Jean C; Barron, Rona M

    2012-07-01

    The association between bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) has demonstrated that cattle transmissible spongiform encephalopathies (TSEs) can pose a risk to human health and raises the possibility that other ruminant TSEs may be transmissible to humans. In recent years, several novel TSEs in sheep, cattle and deer have been described and the risk posed to humans by these agents is currently unknown. In this study, we inoculated two forms of atypical BSE (BASE and H-type BSE), a chronic wasting disease (CWD) isolate and seven isolates of atypical scrapie into gene-targeted transgenic (Tg) mice expressing the human prion protein (PrP). Upon challenge with these ruminant TSEs, gene-targeted Tg mice expressing human PrP did not show any signs of disease pathology. These data strongly suggest the presence of a substantial transmission barrier between these recently identified ruminant TSEs and humans.

  19. The scrapie disease process is unaffected by ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, H.; Farquhar, C.F.; McConnell, I.; Davies, D. (AFRC MRC Neuropathogenesis Unit, Edinburgh (England))

    1989-01-01

    The incubation period of scrapie, its degenerative neuropathology and the replication of its causal unconventional virus are all tightly controlled parameters of the experimental disease in mice. Each parameter can vary depending on the strain and dose of virus, on the route of infection, and on the host genotype. Exposure to whole-body gamma-irradiation from Cesium 137 has no effect on the progress or development of the disease, based on the three independent indices of incubation period, neuropathology, or infectibility by high or low doses of virus. These results are based on an extensive series of experiments in many mouse strains and are consistent using different strains (ME7, 22A, 79A, 87V) and doses of virus, routes of infection, timing and dose of radiation (3-15 Gy) administered as single or fractionated exposures with or without bone-marrow (b.m.) replacement therapy. Levels of infection in the spleen are unaltered after lethal whole-body irradiation of the scrapie-infected host, despite several-fold reductions in tissue mass due to the loss of proliferating myeloid and lymphoid precursor cells and their progeny. Contrary to our earlier suggestion, scrapie infection with the 22A virus does not reduce the effectiveness of post-exposure bone-marrow replacements to recolonize an infected host after repeated ionizing radiation totalling 15Gy. This work narrows the search for the candidate cells and biosynthetic systems which replicate the virus in the lymphoreticular and central nervous systems. Many programmed cellular events are radiation sensitive but protein synthesis is extremely radioresistant.

  20. Magnetic microparticle-based multimer detection system for the detection of prion oligomers in sheep

    Directory of Open Access Journals (Sweden)

    Lim K

    2015-09-01

    Full Text Available Kuntaek Lim,1 Su Yeon Kim,2 Byoungsub Lee,1 Christiane Segarra,3 Sungmin Kang,1 Youngran Ju,2 Mary Jo Schmerr,4 Joliette Coste,3 Sang Yun Kim,5 Takashi Yokoyama,6 Seong Soo A An7 1Department of Research and Development, PeopleBio Inc., 2Department of Arborbiology, Korean Center for Diseases and Control (KCDC, Seoul, Republic of Korea; 3Department of Blood Screening, Etablissement Français Du Sang (EFS, Montpellier, France; 4Ames Laboratories, US Department of Energy (USDOE, Iowa State University, Ames, IA, USA; 5Department of Neurology, Seoul National University Bundang Hospital, Sungnam-si, Republic of Korea; 6Department of Prion Research, National Institute of Animal Health, Tsukuba, Japan; 7Department of Bionano Technology, Gachon University, Sungnam-si, Republic of Korea Abstract: Transmissible spongiform encephalopathies (TSEs are zoonotic fatal neurodegenerative diseases in animals and humans. TSEs are commonly known as bovine spongiform encephalopathy in cattle, scrapie in sheep and goats, chronic wasting disease in cervids, and Creutzfeldt–Jakob disease in humans. The putative transmissible agents are infectious prion proteins (PrPSc, which are formed by the conversion of the normal prion protein on the glycoprotein cell surface in the presence of other PrPSc. Reports of the transmission of TSEs through blood raised considerable concern about the safety of blood and blood products. To address this issue, many laboratories attempted to develop a sensitive and accurate blood diagnostic test to detect PrPSc. Previously, we reported that, compared to normal controls, the multimer detection system (MDS was more efficient in detecting PrPSc in infected hamster brain homogenate, mouse plasma spiked with purified PrPSc from scrapie mouse brain, and scrapie-infected hamster plasmas. MDS differentiates prion multimers from the cellular monomer through the multimeric expression of epitopes on prion multimers, in contrast to the monomeric form

  1. Identification of a Protein that Purifies with the Scrapie Prion

    Science.gov (United States)

    Bolton, David C.; McKinley, Michael P.; Prusiner, Stanley B.

    1982-12-01

    Purification of prions from scrapie-infected hamster brain yielded a protein that was not found in a similar fraction from uninfected brain. The protein migrated with an apparent molecular size of 27,000 to 30,000 daltons in sodium dodecyl sulfate polyacrylamide gels. The resistance of this protein to digestion by proteinase K distinguished it from proteins of similar molecular weight found in normal hamster brain. Initial results suggest that the amount of this protein correlates with the titer of the agent.

  2. Classical antiparticles

    Energy Technology Data Exchange (ETDEWEB)

    Costella, J.P.; McKellar, B.H.J.; Rawlinson, A.A.

    1997-03-01

    We review how antiparticles may be introduced in classical relativistic mechanics, and emphasize that many of their paradoxical properties can be more transparently understood in the classical than in the quantum domain. (authors). 13 refs., 1 tab.

  3. Classical antiparticles

    CERN Document Server

    Costella, J P; Rawlinson, A A; Costella, John P.; Kellar, Bruce H. J. Mc; Rawlinson, Andrew A.

    1997-01-01

    We review how antiparticles may be introduced in classical relativistic mechanics, and emphasize that many of their paradoxical properties can be more transparently understood in the classical than in the quantum domain.

  4. [In vitro modification of the morphology and the growth of cells infected with scrapie (author's transl)].

    Science.gov (United States)

    Markovits, P; Dormont, D; Maunoury, R; Delamarche, C; Delpech, A; Dianoux, L; Latarjet, R

    1982-02-15

    Seven cell lines originated either in brains or in neuroblastomas of Mice, were infected with Scrapie. After 12 to 16 in vitro passages, 6 lines out of 7 showed changes of their morphology, and of their growth, resembling those occurring in the course of a malignant transformation. The Scrapie infected cells acquired the capacity to form 2 to 4 times more colonies in liquid medium than the controls, and to develop large tridimensional colonies in semisolid medium. The role of Scrapie in these changes is discussed.

  5. Apomorphine-induced circling behaviour in hamsters following unilateral injection of scrapie gent in the striatum.

    Science.gov (United States)

    Gorde, J M; Bert, J; Gambarelli, D; Tamalet, J

    1981-03-10

    Twenty golden hamsters received a microinjection of scrapie agent into the left striatum. At different times after inoculation animals were injected intraperitoneally with apomorphine, a direct dopamine receptor agonist. Two types of effects developed simultaneously, starting at about 80 days after infection. First, apomorphine induced a rotational behaviour which showed a progressive destruction of the striatal neurones at the site of injection. This suggest a local spread of scrapie agent by cell to cell transfer in the striatum. Secondly, the clinical signs of scrapie developed, indicating a more widespread distribution of agent throughout the brain.

  6. Toxicological Evaluation of Anti-Scrapie Trimethoxychalcones and Oxadiazoles

    Directory of Open Access Journals (Sweden)

    CLAUDIA P. FIGUEIREDO

    2015-08-01

    Full Text Available An altered form of the cellular prion protein, the PrPScor PrPRes, is implicated in the occurrence of the still untreatable transmissible spongiform encephalopathies. We have previously synthesized and characterized aromatic compounds that inhibit protease-resistant prion protein (PrPRes accumulation in scrapie-infected cells. These compounds belong to different chemical classes, including acylhydrazones, chalcones and oxadiazoles. Some of the active compounds were non-toxic to neuroblastoma cells in culture and seem to possess drugable properties, since they are in agreement with the Lipinski´s rule of 5 and present desirable pharmacokinetic profiles as predicted in silico. Before the evaluation of the in vivo efficacy of the aromatic compounds in scrapie-infected mice, safety assessment in healthy mice is needed. Here we used Swiss mice to evaluate the acute toxicity profile of the six most promising anti-prionic compounds, the 2,4,5-trimethoxychalcones (J1, J8, J20 and J35 and the 1,3,4-oxadiazoles (Y13 and Y17. One single oral administration (300 mg/kg of J1, J8, J20, J35, Y13 and Y17 or repeated intraperitoneal administration (10 mg/kg, 3 times a week, for 4 weeks of J1, J8 and J35, did not elicit toxicity in mice. We strongly believe that the investigated trimethoxychalcones and oxadiazoles are interesting compounds to be further analyzed in vivo against prion diseases.

  7. Sequence polymorphism of PrP exon 3 gene in Istrian and crossbred sheep

    Directory of Open Access Journals (Sweden)

    Ino Curik

    2010-01-01

    Full Text Available Polymorphisms in sheep PrP (prion protein gene are known for scrapie susceptibility. We sequenced part of PrP exon 3 gene in 92 autochthonous Istrian (IS and 38 crossbred sheep (CBS. ARQ, ARR and AHQ alleles were predominant with frequency of 0.674 (0.526, 0.228 (0.132 and 0.082 (0.263 in IS (CBS, respectively, while VRQ (0.011 in IS and ARH (0.005 in IS and 0.079 in CBS alleles were rare. We also found non-synonymous mutations at codons 112 (M→T, 127 (G→S and 143 (H→R, and synonymous mutations at codons 231 (R and 237 (L. Additional mutations were associated only with AHQ, ARH and ARQ alleles. The polymorphism of PrP gene in IS was not critical with respect to scrapie susceptibility and with some efforts number of “favourable” genotypes can be increased.

  8. [Trials of in vitro propagation of the scrapie agent in mouse nerve cells].

    Science.gov (United States)

    Markovits, P; Dormont, D; Delpech, B; Court, L; Latarjet, R

    1981-11-02

    We attempted to propagate the Scrapie agent in vitro in glia and neuroblastoma cells of Mice. Four out of seven assays of infection were positive, i.e. after several passages in vitro yielding at most a 10(9) fold final dilution of the original material, the extracts of each of the four cultures, when injected intracerebrally into CD1 Mice, produced a deadly disease displaying the clinical and pathological signs characteristic of Scrapie.

  9. Inactivation of the Scrapie agent by ultraviolet irradiation in the presence of chlorpromazine

    Energy Technology Data Exchange (ETDEWEB)

    Dees, C.; Wade, W.F.; German, T.L.; Marsh, R.F. (Wisconsin Univ., Madison (USA). Dept. of Veterinary Science)

    1985-04-01

    The sensitivity of the scrapie agent to u.v. inactivation was found to be related to the purity of the tissue preparation. Scrapie infectivity associated with membrane vesicles was unaffected when irradiated with 10/sup 4/ J/m/sup 2/. Irradiation of more highly purified preparations from detergent-extracted CsCl gradient fractions reduced scrapie infectivity from 10sup(7.8) log/sub 10/ LD/sub 50/ per ml to as low as 10sup(4.5). Sensitivity of membrane-associated scrapie infectivity to inactivation by u.v. irradiation could be increased by addition of chlorpromazine, a phenthiazine antipsychotic which penetrates lipid bilayers and induces single-strand breaks in nucleic acids under irradiation. Chlorpromazine without irradiation, and a semiquinone protein-binding radical of chlorpromazine, failed to decrease scrapie infectivity by themselves. A closely related phenthiazine antipsychotic, trifluoperazine, which does not bind to nucleic acids, did not reduce scapie infectivity. These findings suggest that the target of u.v. radiation for inactivation of scrapie infectivity in the presence of chlorpromazine is an essential nucleic acid.

  10. Cloning of a Gene Whose Expression is Increased in Scrapie and in Senile Plaques in Human Brain

    Science.gov (United States)

    Wietgrefe, S.; Zupancic, M.; Haase, A.; Chesebro, B.; Race, R.; Frey, W.; Rustan, T.; Friedman, R. L.

    1985-12-01

    A complementary DNA library was constructed from messenger RNA's extracted from the brains of mice infected with the scrapie agent. The library was differentially screened with the objectives of finding clones that might be used as markers of infection and finding clones of genes whose increased expression might be correlated with the pathological changes common to scrapie and Alzheimer's disease. A gene was identified whose expression is increased in scrapie. The complementary DNA corresponding to this gene hybridized preferentially and focally to cells in the brains of scrapie-infected animals. The cloned DNA also hybridized to the neuritic plaques found with increased frequency in brains of patients with Alzheimer's disease.

  11. PRNP genetic variability and molecular typing of natural goat scrapie isolates in a high number of infected flocks.

    Science.gov (United States)

    Fragkiadaki, Eirini G; Vaccari, Gabriele; Ekateriniadou, Loukia V; Agrimi, Umberto; Giadinis, Nektarios D; Chiappini, Barbara; Esposito, Elena; Conte, Michela; Nonno, Romolo

    2011-09-30

    One hundred and four scrapie positive and 77 negative goats from 34 Greek mixed flocks were analysed by prion protein gene sequencing and 17 caprine scrapie isolates from 11 flocks were submitted to molecular isolate typing. For the first time, the protective S146 variant was reported in Greece, while the protective K222 variant was detected in negative but also in five scrapie positive goats from heavily infected flocks. By immunoblotting six isolates, including two goat flockmates carrying the K222 variant, showed molecular features slightly different from all other Greek and Italian isolates co-analysed, possibly suggesting the presence of different scrapie strains in Greece.

  12. Classics Online.

    Science.gov (United States)

    Clayman, Dee L.

    1995-01-01

    Appraises several databases devoted to classical literature. Thesaurus Linguae Graecae (TLG) contains the entire extant corpus of ancient Greek literature, including works on lexicography and historiography, extending into the 15th century. Other works awaiting completion are the Database of Classical Bibliography and a CD-ROM pictorial dictionary…

  13. Classical integrability

    Science.gov (United States)

    Torrielli, Alessandro

    2016-08-01

    We review some essential aspects of classically integrable systems. The detailed outline of the sections consists of: 1. Introduction and motivation, with historical remarks; 2. Liouville theorem and action-angle variables, with examples (harmonic oscillator, Kepler problem); 3. Algebraic tools: Lax pairs, monodromy and transfer matrices, classical r-matrices and exchange relations, non-ultralocal Poisson brackets, with examples (non-linear Schrödinger model, principal chiral field); 4. Features of classical r-matrices: Belavin-Drinfeld theorems, analyticity properties, and lift of the classical structures to quantum groups; 5. Classical inverse scattering method to solve integrable differential equations: soliton solutions, spectral properties and the Gel’fand-Levitan-Marchenko equation, with examples (KdV equation, Sine-Gordon model). Prepared for the Durham Young Researchers Integrability School, organised by the GATIS network. This is part of a collection of lecture notes.

  14. Remarkable Activation of the Complement System and Aberrant Neuronal Localization of the Membrane Attack Complex in the Brain Tissues of Scrapie-Infected Rodents.

    Science.gov (United States)

    Lv, Yan; Chen, Cao; Zhang, Bao-Yun; Xiao, Kang; Wang, Jing; Chen, Li-Na; Sun, Jing; Gao, Chen; Shi, Qi; Dong, Xiao-Ping

    2015-12-01

    As an integral part of the innate immunity, the complement system has been reported to involve in the pathogenesis of prion diseases (PrD). However, the states of expression and activity of complement proteins in experimental models of scrapie infection are still not fully understood. Herein, the state of complement activation, the presence, and distribution as well as localization of C3 and membrane attack complex (MAC) in the brains of several scrapie-infected rodents were comparatively assessed through various methodologies. Our data illustrated a significant increase in the total complement activity (CH50, U/ml) in several scrapie-infected rodent brains at the terminal stage and a time-dependent upregulation of C1q in 263K-infected hamsters during the incubation period, intimating the sustained and progressive activation of the classical pathway during PrD progression. Confocal microscopy revealed robust activation of C3 and its localization to various central nervous system (CNS) cells with differential morphology in the brain tissues of both 263K-infected hamsters and 139A-infected C57BL/6 mice at disease end stages. Dynamic analyses of MAC in the brains of 263K-infected hamsters and 139A-infected C57BL/6 mice demonstrated remarkably time-dependent deposition during the incubation period, which may highlight a persistently activated terminal complement components. Moreover, immunofluorescent assays (IFAs) showed that MAC-specific signals appeared to overlap with morphologically abnormal neurons rather than proliferative astrocytes or activated microglia throughout the CNS of both 263K-infected hamsters and 139A-infected C57BL/6 mice. Overall, these results indicate that the activation of the complement system and the subsequent localization of the complement components to neurons may be a hallmark during prion infection, which ultimately contribute to the neurodegeneration in PrD.

  15. Characteristics of 263K scrapie agent in multiple hamster species.

    Science.gov (United States)

    Meade-White, Kimberly D; Barbian, Kent D; Race, Brent; Favara, Cynthia; Gardner, Don; Taubner, Lara; Porcella, Stephen; Race, Richard

    2009-02-01

    Transmissible spongiform encephalopathy (TSE) diseases are known to cross species barriers, but the pathologic and biochemical changes that occur during transmission are not well understood. To better understand these changes, we infected 6 hamster species with 263K hamster scrapie strain and, after each of 3 successive passages in the new species, analyzed abnormal proteinase K (PK)-resistant prion protein (PrPres) glycoform ratios, PrPres PK sensitivity, incubation periods, and lesion profiles. Unique 263K molecular and biochemical profiles evolved in each of the infected hamster species. Characteristics of 263K in the new hamster species seemed to correlate best with host factors rather than agent strain. Furthermore, 2 polymorphic regions of the prion protein amino acid sequence correlated with profile differences in these TSE-infected hamster species.

  16. Comparison between two surgical techniques for prenatal correction of meningomyelocele in sheep

    OpenAIRE

    Herrera,Silvia Rejane Fontoura; Leme,Ricardo José de Almeida; Valente, Paulo Roberto [UNIFESP; Caldini,Élia Garcia; Saldiva, Paulo Hilário Nascimento; Pedreira, Denise Araujo Lapa

    2012-01-01

    OBJECTIVE: To compare the classical neurosurgical technique with a new simplified technique for prenatal repair of a myelomeningocelelike defect in sheep. METHODS: A myelomeningocele-like defect (laminectomy and dural excision) was created in the lumbar region on day 90 of gestation in 9 pregnant sheep. Correction technique was randomized. In Group 1 the defect was corrected using the classic neurosurgical technique of three-layer suture (dura mater, muscle and skin closure) performed by a ne...

  17. Apparent reduction of ADAM10 in scrapie-infected cultured cells and in the brains of scrapie-infected rodents.

    Science.gov (United States)

    Chen, Cao; Lv, Yan; Zhang, Bao-Yun; Zhang, Jin; Shi, Qi; Wang, Jing; Tian, Chan; Gao, Chen; Xiao, Kang; Ren, Ke; Zhou, Wei; Dong, Xiao-Ping

    2014-12-01

    It has been described that A disintegrin and metalloproteinase (ADAM10) may involve in the physiopathology of prion diseases, but the direct molecular basis still remains unsolved. In this study, we confirmed that ADAM10 was able to cleave recombinant human prion protein in vitro. Using immunoprecipitation tests (IP) and immunofluorescent assays (IFA), reliable molecular interaction between the native cellular form of PrP (PrP(C)) and ADAM10 was observed not only in various cultured neuronal cell lines but also in brain homogenates of healthy hamsters and mice. Only mature ADAM10 (after removal of its prodomain) molecules showed the binding activity with the native PrP(C). Remarkably more prion protein (PrP)-ADAM10 complexes were detected in the membrane fraction of cultured cells. In the scrapie-infected SMB cell model, the endogenous ADAM10 levels, especially the mature ADAM10, were significantly decreased in the fraction of cell membrane. IP and IFA tests of prion-infected SMB-S15 cells confirmed no detectable PrP-ADAM10 complex in the cellular lysates and PrP-ADAM10 co-localization on the cell surface. Furthermore, we demonstrated that the levels of ADAM10 in the brain homogenates of scrapie agent 263K-infected hamsters and agent ME7-infected mice were also almost diminished at the terminal stage, showing time-dependent decreases during the incubation period. Our data here provide the solid molecular basis for the endoproteolysis of ADAM10 on PrP molecules and interaction between ADAM10 and PrP(C). Obvious loss of ADAM10 during prion infection in vitro and in vivo highlights that ADAM10 may play essential pathophysiological roles in prion replication and accumulation.

  18. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  19. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Science.gov (United States)

    Pritzkow, Sandra; Wagenführ, Katja; Daus, Martin L; Boerner, Susann; Lemmer, Karin; Thomzig, Achim; Mielke, Martin; Beekes, Michael

    2011-01-01

    Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA) for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1)- to ≥10(5.5)-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological scrapie

  20. 9 CFR 93.435 - Sheep and goats.

    Science.gov (United States)

    2010-01-01

    ... must be placed in a flock or herd in the United States that participates in the Voluntary Scrapie Flock... compliance with all requirements of the Voluntary Scrapie Flock Certification Program until the flock or herd... Voluntary Scrapie Flock Certification Program identification number of the receiving flock or herd as...

  1. Dairy Sheep Nutrition

    OpenAIRE

    Rosanna Scipioni

    2010-01-01

    This book, edited by the colleague Giuseppe Pulina, is the result of the project "Further development of a diet formulation model for sheep and goat", supported by the Ministry of Agricultural and Forestry Policies, in Italy.

  2. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-31

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the mutation polymorphism of the PRND has been highly concerned recently, including the single nucleiotide polymorphism and insertion/deletion (indel). Therefore, the objective of present study was to examine this novel indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing four diversity sheep breeds. The results showed that three genotypes were detected and the minor allelic frequency was 0.008 (Lanzhou Fat-Tail sheep), 0.084 (Small Tail Han sheep), 0.021(Tong sheep) and 0.083 (Hu sheep), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus were significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the 20-bp indel of sheep PRND gene by ME strategy, which may provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  3. Selection of ovine housekeeping genes for normalisation by real-time RT-PCR; analysis of PrP gene expression and genetic susceptibility to scrapie

    Directory of Open Access Journals (Sweden)

    Hurtado Ana

    2005-09-01

    Full Text Available Abstract Background Cellular prion protein expression is essential for the development of transmissible spongiform encephalopathies (TSEs, and in sheep, genetic susceptibility to scrapie has been associated to PrP gene polymorphisms. To test the hypothetical linkage between PrP gene expression and genetic susceptibility, PrP mRNA levels were measured by real-time RT-PCR in six ovine tissues of animals with different genotypes. Results Previous to the PrP gene expression analysis the stability of several housekeeping (HK genes was assessed in order to select the best ones for relative quantification. The normalisation of gene expression was carried out using a minimum of three HK genes in order to detect small expression differences more accurately than using a single control gene. The expression stability analysis of six HK genes showed a large tissue-associated variation reflecting the existence of tissue-specific factors. Thereby, a specific set of HK genes was required for an accurate normalisation of the PrP gene expression within each tissue. Statistical differences in the normalised PrP mRNA levels were found among the tissues, obtaining the highest expression level in obex, followed by ileum, lymph node, spleen, cerebellum and cerebrum. A tendency towards increased PrP mRNA levels and genetic susceptibility was observed in central nervous system. However, the results did not support the hypothesis that PrP mRNA levels vary between genotypes. Conclusion The results on PrP gene expression presented here provide valuable baseline data for future studies on scrapie pathogenesis. On the other hand, the results on stability data of several HK genes reported in this study could prove very useful in other gene expression studies carried out in these relevant ovine tissues.

  4. Detection of water-soluble disease-associated PrP species in blood and brain of scrapie-infected hamster.

    Science.gov (United States)

    Abdel-Haq, Hanin

    2015-09-01

    The high-speed supernatant (S(HS)) of scrapie-infected hamster brain homogenate contains a soluble infectivity similar to that of the plasma that escapes leukodepletion and can transmit prion infection. This recent finding highlights the fact that soluble prion infectivity could be relevant for prion disease propagation and progression. PrP(Sc) is essential in prion disease pathogenesis, but little to nothing is known about the PrP(Sc) species that may be associated with this form of prion infectivity. Scrapie-infected hamster plasma and S(HS) were subjected to biochemical analysis, and the results demonstrate for the first time that soluble infectivity is associated with a water-soluble PrP(Sc) species with substantially different properties from classical PrP(Sc), the concentration of which seems to correlate with the magnitude and efficiency of the soluble infectivity. Such characteristics suggest that this species might represent the soluble prion agent itself or its vehicle, highlighting the need to adequately revise the strategies involved in prion removal, diagnosis, and therapy.

  5. 9 CFR 54.11 - Approval of laboratories to run official scrapie tests and official genotype tests.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Approval of laboratories to run official scrapie tests and official genotype tests. 54.11 Section 54.11 Animals and Animal Products ANIMAL... laboratories to run official scrapie tests and official genotype tests. (a) State, Federal, and...

  6. Classical Mechanics

    OpenAIRE

    Gallavotti, Giovanni

    2012-01-01

    This is the English version of a friendly graduate course on Classical Mechanics, containing about 80% of the material I covered during the January-June 1999 semester at IFUG in the Mexican city of Leon. For the Spanish version, see physics/9906066

  7. Cyclodextrins inhibit replication of scrapie prion protein in cell culture.

    Science.gov (United States)

    Prior, Marguerite; Lehmann, Sylvain; Sy, Man-Sun; Molloy, Brendan; McMahon, Hilary E M

    2007-10-01

    Prion diseases are fatal neurodegenerative disorders that are caused by the conversion of a normal host-encoded protein, PrP(C), to an abnormal, disease-causing form, PrP(Sc). This paper reports that cyclodextrins have the ability to reduce the pathogenic isoform of the prion protein PrP(Sc) to undetectable levels in scrapie-infected neuroblastoma cells. Beta-cyclodextrin removed PrP(Sc) from the cells at a concentration of 500 microM following 2 weeks of treatment. Structure activity studies revealed that antiprion activity was dependent on the size of the cyclodextrin. The half-maximal inhibitory concentration (IC(50)) for beta-cyclodextrin was 75 microM, whereas alpha-cyclodextrin, which possessed less antiprion activity, had an IC(50) of 750 microM. This report presents cyclodextrins as a new class of antiprion compound. For decades, the pharmaceutical industry has successfully used cyclodextrins for their complex-forming ability; this ability is due to the structural orientation of the glucopyranose units, which generate a hydrophobic cavity that can facilitate the encapsulation of hydrophobic moieties. Consequently, cyclodextrins could be ideal candidates for the treatment of prion diseases.

  8. Summarization of scrapie%羊痒病概述

    Institute of Scientific and Technical Information of China (English)

    韩彩霞; 吴长德; 赵德明

    2005-01-01

    羊痒病(scrapie)是传染性海绵状脑病(TSE)的原型,目前在世界许多地方流行.该病是绵羊的一种缓慢发展的致死性中枢神经系统变性疾病,能引起绵羊和山羊中枢神经系统发生退化变性,病羊具有中枢神经系统变性、空泡化、星形胶质细胞增生等特点,病羊表现为共济失调、痉挛、麻痹、衰弱和严重的皮肤瘙痒,病畜死亡率达100%.该病是由正常的朊蛋白(FrPc)发生错误折叠而变成异常的蛋白形式(PrPsc)引起的.

  9. Bovine spongiform encephalopathy in sheep?

    NARCIS (Netherlands)

    Schreuder, B.E.C.; Somerville, R.A.

    2003-01-01

    Bovine spongiform encephalopathy (BSE) in sheep has not been identified under natural conditions at the time of writing and remains a hypothetical issue. However, rumours about the possible finding of a BSE-like isolate in sheep have led to great unrest within the sheep industry, among the general p

  10. Unusual resistance to ionizing radiation of the viruses of kuru, Creutzfeldt-Jakob disease, and scrapie.

    Science.gov (United States)

    Gibbs, C J; Gajdusek, D C; Latarjet, R

    1978-01-01

    The titers of several preparations of kuru. Creutzfeldt-Jacob disease, and scrapie viruses were reduced by only 1/10th or less by high doses of gamma radiation of 50 kGy and by only 1/10th-1/1000th or less for 200 kGy. This unusual radiation resistance of the two human viruses further links them with the scrapie virus and suggests that the genetic information of all three viruses is considerably smaller than that of any other known viruses of mammals. PMID:104301

  11. Altered lymphocyte proliferation and innate immune function in scrapie 139A- and ME7-infected mice.

    Science.gov (United States)

    Cho, In Soo; Spinner, Daryl S; Kascsak, Richard J; Meeker, H Cliff; Kim, Bo Sook; Park, Seung Yong; Schuller-Levis, Georgia; Park, Eunkyue

    2013-06-01

    Lymphoid organs play an important role in prion disease development and progression. While the role of lymphoid organs and changes in immune-related genes have been extensively investigated in scrapie-infected animals, innate immunity has not. Previous studies examined lymphocyte function in scrapie-infected C3H/HeJ mice, which exhibit defects in lipopolysaccharide (LPS) response now known to result from a mutation in Toll-like receptor (TLR) 4. We examined immune function in scrapie-infected CD1 mice, which are LPS responders. Lymphocyte proliferation from CD1 mice infected with either 139A or ME7 scrapie was measured in response to concanavalin (Con) A or LPS at 1 and 3 months after infection. Following LPS exposure, mice infected 3 months with ME7, but not 139A, demonstrated significantly decreased lymphocyte proliferation compared to controls. After Con A exposure, lymphocyte proliferation in scrapie-infected mice did not differ from controls. Gender-specific comparison of lymphocyte proliferation showed significant decreases in mitogenic responses in females infected 3 months with either 139A or ME7, compared to controls. Males infected for 3 months with ME7, but not 139A, showed significantly decreased proliferation after lymphocyte exposure to LPS, but not Con A. Neither gender showed changes in lymphocyte proliferation after 1 month of scrapie infection. Innate immune activation of peritoneal macrophages was determined via production of nitric oxide (NO), IL-6, and TNF-α after exposure to TLR ligands. TNF-α and IL-6 production were reduced in macrophages from females infected with either scrapie strain for 3 months, while NO production after TLR agonist plus IFN-γ exposure was decreased in both females and males infected for 3 months with 139A, compared to ME7. These data demonstrated altered innate immunity, suggesting hormonal and/or other gender-specific regulation may contribute to gender differences in some immune functions. Our data demonstrate

  12. Goats with aspartic acid or serine at codon 146 of the PRNP gene remain scrapie-negative after lifetime exposure in affected herds in Cyprus.

    Science.gov (United States)

    Georgiadou, S; Ortiz-Pelaez, A; Simmons, M M; Windl, O; Dawson, M; Neocleous, P; Papasavva-Stylianou, P

    2017-01-01

    The results of the study reported here are part of an ongoing integrated research programme aimed at producing additional, robust, evidence on the genetic resistance to classical scrapie in goats, with particular reference to codon 146. The study targeted animals aged ⩾6 years, which were born and raised in infected herds and were being culled for management reasons. A total of 556 animals were tested, and all positive animals (n = 117) were of the susceptible NN genotype. A total of 246 goats heterozygous or homozygous for putatively resistant alleles (S146 and D146) were screened with no positive results. The outcome of this study supports the hypothesis that the D146 and S146 alleles could be used as the basis for a nationwide strategy for breeding for resistance in the Cypriot goat population.

  13. [Classical taxomomies].

    Science.gov (United States)

    Liubarskiĭ, G Iu

    2006-01-01

    The sequence of classic paradigms in taxonomy that partly replaced each other and partly co-exist is given as follows: the theory of "organ and organism similarity", the naturalistic theory, the descriptive theory, and the phylogenetic theory. The naturalistic classics accepted the notion of "the plan of creation". The rejection of appealing to this plan brought forth certain problems in the formulation of the purpose of taxonomy; these problems were differently solved by the descriptive and the phylogenetic classic traditions. The difficulties of the current paradigms arising from the loss of a "strong purpose", a problem to be solved by taxonomists that is to be clear and interesting to a wide range of non-professionals. The paradox of formalization led to the losing of content of the methods due to their formalization. To attract attention to taxonomy, a new "image of the results" of its work that would be interesting to the non-professionals is necessary. The co-existence of different methods of reseach applied to different groups of facts leads to the loss of integrity of the research. It is not only that the taxon becomes a hypothesis and such hypotheses multiply. The comparison of these hypotheses is problematic, because each of them is supported by its own independent scope of facts. Because of the existence of a fundamental meronotaxonomic discrepancy, taxonomic systems based on different groups of characters appear to be incomparable, being rather systems of characters than systems of taxa. Systems of characters are not directly comparable with each other; they can be compared only through appealing to taxa, but taxa themselves exist only in the form of a number of hypotheses. Consequently, each separate taxonomic approach creates its own nature, its own subject of research. Therefore, it is necessary to describe the subject of research correctly (and indicate the purpose of research), as well as to distinguish clearly between results achieved through

  14. Manipulation of PrPres production in scrapie-infected neuroblastoma cells

    NARCIS (Netherlands)

    Bate, C.; Langeveld, J.P.M.; Williams, A.

    2004-01-01

    In the present study the accumulation of protease resistant prion protein (PrPres) in scrapie-infected neuroblastoma cells (ScN2a cells) was shown to be dependent on culture conditions. The highest levels of PrPres were found in slow growing cells. Further increases in PrPres accumulation were obser

  15. New insight into the nature of scrapie from old radiation results

    Energy Technology Data Exchange (ETDEWEB)

    Alper, T.

    1993-02-01

    The author examines a modification of the infectious plasma membrane hypothesis put forward to by Gibbons and Hunter (1967) to explain the transmission of Scrapie and discusses radiation experiments in the light of the target theory, carried out to estimate the size of the transmitting agent of the disease. (UK).

  16. Medulla oblongata transcriptome changes during presymptomatic natural scrapie and their associaition with prion-related lesions.

    NARCIS (Netherlands)

    Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Serrano, C.; Acín, C.; Badiola, J.J.; Bossers, A.; Bolea, R.

    2012-01-01

    Background The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new bi

  17. Scrapie strains retain their distinctive characteristics following passages of homogenates from different brain regions and spleen.

    Science.gov (United States)

    Carp, R I; Meeker, H; Sersen, E

    1997-01-01

    The molecular basis of differences among scrapie strains is unknown. The prion theory posits that there are differences in the conformation of the host protease-resistant protein (PrP) molecules and that these differences are responsible for scrapie strains. A corollary of this theory is that the origin of host PrP variation resides in different neuronal cell types. To assess this concept, preparations from three brain regions (cerebrum, cerebellum and olfactory bulb) and from spleen were passaged in C57BL mice by intracerebral injection. After three passages of three scrapie strains in this manner, homogenates of each brain region and spleen were tested for several of the characteristics that distinguish the three strains: (1) the rank order of incubation periods in C57BL mice, (2) induction of obesity in SJL mice and (3) comparative incubation periods in mice with three genotypes for the scrapie incubation period marker. Analysis revealed that virtually all of the criteria that distinguished the three strains prior to passages of the three brain regions and spleen were retained after this series of passages. This finding argues against cellular-based PrP differences providing a basis for strain specificity.

  18. Susceptibility of phagocytes from elk, deer, bighorn sheep, and domestic sheep to Pasteurella haemolytica cytotoxins.

    Science.gov (United States)

    Silflow, R M; Foreyt, W J

    1994-10-01

    Alveolar macrophages and peripheral blood neutrophils from elk (Cervus elaphus), bighorn sheep (Ovis canadensis canadensis), and domestic sheep were exposed to culture supernatants from Pasteurella haemolytica isolated from bighorn sheep and domestic sheep. In a second experiment, peripheral blood neutrophils from mule deer (Odocoileus hemionus), elk, and bighorn sheep were exposed to culture supernatants from P. haemolytica isolated from elk, bighorn sheep and domestic sheep. Alveolar macrophages from elk, bighorn sheep and domestic sheep were resistant to killing by P. haemolytica supernatants from bighorn sheep and domestic sheep; susceptibility of neutrophils to cell death, as measured by release of lactate dehydrogenase, differed significantly (P sheep and domestic sheep neutrophils were susceptible to cytotoxin damage by the P. haemolytica isolates used; bighorn sheep neutrophils were four- to eight-fold more susceptible to cytotoxin damage than domestic sheep neutrophils. Neutrophils from deer and elk were resistant to killing by P. haemolytica cytotoxins from any species tested.

  19. Scrapie e seu diagnóstico diferencial em ovinos no Mato Grosso do Sul

    Directory of Open Access Journals (Sweden)

    Héllen M. Martins

    2012-12-01

    Full Text Available Scrapie é uma doença infecciosa, neurodegenerativa fatal, causada pelo príon scrapie (PrPsc. Apresenta-se tanto na forma clássica em ovinos e caprinos geneticamente susceptíveis quanto na forma atípica em ovinos. A primeira notificação oficial do Brasil à Organização Mundial de Saúde Animal (OIE, um caso da forma clássica diagnosticado no Rio Grande do Sul ocorreu em 1985, mas a doença já havia sido diagnosticada no mesmo Estado em 1978. Este trabalho objetivou descrever dois surtos de Scrapie em ovinos em Mato Grosso do Sul (MS, Brasil e investigar, por meio de imuno-histoquímica (IHQ a presença de PrPsc no Sistema Nervoso Central (SNC de ovinos examinados entre 2003 e 2010. Na primeira parte observaram-se dois ovinos com sinais clínicos típicos de scrapie, detalhando-se os sinais neurológicos, dados epidemiológicos, histopatológicos e amostras teciduais em duplicata desses ovinos foram encaminhadas para realização de diagnóstico de Raiva e para diagnóstico IHQ para príon. Na segunda parte realizou-se levantamento de laudos de necropsia e diagnósticos histopatológicos de ovinos, no período de maio de 2003 a março de 2010. Amostras de sistema nervoso central de 51 casos foram selecionados, incluindo os dois já com diagnóstico de Scrapie mencionados acima; os tecido de todos esses ovinos foram submetidos à IHQ para detecção de proteína priônica. Os 49 ovinos avaliados apresentaram resultado negativo na IHQ para príon.

  20. Salmonella in Sheep in Iceland

    Directory of Open Access Journals (Sweden)

    Gunnarsson E

    2002-03-01

    Full Text Available In 1995 several outbreaks of food poisoning in humans occurred in Iceland, that were traced to salmonella contamination of singed sheep heads. This prompted us to study the prevalence of salmonella infection in sheep and to trace where and how infection might have occurred. Faecal, intestinal contents and tonsillar samples were collected in the spring and autumn from sheep on 50 farms in the southwestern part of the country, where salmonellosis had been detected and from 5 farms in the northwestern part of the country. All faecal samples from the southwest were negative, whereas samples from 3 farms obtained in the autumn in the northwest were positive. Tonsillae taken in the autumn were positive in sheep from 3 farms in the southwest and 2 in the northwest. Our results show that salmonella infection is rare in Icelandic sheep but healthy carriers may harbour the bacteria in tonsillae. Salmonella was not detected in drainage from slaughterhouses nor in singed sheep heads.

  1. Quantitative trait loci underlying milk production traits in sheep.

    Science.gov (United States)

    Gutiérrez-Gil, B; El-Zarei, M F; Alvarez, L; Bayón, Y; de la Fuente, L F; San Primitivo, F; Arranz, J-J

    2009-08-01

    Improvement of milk production traits in dairy sheep is required to increase the competitiveness of the industry and to maintain the production of high quality cheese in regions of Mediterranean countries with less favourable conditions. Additional improvement over classical selection could be reached if genes with significant effects on the relevant traits were specifically targeted by selection. However, so far, few studies have been undertaken to detect quantitative trait loci (QTL) in dairy sheep. In this study, we present a complete genome scan performed in a commercial population of Spanish Churra sheep to identify chromosomal regions associated with phenotypic variation observed in milk production traits. Eleven half-sib families, including a total of 1213 ewes, were analysed following a daughter design. Genome-wise multi-marker regression analysis revealed a genome-wise significant QTL for milk protein percentage on chromosome 3. Eight other regions, localized on chromosomes 1, 2, 20, 23 and 25, showed suggestive significant linkage associations with some of the analysed traits. To our knowledge, this study represents the first complete genome scan for milk production traits reported in dairy sheep. The experiment described here shows that analysis of commercial dairy sheep populations has the potential to increase our understanding of the genetic determinants of complex production-related traits.

  2. Becoming Sheep, Becoming Animal..

    DEFF Research Database (Denmark)

    Grum, Charlotte; Svabo, Connie

    As a part of a 2015 group exhibition exploring the history and local myths of a woman living in a Danish heath landscape 150 years ago, artist Charlotte Grum connected herself to a live sheep for 4 hours a day, 5 days a week, for 5 weeks, turning the two into a hybrid relational assemblage, intra...... of posthuman performance.Engaging with matter and producing knowledge on mattering itself seems to call for multiple mediated modes of dissemination, embodying the complexities of becoming...

  3. SHEEP TEMPORAL BONE

    Directory of Open Access Journals (Sweden)

    Kesavan

    2016-03-01

    Full Text Available INTRODUCTION Human temporal bones are difficult to procure now a days due to various ethical issues. Sheep temporal bone is a good alternative due to morphological similarities, easy to procure and less cost. Many middle ear exercises can be done easily and handling of instruments is done in the procedures like myringoplasty, tympanoplasty, stapedotomy, facial nerve dissection and some middle ear implants. This is useful for resident training programme.

  4. In vitro Expression in Eukaryotic Cells of a Prion Protein Gene Cloned from Scrapie-Infected Mouse Brain

    Science.gov (United States)

    Caughey, Byron; Race, Richard E.; Vogel, Mari; Buchmeier, Michael J.; Chesebro, Bruce

    1988-07-01

    It has been proposed that the causative agent of scrapie represents a class of infectious particle that is devoid of nucleic acid and that an altered form of the endogenous prion protein (PrP) is the agent. However, it has been difficult to exclude the possibility that PrP purified from scrapie tissues might be contaminated with a more conventional viral agent. To obtain PrP uncontaminated by scrapie-infected tissues, PrP cDNA cloned from a scrapie-infected mouse brain was expressed in mouse C127 cells in vitro. mRNA and protein encoded by the cloned PrP gene were identified. The expressed PrP polypeptides appeared to be glycosylated and were released from the cell surface into the medium. Homogenates of the cells expressing the cloned PrP gene were inoculated into susceptible mice but failed to induce clinical signs of scrapie. Thus, either PrP is not the transmissible agent of scrapie or the expressed PrP requires additional modification to be infectious.

  5. Eyeblink classical conditioning in the preweanling lamb.

    Science.gov (United States)

    Johnson, Timothy B; Stanton, Mark E; Goodlett, Charles R; Cudd, Timothy A

    2008-06-01

    Classical conditioning of eyeblink responses has been one of the most important models for studying the neurobiology of learning, with many comparative, ontogenetic, and clinical applications. The current study reports the development of procedures to conduct eyeblink conditioning in preweanling lambs and demonstrates successful conditioning using these procedures. These methods will permit application of eyeblink conditioning procedures in the analysis of functional correlates of cerebellar damage in a sheep model of fetal alcohol spectrum disorders, which has significant advantages over more common laboratory rodent models. Because sheep have been widely used for studies of pathogenesis and mechanisms of injury with many different prenatal or perinatal physiological insults, eyeblink conditioning can provide a well-studied method to assess postnatal behavioral outcomes, which heretofore have not typically been pursued with ovine models of developmental insults.

  6. Breeding Practices in Sheep Farming

    Directory of Open Access Journals (Sweden)

    M.A. Shejal

    2009-02-01

    Full Text Available The sheep is an important economic livestock species, contributing greatly to the Indian economy, especially in arid, semi arid and mountain areas. The current population in world is 1110.78 millions, around 44.85 millions (1987 sheeps in India (ICAR., 2002. Sheeps are mostly reared for meat and wool. The average annual wool production per sheep is between 3.5 to 5.5 kg of fine quality wool in Australia, New Zealand and U.S.S.R., where as in India except Magra sheep which annually yield more than 2 kg wool having staple length 5.8 cm, the average of rest of the wool produced is less than 1.0 kg per sheep of inferior quality (Banerjee G.C., 1998. Therefore many farmers in southern India adapted sheep rearing for meat production than for wool production. For yielding more production from sheep farming one should have sound knowledge of general information related to the reproduction and different breeding practices. [Vet. World 2009; 2(1.000: 43-44

  7. Effect of chemicals, heat, and histopathologic processing on high-infectivity hamster-adapted scrapie virus.

    Science.gov (United States)

    Brown, P; Rohwer, R G; Green, E M; Gajdusek, D C

    1982-05-01

    High-titered (greater than 10(10) LD50 [50% lethal dose[/g) preparations of scrapie virus-infected hamster brain were subjected to inactivation by various chemicals, autoclaving, and histopathologic processing. Sodium hypochlorite, which reduced infectivity by approximately 4 log LD50/g of brain (99.99%), was somewhat superior to sodium metaperiodate and clearly superior to chlorine dioxide, Lysol (National Laboratories, Montvale, N.J.), iodine, potassium permanganate, and hydrogen peroxide. Most inactivation occurred within 15-30 min of exposure to a chemical, and little if any additional inactivation occurred after 1 hr. Brains processed for histopathologic examination (formalin fixation followed by dehydration in methanol, clearing in chloroform, and embedding in paraffin) retained greater than or equal to 6.8 log LD50/g of the infectivity present in unprocessed control tissues (9.6 log LD50/g). One hour in an autoclave at 121 C reduced the titer of scrapie virus by approximately 7.5 log LD50/g of brain but left 2.5 log LD50/g of residual infectivity. A combination of exposure to chemicals and autoclaving may be necessary to sterilize high-titered scrapie virus-infected tissue.

  8. ANTIPARASITICAL PROTECTION IN SHEEP FARMS

    Directory of Open Access Journals (Sweden)

    DOINA ARDELEANU

    2013-12-01

    Full Text Available Through our researches were carried out at ICDCOC- Palas, Constantza, we proposed ourselves to establish the poly-parasitism structure on sheep, as well as elaborating efficientical methods for anti-parasitical prophylaxis and fighting in sheep populations and pasture sourfaces, in order to ensuring anti-parasitical protection in sheep exploitations The copro-parasitological examinations was carried ovoscopicaly (flotation - by Willis and Mc. Master methods; sediment – by polyvalent method and larvoscopicaly – by Baermann method. The parasitological examination of coprological smears which were harvested on sheep showed the presence of polyparasitism phenomenon with protozoans (coccidiae: Eimeria spp. and helmints (cestodae: Moniesia expansa; gastro-intestinal nemathodes: Trichostrongylus spp., Nematodirus spp., Strongyloides papillosus and pulmonary nemathodes: Müellerius capillaris, Protostrongylus rufescens, Dictyocaulus filaria. Also, we proposed ourselves to study the paresites and their intermediary stages on pastures which were exploited with sheep, comparatively with mowed pastures. In the ansamble of research activities a special place is occupied by testing differents methods, in order to prevention and fighting of parasitical infestations on sheep and pasture in sheep farms.

  9. Vitamin and water requirements of dairy sheep

    Directory of Open Access Journals (Sweden)

    Fulvia Bovera

    2010-01-01

    Full Text Available The authors review the physiological role and the daily requirement of fat-soluble vitamins (A, D, E and K, vitamin C  and water in dairy sheep. Regarding the vitamins, classical clinical symptoms and/or non-specific parameters, such as  lowered production and reproduction rates are associated with their deficiencies or excesses. Until the last decade,  these compounds were considered important only for the prevention of such alterations; currently, there is more  emphasis on their function as the vitamins can play a key role in optimising animal health. In this respect, of particu-  lar interest is the action of the antioxidant vitamins (especially vitamin C, vitamin E and beta-carotene in improving  the efficiency of the immune system. 

  10. Allelic variants at codon 146 in the PRNP gene show significant differences in the risk for natural scrapie in Cypriot goats.

    Science.gov (United States)

    Ortiz-Pelaez, A; Georgiadou, S; Simmons, M M; Windl, O; Dawson, M; Arnold, M E; Neocleous, P; Papasavva-Stylianou, P

    2015-04-01

    Previous studies have shown the association between the polymorphisms serine (S) or aspartic acid (D) at codon 146 of the PRNP gene and resistance to scrapie. All goats aged >12 months (a total of 1075 animals) from four herds with the highest prevalence of scrapie in the country were culled and tested, of which 234 (21·7%) were positive by either the rapid test or immunohistochemistry (IHC) for any of the tissues tested. The odds of scrapie infection occurring in NN146 goats was 101 [95% credible interval (CrI) 19-2938] times higher than for non-NN146 or unknown genotypes. IHC applied to lymphoreticular tissue produced the highest sensitivity (94%, 95% CrI 90-97). The presence of putatively resistant non-NN146 alleles in the Cypriot goat population, severely affected by scrapie, provides a potential tool to reduce/eradicate scrapie provided that coordinated nationwide breeding programmes are implemented and maintained over time.

  11. Short-term study of the uptake of PrPSc by the Peyer’s patches in hamsters after oral exposure to scrapie

    DEFF Research Database (Denmark)

    Bergström, Ann-Louise; Jensen, Tim Kåre; Heegaard, Peter M. H.;

    2006-01-01

    The disease-associated prion protein (PrPSc) has been detected in the ileal Peyer's patches of lambs as early as one week after oral exposure to scrapie. In hamsters, the earliest reported time of PrPSc detection in the Peyer's patches after oral exposure to scrapie is 69 days post......-infection. To evaluate the acute uptake of inoculum and to investigate whether the Peyer's patches constitute the primary site of entry for scrapie after oral exposure, hamsters were each exposed orally to 1 ml of a 10% brain homogenate from hamsters in the terminal stage of infection with the 263 K strain...... of the scrapie agent. PrPSc was demonstrated in the Peyer's patches only a few days after exposure, i.e., much earlier than previously reported. This study Supports the view that the Peyer's patches constitute at least one of the primary entry sites of PrPSc after oral exposure to scrapie....

  12. Mouse-adapted scrapie strains 139A and ME7 overcome species barrier to induce experimental scrapie in hamsters and changed their pathogenic features

    Directory of Open Access Journals (Sweden)

    Shi Qi

    2012-03-01

    Full Text Available Abstract Background Transmissible spongiform encephalopathy (TSE diseases are known to be zoonotic diseases that can infect different kinds of animals. The transmissibility of TSE, like that of other infectious diseases, shows marked species barrier, either being unable to infect heterologous species or difficult to form transmission experimentally. The similarity of the amino acid sequences of PrP among species is believed to be one of the elements in controlling the transmission TSE interspecies. Other factors, such as prion strains and host's microenvironment, may also participate in the process. Methods Two mouse-adapted strains 139A and ME7 were cerebrally inoculated to Golden hamsters. Presences of scrapie associate fibril (SAF and PrPSc in brains of the infected animals were tested by TEM assays and Western blots dynamically during the incubation periods. The pathogenic features of the novel prions in hamsters, including electrophoretic patterns, glycosylating profiles, immunoreactivities, proteinase K-resistances and conformational stabilities were comparatively evaluated. TSE-related neuropathological changes were assayed by histological examinations. Results After long incubation times, mouse-adapted agents 139A and ME7 induced experimental scrapie in hamsters, respectively, showing obvious spongiform degeneration and PrPSc deposits in brains, especially in cortex regions. SAF and PrPSc in brains were observed much earlier than the onset of clinical symptoms. The molecular characteristics of the newly-formed PrPSc in hamsters, 139A-ha and ME7-ha, were obviously distinct from the original mouse agents, however, greatly similar as that of a hamster-adapted scrapie strain 263 K. Although the incubation times and main disease signs of the hamsters of 139A-ha and ME7-ha were different, the pathogenic characteristics and neuropathological changes were highly similar. Conclusions This finding concludes that mouse-adapted agents 139A and ME7

  13. Genetic components of litter size variability in sheep

    Directory of Open Access Journals (Sweden)

    Chevalet Claude

    2001-05-01

    Full Text Available Abstract Classical selection for increasing prolificacy in sheep leads to a concomitant increase in its variability, even though the objective of the breeder is to maximise the frequency of an intermediate litter size rather than the frequency of high litter sizes. For instance, in the Lacaune sheep breed raised in semi-intensive conditions, ewes lambing twins represent the economic optimum. Data for this breed, obtained from the national recording scheme, were analysed. Variance components were estimated in an infinitesimal model involving genes controlling the mean level as well as its environmental variability. Large heritability was found for the mean prolificacy, but a high potential for increasing the percentage of twins at lambing while reducing the environmental variability of prolificacy is also suspected. Quantification of the response to such a canalising selection was achieved.

  14. Genetic components of litter size variability in sheep

    Science.gov (United States)

    SanCristobal-Gaudy, Magali; Bodin, Loys; Elsen, Jean-Michel; Chevalet, Claude

    2001-01-01

    Classical selection for increasing prolificacy in sheep leads to a concomitant increase in its variability, even though the objective of the breeder is to maximise the frequency of an intermediate litter size rather than the frequency of high litter sizes. For instance, in the Lacaune sheep breed raised in semi-intensive conditions, ewes lambing twins represent the economic optimum. Data for this breed, obtained from the national recording scheme, were analysed. Variance components were estimated in an infinitesimal model involving genes controlling the mean level as well as its environmental variability. Large heritability was found for the mean prolificacy, but a high potential for increasing the percentage of twins at lambing while reducing the environmental variability of prolificacy is also suspected. Quantification of the response to such a canalising selection was achieved. PMID:11403747

  15. What classicality? Decoherence and Bohr's classical concepts

    CERN Document Server

    Schlosshauer, Maximilian

    2010-01-01

    Niels Bohr famously insisted on the indispensability of what he termed "classical concepts." In the context of the decoherence program, on the other hand, it has become fashionable to talk about the "dynamical emergence of classicality" from the quantum formalism alone. Does this mean that decoherence challenges Bohr's dictum and signifies a break with the Copenhagen interpretation-for example, that classical concepts do not need to be assumed but can be derived? In this paper we'll try to shine some light down the murky waters where formalism and philosophy cohabitate. To begin, we'll clarify the notion of classicality in the decoherence description. We'll then discuss Bohr's and Heisenberg's take on the quantum-classical problem and reflect on different meanings of the terms "classicality" and "classical concepts" in the writings of Bohr and his followers. This analysis will allow us to put forward some tentative suggestions for how we may better understand the relation between decoherence-induced classical...

  16. Becoming Sheep, Becoming Animal

    DEFF Research Database (Denmark)

    Grum, Charlotte; Svabo, Connie

    2016-01-01

    Proposal for Performance Research, in response to the call Turning Animal: As a part of a 2015 group exhibition exploring the history and local myths of a woman living in a Danish heath landscape 150 years ago, artist Charlotte Grum connected herself to a live sheep for 4 hours a day, 5 days a we...... support the written account – together with graphic figurations of the many human and non-human actors playing a part of the mattering of “Becoming Sheep”, with an equal intention of performing multiple positions within and through the text......., for 5 weeks, turning the two into a hybrid relational assemblage, intra-acting and becoming with the heath habitat, the other by-passing human and non-human animals, the changing weather and their fluctuating biological needs. She wanted to explore the discursive and material effects of a site......-specific human-nonhuman animal intra-action, to challenge the gendered and anthropocentric reading of a particular historical subject and to explore the messy constituents of the very categories of women and animals. In general she is occupied with how to animate and perform the intra-active entanglement...

  17. Sheep-related Culture of Guizhou

    Institute of Scientific and Technical Information of China (English)

    WuZhengguang

    2003-01-01

    Sheep and goats, major livestock in Guizhou Steppe of southwest China, are of both practical and social value for local dwellers. As sheep is pronounced similar as "auspicious" in Chinese, its image is widely applied to every aspect of local society, including religious rites, calendar calculation, arts creation and architecture. Thus a sheep-related culture has been developed and prospered.

  18. Inoculation of Scrapie with the Self-Assembling RADA-Peptide Disrupts Prion Accumulation and Extends Hamster Survival

    Science.gov (United States)

    Intercerebral inoculation of 263K Scrapie brain homogenate (PrPsc) with a self-assembling RADA-peptide (RADA) significantly delayed disease onset and increased hamster survival. Time of survival was dependent on the dose of RADA and pre-incubation with PrPsc prior to inoculation. RADA treatment resu...

  19. Dysfunction of mitochondrial dynamics in the brains of scrapie-infected mice.

    Science.gov (United States)

    Choi, Hong-Seok; Choi, Yeong-Gon; Shin, Hae-Young; Oh, Jae-Min; Park, Jeong-Ho; Kim, Jae-Il; Carp, Richard I; Choi, Eun-Kyoung; Kim, Yong-Sun

    2014-05-30

    Mitochondrial dysfunction is a common and prominent feature of many neurodegenerative diseases, including prion diseases; it is induced by oxidative stress in scrapie-infected animal models. In previous studies, we found swelling and dysfunction of mitochondria in the brains of scrapie-infected mice compared to brains of controls, but the mechanisms underlying mitochondrial dysfunction remain unclear. To examine whether the dysregulation of mitochondrial proteins is related to the mitochondrial dysfunction associated with prion disease, we investigated the expression patterns of mitochondrial fusion and fission proteins in the brains of ME7 prion-infected mice. Immunoblot analysis revealed that Mfn1 was up-regulated in both whole brain and specific brain regions, including the cerebral cortex and hippocampus, of ME7-infected mice compared to controls. Additionally, expression levels of Fis1 and Mfn2 were elevated in the hippocampus and the striatum, respectively, of the ME7-infected brain. In contrast, Dlp1 expression was significantly reduced in the hippocampus in the ME7-infected brain, particularly in the cytosolic fraction. Finally, we observed abnormal mitochondrial enlargement and histopathological change in the hippocampus of the ME7-infected brain. These observations suggest that the mitochondrial dysfunction, which is presumably caused by the dysregulation of mitochondrial fusion and fission proteins, may contribute to the neuropathological changes associated with prion disease.

  20. Perturbation of the Secondary Structure of the Scrapie Prion Protein Under Conditions that Alter Infectivity

    Science.gov (United States)

    Gasset, Maria; Baldwin, Michael A.; Fletterick, Robert J.; Prusiner, Stanley B.

    1993-01-01

    Limited proteolysis of the scrapie prion protein (PrPSc) generates PrP 27-30, which polymerizes into amyloid. By attenuated total reflection-Fourier transform infrared spectroscopy, PrP 27-30 polymers contained 54% β-sheet, 25% α-helix, 10% turns, and 11% random coil; dispersion into detergent-lipid-protein-complexes preserved infectivity and secondary structure. Almost 60% of the β-sheet was low-frequency infrared-absorbing, reflecting intermolecular aggregation. Decreased low-frequency β-sheet and increased turn content were found after SDS/PAGE, which disassembled the amyloid polymers, denatured PrP 27-30, and diminished scrapie infectivity. Acid-induced transitions were reversible, whereas alkali produced an irreversible transition centered at pH 10 under conditions that diminished infectivity. Whether PrPSc synthesis involves a transition in the secondary structure of one or more domains of the cellular prion protein from α-helical, random coil, or turn into β-sheet remains to be established.

  1. Antigen retrieval using sodium hydroxide for prion immunohistochemistry in bovine spongiform encephalopathy and scrapie.

    Science.gov (United States)

    Okada, H; Sato, Y; Sata, T; Sakurai, M; Endo, J; Yokoyama, T; Mohri, S

    2011-05-01

    Formalin-fixed and paraffin wax-embedded (FFPE) tissue sections are usually used for histopathological and immunohistochemical analyses in prion diseases in animals and man. However, formalin fixation cross-links proteins, reducing disease-associated prion protein (PrP(Sc)) immunolabelling. To detect PrP(Sc) in animals naturally affected with bovine spongiform encephalopathy (BSE) and scrapie, we applied minimal pretreatment with sodium hydroxide (NaOH). This simple pretreatment, combined with enzymatic digestion using proteinase K (PK), was equally effective in the detection of PrP(Sc) in FFPE tissue, and superior in terms of speed, compared with the usual autoclaving method. The most effective results, without any section loss, were obtained with 10 μg/ml PK in phosphate buffered saline containing 0.1% Triton-X at room temperature for 10 min and 150 mM NaOH at 60 °C for 10 min. By this simple procedure, PrP(Sc) was visualized in the brain of animals with BSE and scrapie using a range of anti-PrP primary antibodies.

  2. Milk yield of some Croatian sheep breeds

    OpenAIRE

    Kristijan Pandek; Boro Mioč; Zdravko Barać; Vesna Pavić; Neven Antunac; Zvonimir Prpić

    2005-01-01

    Among the most important breeds of sheep, used for the milk production in Croatia, are the sheep from Pag, Brač, Cres, Istrian and Travnik΄s sheep, different crossbreeds and, recently, East Friesian sheep. The aim of the research was to determine the genotype effect on lactation period, milk yield and protein and fat content, which are important in cheese making. The longest lactation period (213 days) had East Friesian sheep, while the highest total milk production (294 kg) and the highest p...

  3. Classical mechanics without determinism

    OpenAIRE

    Nikolic, H.

    2005-01-01

    Classical statistical particle mechanics in the configuration space can be represented by a nonlinear Schrodinger equation. Even without assuming the existence of deterministic particle trajectories, the resulting quantum-like statistical interpretation is sufficient to predict all measurable results of classical mechanics. In the classical case, the wave function that satisfies a linear equation is positive, which is the main source of the fundamental difference between classical and quantum...

  4. Quantum computing classical physics.

    Science.gov (United States)

    Meyer, David A

    2002-03-15

    In the past decade, quantum algorithms have been found which outperform the best classical solutions known for certain classical problems as well as the best classical methods known for simulation of certain quantum systems. This suggests that they may also speed up the simulation of some classical systems. I describe one class of discrete quantum algorithms which do so--quantum lattice-gas automata--and show how to implement them efficiently on standard quantum computers.

  5. Ivermectin pharmacokinetics in lactating sheep

    NARCIS (Netherlands)

    Cerkvenik, V.; Grabnar, V.; Skubic, V.; Doganoc, D.Z.; Beek, W.M.J.; Keukens, H.J.; Kosorok, M.D.; Pogacnik, M.

    2002-01-01

    Ivermectin (IVM) concentrations in plasma and milk were studied in six Istrian Pramenka dairy sheep after a single subcutaneous dose of 0.2 mg/kg b.w. of IVM in the early lactation period to describe IVM disposition in milk and to evaluate the transfer of IVM residues via milk to suckling lambs. Lar

  6. Ventral hernia in the sheep.

    Science.gov (United States)

    Tirgari, M

    1980-01-05

    Between November 1974 and November 1978, 11 sheep with ventral hernia were referred for surgical correction. The anatomy of the area, clinical findings, operative details, surgicopathological observations and postoperative results are described. A comparison of these cases with hernial correction in horses and cattle is made.

  7. Entanglement in Classical Optics

    CERN Document Server

    Ghose, Partha

    2013-01-01

    The emerging field of entanglement or nonseparability in classical optics is reviewed, and its similarities with and differences from quantum entanglement clearly pointed out through a recapitulation of Hilbert spaces in general, the special restrictions on Hilbert spaces imposed in quantum mechanics and the role of Hilbert spaces in classical polarization optics. The production of Bell-like states in classical polarization optics is discussed, and new theorems are proved to discriminate between separable and nonseparable states in classical wave optics where no discreteness is involved. The influence of the Pancharatnam phase on a classical Bell-like state is deived. Finally, to what extent classical polarization optics can be used to simulate quantum information processing tasks is also discussed. This should be of great practical importance because coherence and entanglement are robust in classical optics but not in quantum systems.

  8. Association of an indel polymorphism in the 3'UTR of the caprine SPRN gene with scrapie positivity in the central nervous system.

    Science.gov (United States)

    Peletto, Simone; Bertolini, Silvia; Maniaci, Maria Grazia; Colussi, Silvia; Modesto, Paola; Biolatti, Cristina; Bertuzzi, Simone; Caramelli, Maria; Maurella, Cristiana; Acutis, Pier Luigi

    2012-07-01

    The aim of this study was to analyse the SPRN genes of goats from several scrapie outbreaks in order to detect polymorphisms and to look for association with scrapie occurrence, by an unmatched case-control study. A region of the caprine SPRN gene encompassing the entire ORF and a fragment of the 3'UTR revealed a total of 11 mutations: 10 single-nucleotide polymorphisms and one indel polymorphism. Only two non-synonymous mutations occurring at very low incidence were identified. A significant association with scrapie positivity in the central nervous system was found for an indel polymorphism (602_606insCTCCC) in the 3'UTR. Bioinformatics analyses suggest that this indel may modulate scrapie susceptibility via a microRNA-mediated post-transcriptional mechanism. This is the first study to demonstrate an association between the SPRN gene and goat scrapie. The identified indel may serve as a genetic target other than PRNP to predict disease risk in future genetics-based scrapie-control approaches in goats.

  9. Analysis of the incubation periods, induction of obesity and histopathological changes in senescence-prone and senescence-resistant mice infected with various scrapie strains.

    Science.gov (United States)

    Carp, R I; Meeker, H; Sersen, E; Kozlowski, P

    1998-11-01

    The similarity in histopathological changes seen in scrapie-infected mice and in an uninfected senescence-accelerated mouse strain led to a study in which the mouse strain that is prone to senescence (SAMP8), a strain that is resistant to senescence (SAMR1) and a progenitor strain (AKR) of these two strains were infected with three different scrapie strains, ME7, 139A and 22L. For each scrapie strain, the incubation period was shortest in AKR mice and longest in SAMR1 mice. The induction of obesity was a function of scrapie strain and not mouse strain; ME7 caused obesity in all mouse strains, whereas the average weights of mice injected with 139A and 22L did not differ significantly from mice injected with homogenates of normal mouse brain. The pattern of vacuolation seen in the brain of each mouse strain was primarily dependent on the scrapie strain injected. There were, in general, similarities to the patterns induced in other inbred strains; e.g. ME7 caused extensive forebrain vacuolation, 22L caused prominent vacuolation in the cerebellum, and the 139A strain induced characteristic white matter vacuolation. Vacuolation was also seen in the medulla and midbrain of SAMP8 mice injected with normal mouse brain, which is consistent with the occurrence of accelerated ageing changes in the brain of this strain. Further analysis of the differences among these mouse strains should provide information relating to the observed differences in scrapie incubation periods.

  10. A Csf1r-EGFP Transgene Provides a Novel Marker for Monocyte Subsets in Sheep.

    Science.gov (United States)

    Pridans, Clare; Davis, Gemma M; Sauter, Kristin A; Lisowski, Zofia M; Corripio-Miyar, Yolanda; Raper, Anna; Lefevre, Lucas; Young, Rachel; McCulloch, Mary E; Lillico, Simon; Milne, Elspeth; Whitelaw, Bruce; Hume, David A

    2016-09-15

    Expression of Csf1r in adults is restricted to cells of the macrophage lineage. Transgenic reporters based upon the Csf1r locus require inclusion of the highly conserved Fms-intronic regulatory element for expression. We have created Csf1r-EGFP transgenic sheep via lentiviral transgenesis of a construct containing elements of the mouse Fms-intronic regulatory element and Csf1r promoter. Committed bone marrow macrophage precursors and blood monocytes express EGFP in these animals. Sheep monocytes were divided into three populations, similar to classical, intermediate, and nonclassical monocytes in humans, based upon CD14 and CD16 expression. All expressed EGFP, with increased levels in the nonclassical subset. Because Csf1r expression coincides with the earliest commitment to the macrophage lineage, Csf1r-EGFP bone marrow provides a tool for studying the earliest events in myelopoiesis using the sheep as a model.

  11. Improving the Local Sheep in Gansu via Crossing with Introduced Sheep Breeds Dorset and Borderdale

    Institute of Scientific and Technical Information of China (English)

    Sun; Xiaoping; Liu; Jianbin; Zhang; Wanlong; Lang; Xia; Yang; Bohui; Guo; Jian; Feng; Ruilin

    2014-01-01

    In order to improve the meat performance of local sheep in Gansu Province,Dorset and Borderdale were introduced to crossbreed with local sheep which were Tan sheep,Small-tail Han sheep and Mongolia sheep. The offspring under different crossbreeding combinations were sampled randomly at the different growing stage to measure their growth traits so as to select optimize the crossbreeding mode. The results indicated that,for the same crossbreeding mode,the growth rate of progeny was in order F3> F2> F1; for the F3 progeny,the combinations Dorset- Borderdale- Small tail Han sheep and Dorset- Borderdale- Mongolia sheep gave a higher growth rate,with a body weight of 1. 57%,3. 17%,8. 23%,1. 15% higher in male and female individuals than the counterparts of Dorset and Tan sheep and Small tail Han sheep; for the F2 progeny,the combinations Dorset- Borderdale- Small tail Han sheep and Dorset- Borderdale- Mongolia sheep also gave a higher growth rate,with a body weight of 2. 15%,4. 53%,9. 21% and 2. 75% higher in male and female individuals than the counterparts of Dorset and Tan sheep and Small tail Han sheep; for the F1 progeny,the combination Borderdale and Small tail Han sheep assumed a higher growth rate,with a body weight of 3. 23%,6. 07%,7. 42% and 8. 66% higher in male and female individuals than the counterparts of Borderdale- Mongolia sheep and Tan sheep- Small tail Han sheep,respectively. Therefore,in the Small-tail Han sheep and Mongolia sheep producing regions,the F2 or F3progeny bred by using Dorset or Borderdale sheep as male parent to cross with local breeds,or the hybrid lambs of Small-tail Han sheep and Borderdale sheep as highly qualified commodity,would produce significant economic benefit. Moreover,the novel breeds obtained by crossing were the valuable genetic resource for breeding meat sheep.

  12. The Levels of Genetic Differentiation of Small-Tailed Han Sheep and Tan Sheep Populations Using Structural Loci

    Institute of Scientific and Technical Information of China (English)

    LU Sheng-xia; CHANG Hong; JI De-jun; Tsunoda Kenji; REN Zhan-jun; REN Xiang-lian; SUN Wei; YANG Zhang-ping; CHANG Guo-bin

    2006-01-01

    Using the method of "random sampling in typical colonies of the central area of the habitat" and several electrophoresis techniques, the variations of 17 structural loci encoding blood proteins in 60 Small-Tailed Han sheep and 73 Tan sheep were examined and compared with those of 14 other sheep populations in China and other countries to investigate their levels of genetic differentiation. The average heterozygosities of Small-Tailed Han sheep and Tan sheep were 0.2360 and 0.2587, respectively. The average polymorphic information content values were 0.1974 and 0.2102, respectively. The average effective numbers of alleles were 1.5723 and 1.5751, respectively. The coefficients of gene differentiation in the four groups (including 4, 6, 13, and 16 sheep populations, respectively) were 0.049323, 0.059987, 0.1728, and 0.201256,respectively, indicating that the degree of gene differentiation at the structural loci was the least in Hu sheep, Tong sheep,Small-Tailed Han sheep, and Tan sheep; followed by the above-mentioned four sheep populations and two Mongolian sheep populations; and was the highest in sheep populations belonging to the Mongolian sheep group, South Asian sheep, and European sheep. The earlier researchers' conclusions that both Small-Tailed Han sheep and Tan sheep evolved from Mongolian sheep were further verified by the results of this study. Hu sheep, Tong sheep, Small-Tailed Han sheep, and Tan sheep were decreasingly affected by the bloodline of Mongolian sheep to different degrees. The relationships among sheep populations were not closely related to the geographical distances among sheep populations.

  13. Emerging parasitic diseases of sheep.

    Science.gov (United States)

    Taylor, M A

    2012-09-30

    There have been changes in the emergence and inability to control of a number of sheep parasitic infections over the last decade. This review focuses on the more globally important sheep parasites, whose reported changes in epidemiology, occurrence or failure to control are becoming increasingly evident. One of the main perceived driving forces is climate change, which can have profound effects on parasite epidemiology, especially for those parasitic diseases where weather has a direct effect on the development of free-living stages. The emergence of anthelmintic-resistant strains of parasitic nematodes and the increasing reliance placed on anthelmintics for their control, can exert profound changes on the epidemiology of those nematodes causing parasitic gastroenteritis. As a consequence, the effectiveness of existing control strategies presents a major threat to sheep production in many areas around the world. The incidence of the liver fluke, Fasciola hepatica, is inextricably linked to high rainfall and is particularly prevalent in high rainfall years. Over the last few decades, there have also been increasing reports of other fluke associated diseases, such as dicroceliosis and paramphistomosis, in a number of western European countries, possibly introduced through animal movements, and able to establish with changing climates. External parasite infections, such as myiasis, can cause significant economic loss and presents as a major welfare problem. The range of elevated temperatures predicted by current climate change scenarios, result in an elongated blowfly season with earlier spring emergence and a higher cumulative incidence of fly strike. Additionally, legislative decisions leading to enforced changes in pesticide usage and choices have resulted in increased reports and spread of ectoparasitic infections, particularly mite, lice and tick infestations in sheep. Factors, such as dip disposal and associated environmental concerns, and, perhaps more

  14. Dysfunction of mitochondrial dynamics in the brains of scrapie-infected mice

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hong-Seok [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Choi, Yeong-Gon; Shin, Hae-Young; Oh, Jae-Min [Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Park, Jeong-Ho [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Kim, Jae-Il [Department of Food Science and Nutrition, Pukyong National University, 599-1 Daeyeon-3-dong, Nam-gu, Busan 608-737 (Korea, Republic of); Carp, Richard I. [New York State Institute for Basic Research in Developmental Disabilities, 1050 Forest Hill Road, Staten Island, NY 10314 (United States); Choi, Eun-Kyoung, E-mail: ekchoi@hallym.ac.kr [Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of); Kim, Yong-Sun, E-mail: yskim@hallym.ac.kr [Department of Microbiology, College of Medicine, Hallym University, 1 Okcheon-dong, Chuncheon, Gangwon-do 200-702 (Korea, Republic of); Ilsong Institute of Life Science, Hallym University, 1605-4 Gwanyang-dong, Dongan-gu, Anyang, Gyeonggi-do 431-060 (Korea, Republic of)

    2014-05-30

    Highlights: • Mfn1 and Fis1 are significantly increased in the hippocampal region of the ME7 prion-infected brain, whereas Dlp1 is significantly decreased in the infected brain. • Dlp1 is significantly decreased in the cytosolic fraction of the hippocampus in the infected brain. • Neuronal mitochondria in the prion-infected brains are enlarged and swollen compared to those of control brains. • There are significantly fewer mitochondria in the ME7-infected brain compared to the number in control brain. - Abstract: Mitochondrial dysfunction is a common and prominent feature of many neurodegenerative diseases, including prion diseases; it is induced by oxidative stress in scrapie-infected animal models. In previous studies, we found swelling and dysfunction of mitochondria in the brains of scrapie-infected mice compared to brains of controls, but the mechanisms underlying mitochondrial dysfunction remain unclear. To examine whether the dysregulation of mitochondrial proteins is related to the mitochondrial dysfunction associated with prion disease, we investigated the expression patterns of mitochondrial fusion and fission proteins in the brains of ME7 prion-infected mice. Immunoblot analysis revealed that Mfn1 was up-regulated in both whole brain and specific brain regions, including the cerebral cortex and hippocampus, of ME7-infected mice compared to controls. Additionally, expression levels of Fis1 and Mfn2 were elevated in the hippocampus and the striatum, respectively, of the ME7-infected brain. In contrast, Dlp1 expression was significantly reduced in the hippocampus in the ME7-infected brain, particularly in the cytosolic fraction. Finally, we observed abnormal mitochondrial enlargement and histopathological change in the hippocampus of the ME7-infected brain. These observations suggest that the mitochondrial dysfunction, which is presumably caused by the dysregulation of mitochondrial fusion and fission proteins, may contribute to the

  15. Classical, Semi-classical and Quantum Noise

    CERN Document Server

    Poor, H; Scully, Marlan

    2012-01-01

    David Middleton was a towering figure of 20th Century engineering and science and one of the founders of statistical communication theory. During the second World War, the young David Middleton, working with Van Fleck, devised the notion of the matched filter, which is the most basic method used for detecting signals in noise. Over the intervening six decades, the contributions of Middleton have become classics. This collection of essays by leading scientists, engineers and colleagues of David are in his honor and reflect the wide  influence that he has had on many fields. Also included is the introduction by Middleton to his forthcoming book, which gives a wonderful view of the field of communication, its history and his own views on the field that he developed over the past 60 years. Focusing on classical noise modeling and applications, Classical, Semi-Classical and Quantum Noise includes coverage of statistical communication theory, non-stationary noise, molecular footprints, noise suppression, Quantum e...

  16. Photosenitization of sheep on kleingrass pasture.

    Science.gov (United States)

    Muchiri, D J; Bridges, C H; Ueckert, D N; Bailey, E M

    1980-08-15

    The clinical appearance and serum gamma-glutamyl transpeptidase (GGT) activity were studied in 5 groups of sheep (12 per group) on kleingrass (Panicum coloratum) pasture plots and in 1 group of sheep (10 animals) on native buffalograss (Buchloë dactyloides) pasture. Eleven sheep (at least 1 from each group on kleingrass pasture plots) had elevated serum GGT activity. Seven of 11 sheep with elevated serum GGT activity developed signs of photosensitization. None of the sheep on buffalograss pasture developed signs of photosensitization or elevated GGT activity. The pathologic findings were similar in the sheep that had signs of photosensitization. Grossly, there was icterus and subcutaneous edema. The livers had tapeworms (Thysanosoma actinioides) in the bile ducts, were slightly swollen, and varied in color from yellow to ochre in severe cases of biliary system derangements. Microscopically, there was cholangitis.

  17. Royana: Successful Experience in Cloning the Sheep

    OpenAIRE

    Saeed Kazemi Ashtiani; Mohammad Hossein Nasr-Esfahani; Sayyed Mortaza Hosseini; Fariba Moulavi; Mahdi Hajian; Mohsen Frouzanfar; Parvaneh Abedi; Maryam Meamar; Mojtaba Rezazadeh Valojerdi; Hamid Gourabi; Abdolhossein Shahverdi; Hossein Baharvand; Ahmad Vosough Dizaj; Hossein Imani; Poopak Eftekhari-Yazdi

    2008-01-01

    Objective: This study describes our experiences in reproductive cloning using two differentprocedures resulting in birth of the first successfully cloned sheep in Iran and theMiddle-East, nick-named "Royana".Materials and Methods: Abattoir-derived sheep oocytes were enucleated after in vitromaturation for 18-20hrs and then reconstructed by ear-derived sheep somatic cells usingtwo different procedures of renucleation (subzonary, intracytoplasmic), embryo culture (coculture,sequential medium) a...

  18. The abnormal isoform of the prion protein accumulates in late-endosome-like organelles in scrapie-infected mouse brain.

    Science.gov (United States)

    Arnold, J E; Tipler, C; Laszlo, L; Hope, J; Landon, M; Mayer, R J

    1995-08-01

    The prion encephalopathies are characterized by accumulation in the brain of the abnormal form PrPsc of a normal host gene product PrPc. The mechanism and site of formation of PrPsc from PrPc are currently unknown. In this study, ME7 scrapie-infected mouse brain was used to show, both biochemically and by double-labelled immunogold electron microscopy, that proteinase K-resistant PrPsc is enriched in subcellular structures which contain the cation-independent mannose 6-phosphate receptor, ubiquitin-protein conjugates, beta-glucuronidase, and cathepsin B, termed late endosome-like organelles. The glycosylinositol phospholipid membrane-anchored PrPc will enter such compartment for normal degradation and the organelles may therefore act as chambers for the conversion of PrPc into infectious PrPsc in this murine model of scrapie.

  19. Isolation of Leptospira noguchii from sheep.

    Science.gov (United States)

    Silva, Everton F; Brod, Claudiomar S; Cerqueira, Gustavo M; Bourscheidt, Débora; Seyffert, Núbia; Queiroz, Adriano; Santos, Cleiton S; Ko, Albert I; Dellagostin, Odir A

    2007-03-31

    The main goal of this study was to obtain new isolates of Leptospira spp. from sheep. A total of 10 kidney samples and 44 blood samples were collected from sheep slaughtered in Pelotas, Southern Brazil. One isolate was obtained which was identified by 16S rRNA gene sequencing and serogrouping to be Leptospira noguchii serogroup Autumnalis. Microscopic agglutination test (MAT) evaluation revealed that 4.5% of the sheep sera reacted against the Autumnalis serogroup. This is the first report of isolation of L. noguchii from sheep. Together these findings indicate that L. noguchii infections may be a potentially important veterinary problem in this domestic animal species.

  20. Disruption of glycosylation enhances ubiquitin-mediated proteasomal degradation of Shadoo in Scrapie-infected rodents and cultured cells.

    Science.gov (United States)

    Zhang, Jin; Guo, Yan; Xie, Wu-Ling; Xu, Yin; Ren, Ke; Shi, Qi; Zhang, Bao-Yun; Chen, Cao; Tian, Chan; Gao, Chen; Dong, Xiao-Ping

    2014-06-01

    Shadoo (Sho) is an N-glycosylated glycophosphatidylinositol-anchored protein that is expressed in the brain and exhibits neuroprotective properties. Recently, research has shown that a reduction of Sho levels may reflect the presence of PrPSc in the brain. However, the possible mechanism by which prion infection triggers down-regulation of Sho remains unclear. In the present study, Western blot and immunohistochemical assays revealed that Sho, especially glycosylated Sho, declined markedly in the brains of five scrapie agent-infected hamsters and mice at the terminal stages. Analyses of the down-regulation of Sho levels with the emergence of PrPSc C2 proteolytic fragments did not identify close association in all tested scrapie-infected models. To further investigate the mechanism of depletion of Sho in prion disease, a Sho-expressing plasmid with HA tag was introduced into a scrapie-infected cell line, SMB-S15, and its normal cell line, SMB-PS. Western blot assay revealed dramatically decreased Sho in SMB-S15 cells, especially its glycosylated form. Proteasome inhibitor MG132 reversed the decrease of nonglycosylated Sho, but had little effect on glycosylated Sho. N-acetylglucosamine transferase inhibitor tunicamycin efficiently reduced the glycosylations of Sho and PrPC in SMB-PS cells, while two other endoplasmic reticulum stress inducers showed clear inhibition of diglycosylated PrPC, but did not change the expression level and profile of Sho. Furthermore, immunoprecipitation of HA-Sho illustrated ubiquitination of Sho in SMB-S15 cells, but not in SMB-PS cells. We propose that the depletions of Sho in scrapie-infected cell lines due to inhibition of glycosylation mediate protein destabilization and subsequently proteasome degradation after modification by ubiquitination.

  1. Isolation of cDNAs of scrapie-modulated RNAs by subtractive hybridization of a cDNA library.

    OpenAIRE

    1988-01-01

    We have developed a subtractive cloning procedure based on the hybridization of single-stranded cDNA libraries constructed in pi H3M, a vector containing the phage M13 origin of replication. We have used this strategy to isolate three transcripts whose abundance is increased in scrapie-infected brain. DNA sequence analysis showed that they represent glial fibrillary acidic protein, metallothionein II, and the B chain of alpha-crystallin; the latter two may represent a response to stress.

  2. Lectures on Classical Integrability

    CERN Document Server

    Torrielli, Alessandro

    2016-01-01

    We review some essential aspects of classically integrable systems. The detailed outline of the lectures consists of: 1. Introduction and motivation, with historical remarks; 2. Liouville theorem and action-angle variables, with examples (harmonic oscillator, Kepler problem); 3. Algebraic tools: Lax pairs, monodromy and transfer matrices, classical r-matrices and exchange relations, non-ultralocal Poisson brackets, with examples (non-linear Schroedinger model, principal chiral field); 4. Features of classical r-matrices: Belavin-Drinfeld theorems, analyticity properties, and lift of the classical structures to quantum groups; 5. Classical inverse scattering method to solve integrable differential equations: soliton solutions, spectral properties and the Gel'fand-Levitan-Marchenko equation, with examples (KdV equation, Sine-Gordon model). Prepared for the Durham Young Researchers Integrability School, organised by the GATIS network. This is part of a collection of lecture notes.

  3. Fermions from classical statistics

    OpenAIRE

    2010-01-01

    We describe fermions in terms of a classical statistical ensemble. The states $\\tau$ of this ensemble are characterized by a sequence of values one or zero or a corresponding set of two-level observables. Every classical probability distribution can be associated to a quantum state for fermions. If the time evolution of the classical probabilities $p_\\tau$ amounts to a rotation of the wave function $q_\\tau(t)=\\pm \\sqrt{p_\\tau(t)}$, we infer the unitary time evolution of a quantum system of fe...

  4. Davidson and classical pragmatism

    Directory of Open Access Journals (Sweden)

    Paula Rossi

    2007-06-01

    Full Text Available In this paper I wish to trace some connections between Donald Davidson's work (1917-2003 and two major representatives of the classical pragmatist movement: Charles S. Peirce (1839-1914 and William James (1842-1910. I will start with a basic characterization of classical pragmatism; then, I shall examine certain conceptions in Peirce's and James' pragmatism, in order to establish affinities with Davidson´s thought. Finally, and bearing in mind the previous con-nections, I will reflect briefly on the relevance –often unrecognized- of classical pragmatist ideas in the context of contemporary philosophi-cal discussions.

  5. Advanced classical field theory

    CERN Document Server

    Giachetta, Giovanni; Sardanashvily, Gennadi

    2009-01-01

    Contemporary quantum field theory is mainly developed as quantization of classical fields. Therefore, classical field theory and its BRST extension is the necessary step towards quantum field theory. This book aims to provide a complete mathematical foundation of Lagrangian classical field theory and its BRST extension for the purpose of quantization. Based on the standard geometric formulation of theory of nonlinear differential operators, Lagrangian field theory is treated in a very general setting. Reducible degenerate Lagrangian theories of even and odd fields on an arbitrary smooth manifold are considered. The second Noether theorems generalized to these theories and formulated in the homology terms provide the strict mathematical formulation of BRST extended classical field theory

  6. Schmallenberg virus experimental infection of sheep

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Hoffmann, Bernd; Bréard, Emmanuel

    2013-01-01

    production and diarrhoea for a few days. However, the knowledge about clinical signs and pathogenesis in adult sheep is limited.In the present study, adult sheep of European domestic breeds were inoculated with SBV either as cell culture grown virus or as virus with no history of passage in cell cultures....... Various experimental set-ups were used. Sampling included blood collection at different time points during the experimental period and selected organ material at autopsy.Data from this study showed, that the RNAemic period in sheep was as short as reported for cattle; viral genome was detectable for about...... 3–5 days by real-time RT-PCR. In total, 13 out of 30 inoculated sheep became RNAemic, with the highest viral load in animals inoculated with virus from low cell culture passaged or the animal passaged material. Contact animals remained negative throughout the study. One RNAemic sheep showed...

  7. On Noncommutative Classical Mechanics

    CERN Document Server

    Djemai, A E F

    2003-01-01

    In this work, I investigate the noncommutative Poisson algebra of classical observables corresponding to a proposed general Noncommutative Quantum Mechanics, \\cite{1}. I treat some classical systems with various potentials and some Physical interpretations are given concerning the presence of noncommutativity at large scales (Celeste Mechanics) directly tied to the one present at small scales (Quantum Mechanics) and its possible relation with UV/IR mixing.

  8. Between classical and quantum

    OpenAIRE

    2007-01-01

    The relationship between classical and quantum theory is of central importance to the philosophy of physics, and any interpretation of quantum mechanics has to clarify it. Our discussion of this relationship is partly historical and conceptual, but mostly technical and mathematically rigorous, including over 500 references. On the assumption that quantum mechanics is universal and complete, we discuss three ways in which classical physics has so far been believed to emerge from quantum physic...

  9. Quantum and Classic Brackets

    OpenAIRE

    Kisil, Vladimir V.

    2000-01-01

    We describe an $p$-mechanical (see funct-an/9405002 and quant-ph/9610016) brackets which generate quantum (commutator) and classic (Poisson) brackets in corresponding representations of the Heisenberg group. We \\emph{do not} use any kind of semiclassic approximation or limiting procedures for $\\hbar \\to 0$. Harmonic oscillator considered within the approach. Keywords: Classic and quantum mechanics, Hamilton and Heisenberg equations, Poisson brackets, commutator, Heisenberg group.

  10. Impact of strong selection for the PrP major gene on genetic variability of four French sheep breeds (Open Access publication

    Directory of Open Access Journals (Sweden)

    Pantano Thais

    2008-11-01

    Full Text Available Abstract Effective selection on the PrP gene has been implemented since October 2001 in all French sheep breeds. After four years, the ARR "resistant" allele frequency increased by about 35% in young males. The aim of this study was to evaluate the impact of this strong selection on genetic variability. It is focussed on four French sheep breeds and based on the comparison of two groups of 94 animals within each breed: the first group of animals was born before the selection began, and the second, 3–4 years later. Genetic variability was assessed using genealogical and molecular data (29 microsatellite markers. The expected loss of genetic variability on the PrP gene was confirmed. Moreover, among the five markers located in the PrP region, only the three closest ones were affected. The evolution of the number of alleles, heterozygote deficiency within population, expected heterozygosity and the Reynolds distances agreed with the criteria from pedigree and pointed out that neutral genetic variability was not much affected. This trend depended on breed, i.e. on their initial states (population size, PrP frequencies and on the selection strategies for improving scrapie resistance while carrying out selection for production traits.

  11. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort...

  12. An endogenous retrovirus and exogenous scrapie in a mouse model of aging.

    Science.gov (United States)

    Carp, R I; Meeker, H C; Kozlowski, I; Sersen, E A

    2000-01-01

    As we enter the post-genomic era, there is an increasing need for accurate methods of identifying host and pathogen factors that contribute to bacterial, viral and fungal disease. In addition, there is a requirement for fast and precise techniques to evaluate potential therapies for the prevention of infectious diseases. The development of useful and cost-effective model systems will be crucial in advancing our knowledge of all aspects of microbial pathogenesis. In this series, we will learn of animal models used to investigate diseases caused by a wide variety of pathogens, including HIV, Vibrio cholerae and Pseudomonas aeruginosa. A description of a model system specifically designed to study intracellular pathogens will be presented, as will a variety of the techniques currently used to exploit other useful models of infection. Additionally, a description of the mathematical models used to analyse the population biology of human onchocerciasis will be discussed. The series begins with an intriguing look at the possible connections between an endogenous retrovirus, the infectious agent of scrapie and accelerated senescence in a mouse model of early aging.

  13. Discrete Classical Electromagnetic Fields

    CERN Document Server

    De Souza, M M

    1997-01-01

    The classical electromagnetic field of a spinless point electron is described in a formalism with extended causality by discrete finite transverse point-vector fields with discrete and localized point interactions. These fields are taken as a classical representation of photons, ``classical photons". They are all transversal photons; there are no scalar nor longitudinal photons as these are definitely eliminated by the gauge condition. The angular distribution of emitted photons coincides with the directions of maximum emission in the standard formalism. The Maxwell formalism and its standard field are retrieved by the replacement of these discrete fields by their space-time averages, and in this process scalar and longitudinal photons are necessarily created and added. Divergences and singularities are by-products of this averaging process. This formalism enlighten the meaning and the origin of the non-physical photons, the ones that violate the Lorentz condition in manifestly covariant quantization methods.

  14. Between classical and quantum

    CERN Document Server

    Landsman, N P

    2005-01-01

    The relationship between classical and quantum theory is of central importance to the philosophy of physics, and any interpretation of quantum mechanics has to clarify it. Our discussion of this relationship is partly historical and conceptual, but mostly technical and mathematically rigorous, including over 500 references. On the assumption that quantum mechanics is universal and complete, we discuss three ways in which classical physics has so far been believed to emerge from quantum physics, namely in the limit h -> 0 of small Planck's constant (in a finite system), in the limit of a large system, and through decoherence and consistent histores. The first limit is closely related to modern quantization theory and microlocal analysis, whereas the second involves methods of C*-algebras and the concepts of superselection sectors and macroscopic observables. In these limits, the classical world does not emerge as a sharply defined objective reality, but rather as an approximate appearance relative to certain "...

  15. Randomness: Quantum versus classical

    Science.gov (United States)

    Khrennikov, Andrei

    2016-05-01

    Recent tremendous development of quantum information theory has led to a number of quantum technological projects, e.g. quantum random generators. This development had stimulated a new wave of interest in quantum foundations. One of the most intriguing problems of quantum foundations is the elaboration of a consistent and commonly accepted interpretation of a quantum state. Closely related problem is the clarification of the notion of quantum randomness and its interrelation with classical randomness. In this short review, we shall discuss basics of classical theory of randomness (which by itself is very complex and characterized by diversity of approaches) and compare it with irreducible quantum randomness. We also discuss briefly “digital philosophy”, its role in physics (classical and quantum) and its coupling to the information interpretation of quantum mechanics (QM).

  16. Classical mechanics with Maxima

    CERN Document Server

    Timberlake, Todd Keene

    2016-01-01

    This book guides undergraduate students in the use of Maxima—a computer algebra system—in solving problems in classical mechanics. It functions well as a supplement to a typical classical mechanics textbook. When it comes to problems that are too difficult to solve by hand, computer algebra systems that can perform symbolic mathematical manipulations are a valuable tool. Maxima is particularly attractive in that it is open-source, multiple-platform software that students can download and install free of charge. Lessons learned and capabilities developed using Maxima are easily transferred to other, proprietary software.

  17. Covariantizing Classical Field Theories

    CERN Document Server

    López, Marco Castrillón

    2010-01-01

    We show how to enlarge the covariance group of any classical field theory in such a way that the resulting "covariantized" theory is 'essentially equivalent' to the original. In particular, our technique will render any classical field theory generally covariant, that is, the covariantized theory will be spacetime diffeomorphism-covariant and free of absolute objects. Our results thus generalize the well-known parametrization technique of Dirac and Kucha\\v{r}. Our constructions apply equally well to internal covariance groups, in which context they produce natural derivations of both the Utiyama minimal coupling and St\\"uckelberg tricks.

  18. Problems in classical mechanics

    CERN Document Server

    Katkar, L N

    2014-01-01

    Problems in classical mechanics presents a lucid treatment of the formulations of Lagrangian, Hamiltonian, and the Principles of Calculus of Variations etc. important for the study of modern physics. The study of classical mechanics prepares students to apply the principles and the mathematical tools to solve real life problems. The book also incorporates and discusses in detail topics such as Central Force Motion, Rigid Body Motion and Canonical Transformations. KEY FEATURES: Around 200 solved examples with complete mathematical theory Around 70 examples given as an exercise to test and develop students understanding The physical interpretation of the Hamiltonian is highlighted

  19. Classic Problems of Probability

    CERN Document Server

    Gorroochurn, Prakash

    2012-01-01

    "A great book, one that I will certainly add to my personal library."—Paul J. Nahin, Professor Emeritus of Electrical Engineering, University of New Hampshire Classic Problems of Probability presents a lively account of the most intriguing aspects of statistics. The book features a large collection of more than thirty classic probability problems which have been carefully selected for their interesting history, the way they have shaped the field, and their counterintuitive nature. From Cardano's 1564 Games of Chance to Jacob Bernoulli's 1713 Golden Theorem to Parrondo's 1996 Perplexin

  20. Classical Holographic Codes

    CERN Document Server

    Brehm, Enrico M

    2016-01-01

    In this work, we introduce classical holographic codes. These can be understood as concatenated probabilistic codes and can be represented as networks uniformly covering hyperbolic space. In particular, classical holographic codes can be interpreted as maps from bulk degrees of freedom to boundary degrees of freedom. Interestingly, they are shown to exhibit features similar to those expected from the AdS/CFT correspondence. Among these are a version of the Ryu-Takayanagi formula and intriguing properties regarding bulk reconstruction and boundary representations of bulk operations. We discuss the relation of our findings with expectations from AdS/CFT and, in particular, with recent results from quantum error correction.

  1. Learning Classical Music Club

    CERN Multimedia

    Learning Classical Music Club

    2010-01-01

    There is a new CERN Club called “Learning Classical Music at CERN”. We are aiming to give classical music lessons for different instruments (see link) for students from 5 to 100 years old. We are now ready to start our activities in the CERN barracks. We are now in the enrollment phase and hope to start lessons very soon ! Club info can be found in the list of CERN Club: http://user.web.cern.ch/user/Communication/SocialLifeActivities/Clubs/Clubs.html Salvatore Buontempo Club President

  2. Rumen protozoa in South African sheep with a summary of the worldwide distribution of sheep protozoa

    Directory of Open Access Journals (Sweden)

    Dirk Booyse

    2011-02-01

    Full Text Available Protozoa species were identified in rumen contents of four domestic sheep (Ovis aries from South Africa. All animals were fed a forage diet which consisted of 50% lucerne and 50% teff hay. Ten new host records were identified, bringing the total number of species and forms observed in sheep in South Africa to 30. The occurrence and geographic distribution of ciliate protozoa in both domestic and wild sheep from around the world are summarised. It was found that 15 genera and 131 species occur in domestic sheep globally.

  3. Limited transcriptional response of ovine microglia to prion accumulation

    Science.gov (United States)

    Sheep scrapie (Sc) is the classical transmissible spongiform encephalopathy (prion disease). The conversion of normal cellular prion protein (PrPC) to disease-associated prion protein (PrPSc) is the fundamental pathogenesis of prion diseases. Many of the molecular mechanisms contributing to prion ...

  4. Paratuberculosis in sheep and goats.

    Science.gov (United States)

    Windsor, P A

    2015-12-14

    Paratuberculosis is a chronic insidious, often serious, disease of the global small ruminant industries, mainly causing losses from mortalities and reduced productivity on-farm, interference in trading and, in Australia, profound socio-economic impacts that have periodically compromised harmony of rural communities. The pathogenesis, diagnosis, impacts and disease management options for ovine and caprine paratuberculosis are reviewed, comparing current controls in the extensive management system for sheep in wool flocks in Australia with the semi-intensive system of dairy flocks/herds in Greece. Improved understanding of the immune and cellular profiles of sheep with varying paratuberculosis outcomes and the recognition of the need for prolonged vaccination and biosecurity is considered of relevance to future control strategies. Paratuberculosis in goats is also of global distribution although the prevalence, economic impact and strategic control options are less well recognized, possibly due to the relatively meagre resources available for goat industry research. Although there have been some recent advances, more work is required on developing control strategies for goats, particularly in dairy situations where there is an important need for validation of improved diagnostic assays and the recognition of the potential impacts for vaccination. For all species, a research priority remains the identification of tests that can detect latent and subclinical infections to enhance removal of future sources of infectious material from flocks/herds and the food chain, plus predict the likely outcomes of animals exposed to the organism at an early age. Improving national paratuberculosis control programs should also be a priority to manage disease risk from trade. The importance of strong leadership and communication, building trust within rural communities confused by the difficulties in managing this insidious disease, reflects the importance of change management

  5. Strong Coupling and Classicalization

    CERN Document Server

    Dvali, Gia

    2016-01-01

    Classicalization is a phenomenon in which a theory prevents itself from entering into a strong-coupling regime, by redistributing the energy among many weakly-interacting soft quanta. In this way, the scattering process of some initial hard quanta splits into a large number of soft elementary processes. In short, the theory trades the strong coupling for a high-multiplicity of quanta. At very high energies, the outcome of such a scattering experiment is a production of soft states of high occupation number that are approximately classical. It is evident that black hole creation in particle collision at super-Planckian energies is a result of classicalization, but there is no a priory reason why this phenomenon must be limited to gravity. If the hierarchy problem is solved by classicalization, the LHC has a chance of detecting a tower of new resonances. The lowest-lying resonances must appear right at the strong coupling scale in form of short-lived elementary particles. The heavier members of the tower must b...

  6. Classical Mythology. Fourth Edition.

    Science.gov (United States)

    Morford, Mark P. O.; Lenardon, Robert J.

    Designed for students with little or no background in classical literature, this book introduces the Greek and Roman myths of creation, myths of the gods, Greek sagas and local legends, and presents contemporary theories about the myths. Drawing on Homer, Hesiod, Pindar, Vergil, and others, the book provides many translations and paraphrases of…

  7. Classical galactosaemia revisited

    NARCIS (Netherlands)

    A.M. Bosch

    2006-01-01

    Classical galactosaemia (McKusick 230400) is an: autosomal recessive disorder of galactose metabolism, caused by a deficiency of the enzyme galactose-1-phosphate uridyltransferase (GALT; EC 2.7.712). Most patients present in the neonatal period, after ingestion of galactose, with jaundice, hepatospl

  8. Classicism and Romanticism.

    Science.gov (United States)

    Huddleston, Gregory H.

    1993-01-01

    Describes one teacher's methods for introducing to secondary English students the concepts of Classicism and Romanticism in relation to pictures of gardens, architecture, music, and literary works. Outlines how the unit leads to a writing assignment based on collected responses over time. (HB)

  9. Mecanica Clasica (Classical Mechanics)

    OpenAIRE

    Rosu, H. C.

    1999-01-01

    First Internet graduate course on Classical Mechanics in Spanish (Castellano). This is about 80% of the material I covered during the January-June 1999 semester at IFUG in the Mexican city of Leon. English and Romanian versions are in (slow) progress and hopefully will be arXived. For a similar course on Quantum Mechanics, see physics/9808031

  10. Nuclear motion is classical

    CERN Document Server

    Frank, Irmgard

    2016-01-01

    The notion from ab-initio molecular dynamics simulations that nuclear motion is best described by classical Newton dynamics instead of the time-dependent Schr{\\"o}dinger equation is substantiated. In principle a single experiment should bring clarity. Caution is however necessary, as temperature dependent effects must be eliminated when trying to determine the existence of a zero-point energy.

  11. Mecanica Clasica (Classical Mechanics)

    CERN Document Server

    Rosu, H C

    1999-01-01

    First Internet undergraduate course on Classical Mechanics in Spanish (Castellano). This is about 80% of the material I covered during the January-June 1999 semester at IFUG in the Mexican city of Leon. English and Romanian versions are in (slow) progress and hopefully will be arXived. For a similar course on Quantum Mechanics, see physics/9808031

  12. Classical Mechanics Laboratory

    Science.gov (United States)

    Brosing, Juliet W.

    2006-12-01

    At Pacific University we have included a lab with our upper division Classical Mechanics class. We do a combination of physical labs (air resistance, harmonic motion, amusement park physics), Maple labs (software), and projects. Presentation of some of the labs, results and challenges with this course will be included.

  13. Children's Classics. Fifth Edition.

    Science.gov (United States)

    Jordan, Alice M.

    "Children's Classics," a 1947 article by Alice M. Jordan reprinted from "The Horn Book Magazine," examines the dynamics and appeal of some of the most famous books for young readers, including "Alice in Wonderland,""The Wind in the Willows,""Robinson Crusoe," and "Andersen's Fairy Tales." Paul Hein's annotated bibliography, a revision of Jordan's…

  14. Monoclonal and polyclonal antibodies for ante- and post-mortem detection of PrPSc in sheep

    Directory of Open Access Journals (Sweden)

    Michele Dietrich Moura Costa

    2015-04-01

    Full Text Available Scrapie is a disease that affects sheep and goats and is characterized by the accumulation of an abnormal isoform (PrPSc of the cellular prion protein, PrPC, in the central nervous system (CNS and in lymphoid tissues. Detection of PrPSc in these tissues can be attempted by a variety of techniques, including immunohistochemistry (IHC and western blotting (WB, for which a wide range of monoclonal and polyclonal antibodies are commercially available. The objective of this study was to test and compare the efficacy of monoclonal antibodiesF89/160.1.5, F99/97.6.1, and P4 and polyclonal antibodies M52 and R486 in the detection of PrPSc in lymphoid and CNS tissue samples by using IHC. Positive and negative control samples of sheep brain and tonsils were provided by the Animal Health and Veterinary Laboratories Agency (AHVLA, UK. The IHC examination of CNS samples with both monoclonal and polyclonal antibodies confirmed the granular deposition of PrPSc in the neurons of the positive control tissues. However, while the monoclonal antibodies did not produce positive reactions in the negative controls, the polyclonal antibodies showed some non-specific staining. The testing of positive control tonsil samples with polyclonal and monoclonal antibodies identified positive control-specific reactions, whereas the negative control tissues were IHC-negative with all antibodies, although P4 and the polyclonal antibodies produced some background staining. In summary, although the polyclonal antibodies may be more accessible, their use is not advisable because of possible false positive reactions. The polyclonal antibody M52 was able to identify PrPC in brain and spleen samples by WB but other lymphoid tissues were negative.

  15. Human Variant Creutzfeldt-Jakob disease and sheep scrapie PrP (res) detection using seeded conversion of recombinant prion protein.

    NARCIS (Netherlands)

    Orrú, C.D.; Wilham, J.M.; Hughson, A.G.; Raymond, L.D.; McNally, K.L.; Bossers, A.; Ligios, C.; Caughey, B.

    2009-01-01

    The pathological isoform of the prion protein (PrPres) can serve as a marker for prion diseases, but more practical tests are needed for preclinical diagnosis and sensitive detection of many prion infections. Previously we showed that the quaking-induced conversion (QuIC) assay can detect sub-femtog

  16. Pharmacokinetics of fenbendazole in sheep.

    Science.gov (United States)

    Marriner, S E; Bogan, J A

    1981-07-01

    Concentrations of fenbendazole and its sulfoxide, oxfendazole, and sulfone metabolites were determined in 6 sheep after oral administration of fenbendazole (10 mg/kd of body weight). Mean peak concentrations in plasma of fenbendazole, oxfendazole, and sulfone of 0.15, 0.29, and 0.17 micrograms/ml occurred 24, 30, and 36 hours after administration, respectively. Mean peak concentrations in abomasal fluid were 1.82, 0.66, and 0.07 micrograms/ml occurring at 30, 48, and 72 hours, respectively. Fenbendazole and oxfendhzole were detectable in plasma and abomasal fluids for 5 days after administration. Much of the anthelmintic activity of fenbendazole may be due to the oxfendazole metabolite. Plasma concentrations of fenbendazole were less and persisted for a shorter period after intra-abomasal administration than after oral administration.

  17. Maternal transmission studies of BSE in sheep.

    Science.gov (United States)

    Foster, J D; Goldmann, W; McKenzie, C; Smith, A; Parnham, D W; Hunter, N

    2004-10-01

    If BSE (bovine spongiform encephalopathy) infected the UK sheep population concurrently with cattle, it would only now be maintained by transmission between sheep by routes which could include from mother to lamb either in utero or via perinatal close contact. In this study of experimental BSE, Cheviot ewes challenged orally with BSE cattle brain produced lambs of various PrP genotypes over the next 7 years. Of 72 surviving to >30 months of age, 29 are of the most susceptible PrP genotype (AQ/AQ) and born to mothers that were challenged with BSE. None of the progeny have shown any signs of disease. The results suggest that in these sheep, BSE could only transmit by the maternal route at a frequency of less than one in four (95 % confidence limit) from clinically affected ewes, a rate which if replicated in other breeds may not be sufficient to maintain BSE within the sheep population.

  18. Technological suitability of sheep milk for processing

    Directory of Open Access Journals (Sweden)

    Romualda Danków

    2011-06-01

    Full Text Available Annual world sheep milk production is estimated at the level of 8.2 million tons and constitutes 1.5% of the total milk production obtained from various species of mammals. Majority of this milk is used to manufacture cheeses and fermented beverages. These products are commonly considered as regional articles and are protected by legal regulations which guarantee their taste and aroma typical for a given region and which they owe to traditional production technologies. In Poland, sheep are reared, primarily, in mountainous areas (Podhale, Bieszczady but also in Wielkopolska and Podlasie. The sheep population in Poland is estimated at 223 000 animals but milk is obtained only from a small number of animals and its annual production is assessed at the level of 1000 t. The nutritional value of sheep milk is higher in comparison with goat or cow milk. Sheep milk protein is characterised by a high biological value comparable with the biological value of the whole chicken egg. In addition, products manufactured from sheep milk possess high nutritive value. Due to its rich chemical composition, sheep milk provides an excellent raw material for processing into maturing soft and hard cheeses (75-80% of protein is casein, for fermented beverages, both natural and with different tastes, as well as butter, ghee and ice-cream. High proportion of dry matter (up to 18% found in sheep milk does not require application of any thickeners in production of fermented beverages. That is why these beverages are fully natural and free of additives.

  19. Technological suitability of sheep milk for processing

    OpenAIRE

    Romualda Danków; Jan Pikul

    2011-01-01

    Annual world sheep milk production is estimated at the level of 8.2 million tons and constitutes 1.5% of the total milk production obtained from various species of mammals. Majority of this milk is used to manufacture cheeses and fermented beverages. These products are commonly considered as regional articles and are protected by legal regulations which guarantee their taste and aroma typical for a given region and which they owe to traditional production technologies. In Poland, sheep are re...

  20. Sudanese live sheep and mutton exports competitiveness

    Directory of Open Access Journals (Sweden)

    Babiker Idris Babiker

    2011-01-01

    Full Text Available The livestock sector of Sudan provides livelihood for about 17% of the population. Sudanese livestock products meet the domestic demand for meat in addition to a substantial excess for export amounting to about 22% of total country exports. It contributes about 19% of GDP. Sheep marketing in Sudan is characterised by traditional operations and is informally organised, although, recently there are great efforts by the formal livestock authorities to organise some secondary and terminal livestock markets. These markets are deficient in basic infrastructures and systematic marketing research. The system as a whole is faced by various complex obstacles and constraints, which decrease the contribution of livestock in general, and sheep in particular, to the national economy, and suppress the optimum exploitation of this resource. These obstacles are represented in the lack of transportation networks that connect the production and consumption centres to break the seasonality of supply that creates shortages and high prices at the consumption centres. This paper employs the policy analysis matrix (PAM technique to examine the Sudanese live sheep and mutton competitiveness in the international market. The results indicated that the market price was greater than the border price implying a positive incentive as an implicit subsidy to the live sheep exporter. The mutton exporters were found subsidised as well. The international value added (IVA indicted a positive foreign exchange earnings or savings. Exported live sheep and mutton coefficient of competitiveness (CIC implied that sheep and mutton exports are profitable and internationally competitive.

  1. Determination of sex and scrapie resistance genotype in preimplantation ovine embryos.

    Science.gov (United States)

    Guignot, Florence; Baril, Gerard; Dupont, Francis; Cognie, Yves; Folch, Jose; Alabart, Jose Luis; Poulin, Naty; Beckers, Jean-Francois; Bed'hom, Bertrand; Babilliot, Jean-Marc; Mermillod, Pascal

    2009-02-01

    The aim of this study was to test the accuracy of genotype diagnosis after pre-amplification of DNA extracted from biopsies obtained by microblade cutting of ovine embryos and to evaluate the viability of biopsied embryos after vitrification/warming and transfer to recipients. Sex and PrP genotypes were determined. Sex diagnosis was done by PCR amplification of ZFX/ZFY and SRY sequences after PEP-PCR while PrP genotype determination was performed after specific pre-amplification of specific target including codons 136, 154 and 171. Embryos were collected at Day 7 after oestrus. Blastocysts and expanded blastocysts were biopsied immediately after collection whereas compacted morulae were biopsied after 24 hr of in vitro culture. Eighty-nine biopsied embryos were frozen by vitrification. Fresh and vitrified whole embryos were kept as control. DNA of biopsies was extracted and pre-amplified. Sex diagnosis was efficient for 96.6% of biopsies and PrP genotyping was determined in 95.8% of codons. After embryo transfer, no significant difference was observed in lambing rate between biopsied, vitrified control and fresh embryos (54.5%, 60% and 66.6%, respectively). Embryo survival rate was not different between biopsied and whole vitrified embryos (P = 0.38). At birth, 96.7% of diagnosed sex and 95.4% of predetermined codons were correct. Lamb PrP profiles were in agreement with parental genotype. PEP-PCR coupled with sex diagnosis and nested PCR coupled with PrP genotype predetermination are very accurate techniques to genotype ovine embryo before transfer. These original results allow planning of selection of resistant genotype to scrapie and sex of offspring before transfer of cryopreserved embryo.

  2. A robust, low- to medium-throughput prnp genotyping system in sheep

    Directory of Open Access Journals (Sweden)

    Semmer Jördis

    2004-09-01

    Full Text Available Abstract Background In many countries breeding programs for resistance to scrapie in sheep are established. Therefore, the demand on genotyping capacities of the polymorphisms of the prion protein gene (prnp relevant to presently known disease associations and EU regulations is steadily increasing. Most published typing methods are not well suited for routine typing of large sample numbers in smaller service laboratories for different reasons: they require partly manual data processing, sophisticated and sensitive protocols, high efforts regarding time and manpower, multiple step reactions or substantial hardware investments. To overcome these drawbacks, we developed a prnp typing method that is based on a `multiplex amplification refractory mutation system' (ARMS reaction. Methods In this study we combined the amplification refractory mutation system (ARMS with standard fluorescent based fragment length analyses method to develop a prnp genotyping method (PRNP ARMS. Results By optimised primer design it was possible to type the 4 relevant single nucleotide polymorphisms (SNPs in the prnp simultaneously in one multiplex reaction. Automated fragment length analysis enabled automated allele designation. Suitability of the PRNP ARMS for routine application was proven by typing samples with known genotypes and larger sample numbers from half-sib families. Conclusion The ARMS PRNP typing method established in this study is universally suited for a broad range of typing projects with different requirements. It provides an efficient and inexpensive diagnostic mutation analysis that will improve the quality of prnp genotyping compared with other low-cost methods. It can be implemented by most molecular genetic laboratories using standard equipment.

  3. Classical Weyl Transverse Gravity

    CERN Document Server

    Oda, Ichiro

    2016-01-01

    We study various classical aspects of the Weyl transverse (WTDiff) gravity in a general space-time dimension. First of all, we clarify a classical equivalence among three kinds of gravitational theories, those are, the conformally-invariant scalar tensor gravity, Einstein's general relativity and the WTDiff gravity via the gauge fixing procedure. Secondly, we show that in the WTDiff gravity the cosmological constant is a mere integration constant as in unimodular gravity, but it does not receive any radiative corrections unlike the unimodular gravity. A key point in this proof is to construct a covariantly conserved energy-momentum tensor, which is achieved on the basis of this equivalence relation. Thirdly, we demonstrate that the Noether current for the Weyl transformation is identically vanishing, thereby implying that the Weyl symmetry existing in both the conformally-invariant scalar tensor gravity and the WTDiff gravity is a "fake" symmetry. We find it possible to extend this proof to all matter fields,...

  4. Classical Diophantine equations

    CERN Document Server

    1993-01-01

    The author had initiated a revision and translation of "Classical Diophantine Equations" prior to his death. Given the rapid advances in transcendence theory and diophantine approximation over recent years, one might fear that the present work, originally published in Russian in 1982, is mostly superseded. That is not so. A certain amount of updating had been prepared by the author himself before his untimely death. Some further revision was prepared by close colleagues. The first seven chapters provide a detailed, virtually exhaustive, discussion of the theory of lower bounds for linear forms in the logarithms of algebraic numbers and its applications to obtaining upper bounds for solutions to the eponymous classical diophantine equations. The detail may seem stark--- the author fears that the reader may react much as does the tourist on first seeing the centre Pompidou; notwithstanding that, Sprind zuk maintainsa pleasant and chatty approach, full of wise and interesting remarks. His emphases well warrant, ...

  5. Electrodynamics classical inconsistencies

    CERN Document Server

    De Souza, M M

    1995-01-01

    The problems of Classical Electrodynamics with the electron equation of motion and with non-integrable singularity of its self-field stress tensor are well known. They are consequences, we show, of neglecting terms that are null off the charge world line but that gives a non null contribution on its world line. The self-field stress tensor of a point classical electron is integrable, there is no causality violation and no conflict with energy conservation in its equation of motion, and there is no need of any kind of renormalization nor of any change in the Maxwell's theory for this. (This is part of the paper hep-th/9510160, stripped , for simplicity, of its non-Minkowskian geometrization of causality and of its discussion about the physical meaning of the Maxwell-Faraday concept of field).

  6. Injuries in classical ballet

    Directory of Open Access Journals (Sweden)

    Adriana Coutinho de Azevedo Guimarães

    2008-06-01

    Full Text Available This study aimed to elucidate what injuries are most likely to occur due to classical ballet practice. The research used national and international bibliography. The bibliography analysis indicated that technical and esthetical demands lead to a practice of non-anatomical movements, causing the ballet dancer to suffer from a number of associated lesions. Most of the injuries are caused by technical mistakes and wrong training. Troubles in children are usually due to trying to force external rotation at hip level and to undue use of point ballet slippers. The commonest lesions are in feet and ankles, followed by knees and hips. The rarest ones are in the upper limbs. These injuries are caused by exercise excess, by repetitions always in the same side and by wrong and early use of point slippers. The study reached the conclusion that incorrect application of classical ballet technique predisposes the dancers to characteristic injuries.

  7. Classical and statistical thermodynamics

    CERN Document Server

    Rizk, Hanna A

    2016-01-01

    This is a text book of thermodynamics for the student who seeks thorough training in science or engineering. Systematic and thorough treatment of the fundamental principles rather than presenting the large mass of facts has been stressed. The book includes some of the historical and humanistic background of thermodynamics, but without affecting the continuity of the analytical treatment. For a clearer and more profound understanding of thermodynamics this book is highly recommended. In this respect, the author believes that a sound grounding in classical thermodynamics is an essential prerequisite for the understanding of statistical thermodynamics. Such a book comprising the two wide branches of thermodynamics is in fact unprecedented. Being a written work dealing systematically with the two main branches of thermodynamics, namely classical thermodynamics and statistical thermodynamics, together with some important indexes under only one cover, this treatise is so eminently useful.

  8. Randomness: quantum versus classical

    CERN Document Server

    Khrennikov, Andrei

    2015-01-01

    Recent tremendous development of quantum information theory led to a number of quantum technological projects, e.g., quantum random generators. This development stimulates a new wave of interest in quantum foundations. One of the most intriguing problems of quantum foundations is elaboration of a consistent and commonly accepted interpretation of quantum state. Closely related problem is clarification of the notion of quantum randomness and its interrelation with classical randomness. In this short review we shall discuss basics of classical theory of randomness (which by itself is very complex and characterized by diversity of approaches) and compare it with irreducible quantum randomness. The second part of this review is devoted to the information interpretation of quantum mechanics (QM) in the spirit of Zeilinger and Brukner (and QBism of Fuchs et al.) and physics in general (e.g., Wheeler's "it from bit") as well as digital philosophy of Chaitin (with historical coupling to ideas of Leibnitz). Finally, w...

  9. Computation in Classical Mechanics

    CERN Document Server

    Timberlake, Todd

    2007-01-01

    There is a growing consensus that physics majors need to learn computational skills, but many departments are still devoid of computation in their physics curriculum. Some departments may lack the resources or commitment to create a dedicated course or program in computational physics. One way around this difficulty is to include computation in a standard upper-level physics course. An intermediate classical mechanics course is particularly well suited for including computation. We discuss the ways we have used computation in our classical mechanics courses, focusing on how computational work can improve students' understanding of physics as well as their computational skills. We present examples of computational problems that serve these two purposes. In addition, we provide information about resources for instructors who would like to include computation in their courses.

  10. Lectures on classical electrodynamics

    CERN Document Server

    Englert, Berthold-Georg

    2014-01-01

    These lecture notes cover classical electrodynamics at the level of advanced undergraduates or postgraduates. There is a strong emphasis on the general features of the electromagnetic field and, in particular, on the properties of electromagnetic radiation. It offers a comprehensive and detailed, as well as self-contained, account of material that can be covered in a one-semester course for students with a solid undergraduate knowledge of basic electricity and magnetism.

  11. Concepts of classical optics

    CERN Document Server

    Strong, John

    2004-01-01

    An intermediate course in optics, this volume explores both experimental and theoretical concepts, offering practical knowledge of geometrical optics that will enhance students' comprehension of any relevant applied science. Its exposition of the concepts of classical optics is presented with a minimum of mathematical detail but presumes some knowledge of calculus, vectors, and complex numbers.Subjects include light as wave motion; superposition of wave motions; electromagnetic waves; interaction of light and matter; velocities and scattering of light; polarized light and dielectric boundarie

  12. Revisiting a Classic

    Science.gov (United States)

    Rogers, Ibram

    2008-01-01

    As a 26-year-old English teacher in 1958, Chinua Achebe had no idea that the book he was writing would become a literary classic, not only in Africa but also throughout the world. He could only try to articulate the feelings he had for his countrymen and women. Achebe had a burning desire to tell the true story of Africa and African humanity. The…

  13. Determinants of sheep prices in the highlands of northeastern Ethiopia: implication for sheep value chain development.

    Science.gov (United States)

    Kassa, Beneberu Teferra; Haile, Anteneh Girma; Essa, John Abdu

    2011-12-01

    In order to assess and identify the determinants of sheep price and price variation across time, a time series data were collected from four selected markets in North Shewa, Northeastern Ethiopia on weekly market day basis for a period of 2 years. Data on animal characteristics and purpose of buying were collected on a weekly basis from randomly selected 15-25 animals, and a total of 7,976 transactions were recorded. A general linear model technique was used to identify factors influencing sheep price, and the results showed that sheep price (liveweight sheep price per kilogram taken as a dependent variable) is affected by animal characteristics such as weight, sex, age, condition, season, and color. Most of the markets' purpose for which the animal was purchased did not affect significantly the price per kilogram. This may be due to the similarity of the markets in terms of buyer's purpose. The results suggest that there will be benefit from coordinated fattening, breeding, and marketing programs to take the highest advantage from the preferred animals' characteristics and selected festival markets. Finally, the study recommends for a coordinated action to enhance the benefit generated for all participant actors in the sheep value chain through raising sheep productivity, improving the capacity of sheep producers and agribusiness entrepreneurs to access and use latest knowledge and technologies; and strengthening linkages among actors in the sheep value chain.

  14. Translational neurophysiology in sheep: measuring sleep and neurological dysfunction in CLN5 Batten disease affected sheep.

    Science.gov (United States)

    Perentos, Nicholas; Martins, Amadeu Q; Watson, Thomas C; Bartsch, Ullrich; Mitchell, Nadia L; Palmer, David N; Jones, Matthew W; Morton, A Jennifer

    2015-04-01

    Creating valid mouse models of slowly progressing human neurological diseases is challenging, not least because the short lifespan of rodents confounds realistic modelling of disease time course. With their large brains and long lives, sheep offer significant advantages for translational studies of human disease. Here we used normal and CLN5 Batten disease affected sheep to demonstrate the use of the species for studying neurological function in a model of human disease. We show that electroencephalography can be used in sheep, and that longitudinal recordings spanning many months are possible. This is the first time such an electroencephalography study has been performed in sheep. We characterized sleep in sheep, quantifying characteristic vigilance states and neurophysiological hallmarks such as sleep spindles. Mild sleep abnormalities and abnormal epileptiform waveforms were found in the electroencephalographies of Batten disease affected sheep. These abnormalities resemble the epileptiform activity seen in children with Batten disease and demonstrate the translational relevance of both the technique and the model. Given that both spontaneous and engineered sheep models of human neurodegenerative diseases already exist, sheep constitute a powerful species in which longitudinal in vivo studies can be conducted. This will advance our understanding of normal brain function and improve our capacity for translational research into neurological disorders.

  15. A low morbidity surgical approach to the sheep femoral trochlea

    Directory of Open Access Journals (Sweden)

    Orth Patrick

    2013-01-01

    Full Text Available Abstract Background The ovine stifle joint is an important location for investigations on the repair of articular cartilage defects in preclinical large animals. The classical medial parapatellar approach to the femoral trochlea is hazardous because of the high risk of postoperative patellar luxation. Here, we describe a low morbidity surgical exposure of the ovine trochlea without the necessity for intraoperative patellar luxation. Methods Bilateral surgical exposure of the femoral trochlea of the sheep stifle joint was performed using the classical medial parapatellar approach with intraoperative lateral patellar luxation and transection of the medial patellar retinaculum in 28 ovine stifle joints. A low morbidity approach was performed bilaterally in 116 joints through a mini-arthrotomy without the need to transect the medial patellar retinaculum or the oblique medial vastus muscle nor surgical patellar luxation. Postoperatively, all 72 animals were monitored to exclude patellar luxations and deep wound infections. Results The novel approach could be performed easily in all joints and safely exposed the distal two-thirds of the medial and lateral trochlear facet. No postoperative patellar luxations were observed compared to a postoperative patellar luxation rate of 25% experienced with the classical medial parapatellar approach and a re-luxation rate of 80% following revision surgery. No signs of lameness, wound infections, or empyema were observed for both approaches. Conclusions The mini-arthrotomy presented here yields good exposure of the distal ovine femoral trochlea with a lower postoperative morbidity than the classical medial parapatellar approach. It is therefore suitable to create articular cartilage defects on the femoral trochlea without the risk of postoperative patellar luxation.

  16. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine and cervid prion protein

    Science.gov (United States)

    Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...

  17. Co-existence of scrapie prion protein types 1 and 2 in sporadic Creutzfeldt-Jakob disease: its effect on the phenotype and prion-type characteristics

    NARCIS (Netherlands)

    Cali, I.; Castellani, R.; Alshekhlee, A.; Cohen, Y.; Blevins, J.; Yuan, J.; Langeveld, J.P.M.; Parchi, P.; Safar, J.G.; Zou, W.Q.; Gambetti, P.

    2009-01-01

    Five phenotypically distinct subtypes have been identified in sporadic Creutzfeldt-Jakob disease (sCJD), based on the methionine/valine polymorphic genotype of codon 129 of the prion protein (PrP) gene and the presence of either one of the two protease K-resistant scrapie prion protein (PrPSc) types

  18. Experimental transmission of transmissible spongiform encephalopathies (scrapie, chronic wasting disease, transmissible mink encephalopathy) to cattle and their differentiation from bovine spongiform encephalopathy

    Science.gov (United States)

    Experimental cross-species transmission of TSE agents provides valuable information for identification of potential host ranges of known TSEs. This report provides a synopsis of TSE (scrapie, CWD, TME) transmission studies that have been conducted in cattle and compares these findings to those seen ...

  19. IMPY, a potential {beta}-amyloid imaging probe for detection of prion deposits in scrapie-infected mice

    Energy Technology Data Exchange (ETDEWEB)

    Song, P.-J. [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Bernard, Serge [IFR135, F-37000 Tours (France); INRA, UR1282, IASP, 37380 Nouzilly (France)], E-mail: bernard@tours.inra.fr; Sarradin, Pierre [INRA, UR1282, IASP, 37380 Nouzilly (France); Vergote, Jackie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Barc, Celine [INRA, UR1282, IASP, 37380 Nouzilly (France); Chalon, Sylvie [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France); Kung, M.-P.; Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Guilloteau, Denis [INSERM, U619, F-37000 Tours (France); Universite Francois-Rabelais, F-37000 Tours (France); IFR135, F-37000 Tours (France)

    2008-02-15

    Introduction: A potential single-photon emission computed tomography imaging agent for labeling of A{beta} plaques of Alzheimer's disease, IMPY (2-(4'-dimethylaminophenyl)-6-iodo-imidazo[1,2-a]pyridine), would be effective in detection of prion amyloid deposits in transmissible spongiform encephalopathies (TSEs). Methods: In vitro autoradiographic studies were carried out with [{sup 125}I]IMPY on brain sections from scrapie-infected mice and age-matched controls. Competition study was performed to evaluate the prion deposit binding specificity with nonradioactive IMPY. Results: Binding of [{sup 125}I]IMPY was observed in infected brain sections, while on age-matched control brain sections, there was no or very low labeling. Prion deposit binding was confirmed by histoblots with prion protein-specific monoclonal antibody 2D6. In the presence of nonradioactive IMPY, the binding of [{sup 125}I]IMPY was significantly inhibited in all regions studied. Conclusions: These findings indicate that IMPY can detect the prion deposits in vitro in scrapie-infected mice. Labeled with {sup 123}I, this ligand may be useful to quantitate prion deposit burdens in TSEs by in vivo imaging.

  20. Establishment of a Stable PrPSc Panel from Brain Tissues of Experimental Hamsters with Scrapie Strain 263K

    Institute of Scientific and Technical Information of China (English)

    BAO-YUN ZHANG; CHAN TIAN; JUN HAN; CHEN GAO; QI SHI; JIAN-MING CHEN; HUI-YING JIANG; WEI ZHOU; XIAO-Ping DONG

    2009-01-01

    Objective To establish a stable PrPSc panel from brain tissues of experimental hamsters infected with scrapie agent 263K for evaluating diagnostic techniques of human and animals' prion diseases. Methods Thirty brain tissue samples from hamsters intracerebrally infected with scrapie strain 263K and another 30 samples from normal hamsters were selected to prepare 10%, 1%, and 0.5% brain homogenates, which were aliquoted into stocks. PrPSc in each brain homogenate was determined by proteinase K digestions followed by Western blot assay and partially by immunohistochemistry. Stability and glycoforms of PrPSc were repeatedly detected by PrPSc-specific Western blots in half a year and 3 years later. Results PrPSc signals were observed in all 10% brain homogenates of infected hamsters. Twenty out of 30 stocks and 19 out of 30 stocks were PrPSc positive in 1% and 0.5% brain homogenatesof infected hamsters, respectively. Twenty-seven out of 30 stocks presented three positive bands in 10% brain homogenates, whereas none of 1% and 0.5% homogenates contained 3 bands. The detection of PrPSc-specific signals stored in half a year and 3 years later demonstrated that the ratio of PrPSc positive samples and glycoforms was almost unchanged. All normal hamsters' brain homogenates were PrPSc negative. Conclusion A PrPSc panel of prion disease can be established, which displays reliably stable PrPSc-specific signals and glycoforms.

  1. Breeding objectives for Targhee sheep.

    Science.gov (United States)

    Borg, R C; Notter, D R; Kuehn, L A; Kott, R W

    2007-11-01

    Breeding objectives were developed for Targhee sheep under rangeland production conditions. Traits considered were those for which EPD were available from the US National Sheep Improvement Program and included direct and maternal effects on 120-d weaning weight (WW and MM, respectively); yearling weight (YW); yearling fleece weight, fiber diameter, and staple length; and percent lamb crop (PLC), measured as the number of lambs born per 100 ewes lambing. A bioeconomic model was used to predict the effects of a change of 1 additive SD in EPD for each trait, holding all other traits constant at their mean, on animal performance, feed requirements, feed costs, and economic returns. Resulting economic weightings were then used to derive selection indexes. Indexes were derived separately for 3 prolificacy levels (1.41, 1.55, and 1.70 lambs/ewe lambing), 2 triplet survival levels (50 and 67%), 2 lamb pricing policies (with or without discounting of prices for heavy feeder lambs), and 3 forage cost scenarios (renting pasture, purchasing hay, or reducing flock size to accommodate increased nutrient requirements for production). Increasing PLC generally had the largest impact on profitability, although an increase in WW was equally important, with low feed costs and no discounting of prices for heavy feeder lambs. Increases in PLC were recommended at all 3 prolificacy levels, but with low triplet survival the value of increasing PLC eventually declined as the mean litter size increased to approximately 2.15 lambs/ewe lambing and above. Increasing YW (independent of WW) increased ewe maintenance costs and reduced profitability. Predicted changes in breeding values for WW and YW under index selection varied with lamb pricing policy and feed costs. With low feed costs or no discounts for heavy lambs, YW increased at a modest rate in association with increasing WW, but with high feed costs or discounting of heavy lambs, genetic trends in WW were reduced by approximately 50% to

  2. Classical Trace Anomaly

    OpenAIRE

    Farhoudi, M.

    1995-01-01

    We seek an analogy of the mathematical form of the alternative form of Einstein's field equations for Lovelock's field equations. We find that the price for this analogy is to accept the existence of the trace anomaly of the energy-momentum tensor even in classical treatments. As an example, we take this analogy to any generic second order Lagrangian and exactly derive the trace anomaly relation suggested by Duff. This indicates that an intrinsic reason for the existence of such a relation sh...

  3. The classical task

    DEFF Research Database (Denmark)

    Gillis, Steven; Souman, Agnita; Dhollander, Sim

    -year-olds to 9-year-olds. The experiment was also administered with a control group of adults. Procedure: The procedure consists of a classical set-up in which the subjects are shown pictures of objects. On presenting each object, the test leader says: "Here is a X (name of the object)". The next...... articulated: Prediction 1: a global analysis of the plural forms provided by the subjects is expected to show an increase of the correct responses as children grow older. Prediction 2: As to suffix selection, we expect that the plural of nouns selecting a fully predictable suffix will be more readily mastered...

  4. A Classic Through Eternity

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    FIVE years ago, an ancient Chinese air was beamed to outer space as a PR exercise. To humankind, music is a universal language, so the tune seemed an ideal medium for communication with extraterrestrial intelligence. So far there has been no response, but it is believed that the tune will play for a billion years, and eventually be heard and understood. The melody is called High Mountain and Flowing Stream, and it is played on the guqin, a seven-stringed classical musical instrument similar to the zither.

  5. On Classical Ideal Gases

    Directory of Open Access Journals (Sweden)

    Laurent Chusseau

    2013-02-01

    Full Text Available We show that the thermodynamics of ideal gases may be derived solely from the Democritean concept of corpuscles moving in vacuum plus a principle of simplicity, namely that these laws are independent of the laws of motion, aside from the law of energy conservation. Only a single corpuscle in contact with a heat bath submitted to a z and t-invariant force is considered. Most of the end results are known but the method appears to be novel. The mathematics being elementary, the present paper should facilitate the understanding of the ideal gas law and of classical thermodynamics even though not-usually-taught concepts are being introduced.

  6. Semi-classical Electrodynamics

    Science.gov (United States)

    Lestone, John

    2016-03-01

    Quantum electrodynamics is complex and its associated mathematics can appear overwhelming for those not trained in this field. We describe semi-classical approaches that can be used to obtain a more intuitive physical feel for several QED processes including electro-statics, Compton scattering, pair annihilation, the anomalous magnetic moment, and the Lamb shift, that could be taught easily to undergraduate students. Any physicist who brings their laptop to the talk will be able to build spread sheets in less than 10 minutes to calculate g/2 =1.001160 and a Lamb shift of 1057 MHz.

  7. Classical cytogenetics: karyotyping techniques.

    Science.gov (United States)

    Bates, Steven E

    2011-01-01

    Classical cytogenetics by karyotyping has been utilized in clinical research laboratories for more than 50 years and remains the key method used in the stem cell laboratory to assess the genetic stability of stem cell cultures. It is currently the most readily accessible method for detecting chromosomal abnormalities in pluripotent stem cell cultures. This chapter will describe (1) how to prepare a culture to maximize the number of metaphase cells, (2) how to prepare slides containing chromosome spreads (3) methods used to stain chromosomes, and (4) how to interpret the cytogenetic report.

  8. Mechanics classical and quantum

    CERN Document Server

    Taylor, T T

    2015-01-01

    Mechanics: Classical and Quantum explains the principles of quantum mechanics via the medium of analytical mechanics. The book describes Schrodinger's formulation, the Hamilton-Jacobi equation, and the Lagrangian formulation. The author discusses the Harmonic Oscillator, the generalized coordinates, velocities, as well as the application of the Lagrangian formulation to systems that are partially or entirely electromagnetic in character under certain conditions. The book examines waves on a string under tension, the isothermal cavity radiation, and the Rayleigh-Jeans result pertaining to the e

  9. A genome scan to detect QTL affecting dairy traits in a dairy sheep backcross Sarda x Lacaune population

    Directory of Open Access Journals (Sweden)

    L. Mura

    2011-03-01

    Full Text Available Recently in Mediterranean countries as France, Italy and Spain, dairy sheep selection has been efficiently oriented towards milk yield and milk composition. More attention has been now paid to traits related to the reduction of production costs (milkability, functional traits, longevity, health (resistance to mastitis or parasitic diseases, safety of food (reduction in contaminants and quality (milk fatty acids composition. Therefore, research combining classical quantitative approach and QTL detection is needed, either on-farm by implementing experimental recording schemes......

  10. Sheep and Goats: Final Estimates 1989-93

    OpenAIRE

    1995-01-01

    This publication presents final sheep and goat inventory estimates for the period 1989-1993 and wool and mohair estimates for the period 1988-1992. made by the Agricultural Statistics Board including some revisions and continues the official series published in Statistical Bulletin No. 800 "Sheep and Goats: Final Estimates 1984-88" issued January 1990. This series includes annual estimates for sheep and goat inventory, sheep and lambs on feed for January 1. 1993, lamb crop. wool and mohair pr...

  11. Probability representation of classical states

    NARCIS (Netherlands)

    Man'ko, OV; Man'ko, [No Value; Pilyavets, OV

    2005-01-01

    Probability representation of classical states described by symplectic tomograms is discussed. Tomographic symbols of classical observables which are functions on phase-space are studied. Explicit form of kernel of commutative star-product of the tomographic symbols is obtained.

  12. Proteomic evaluation of sheep serum proteins

    Directory of Open Access Journals (Sweden)

    Chiaradia Elisabetta

    2012-05-01

    Full Text Available Abstract Background The applications of proteomic strategies to ovine medicine remain limited. The definition of serum proteome may be a good tool to identify useful protein biomarkers for recognising sub-clinical conditions and overt disease in sheep. Findings from bovine species are often directly translated for use in ovine medicine. In order to characterize normal protein patterns and improve knowledge of molecular species-specific characteristics, we generated a two-dimensional reference map of sheep serum. The possible application of this approach was tested by analysing serum protein patterns in ewes with mild broncho-pulmonary disease, which is very common in sheep and in the peripartum period which is a stressful time, with a high incidence of infectious and parasitic diseases. Results This study generated the first reference 2-DE maps of sheep serum. Overall, 250 protein spots were analyzed, and 138 identified. Compared with healthy sheep, serum protein profiles of animals with rhino-tracheo-bronchitis showed a significant decrease in protein spots identified as transthyretin, apolipoprotein A1 and a significant increase in spots identified as haptoglobin, endopin 1b and alpha1B glycoprotein. In the peripartum period, haptoglobin, alpha-1-acid glycoprotein, apolipoprotein A1 levels rose, while transthyretin content dropped. Conclusions This study describes applications of proteomics in putative biomarker discovery for early diagnosis as well as for monitoring the physiological and metabolic situations critical for ovine welfare.

  13. Medetomidine-midazolam sedation in sheep.

    Science.gov (United States)

    Raekallio, M; Tulamo, R M; Valtamo, T

    1998-01-01

    Seven sheep were sedated 3 times: with medetomidine (15 micrograms kg-1), with midazolam (0.1 mg kg-1) and with a combination of the drugs. All drugs were administered intravenously. Heart and respiratory rates were measured. Arterial blood samples were collected, and PaO2, PaCO2, pH, haemoglobin concentration and saturation, and base excess were determined. Systolic and mean arterial pressures were recorded before and after the treatment with medetomidine-midazolam. Midazolam increased the time of recumbency induced by medetomidine. After administration of midazolam alone, 4 of the 7 sheep were sedated and the other 3 were excited. Heart rate decreased after both medetomidine and medetomidine-midazolam. One sheep suffered a cardiac arrest after medetomidine-midazolam injection, and it required resuscitation. PaO2 and haemoglobin oxygen saturation decreased after medetomidine, and medetomidine-midazolam caused a marked hypoxaemia. PaCO2 increased after medetomidine, both alone and combined with midazolam, but arterial pH was within the reference values after all drug administrations. Systolic and mean arterial pressures decreased after medetomidine-midazolam. This study indicates that though in sheep midazolam potentiates the sedative effect of medetomidine, the combination of medetomidine and midazolam also reduces the in PaO2 and haemoglobin oxygen saturation more than medetomidine alone. The results indicate that a medetomidine-midazolam combination is unsafe for sheep at the doses studied.

  14. Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae.

    Science.gov (United States)

    Besser, Thomas E; Cassirer, E Frances; Yamada, Catherine; Potter, Kathleen A; Herndon, Caroline; Foreyt, William J; Knowles, Donald P; Srikumaran, Subramaniam

    2012-01-01

    To test the hypothesis that Mycoplasma ovipneumoniae is an important agent of the bighorn sheep (Ovis canadensis) pneumonia that has previously inevitably followed experimental commingling with domestic sheep (Ovis aries), we commingled M. ovipneumoniae-free domestic and bighorn sheep (n=4 each). One bighorn sheep died with acute pneumonia 90 days after commingling, but the other three remained healthy for >100 days. This unprecedented survival rate is significantly different (P=0.002) from that of previous bighorn-domestic sheep contact studies but similar to (P>0.05) bighorn sheep survival following commingling with other ungulates. The absence of epizootic respiratory disease in this experiment supports the hypothesized role of M. ovipneumoniae as a key pathogen of epizootic pneumonia in bighorn sheep commingled with domestic sheep.

  15. Milk yield and quality of Cres sheep and their crosses with Awassi and East Friesian sheep

    Directory of Open Access Journals (Sweden)

    Boro Mioč

    2009-09-01

    Full Text Available The objective of this study was to establish the impact of crossing the indigenous Cres sheep with Awassi and, respectively, Awassi and East Friesian sheep on the milk yield and quality. For this purpose, through regular monthly milk yield recordings a total of 824individual milk samples from 139 sheep in the second lactation of the same flock were collected, of which: 46 purebred Cres sheep, CS; 33 crosses with 50 % Cres sheep and 50 % Awassi, CA; 60 crosses with 50 % Cres sheep, 25 % Awassi and 25 % East Friesian, CAEF. The obtained results show a significant (P<0.05; P<0.01 impact of the genotype and the lactation stage on the yield and chemical composition of milk, and the somatic cell count. The most milk was yielded by CAEF crosses (690 mL/ewe/day, i.e., 133.8 L per lactation and the least by CS (340 mL/ewe/day, i.e., 58.48 L per lactation. The content of total solids, fat and protein increased as lactation advanced, whereas the trend of the lactose content was opposite. The highest content of total solids, fat and protein were established in the milk of the indigenous Cres sheep. A positive correlation was established between the amount of yielded milk and the somatic cell count, whereas a negative correlation was established between the amount of milk and the content of solids, fat and proteins.

  16. Bartonella melophagi in Melophagus ovinus (sheep ked) collected from sheep in northern Oromia, Ethiopia.

    Science.gov (United States)

    Kumsa, Bersissa; Parola, Philippe; Raoult, Didier; Socolovschi, Cristina

    2014-01-01

    Melophagus ovinus (sheep ked) is one of the most common ectoparasites that contributes to enormous economic losses in the productivity of sheep in many countries. The present study was conducted from January 2012 to July 2013 on M. ovinus collected from sheep at three sites in Ethiopia. Of the sheep studied, 65.7% (88/134) were infested with M. ovinus. The prevalence of M. ovinus was 76% (76/100), 47% (8/17) and 23.5% (4/17) at the Kimbibit, Chacha and Shano sites, respectively. An overall number of 229 M. ovinus specimens (138 females, 86 males and five pupae) and 554 M. ovinus specimens (272 females, 282 males) were collected from young and adult sheep, respectively. Bartonella DNA was detected in 89% (694/783) of M. ovinus using a quantitative Bartonella genus-specific PCR assay targeting the 16S/23S rRNA intergenic spacer region. The sequencing of the PCR products of fragments of the gltA and rpoB genes showed 99.6-100% and 100% homology, respectively, with B. melophagi. Statistically significant variation was not noted in the overall prevalence of Bartonella DNA between female and male M. ovinus. All of the sheep infested with M. ovinus 100% (88/88) harbored at least one M. ovinus specimen that contained Bartonella DNA. This study highlights that B. melophagi in M. ovinus from sheep in highlands in Ethiopia possibly has certain zoonotic importance.

  17. Breeding strategies to make sheep farms resilient to uncertainty

    NARCIS (Netherlands)

    Rose, I.J.

    2014-01-01

    The sheep industry in Western Australian has had many challenges over the last 20 years which have caused sheep numbers to decline. This decline is because sheep farms are not resilient to uncertain pasture growth and commodity prices. One way to improve resilience and profitability of farming syste

  18. Classical Trajectories and Quantum Spectra

    Science.gov (United States)

    Mielnik, Bogdan; Reyes, Marco A.

    1996-01-01

    A classical model of the Schrodinger's wave packet is considered. The problem of finding the energy levels corresponds to a classical manipulation game. It leads to an approximate but non-perturbative method of finding the eigenvalues, exploring the bifurcations of classical trajectories. The role of squeezing turns out decisive in the generation of the discrete spectra.

  19. Elaeophorosis in bighorn sheep in New Mexico.

    Science.gov (United States)

    Boyce, W; Fisher, A; Provencio, H; Rominger, E; Thilsted, J; Ahlm, M

    1999-10-01

    Two bighorn sheep (Ovis canadensis) in New Mexico (USA) were found to be naturally infected with Elaeophora schneideri. An adult ram examined in 1997 in the Fra Cristobal Mountains had 26 nematodes in the carotid and iliac arteries, and microfilariae were present in the skin, nasal mucosa, brain, and lungs. This ram was markedly debilitated prior to euthanasia and extensive crusty, scabby lesions were observed on its head. In 1998, a yearling ewe found dead adjacent to Watson Mountain near the Gila Wilderness area was found to have 13 nematodes present in its heart. This is the first report of E. schneideri in bighorn sheep, and we suggest that bighorn sheep are susceptible to E. schneideri infection wherever they coexist with mule deer (Odocoileus hemionus hemionus) and appropriate tabanid vectors.

  20. Perspective: Quantum or classical coherence?

    Science.gov (United States)

    Miller, William H

    2012-06-07

    Some coherence effects in chemical dynamics are described correctly by classical mechanics, while others only appear in a quantum treatment--and when these are observed experimentally it is not always immediately obvious whether their origin is classical or quantum. Semiclassical theory provides a systematic way of adding quantum coherence to classical molecular dynamics and thus provides a useful way to distinguish between classical and quantum coherence. Several examples are discussed which illustrate both cases. Particularly interesting is the situation with electronically non-adiabatic processes, where sometimes whether the coherence effects are classical or quantum depends on what specific aspects of the process are observed.

  1. Cloning non-transformed sheep B cells.

    Science.gov (United States)

    Griebel, P J; Beskorwayne, T; Godson, D L; Popowych, Y; Hein, W

    2000-04-03

    The capacity to clone B cells and establish permanent B cell lines has greatly facilitated a wide variety of studies characterising the growth, differentiation, and gene expression of murine and human B cells. Similar investigations of B cell biology for other species have been severely restricted by an inability to culture or clone B cells. This is the first report of a method to clone non-transformed sheep B cells using a culture system based on murine CD154 and a combination of human gamma chain-common cytokines. Sheep Peyer's patch B cells were cultured for 120 days and then cloned by limiting dilution culture. The parental B cell culture contained both surface immunoglobulin (sIg)M(+) and sIgG1(+) B cells and both types of B cell were cloned. Clonality was confirmed by PCR analysis of Ig heavy chain (HC) and light chain (LC) expression and DNA sequencing of HC V genes. There was agreement between the PCR and flow cytometric analyses of HC isotype expression on the B cell clones but the available monoclonal antibodies specific for sheep lambda and kappa LC did not react with all clones. Soluble Ig was detected in the culture supernatant of sIgG1(+) clones but not sIgM(+) clones. The B cell clones remained dependent upon CD154 and gamma chain-common cytokine co-stimulation for sustained growth and maintained stable Ig expression. The cloning of non-transformed sheep B cells should provide a valuable tool for studying sheep B cell biology, establishing Ig HC- and LC-specific monoclonal antibodies, analysing the B cell Ig repertoire, and may be used to produce sheep monoclonal antibodies.

  2. Mechanical Systems, Classical Models

    CERN Document Server

    Teodorescu, Petre P

    2009-01-01

    This third volume completes the Work Mechanical Systems, Classical Models. The first two volumes dealt with particle dynamics and with discrete and continuous mechanical systems. The present volume studies analytical mechanics. Topics like Lagrangian and Hamiltonian mechanics, the Hamilton-Jacobi method, and a study of systems with separate variables are thoroughly discussed. Also included are variational principles and canonical transformations, integral invariants and exterior differential calculus, and particular attention is given to non-holonomic mechanical systems. The author explains in detail all important aspects of the science of mechanics, regarded as a natural science, and shows how they are useful in understanding important natural phenomena and solving problems of interest in applied and engineering sciences. Professor Teodorescu has spent more than fifty years as a Professor of Mechanics at the University of Bucharest and this book relies on the extensive literature on the subject as well as th...

  3. Grassmannization of classical models

    CERN Document Server

    Pollet, Lode; Prokof'ev, Nikolay V; Svistunov, Boris V

    2016-01-01

    Applying Feynman diagrammatics to non-fermionic strongly correlated models with local constraints might seem generically impossible for two separate reasons: (i) the necessity to have a Gaussian (non-interacting) limit on top of which the perturbative diagrammatic expansion is generated by Wick's theorem, and (ii) the Dyson's collapse argument implying that the expansion in powers of coupling constant is divergent. We show that for arbitrary classical lattice models both problems can be solved/circumvented by reformulating the high-temperature expansion (more generally, any discrete representation of the model) in terms of Grassmann integrals. Discrete variables residing on either links, plaquettes, or sites of the lattice are associated with the Grassmann variables in such a way that the partition function (and correlations) of the original system and its Grassmann-field counterpart are identical. The expansion of the latter around its Gaussian point generates Feynman diagrams. A proof-of-principle implement...

  4. Classical and quantum cosmology

    CERN Document Server

    Calcagni, Gianluca

    2017-01-01

    This comprehensive textbook is devoted to classical and quantum cosmology, with particular emphasis on modern approaches to quantum gravity and string theory and on their observational imprint. It covers major challenges in theoretical physics such as the big bang and the cosmological constant problem. An extensive review of standard cosmology, the cosmic microwave background, inflation and dark energy sets the scene for the phenomenological application of all the main quantum-gravity and string-theory models of cosmology. Born of the author's teaching experience and commitment to bridging the gap between cosmologists and theoreticians working beyond the established laws of particle physics and general relativity, this is a unique text where quantum-gravity approaches and string theory are treated on an equal footing. As well as introducing cosmology to undergraduate and graduate students with its pedagogical presentation and the help of 45 solved exercises, this book, which includes an ambitious bibliography...

  5. THE USE OF MICROSATELLITE MARKERS TO STUDY GENETIC DIVERSITY IN INDONESIAN SHEEP

    OpenAIRE

    Jakaria; M.S.A. Zein; S. Sulandari; Subandriyo,; Muladno

    2014-01-01

    The purpose of this research was to study genetic diversity in Indonesian sheep population using microsatellite markers. A total of 18 microsatellite loci have been used for genotyping Indonesian sheep. Total sheep blood 200 samples were extracted from garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep populations by using a salting out method. Microsatellite loci data were analyzed using POPGENE 3.2 software. Based on this study obtained 180 alleles from ...

  6. Cloned Sheep May Age Prematurely

    Institute of Scientific and Technical Information of China (English)

    Joseph; B.Verrengia; 孙颖

    1999-01-01

    1996年的头条科技新闻之一是:多利羊被克隆成功。世人曾为消息雀跃,以为克隆技术马上可以造福人类了,而且科幻作家也开始忙碌起来。而今,当多利羊过3岁生日时,人们却伤感地发现: In Dolly’s case,she is 3,but her genetic material is aging at the rate of the6-year-old sheep from which she was cloned. 这就是所谓aging prematurely。这则消息给人们带来的忧虑有两条。一是:被克隆的动物的预期寿命比人们想象的要短;二是:人们是否能够有效利用克隆的人体细胞去治疗疾病。目前,科学家们的担心还是集中于后者。本书收入的另一篇有关克隆的文章(It’s A Boy!Scientists Clone First Male Mammal)和本篇构成了强烈的对照,可谓一喜一忧。然而,无论喜忧,人类在克隆技术方面正在以坚实的步伐向前迈进。

  7. Citation classics in epilepsy

    Directory of Open Access Journals (Sweden)

    Maryann Wilson

    2013-01-01

    Full Text Available BACKGROUND: The impact of a scientific article is proportional to the citations it has received. In this study, we set out to identify the most cited works in epileptology in order to evaluate research trends in this field. METHODS: According to the Web of Science database, articles with more than 400 citations qualify as "citation classics". We conducted a literature search on the ISI Web of Science bibliometric database for scientific articles relevant to epilepsy. RESULTS: We retrieved 67 highly cited articles (400 or more citations, which were published in 31 journals: 17 clinical studies, 42 laboratory studies, 5 reviews and 3 classification articles. Clinical studies consisted of epidemiological analyses (n=3, studies on the clinical phenomenology of epilepsy (n=5 – including behavioral and prognostic aspects – and articles focusing on pharmacological (n=6 and non-pharmacological (n=3 treatment. The laboratory studies dealt with genetics (n=6, animal models (n=27, and neurobiology (n=9 – including both neurophysiology and neuropathology studies. The majority (61% of citation classics on epilepsy were published after 1986, possibly reflecting the expansion of research interest in laboratory studies driven by the development of new methodologies, specifically in the fields of genetics and animal models. Consequently, clinical studies were highly cited both before and after the mid 80s, whilst laboratory researches became widely cited after 1990. CONCLUSIONS: Our study indicates that the main drivers of scientific impact in the field of epileptology have increasingly become genetic and neurobiological studies, along with research on animal models of epilepsy. These articles are able to gain the highest numbers of citations in the time span of a few years and suggest potential directions for future research.

  8. Sensitive and specific detection of classical scrapie prions in the brain of goats by real-time quaking-induced conversion

    Science.gov (United States)

    The real-time quaking-induced conversion (RT-QuIC) is a rapid, specific, and sensitive prion seeding activity detection assay that uses recombinant prion protein (rPrPSen) to detect sub-infectious levels of the abnormal isoforms of the prion protein (PrPSc). Although RT-QuIC has been successfully us...

  9. Highly sensitive detection of small ruminant bovine spongiform encephalopathy within transmissible spongiform encephalopathy mixes by serial protein misfolding cyclic amplification.

    Science.gov (United States)

    Gough, Kevin C; Bishop, Keith; Maddison, Ben C

    2014-11-01

    It is assumed that sheep and goats consumed the same bovine spongiform encephalopathy (BSE)-contaminated meat and bone meal that was fed to cattle and precipitated the BSE epidemic in the United Kingdom that peaked more than 20 years ago. Despite intensive surveillance for cases of BSE within the small ruminant populations of the United Kingdom and European Union, no instances of BSE have been detected in sheep, and in only two instances has BSE been discovered in goats. If BSE is present within the small ruminant populations, it may be at subclinical levels, may manifest as scrapie, or may be masked by coinfection with scrapie. To determine whether BSE is potentially circulating at low levels within the European small ruminant populations, highly sensitive assays that can specifically detect BSE, even within the presence of scrapie prion protein, are required. Here, we present a novel assay based on the specific amplification of BSE PrP(Sc) using the serial protein misfolding cyclic amplification assay (sPMCA), which specifically amplified small amounts of ovine and caprine BSE agent which had been mixed into a range of scrapie-positive brain homogenates. We detected the BSE prion protein within a large excess of classical, atypical, and CH1641 scrapie isolates. In a blind trial, this sPMCA-based assay specifically amplified BSE PrP(Sc) within brain mixes with 100% specificity and 97% sensitivity when BSE agent was diluted into scrapie-infected brain homogenates at 1% (vol/vol).

  10. Minimum Effective Dose of Cattle and Sheep BSE for Oral Sheep Infection.

    Directory of Open Access Journals (Sweden)

    Gillian McGovern

    Full Text Available The minimum dose required to cause infection of Romney and Suffolk sheep of the ARQ/ARQ or ARQ/ARR prion protein gene genotypes following oral inoculation with Romney or Suffolk a sheep Bovine spongiform encephalopathy (BSE-derived or cattle BSE-derived agent was investigated using doses ranging from 0.0005g to 5g. ARQ/ARQ sheep which were methionine (M / threonine (T heterozygous or T/T homozygous at codon 112 of the Prnp gene, dosed ARQ/ARR sheep and undosed controls did not show any evidence of infection. Within groups of susceptible sheep, the minimum effective oral dose of BSE was found to be 0.05g, with higher attack rates following inoculation with the 5g dose. Surprisingly, this study found no effect of dose on survival time suggesting a possible lack of homogeneity within the inoculum. All clinical BSE cases showed PrPd accumulation in brain; however, following cattle BSE inoculation, LRS involvement within Romney recipients was found to be significantly lower than within the Suffolk sheep inoculated group which is in agreement with previous reports.

  11. Fermentation of methanol in the sheep rumen.

    OpenAIRE

    Pol, A.; Demeyer, D. I.

    1988-01-01

    Sheep fed a hay-concentrate diet were adapted to pectin administration and ruminal infusion of methanol. Both treatments resulted in a strong increase in the rate of methanogenesis from methanol. Quantitative data show that methanol was exclusively converted into methane. Treatments did not influence ruminal volatile fatty acid percentages.

  12. Dynamics of Sheep Production in Brazil

    Directory of Open Access Journals (Sweden)

    Samuel Rezende Paiva

    2013-07-01

    Full Text Available Sheep production is present on all continents and has been practiced in Brazil since the colonization. In this study, the multitemporal dynamics of sheep production in Brazil is examined using official government data (Brazilian Institute for Geography and Statistics-IBGE from 1976 to 2010. Maps of flock growth rates and growth acceleration maps by municipality were elaborated. The Southern states are seen to show a reduction in production mainly due to the wool crisis in the 1970s and 80s. The Northeast is seen to be important for meat production. More recently, centerwest and northern states have shown an increase in growth rates but this is still incipient. The maps of growth, acceleration and midpoint for sheep production showed a noticeable return to an increase in production in the South in recent years. The midpoint of production flow was in the northeast direction, which has stagnated. There was great dynamics in sheep production over the whole Brazilian territory, which affected supply chains due to the expansion of domestic and foreign markets. Areas with higher fluctuations in production are more vulnerable in terms of investment policies.

  13. Coxiella burnetii infections in sheep or goats

    NARCIS (Netherlands)

    Brom, Van den R.; Engelen, van E.; Roest, H.I.J.; Hoek, van der W.; Vellema, P.

    2015-01-01

    Q fever is an almost ubiquitous zoonosis caused by Coxiella burnetii, which is able to infect several animal species, as well as humans. Cattle, sheep and goats are the primary animal reservoirs. In small ruminants, infections are mostly without clinical symptoms, however, abortions and stillbirt

  14. 9 CFR 91.8 - Sheep.

    Science.gov (United States)

    2010-01-01

    ...-positive animal or an exposed animal, as defined in 9 CFR parts 54 and 79, or if it has ever been in an infected flock, source flock, or trace flock, as defined in 9 CFR parts 54 and 79; or if it is the progeny... be identified by eartags or tattoos approved by the Administrator. 3 except that sheep for export...

  15. Classical Fourier analysis

    CERN Document Server

    Grafakos, Loukas

    2014-01-01

    The main goal of this text is to present the theoretical foundation of the field of Fourier analysis on Euclidean spaces. It covers classical topics such as interpolation, Fourier series, the Fourier transform, maximal functions, singular integrals, and Littlewood–Paley theory. The primary readership is intended to be graduate students in mathematics with the prerequisite including satisfactory completion of courses in real and complex variables. The coverage of topics and exposition style are designed to leave no gaps in understanding and stimulate further study. This third edition includes new Sections 3.5, 4.4, 4.5 as well as a new chapter on “Weighted Inequalities,” which has been moved from GTM 250, 2nd Edition. Appendices I and B.9 are also new to this edition.  Countless corrections and improvements have been made to the material from the second edition. Additions and improvements include: more examples and applications, new and more relevant hints for the existing exercises, new exercises, and...

  16. Extended symmetrical classical electrodynamics.

    Science.gov (United States)

    Fedorov, A V; Kalashnikov, E G

    2008-03-01

    In this paper, we discuss a modification of classical electrodynamics in which "ordinary" point charges are absent. The modified equations contain additional terms describing the induced charges and currents. The densities of the induced charges and currents depend on the vector k and the vectors of the electromagnetic field, E and B . It is shown that the vectors E and B can be defined in terms of two four-potentials and the components of k are the components of a four-tensor of the third rank. The Lagrangian of the modified electrodynamics is defined. The conditions are derived at which only one four-potential determines the behavior of the electromagnetic field. It is also shown that static modified electrodynamics can describe the electromagnetic field in the inner region of an electric monopole. In the outer region of the electric monopole the electric field is governed by the Maxwell equations. It follows from boundary conditions at the interface between the inner and outer regions of the monopole that the vector k has a discrete spectrum. The electric and magnetic fields, energy, and angular momentum of the monopole are found for different eigenvalues of k .

  17. Grassmannization of classical models

    Science.gov (United States)

    Pollet, Lode; Kiselev, Mikhail N.; Prokof'ev, Nikolay V.; Svistunov, Boris V.

    2016-11-01

    Applying Feynman diagrammatics to non-fermionic strongly correlated models with local constraints might seem generically impossible for two separate reasons: (i) the necessity to have a Gaussian (non-interacting) limit on top of which the perturbative diagrammatic expansion is generated by Wick’s theorem, and (ii) Dyson’s collapse argument implying that the expansion in powers of coupling constant is divergent. We show that for arbitrary classical lattice models both problems can be solved/circumvented by reformulating the high-temperature expansion (more generally, any discrete representation of the model) in terms of Grassmann integrals. Discrete variables residing on either links, plaquettes, or sites of the lattice are associated with the Grassmann variables in such a way that the partition function (as well as all correlation functions) of the original system and its Grassmann-field counterpart are identical. The expansion of the latter around its Gaussian point generates Feynman diagrams. Our work paves the way for studying lattice gauge theories by treating bosonic and fermionic degrees of freedom on equal footing.

  18. Time, classical and quantum

    Science.gov (United States)

    Aniello, P.; Ciaglia, F. M.; Di Cosmo, F.; Marmo, G.; Pérez-Pardo, J. M.

    2016-10-01

    We propose a new point of view regarding the problem of time in quantum mechanics, based on the idea of replacing the usual time operator T with a suitable real-valued function T on the space of physical states. The proper characterization of the function T relies on a particular relation with the dynamical evolution of the system rather than with the infinitesimal generator of the dynamics (Hamiltonian). We first consider the case of classical hamiltonian mechanics, where observables are functions on phase space and the tools of differential geometry can be applied. The idea is then extended to the case of the unitary evolution of pure states of finite-level quantum systems by means of the geometric formulation of quantum mechanics. It is found that T is a function on the space of pure states which is not associated with any self-adjoint operator. The link between T and the dynamical evolution is interpreted as defining a simultaneity relation for the states of the system with respect to the dynamical evolution itself. It turns out that different dynamical evolutions lead to different notions of simultaneity, i.e., the notion of simultaneity is a dynamical notion.

  19. Classical competing risks

    CERN Document Server

    Crowder, Martin J

    2001-01-01

    If something can fail, it can often fail in one of several ways and sometimes in more than one way at a time. There is always some cause of failure, and almost always, more than one possible cause. In one sense, then, survival analysis is a lost cause. The methods of Competing Risks have often been neglected in the survival analysis literature. Written by a leading statistician, Classical Competing Risks thoroughly examines the probability framework and statistical analysis of data of Competing Risks. The author explores both the theory of the subject and the practicalities of fitting the models to data. In a coherent, self-contained, and sequential account, the treatment moves from the bare bones of the Competing Risks setup and the associated likelihood functions through survival analysis using hazard functions. It examines discrete failure times and the difficulties of identifiability, and concludes with an introduction to the counting-process approach and the associated martingale theory.With a dearth of ...

  20. Classics in radio astronomy

    CERN Document Server

    Sullivan, Woodruff Turner

    1982-01-01

    Radio techniques were the nrst to lead astronomy away from the quiescent and limited Universe revealed by traditional observations at optical wave­ lengths. In the earliest days of radio astronomy, a handful of radio physicists and engineers made one startling discovery after another as they opened up the radio sky. With this collection of classic papers and the extensive intro­ ductory material, the reader can experience these exciting discoveries, as well as understand the developing techniques and follow the motivations which prompted the various lines of inquiry. For instance he or she will follow in detail the several attempts to detect radio waves from the sun at the turn of the century; the unravelling by Jansky of a "steady hiss type static"; the incredible story of Reber who built a 9 meter dish in his backyard in 1937 and then mapped the Milky Way; the vital discoveries by Hey and colleagues of radio bursts from the Sun and of a discrete source in the constellation of Cygnus; the development of re...

  1. The classic: Bone morphogenetic protein.

    Science.gov (United States)

    Urist, Marshall R; Strates, Basil S

    2009-12-01

    This Classic Article is a reprint of the original work by Marshall R. Urist and Basil S. Strates, Bone Morphogenetic Protein. An accompanying biographical sketch of Marshall R. Urist, MD is available at DOI 10.1007/s11999-009-1067-4; a second Classic Article is available at DOI 10.1007/s11999-009-1069-2; and a third Classic Article is available at DOI 10.1007/s11999-009-1070-9. The Classic Article is copyright 1971 by Sage Publications Inc. Journals and is reprinted with permission from Urist MR, Strates BS. Bone morphogenetic protein. J Dent Res. 1971;50:1392-1406.

  2. Heterologous PrP molecules interfere with accumulation of protease-resistant PrP in scrapie-infected murine neuroblastoma cells.

    OpenAIRE

    Priola, S A; Caughey, B; Race, R E; Chesebro, B

    1994-01-01

    Mutations within a host cellular protein, PrP, have been associated with disease in the transmissible spongiform encephalopathies. Murine neuroblastoma cells persistently infected with mouse scrapie accumulate protease-resistant PrP (PrP-res), the abnormal form of PrP associated with disease in the transmissible spongiform encephalopathies. These cells provide a controlled system in which to study the molecular interactions which are important in the formation of PrP-res. We have expressed re...

  3. Scrapie infection in experimental rodents and SMB-S15 cells decreased the brain endogenous levels and activities of Sirt1.

    Science.gov (United States)

    Wang, Jing; Zhang, Jin; Shi, Qi; Zhang, Bao-Yun; Chen, Cao; Chen, Li-Na; Sun, Jing; Wang, Hui; Xiao, Kang; Dong, Xiao-Ping

    2015-04-01

    Prion diseases are composed of a group of fatal neurodegenerative disorders resulting from misfolding of cellular prion (PrP(C)) into scrapie prion (PrP(Sc)). Sirt1, a class III histone deacetylase, has been reported to protect neuronal cells against PrP (106-126)-induced cell death. To address the potential role of Sirt1 during prion infection, the levels and enzyme activities of Sirt1 in the brains of scrapie-infected rodents, including hamsters infected with strain 263K, mice infected with strains 139A and ME7, and in prion infected SMB-S15 cells, were analyzed. Western blots revealed that endogenous Sirt1 levels were significantly decreased in all tested scrapie-infected models. Dynamic assays of brain Sirt1 levels in 263K-infected hamsters during incubation period showed a time-dependent decrease. The acetylating forms of Sirt1 target proteins, P53, PGC-1, and STAT3, markedly increased both in the brains of scrapie-infected rodents and in SMB-S15 cells, representing decreased Sirt1 activity. Immunofluorescent assays illustrated that Sirt1 predominately localized in cytosol of SMB-S15 cells but clearly distributed in nucleus of its normal partner cell line, SMB-PS. Moreover, accompanying with increase of Sirt1 level and decrease of acetyl-P53 level, treatments with Sirt1 activators SRT1720 and resveratrol in SMB-S15 cells significantly reduced PrP(Sc); at the same time, the cellular distribution of PrP proteins became normal, and the cell proliferating state was slightly improved. These data indicate that prion infection notably attenuates the Sirt1 activity in host cells. Sensitivity of the PrP(Sc) to Sirt1 activators highlights a potential role of Sirt1 in prion therapeutics.

  4. Innovation: the classic traps.

    Science.gov (United States)

    Kanter, Rosabeth Moss

    2006-11-01

    Never a fad, but always in or out of fashion, innovation gets rediscovered as a growth enabler every half dozen years. Too often, though, grand declarations about innovation are followed by mediocre execution that produces anemic results, and innovation groups are quietly disbanded in cost-cutting drives. Each managerial generation embarks on the same enthusiastic quest for the next new thing. And each generation faces the same vexing challenges- most of which stem from the tensions between protecting existing revenue streams critical to current success and supporting new concepts that may be crucial to future success. In this article, Harvard Business School professor Rosabeth Moss Kanter reflects on the four major waves of innovation enthusiasm she's observed over the past 25 years. She describes the classic mistakes companies make in innovation strategy, process, structure, and skills assessment, illustrating her points with a plethora of real-world examples--including AT&T Worldnet, Timberland, and Ocean Spray. A typical strategic blunder is when managers set their hurdles too high or limit the scope of their innovation efforts. Quaker Oats, for instance, was so busy in the 1990s making minor tweaks to its product formulas that it missed larger opportunities in distribution. A common process mistake is when managers strangle innovation efforts with the same rigid planning, budgeting, and reviewing approaches they use in their existing businesses--thereby discouraging people from adapting as circumstances warrant. Companies must be careful how they structure fledgling entities alongside existing ones, Kanter says, to avoid a clash of cultures and agendas--which Arrow Electronics experienced in its attempts to create an online venture. Finally, companies commonly undervalue and underinvest in the human side of innovation--for instance, promoting individuals out of innovation teams long before their efforts can pay off. Kanter offers practical advice for avoiding

  5. Transmission of scrapie prions to primate after an extended silent incubation period

    Science.gov (United States)

    Classical bovine spongiform encephalopathy (c-BSE) is an animal prion disease that also causes variant Creutzfeldt-Jakob disease in humans. Over the past decades, c-BSE's zoonotic potential has been the driving force in establishing extensive protective measures for animal and human health. In compl...

  6. Economic evaluation of genomic selection in small ruminants: a sheep meat breeding program.

    Science.gov (United States)

    Shumbusho, F; Raoul, J; Astruc, J M; Palhiere, I; Lemarié, S; Fugeray-Scarbel, A; Elsen, J M

    2016-06-01

    Recent genomic evaluation studies using real data and predicting genetic gain by modeling breeding programs have reported moderate expected benefits from the replacement of classic selection schemes by genomic selection (GS) in small ruminants. The objectives of this study were to compare the cost, monetary genetic gain and economic efficiency of classic selection and GS schemes in the meat sheep industry. Deterministic methods were used to model selection based on multi-trait indices from a sheep meat breeding program. Decisional variables related to male selection candidates and progeny testing were optimized to maximize the annual monetary genetic gain (AMGG), that is, a weighted sum of meat and maternal traits annual genetic gains. For GS, a reference population of 2000 individuals was assumed and genomic information was available for evaluation of male candidates only. In the classic selection scheme, males breeding values were estimated from own and offspring phenotypes. In GS, different scenarios were considered, differing by the information used to select males (genomic only, genomic+own performance, genomic+offspring phenotypes). The results showed that all GS scenarios were associated with higher total variable costs than classic selection (if the cost of genotyping was 123 euros/animal). In terms of AMGG and economic returns, GS scenarios were found to be superior to classic selection only if genomic information was combined with their own meat phenotypes (GS-Pheno) or with their progeny test information. The predicted economic efficiency, defined as returns (proportional to number of expressions of AMGG in the nucleus and commercial flocks) minus total variable costs, showed that the best GS scenario (GS-Pheno) was up to 15% more efficient than classic selection. For all selection scenarios, optimization increased the overall AMGG, returns and economic efficiency. As a conclusion, our study shows that some forms of GS strategies are more advantageous

  7. Treatment of Scrapie Pathogen 263K With Tetracycline Partially Abolishes Protease-resistant Activity in vitro and Reduces Infectivity in vivo

    Institute of Scientific and Technical Information of China (English)

    YAN-JUN GUO; DE-XIN WANG; XIAO-PING DONG; JUN HAN; HAI-LAN YAO; BAO-YUN ZHANG; JIAN-MEI GAO; JIN ZHANG; XIN-LI XIAO; XIAO-FAN WANG; WEI-QIN ZHAO

    2007-01-01

    Objective To study the possible effect of tetracycline on protease-resistant activity in vitro and infectivity in vivo of a scrapie strain 263K.Methods Scrapie pathogens were incubated with tetracycline at different concentrations for various periods of time and protease-resistant PrP signals were evaluated with proteinase K-treatment and Western blots.The preparations treated with tetracycline were intracerebrally inoculated into golden hamsters and typical TSE manifestations were noted.PrPSc in brain tissues of the infected animals was detected by PrP specific Western blot assays. Results Protease-resistant PrP was significantly reduced in or removed from the preparations treated with tetracycline in a dose-dependant manner.Compared with the control group after incubated for 53.75±0.50 days,the preparations treated with 5 mmol/L and 20 mmol/L tetracycline prolonged the incubation time of 61.5±1.73 and 59.5±0.58 days (P<0.05). Conclusion Treatment of scrapie pathogen 263K with tetracycline reduces or removes its protease-resistant activity in vitro.

  8. Predicting the consequences of selecting on PrP genotypes on PrP frequencies, performance and inbreeding in commercial meat sheep populations

    Directory of Open Access Journals (Sweden)

    Boulton Kay

    2007-11-01

    Full Text Available Abstract Selection programmes based on prion protein (PrP genotypes are being implemented for increasing resistance to scrapie. Commercial meat sheep populations participating in sire-referencing schemes were simulated to investigate the effect of selection on PrP genotypes on ARR and VRQ allele frequencies, inbreeding and genetic gain in a performance trait under selection. PrP selection strategies modelled included selection against the VRQ allele and in favour of the ARR allele. Assuming realistic initial PrP frequencies, selection against the VRQ allele had a minimal impact on performance and inbreeding. However, when selection was also in favour of the ARR allele and the frequency of this allele was relatively low, there was a loss of up to three to four years of genetic gain over the 15 years of selection. Most loss in gain occurred during the first five years. In general, the rate of inbreeding was reduced when applying PrP selection. Since animals were first selected on their PrP genotype before being selected on the performance trait, the intensity of selection on performance was weaker under PrP selection (compared with no PrP selection. Eradication of the VRQ allele or fixation of the ARR allele within 15 years of selection was possible only with PrP selection targeting all breeding animals.

  9. Operator Formulation of Classical Mechanics.

    Science.gov (United States)

    Cohn, Jack

    1980-01-01

    Discusses the construction of an operator formulation of classical mechanics which is directly concerned with wave packets in configuration space and is more similar to that of convential quantum theory than other extant operator formulations of classical mechanics. (Author/HM)

  10. Dynamical Symmetries in Classical Mechanics

    Science.gov (United States)

    Boozer, A. D.

    2012-01-01

    We show how symmetries of a classical dynamical system can be described in terms of operators that act on the state space for the system. We illustrate our results by considering a number of possible symmetries that a classical dynamical system might have, and for each symmetry we give examples of dynamical systems that do and do not possess that…

  11. Teaching and Demonstrating Classical Conditioning.

    Science.gov (United States)

    Sparrow, John; Fernald, Peter

    1989-01-01

    Discusses classroom demonstrations of classical conditioning and notes tendencies to misrepresent Pavlov's procedures. Describes the design and construction of the conditioner that is used for demonstrating classical conditioning. Relates how students experience conditioning, generalization, extinction, discrimination, and spontaneous recovery.…

  12. Classic writings on instructional technology

    NARCIS (Netherlands)

    Ely, Donald P.; Plomp, Tjeerd

    1996-01-01

    This paper describes the selection process of 17 articles for inclusion in the book, "Classic Writings on Instructional Technology." The book brings together original "classic" educational technology articles into one volume to document the history of the field through its literature. It is also an

  13. COMPETITION: CLASSICAL VERSUS NEOCLASSICAL VIEW

    OpenAIRE

    Mihaela Cornelia Sandu

    2013-01-01

    Competition is an important element from economical theory. Over time it has experienced several definitions and classifications much of them being contradictory. In this paper I will make a parallel between classical and neoclassical point of view according to competition. Keywords. Competition; neoclassical theory; classical theory; monopolistic; perfect competition.

  14. Classic African American Children's Literature

    Science.gov (United States)

    McNair, Jonda C.

    2010-01-01

    The purpose of this article is to assert that there are classic African American children's books and to identify a sampling of them. The author presents multiple definitions of the term classic based on the responses of children's literature experts and relevant scholarship. Next, the manner in which data were collected and analyzed in regard to…

  15. Classical Music Fan Chen Li

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The heyday of Beijing’s classical music beganin 1993, when top-quality sound equipment andrecords were imported. Also in that year, BeijingMusic Radio presented a classical music programtitled "Fan’s Club" and founded the "Music and

  16. THE USE OF MICROSATELLITE MARKERS TO STUDY GENETIC DIVERSITY IN INDONESIAN SHEEP

    Directory of Open Access Journals (Sweden)

    Jakaria

    2012-03-01

    Full Text Available The purpose of this research was to study genetic diversity in Indonesian sheep population using microsatellite markers. A total of 18 microsatellite loci have been used for genotyping Indonesian sheep. Total sheep blood 200 samples were extracted from garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep populations by using a salting out method. Microsatellite loci data were analyzed using POPGENE 3.2 software. Based on this study obtained 180 alleles from 17 microsatellite loci, while average number of alleles was 6.10 alleles (6 to 18 alleles from five Indonesian sheep populations (garut sheep of fighting type, garut sheep of meat type, purbalingga sheep, batur sheep and jember sheep population. The average of observed heterozygosity (Ho and expected heterozygosity (He values were 0.5749 and 0.6896, respectively, while the genetic differentiation for inbreeding among population (FIS, within population (FIT and average genetic differentiation (FST were 0.1006, 0.1647 and 0.0712, respectively. Genetic distance and genetic tree showed that Indonesian sheep population was distinct from garut sheep of fighting and meat types, purbalingga sheep, batur sheep and jember sheep population. Based on this results were needed a strategy for conservation and breeding programs in each Indonesian sheep population.

  17. Classical approach in quantum physics

    CERN Document Server

    Solov'ev, Evgeni A

    2010-01-01

    The application of a classical approach to various quantum problems - the secular perturbation approach to quantization of a hydrogen atom in external fields and a helium atom, the adiabatic switching method for calculation of a semiclassical spectrum of hydrogen atom in crossed electric and magnetic fields, a spontaneous decay of excited states of a hydrogen atom, Gutzwiller's approach to Stark problem, long-lived excited states of a helium atom recently discovered with the help of Poincar$\\acute{\\mathrm{e}}$ section, inelastic transitions in slow and fast electron-atom and ion-atom collisions - is reviewed. Further, a classical representation in quantum theory is discussed. In this representation the quantum states are treating as an ensemble of classical states. This approach opens the way to an accurate description of the initial and final states in classical trajectory Monte Carlo (CTMC) method and a purely classical explanation of tunneling phenomenon. The general aspects of the structure of the semicla...

  18. Classical dynamics a modern perspective

    CERN Document Server

    Sudarshan, Ennackal Chandy George

    2016-01-01

    Classical dynamics is traditionally treated as an early stage in the development of physics, a stage that has long been superseded by more ambitious theories. Here, in this book, classical dynamics is treated as a subject on its own as well as a research frontier. Incorporating insights gained over the past several decades, the essential principles of classical dynamics are presented, while demonstrating that a number of key results originally considered only in the context of quantum theory and particle physics, have their foundations in classical dynamics.Graduate students in physics and practicing physicists will welcome the present approach to classical dynamics that encompasses systems of particles, free and interacting fields, and coupled systems. Lie groups and Lie algebras are incorporated at a basic level and are used in describing space-time symmetry groups. There is an extensive discussion on constrained systems, Dirac brackets and their geometrical interpretation. The Lie-algebraic description of ...

  19. Cytogenetical anchoring of sheep linkage map and syntenic groups using a sheep BAC library

    Directory of Open Access Journals (Sweden)

    Cribiu Edmond-Paul

    2000-07-01

    Full Text Available Abstract In order to simultaneously integrate linkage and syntenic groups to the ovine chromosomal map, a sheep bacterial artificial chromosome (BAC library was screened with previously assigned microsatellites using a sheep-hamster hybrid panel and genetic linkage. Thirty-three BACs were obtained, fluorescently labelled and hybridised on sheep-goat hybrid metaphases (2n = 57. This study allowed us, (i, to anchor all linkage groups on sheep chromosomes, (ii, to give information on the probable position of the centromere on the linkage map for the centromeric chromosomes, (iii, to contradict the previous orientation of the ovine × linkage group by the mapping of BMS1008 on OARXq38. Concerning our somatic cell hybrid panel, this study resulted in the assignment of all the previously unassigned groups to ovine chromosomes and a complete characterisation of the hybrid panel. In addition, since hybridisations were performed on a sheep-goat hybrid, new marker/anchoring points were added to the caprine cytogenetic map.

  20. Blood group comparisons between European mouflon sheep and north American desert bighorn sheep.

    Science.gov (United States)

    Bunch, T D; Nguyen, T C

    1982-01-01

    Blood group systems in true sheep (Ovis) provide an additional method by which phylogenetic relationships can be measured. Of the eight genetic systems of blood groups identified in domestic sheep, all appeared to have their homologue in European mouflons and at least six might have their equivalent in North American desert bighorns. The red cells of the European mouflon, which is believed to be ancestral to domestic sheep, cross-reacted with domestic sheep blood-group typing reagents much more strongly and extensively than did the red cells of desert bighorn sheep. It also was noted that all the Mexican desert bighorns tested were Da positive, but their blood factor was not observed in the Nelson desert bighorns sampled. This observation indicated that the two subspecies might differ from each other with respect to the D blood group system. Transferrin type D was observed in the mouflons, while Tfs D and E were in the desert bighorns. Hemoglobins B and AB were observed in the mouflons but only Hb B occurred in the desert bighorns. The systematic implications of blood group polymorphisms are discussed.

  1. Research Progress on Technique of Frozen Embryo Transfer in Sheep

    Institute of Scientific and Technical Information of China (English)

    SHE Qiu-sheng; HU Jian-ye; LOU Peng-yan; TAO Jing; XIE Zhao-hui

    2011-01-01

    The paper introduced the research progress on the technique of frozen embryo transfer in sheep, illustrated selection of donors and receptors, superovulation, synchronization of estrus, embryo cryopreservation and embryo transplantation. Frozen embryo transfer in sheep is another breakthrough in the high-quality sheep raising, and this technique in China is in its infancy recommendation stage, but it will be comprehensively popularized in the future.

  2. Paternal inheritance of mitochondrial DNA in the sheep (Ovine aries)

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Paternal inheritance of mitochondria DNA in sheep was discovered by examination of 152 sheep from 38 hybrid families for mtDNA D-loop polymorphisms using PCR-RFLP, amplification of repeated sequence somain, and PCR-SSCP of the D-loop 5′ end region of a 253 bp fragment. Our findings have provided the first evidence of paternal inheritance of mtDNA in sheep and possible mechanisms of paternal inheritance were discussed.

  3. Detection of quantitative trait loci affecting the milk fatty acid profile on sheep chromosome 22: role of the stearoyl-CoA desaturase gene in Spanish Churra sheep.

    Science.gov (United States)

    García-Fernández, M; Gutiérrez-Gil, B; García-Gámez, E; Sánchez, J P; Arranz, J J

    2010-01-01

    Sheep milk fat contains several components that may provide human health benefits, such as monounsaturated fatty acids and conjugated linoleic acid (CLA). Most of the CLA in ruminant milk is synthesized in the mammary gland by the action of the enzyme stearoyl-CoA desaturase (SCD) on circulating vaccenic acid (trans-11 C18:2; VA). Previous studies have found significant associations between polymorphisms in the SCD gene and the fatty acid composition of ruminant products, including sheep milk. Based on this, we performed a quantitative trait loci (QTL) analysis of an ovine chromosome (22) that harbors the SCD gene for effects on milk fatty acid composition traits and classical milk production traits. We identified a suggestive QTL influencing the CLA/VA ratio with the maximum statistic at position 26 cM of the studied chromosome, whereas the SCD gene has been mapped to position 41.6 cM. The individual introduction of 4 SCD single nucleotide polymorphisms in the QTL model did not cause a reduction of the variance explained by the QTL, which suggests that the SCD gene is not directly responsible for the detected effect in the Churra population studied herein. This conclusion was supported by the lack of any significant association identified between the 4 SCD single nucleotide polymorphisms and the CLA/VA ratio. This association analysis suggested a possible effect of the SCD gene on milk fat percentage in Churra sheep. An independent confirmation of these primary results will be required before attempting its practical implementation in selection programs.

  4. Sheep internal parasites on Rab and Pag

    Directory of Open Access Journals (Sweden)

    Relja Beck

    2010-01-01

    Full Text Available The purpose of our research was to determine which groups and species of internal parasites endanger the health of sheep on the islands of Rab and Pag. The research was carried out in 10 flocks on both islands taking the fresh dung out of 30% of the total number of sheep in each flock. It was ascertained that the gastrointestinal parasites and protozoa of Eimeria genus are present in most flocks on both islands. The presence of the fluke Dicrocoelium dendriticum was ascertained in considerably larger number of flocks on the island of Rab than on the island of Pag. On the other hand, the presence of parasites of Moniezia and Nematodirus genus was ascertained in larger number of flocks on the island of Pag. In two flocks on Rab parasites of Protostrongylus genus were ascertained while on the island of Pag they were not found in any flock.

  5. Experimental studies of chronic pneumonia of sheep.

    Science.gov (United States)

    Gilmour, J S; Jones, G E; Rae, A G

    1979-01-01

    Strains of Mycoplasma ovipneumoniae and Pasteurella haemolytica isolated from sheep affected with chronic pneumonia were inoculated by endobronchial route to conventionally-reared and SPF (Specific Pathogen-Free) lambs. Changes resembling those of the naturally-occurring disease were produced in most lambs given the organisms in combination and in some given M. ovipneumoniae alone. Similar but less extensive changes were seen in SPF lambs and fewer animals were affected. Different strains of M. ovipneumoniae did not affect the extent of changes produced in SPF lambs. M. ovipneumoniae became established in the lungs of both types of sheep; P. haemolytica did so less readily. It was concluded that chronic pneumonia may be reproduced in conventional animals by combined inoculation of M. ovipneumoniae and P. haemolytica. Age and status of immunity to mycoplasmas may account for the different responses of conventional and SPF lambs.

  6. Sheep models of polycystic ovary syndrome phenotype.

    Science.gov (United States)

    Padmanabhan, Vasantha; Veiga-Lopez, Almudena

    2013-07-01

    Polycystic ovary syndrome (PCOS) is a fertility disorder affecting 5-7% of reproductive-aged women. Women with PCOS manifest both reproductive and metabolic defects. Several animal models have evolved, which implicate excess steroid exposure during fetal life in the development of the PCOS phenotype. This review addresses the fetal and adult reproductive and metabolic consequences of prenatal steroid excess in sheep and the translational relevance of these findings to PCOS. By comparing findings in various breeds of sheep, the review targets the role of genetic susceptibility to fetal insults. Disruptions induced by prenatal testosterone excess are evident at both the reproductive and metabolic level with each influencing the other thus creating a self-perpetuating vicious cycle. The review highlights the need for identifying a common mediator of the dysfunctions at the reproductive and metabolic levels and developing prevention and treatment interventions targeting all sites of disruption in unison for achieving optimal success.

  7. 9 CFR 98.5 - Health certificate.

    Science.gov (United States)

    2010-01-01

    ... flock or herd nor had contact with sheep or goats which have been in any flock or herd where scrapie has... embryos' sire and dam showed no evidence of scrapie at the time the embryos were collected; (3) Scrapie... the embryos' sire and dam are not, nor were not, affected with scrapie. (Approved by the Office...

  8. 9 CFR 54.21 - Participation.

    Science.gov (United States)

    2010-01-01

    ... COOPERATIVE CONTROL AND ERADICATION OF LIVESTOCK OR POULTRY DISEASES CONTROL OF SCRAPIE Scrapie Flock Certification Program § 54.21 Participation. Any owner of a sheep or goat flock may apply to enter the Scrapie Flock Certification Program by sending a written request to a State scrapie certification board or...

  9. 9 CFR 98.14 - Health certificate.

    Science.gov (United States)

    2010-01-01

    ... had contact with sheep or goats which have been in any flock or herd where scrapie has been diagnosed... and dam showed no evidence of scrapie at the time the embryos were collected; (3) Scrapie has not been... and dam are not, nor were not, affected with scrapie. (e) There must be a separate health...

  10. Formate metabolism in fetal and neonatal sheep

    OpenAIRE

    2015-01-01

    By virtue of its role in nucleotide synthesis, as well as the provision of methyl groups for vital methylation reactions, one-carbon metabolism plays a crucial role in growth and development. Formate, a critical albeit neglected component of one-carbon metabolism, occurs extracellularly and may provide insights into cellular events. We examined formate metabolism in chronically cannulated fetal sheep (gestation days 119–121, equivalent to mid-third trimester in humans) and in their mothers as...

  11. Ural-Tweed Bighorn Sheep Investigation.

    Science.gov (United States)

    1979-01-01

    downward adjustment in the sheep population through a general decrease in productivity and lamb survival. Through time, ecological succession has been a...are S described below: 1) Rockland is characterized by a low total canopy coverage of bryopbytic as well as non- bryophytic vegetation. Lichens, mosses...classes; snow condition was classed as wet, powder, packed, crusted or frozen; substrate was classed as bedrock, talus, rocky soil, or developed soil

  12. Proteomic evaluation of sheep serum proteins

    OpenAIRE

    Chiaradia Elisabetta; Avellini Luca; Tartaglia Micaela; Gaiti Alberto; Just Ingo; Scoppetta Fausto; Czentnar Zoltan; Pich Andreas

    2012-01-01

    Abstract Background The applications of proteomic strategies to ovine medicine remain limited. The definition of serum proteome may be a good tool to identify useful protein biomarkers for recognising sub-clinical conditions and overt disease in sheep. Findings from bovine species are often directly translated for use in ovine medicine. In order to characterize normal protein patterns and improve knowledge of molecular species-specific characteristics, we generated a two-dimensional reference...

  13. Sheep models of polycystic ovary syndrome phenotype

    OpenAIRE

    Padmanabhan, Vasantha; Veiga-Lopez, Almudena

    2012-01-01

    Polycystic ovary syndrome (PCOS) is a fertility disorder affecting 5–7% of reproductive-aged women. Women with PCOS manifest both reproductive and metabolic defects. Several animal models have evolved, which implicate excess steroid exposure during fetal life in the development of the PCOS phenotype. This review addresses the fetal and adult reproductive and metabolic consequences of prenatal steroid excess in sheep and the translational relevance of these findings to PCOS. By comparing findi...

  14. Mapping risk foci for endemic sheep scab.

    Science.gov (United States)

    Rose, H; Learmount, J; Taylor, M; Wall, R

    2009-10-28

    Psoroptic mange in sheep, resulting from infestation by the astigmatid mite Psoroptes ovis, is increasingly prevalent in Europe and other parts of the world. As a step towards improved national control, regional or local scab management programmes that target high-risk areas and aim to maintain the number of outbreaks below an acceptable level may be an effective initial use of time and resource. To facilitate such a management approach, in this paper scab outbreak farms are identified using a questionnaire survey of sheep farmers, the data from which are then used to build a national scab risk model for Great Britain. The questionnaire results indicate a national prevalence of scab, between March 2007 and February 2008, of 8.6% (+/-1.98). However, previous exposure to sheep scab significantly affected the respondent's probability of reporting a scab outbreak during the survey period (chi(2)=53.2, d.f.=1, P<0.001); 85% of the farms that reported at least one scab outbreak had experienced outbreaks in previous years, 27% had experienced outbreaks in more than five of the previous 10 years. In contrast, 76% of farms that did not report scab had not had a previous outbreak. The highest prevalence areas were in Northern England, Wales, Southwest England and Scotland. Modelling the distribution of the reported scab outbreaks identified height above sea level, temperature and rainfall as significant predictors of the probability of an outbreak, superimposed on an underlying pattern of sheep abundance. It is argued that scab management programmes directed at these foci have the potential to allow a more targeted approach to scab control and significantly reduce the prevalence of scab in the UK and other European countries.

  15. Ocular injury secondary to sheep bile exposure

    Science.gov (United States)

    Okullo, Alfin Taddeo; Low, Tim; Baker, Louise Leslie

    2012-01-01

    A 57-year-old abattoir worker was seen at a general practitioner after sheep bile splashed into his left eye. Flourescein examination revealed extensive ulceration involving at least two-thirds of the corneal surface. Copious irrigation with normal saline, application of chloramphenicol ointment and an eye patch resulted in excellent healing within 2 days with return to normal vision for the patient thereafter. PMID:23208813

  16. Studies on Phylogenetic Relationship of Sheep Population in East and South of Central Asia

    Institute of Scientific and Technical Information of China (English)

    SUN Wei; CHANG Hong; YANG Zhang-ping; GENG Rong-qing; LU Sheng-xia; DU Lei; NI Da-xing; FAN Bao-sheng; Tsunoda K

    2002-01-01

    This paper was based on the Hu sheep in China, after collecting the same data about 9 Asiasheep populations and 5 European sheep (breeds in Japan) populations. It clustered 15 populations in terms ofthe gene frequency of 10 loci and 33 allele in blood enzyme and other protein variations. The result of Hierar-chy Clustering showed that the sheep populations in the East and South of Central Asia could be classified intothree genetic groups: Mongolia sheep, South Asia sheep and European sheep, and the Hu sheep belonged toMongolia sheep.

  17. Classical Knowledge for Quantum Security

    CERN Document Server

    D'Hondt, Ellie

    2008-01-01

    We propose a decision procedure for analysing security of quantum cryptographic protocols, combining a classical algebraic rewrite system for knowledge with an operational semantics for quantum distributed computing. As a test case, we use our procedure to reason about security properties of a recently developed quantum secret sharing protocol that uses graph states. We analyze three different scenarios based on the safety assumptions of the classical and quantum channels and discover the path of an attack in the presence of an adversary. The epistemic analysis that leads to this and similar types of attacks is purely based on our classical notion of knowledge.

  18. Quantum localization of Classical Mechanics

    CERN Document Server

    Batalin, Igor A

    2016-01-01

    Quantum localization of classical mechanics within the BRST-BFV and BV (or field-antifield) quantization methods are studied. It is shown that a special choice of gauge fixing functions (or BRST-BFV charge) together with the unitary limit leads to Hamiltonian localization in the path integral of the BRST-BFV formalism. In turn, we find that a special choice of gauge fixing functions being proportional to extremals of an initial non-degenerate classical action together with a very special solution of the classical master equation result in Lagrangian localization in the partition function of the BV formalism.

  19. Quantum localization of classical mechanics

    Science.gov (United States)

    Batalin, Igor A.; Lavrov, Peter M.

    2016-07-01

    Quantum localization of classical mechanics within the BRST-BFV and BV (or field-antifield) quantization methods are studied. It is shown that a special choice of gauge fixing functions (or BRST-BFV charge) together with the unitary limit leads to Hamiltonian localization in the path integral of the BRST-BFV formalism. In turn, we find that a special choice of gauge fixing functions being proportional to extremals of an initial non-degenerate classical action together with a very special solution of the classical master equation result in Lagrangian localization in the partition function of the BV formalism.

  20. The Wigner representation of classical mechanics, quantization and classical limit

    Energy Technology Data Exchange (ETDEWEB)

    Bolivar, A.O. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rio de Janeiro, RJ (Brazil)

    2001-08-01

    Starting from the Liouvillian formulation of classical physics it is possible by means of a Fourier transform to introduce the Wigner representation and to derive an operator structure to classical mechanisms. The importance of this new representation lies on the fact that it turns out to be suitable route to establish a general method of quantization directly from the equations of motion without alluding to the existence of Hamiltonian and Lagrangian functions. Following this approach we quantize only the motion of a Browian particle with non-linear friction in the Markovian approximation - the thermal bath may be quantum or classical -, thus when the bath is classically described we obtain a master equation which reduces to Caldeira-Legget equation for the linear friction case, and when the reservoir is quantum we get an equation reducing to the one found by Caldeira et al. By neglecting the environmental influence we show that the system can be approximately described by equations of motion in terms of wave function, such as the Schrodinger-Langevin equation and equations of the Caldirola-Kanai type. Finally to make the present study self-consistent we evaluate the classical limit of these dynamical equations employing a new classical limiting method h/2{pi} {yields} 0. (author)