WorldWideScience

Sample records for cl andoh radicals

  1. 13C, 18O, and D Fractionation Effects in the Reactions of CH3OH Isotopologues with Cl andOH Radicals

    DEFF Research Database (Denmark)

    Feilberg, Karen; Gruber-Stadler, Margaret; Johnson, Matthew Stanley;

    2008-01-01

    A relative rate experiment is carried out for six isotopologues of methanol and their reactions with OH and Cl radicals. The reaction rates of CH2DOH, CHD2OH, CD3OH, 13CH3OH, and CH3 18OH with Cl and OH radicals are measured by long-path FTIR spectroscopy relative to CH3OH at 298 ( 2 K and 1013 (...

  2. High resolution FTIR spectroscopy of the ClO radical

    Science.gov (United States)

    Lang, Valerie; Sander, Stanley P.; Friedl, Randy

    1988-01-01

    The chlorine monoxide radical, ClO, plays a significant role in the catalytic destruction of ozone in the Earth's stratosphere. Because of its atmospheric importance, ClO has been the subject of numerous observational attempts. In order to deduce ClO concentrations from stratospheric infrared measurements, the infrared spectroscopy of ClO must be well characterized. Approximately 830 individual lines were measured form ClO imfrared spectra with the ClO concentration between 1 x 10 to the 13th power and 6 x 10 to the 13th power molecules per cu cu. The lines were then averaged and fit to a function of m (where m = O, -J or J+1 for the Q,P and R branches respectively) to obtain the band strength, S sub v and the first Herman-Wallis coefficient, alpha. The total S sub v for the two main isotopmers was 13.11 plus or minus 1 cm(-2) atm(-1) while alpha was 0.00412 plus or minus .00062.

  3. Theoretical study on the reaction of CN radicals with ClO radicals by density functional theory

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    The reaction mechanism of CN radicals with ClO radicals has been studied theoretically using ab initio and density functional theory(DFT).The result shows that the main reaction path is the O atom in radical ClO attacks the C atom in radical CN to compose the intermediate 1 ClOCN.Three thermodynamically accessible prodncts,P1(CO+ClN),P3(NO+CCl),and P4(ClNCO),were obtained from intermediate 1 through isomerization and decomposition reactions.P4 is the primary product,and P1 and P3 are the secondary product.Compared with the singlet potential energy surface,the contribution of the triplet potential energy surface can be ignored.

  4. Lewis Structure Representation of Free Radicals Similar to ClO

    Science.gov (United States)

    Hirsch, Warren; Kobrak, Mark

    2007-01-01

    The study describes the Lewis structure representation of various free radicals, which are quite similar to the ClO radical and its isoelectronic analogues. The analysis of the periodic trends of these radicals shows that oxygen is the most electronegative atom among them.

  5. The potential impact of ClOx radical complexes on polar stratospheric ozone loss processes

    Directory of Open Access Journals (Sweden)

    B. Vogel

    2006-01-01

    Full Text Available The importance of radical-molecule complexes for atmospheric chemistry has been discussed in recent years. In particular, the existence of a ClO·O2 and ClOx water radical complexes like ClO·H2O, OClO·H2O, OClO·(H2O2, and ClOO·H2O could play a role in enhancing the ClO dimer (Cl2O2 formation and therefore may constitute an important intermediate in polar stratospheric ozone loss cycles. Model simulations performed with the Chemical Lagrangian Model of the Stratosphere (CLaMS will be presented to study the role of radical complexes on polar stratospheric ozone loss processes. The model simulations are performed for the Arctic winter 2002/2003 at a level of 500 K potential temperature and the results are compared to observed ozone loss rates determined by the Match technique. Moreover, recently reported values for the equilibrium constant of the ClO dimer formation are used to restrict the number of possible model results caused by large uncertainties about radical complex chemistry. Our model simulations show that the potential impact of ClO·O2 on polar ozone loss processes is small (dO3/dt≪0.5 ppb/sunlight h provided that the ClO·O2 complex is only weakly stable. Assuming that the binding energies of the ClOx water complexes are much higher than theoretically predicted an enhancement of the ozone loss rate by up to ≈0.5 ppb/sunlight h is simulated. Because it is unlikely that the ClOx water complexes are much more stable than predicted we conclude that these complexes have no impact on polar stratospheric ozone loss processes. Although large uncertainties about radical complex chemistry exist, our findings show that the potential impact of ClOx radical molecule complexes on polar stratospheric ozone loss processes is very small considering pure gas-phase chemistry. However the existence of ClOx radical-molecule complexes could possibly explain discrepancies for the equilibrium constant of the ClO dimer formation found between recent

  6. Pulse radiolysis study of salt effects on reactions of aromatic radical cations with Cl-

    International Nuclear Information System (INIS)

    The effect of quaternary ammonium salts on the decays of the radical cations of biphenyl, trans-stilbene, anthracene and pyrene generated by pulse radiolysis in chlorohydrocarbons has been investigated. The decays, which are due to neutralization reactions with Cl-, are retarded by the addition of salts having non-nucleophilic PF6-, BF4- and ClO4-, whereas the radical cations are rapidly quenched by salts having I- and BPh4-. The retarding effect of the salts is attributed to the formation of ion pairs between the reacting ions and the counter-ions from the salts. The rate constants for the neutralization reactions in 1,2-dichloroethane have been determined for the free-ion and ion-paired states; the latter state is attained by the addition of Bu4NPF6. The rate constant determined in the absence of the salt for Pysup(radical)+ is one order of magnitude smaller than those for the others. The salt effect is also smallest on the reaction of Pysup(radical)+. The charge delocalisation of the large aromatic radical cation may be responsible for the exceptional results for Pysup(radical)+. The largest salt effect was observed on the reaction of Ph2CH+, a charge-localized carbenium ion investigated for comparison. The solvent effect on the neutralization reactions is also discussed. (author)

  7. Thermodynamics of reactions of ClHg and BrHg radicals with atmospherically abundant free radicals

    Directory of Open Access Journals (Sweden)

    T. S. Dibble

    2012-07-01

    Full Text Available Quantum calculations are used to determine the stability of reactive gaseous mercury (Hg(II compounds likely to be formed in the Br-initiated oxidation of gaseous elemental mercury (Hg(0. Due to the absence of any evidence, current models neglect the possible reaction of BrHg• with abundant radicals such as NO, NO2, HO2, ClO, or BrO. The present work demonstrates that BrHg• forms stable compounds, BrHgY, with all of these radicals except NO. Additional calculations on the analogous ClHgY compounds reveal that the strength of the XHg-Y bond (for X=Cl, Br varies little with the identity of the halogen. Calculations further suggest that ClO, BrO, and NO3 do not form strong bonds with Hg(0, and cannot initiate Hg(0 oxidation in the gas phase. The theoretical approach is validated by comparison to published data on HgX2 compounds, both from experiments and highly refined quantum chemical calculations. Quantum calculations on the stability of the anions of XHgY are carried out in order to aid future laboratory studies aimed at molecular-level characterization of gaseous Hg(II compounds. Spectroscopic data on BrHg• are analyzed to determine the equilibrium constant for its formation, and BrHg• is determined to be much less stable than previously estimated. An expression is presented for the rate constant for BrHg• dissociation.

  8. Photochemistry and kinetics of gas phase reactions involving HO and Cl radicals

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, H.H.

    1980-11-01

    The kinetics of the reaction of the HO radical with HNO/sub 3/ and H/sub 2/O/sub 2/, the kinetics of Cl atom reactions with ClNO and ClNO/sub 2/, and the photochemistry of ClNO/sub 2/ and ClONO/sub 2/ were examined. The ultraviolet absorption cross sections of HNO/sub 3/ and ClNO/sub 2/ were also determined as part of the kinetics work. The rate constant for the reaction of HO with HNO/sub 3/ at room temperature was measured to be (8.2 +- 1.8) x 10/sup -14/ cm/sup 3/ molecule/sup -1/ s/sup -1/, where the uncertainty reported here and in all cases reflects twice the experimental standard deviation plus an estimate of systematic errors. The rate constant for the reaction HO + H/sub 2/O/sub 2/ was measured as (1.57 +- 0.23) x 10/sup -12/ cm/sup 3/ molecule/sup -1/ s/sup -1/. This agrees well with the two latest determinations and serves as a calibration of the experimental apparatus used. The Cl + ClNO reaction rate constant was determined to be (1.65 +- 0.32) x 10/sup -11/ cm/sup 3/ molecule/sup -1/ s/sup -1/. The rate constant for the reaction of Cl + ClNO/sub 2/ was found to be (5.05 +- 0.75) x 10/sup -12/ cm/sup 3/ molecule/sup -1/ s/sup -1/. This is the first direct measurement of this rate constant. The photodissociation of ClNO/sub 2/ was studied in great detail. The absorption cross sections were measured in the ultraviolet and found to be substantially lower than the literature values in the Cl/sub 2/ absorption region (300 to 360 nm). Two product channels were investigated; products representative of the two channels were Cl and O atoms. Absolute calibration for the product detection systems was provided by Cl/sub 2/ and NO/sub 2/ photolysis respectively. The quantum uields measured for photolysis at 350 nm, calcualted using the absorption spectrum measured in this work, are: 0.93 +- 0.1 for Cl and less than or equal to 0.025 for O. An upper limit of 0.1 was measured for the O atom channel in ClOHO/sub 2/ photolysis.

  9. Pulse radiolysis study of salt effects on reactions of aromatic radical cations with Cl-

    International Nuclear Information System (INIS)

    Pulse radiolysis of all-trans diphenyl-substituted polyenes, such as 1,4-diphenylbuta-1,3-diene, 1,6-diphenylhexa-1,3,5-triene and 1,8-diphenyl-octa-1,3,5,7-tetraene, in 1,2-dichloroethane solution has been undertaken in the absence and presence of Bu4NPF6. The absorption maxima of the diphenylpolyene radical cations are shifted to shorter wavelengths in the presence of the salt. This is evidence for the formation of the contact ion pairs between the radical cations and PF6-. The decays of the radical cations, which are due to neutralization reactions with Cl-, are retarded by the addition of the salt. The rate constants for the neutralization reactions have been determined for the free-ion and ion-paired states. The pulse radiolysis results are compared with those for other aromatic compounds such as triphenylethylene, tetraphenylethylene and perylene. The appreciable spectral shift is characteristic of the diphenylpolyene radical cations. (author)

  10. Kinetics and mechanism of the gas-phase reaction of Cl atoms and OH radicals with fluorobenzene at 296 K

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Nielsen, Ole John; Hurley, MD;

    2002-01-01

    radical and adduct formation to give the C6H5F-Cl adduct. At 296 K the rate constant for the abstraction channel is k(5a)(Cl+C6H5F) = (1.1 +/- 0.1) x 10(-17) cm(3) molecule(-1) s(-1). The C6H5F-Cl adduct undergoes rapid (k similar to 10(8) s(-1)) decomposition to reform C6H5F and Cl atoms and reaction......Smog chamber/FTIR techniques were used to study the kinetics and mechanism of the reaction of Cl atoms and OH radicals with fluorobenzene, C6H5F, in 700 Torr of N-2 or air diluent at 296 K. Reaction of Cl atoms with C6H5F proceeds via two pathways: H-atom abstraction to give HCl and the C6H4F...... with Cl atoms via a mechanism which, at least in part, leads neither to production of C6H5Cl nor to reformation of C6H5F. As the steady-state Cl atom concentration is increased, the fraction of the C6H5F-Cl adduct undergoing reaction with Cl atoms increases causing an increase in the effective rate...

  11. Kinetic of the gas-phase reactions of OH radicals and Cl atoms with Diethyl Ethylphosphonate and Triethyl Phosphate

    KAUST Repository

    Laversin, H.

    2015-11-30

    In this paper, the relative-rate technique has been used to obtain rate coefficients for the reaction of two organophosphorus compounds: Triethyl phosphate (TEP) and Diethyl ethylphosphonate (DEEP) with OH radicals and Cl atoms at atmospheric pressure and at different temperatures. The calculated rate constants were fitted to the Arrhenius expression over the temperature range 298 – 352 K. The following expressions (in cm3molecule-1s-1) were obtained for the reactions of OH and CL with DEEP and TEP: kOH+DEEP= (7.84±0.65)x10-14exp((1866±824)/T), kOH+TEP = (6.54±0.42)x10-14exp((1897±626)/T), kCl+DEEP = (5.27± 0.80)x10−11exp(765±140/T) and kCl+TEP = (5.23± 0.80)x10−11exp(736± 110/T). These results show that the reaction of the studied compounds with Cl atoms proceeds more rapidly than that with OH radicals. The related tropospheric lifetimes suggest that once emitted into the atmosphere, TEP and DEEP can be removed within a few hours in areas close to their emission sources. TEP and DEEP are principally removed by OH radicals. However, in coastal areas where the Cl atoms’ concentration is higher, TEP and DEEP removal by reaction with Cl atoms could be a competitive process.

  12. Kinetic of the gas-phase reactions of OH radicals and Cl atoms with diethyl ethylphosphonate and triethyl phosphate

    Science.gov (United States)

    Laversin, H.; El Masri, A.; Al Rashidi, M.; Roth, E.; Chakir, A.

    2016-02-01

    In this paper, the relative-rate technique has been used to obtain rate coefficients for the reaction of two organophosphorus compounds: Triethyl phosphate (TEP) and Diethyl ethylphosphonate (DEEP) with OH radicals and Cl atoms at atmospheric pressure and at different temperatures. The calculated rate constants were fitted to the Arrhenius expression over the temperature range 298-352 K. The following expressions (in cm3 molecule-1 s-1) were obtained for the reactions of OH and CL with DEEP and TEP: kOH+DEEP = (7.84 ± 0.65) × 10-14exp((1866 ± 824)/T), kOH+TEP = (6.54 ± 0.42) × 10-14exp((1897 ± 626)/T), kCl+DEEP = (5.27 ± 0.80) × 10-11exp(765 ± 140/T) and kCl+TEP = (5.23 ± 0.80) × 10-11exp(736 ± 110/T). These results show that the reaction of the studied compounds with Cl atoms proceeds more rapidly than that with OH radicals. The related tropospheric lifetimes suggest that once emitted into the atmosphere, TEP and DEEP can be removed within a few hours in areas close to their emission sources. TEP and DEEP are principally removed by OH radicals. However, in coastal areas where the Cl atoms' concentration is higher, TEP and DEEP removal by reaction with Cl atoms could be a competitive process.

  13. Controlled radical polymerization of vinyl acetate in presence of mesoporous silica supported TiCl4 heterogeneous catalyst

    Indian Academy of Sciences (India)

    M A Semsarzadeh; S Amiri; M Azadeh

    2012-10-01

    The heterogeneous TiCl4 catalysts supported on mesoporous mobile composition of matter (MCM-41) and mesoporous silicone particles synthesized from block copolymer of PPG–PEG–PPG (SPB) complexed with dimethyl formamide (DMF) ligand were used in a controlled free radical reaction with benzoyl peroxide (BPO) initiator in bulk polymerization of vinyl acetate (VAc). In this polymerization process, mesoporous particle of SPB increased the reactivity of TiCl4 catalyst with DMF ligand. The active site formed on the surface and the pores of the catalyst produced specific sequences of VAc on the chain with different thermal and microstructural properties and crystallinity.

  14. ESR study of the CH2ClCO radical at 77 K in x-irradiated chloroacetamide crystals

    International Nuclear Information System (INIS)

    X-irradiation of chloroacetamide crystals at 77 K yields at least two radicals which are not stable near 300 K. One of these give rise to a four line ESR spectrum due to two nonequivalent protons with the principal hyperfine tensor components for H (1) equal to 268.4, 260.3, and 256.1 MHz and for H (2) equal to 129.9, 109.7, and 109.9 MHz. The principal g values are g/sub max/=2.0674, g/sub int/=2.0144, and g/sub min/=1.9909. Comparing the corresponding direction cosines to selected molecular directions obtained from an x-ray crystal structure as well as deuteration studies suggests the species to be the π-radical CH2ClCO. The unpaired electron is largely distributed between the oxygen and carbon 2p orbitals whose symmetry axis lies perpendicular to the CCO plane. Crystallographically, the chlorine atom lies nearly in the CCO plane and does not give rise to any resolvable ESR hyperfine couplings. The second radical gives rise to a complex ESR spectrum which has been tentatively assigned as due to xCH2Cl. This radical decays upon warming above 100 K with the resultant formation of CHClCONH2

  15. Radicals

    Czech Academy of Sciences Publication Activity Database

    Jahn, Ullrich; Cornils, B.

    Weinheim: Wiley-VCH, 2013 - (Cornils, B.; Herrmann, W.; Wong, C.; Zanthoff, H.), s. 1897-1898 ISBN 978-3-527-33307-3 Institutional support: RVO:61388963 Keywords : radicals * enzymatic catalysis * coenzyme B12 * ribonucleotide reductase * mutases Subject RIV: CC - Organic Chemistry

  16. Accurate spectroscopic calculations of 21 electronic states of ClO radical including transition properties.

    Science.gov (United States)

    Wang, Xinxin; Shi, Deheng; Sun, Jinfeng; Zhu, Zunlue

    2016-08-01

    The potential energy curves were calculated for the 21 states (X(2)Π, A(2)Π, 3(2)Π, 4(2)Π, 5(2)Π, 1(2)Σ(+), 2(2)Σ(+), 3(2)Σ(+), 1(2)Σ(-), 2(2)Σ(-), 3(2)Σ(-), 1(2)Δ, 2(2)Δ, 3(2)Δ, 1(2)Φ, 1(4)Σ(+), a(4)Σ(-), 2(4)Σ(-), 1(4)Π, 2(4)Π and 1(4)Δ), which originated from the two lowest dissociation channels of ClO radical. The calculations were done for internuclear separations approximately from 0.08 to 1.10nm using the CASSCF method, which was followed by the icMRCI approach with the aug-cc-pV5Z basis set. Of these 21 states, the 1(4)Π, 2(4)Π, 3(2)Δ, 4(2)Π, 5(2)Π, 1(2)Φ, 3(2)Σ(+), 1(4)Δ and 2(4)Σ(-) states are repulsive. The 1(2)Δ, 1(2)Σ(-), 1(4)Σ(+), 2(2)Σ(-), 1(2)Σ(+), 2(2)Σ(+), 2(2)Δ and 3(2)Σ(-) states are very weakly bound. Only the A(2)Π state has one barrier. The avoided crossing exists between the A(2)Π and the 3(2)Π state. However, the avoided crossing does not generate any double wells. Core- valence correlation correction was accounted for at the level of an aug-cc-pCVQZ basis set. Scalar relativistic correction was included by the third-order Douglas-Kroll Hamiltonian approximation at the level of an aug-cc-pVQZ basis set. All the potential energy curves were extrapolated to the complete basis set limit. The spectroscopic parameters were determined. The 1(2)Σ(-), 2(2)Σ(-), 3(2)Σ(-) and 1(4)Σ(+) states may be very difficult to be detected in an experiment, since each of these Λ-S states has only one or two vibrational states. The Franck-Condon factors and radiative lifetimes were calculated for several low vibrational levels of the A(2)Π - X(2)Π, 3(2)Π - a(4)Σ(-), 2(2)Δ - a(4)Σ(-) and 3(2)Σ(-) - 1(2)Σ(-) transitions. The spin-orbit coupling effect on the spectroscopic parameters of the X(2)Π, A(2)Π, 3(2)Π, a(4)Σ(-) and 2(2)Σ(+) states were discussed. The spectroscopic properties reported here can be expected to be reliably predicted ones. PMID:27111157

  17. Kinetics of the reaction of hydroxyl radicals with ethane and a series of Cl- and F-substituted methanes at 300-400degK

    International Nuclear Information System (INIS)

    Gas phase reactions of hydroxyl radicals with ethane and a series of Cl- and F-substituted methanes were studied at atmospheric pressure and over the temperature range 300-400degK. Hydroxyl radicals were produced by pulse radiolysis of water vapour and the decay rate was studied by monitoring the transient light absorption at 3090 A. Arrhenius parameters (A,Esub(a)) for the reaction RH + OH arrow R + HOH were obtained for the reactants RH = C2H6,CH3Cl,CH2Cl2,CHFCl2. CF2Cl2 (CFC-12) which contains no C-H bonds was found to be inert toward attack by hydroxyl radicals. Since no other tropospheric sink reactions have been reported for CFC-12 its possible impact on the stratospheric ozone remains a controversial problem. (author)

  18. Atmospheric chemistry of CF3CHCH2 and C4F9CHCH2: Products of the gas-phase reactions with Cl atoms and OH radicals

    DEFF Research Database (Denmark)

    Nakayama, T.; Takahashi, K.; Matsumi, Y.;

    2007-01-01

    +/- 5% and 6.2 +/- 0.5 respectively. Reaction with Cl atoms proceeds via addition to the > CC Cl and CF3CHClCH2O radicals. Reaction with O-2 and decomposition via C-C bond scission...... presence of NOx gives CxF2x+1CHO in a yield of 88 +/- 9 Reaction with OH radicals proceeds via addition to the > CC radicals. Decomposition via C-C bond scission is the sole fate of CxF2x+1CH(O)CH2OH and CxF2x+1CH(OH)CH2O...... are competing loss mechanisms for CF3CH(O)CH2Cl radicals, k(O2)/k(diss) = (3.8 +/- 1.8) x 10(-18) cm(3) molecule(-1). The atmospheric fate of CF3CHClCH2O radicals is reaction with O-2 to give CF3CHClCHO. The OH radical initiated oxidation of CxF2x+1CHCH2 (x = 1 and 4) in 700 Torr of air in the...

  19. Atmospheric chemistry of trans-CF3CH = CHCl: Kinetics of the gas-phase reactions with Cl atoms, OH radicals, and O-3

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Nilsson, E. J. K.; Nielsen, O. J.;

    2008-01-01

    Long path length Fourier transform infrared (FTIR)-smog chamber techniques were used to study the kinetics of the gas-phase reactions of Cl atoms. OH radicals and O-3 with trans-3,3,3-trifluoro-1-chloropropene, t-CF3CH = CHCl, in 700Torr total pressure at 295 +/- 2 K. Values of k(Cl + t-CF3CH = C...

  20. Atmospheric chemistry of trans-CF3CH=CHCl: Kinetics of the gas-phase reactions with Cl atoms, OH radicals, and O3

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbaek; Nilsson, Elna Johanna Kristina; Nielsen, Ole John;

    2008-01-01

    Long path length Fourier transform infrared (FTIR)–smog chamber techniques were used to study the kinetics of the gas-phase reactions of Cl atoms, OH radicals and O3 with trans-3,3,3-trifluoro-1-chloropropene, t-CF3CH CHCl, in 700 Torr total pressure at 295±2K. Values of k(Cl + t-CF3CH CHCl) = (5...

  1. Fock-space multi-reference coupled-cluster response with the effect of triples on dipole moment of ClO and SF radicals

    Indian Academy of Sciences (India)

    Lalitha Ravichandran; Debarati Bhattacharya; Nayana Vaval; Sourav Pal

    2012-01-01

    Dipole moment calculations of SF and ClO radicals have been carried out using the recently developed partial triples correction to Fock-space multi-reference coupled cluster method. Theoretical calculation of the doublet SF and ClO radicals is useful due to their importance in atmospheric chemistry. The dipole moments of these radicals are extremely sensitive to correlation effects. A brief insight to the way the triples correction has been implemented is presented. We compare the results obtained from our analytic response treatment with that of restricted open Hartree-Fock (ROHF) calculations. Results are presented for both relaxed and non-relaxed approach in the ROHF method. Results suggest the importance of triples corrections. The effects of orbital relaxation are also analysed from the results.

  2. Influence of the reactor wall composition on radicals' densities and total pressure in Cl2 inductively coupled plasmas: II. During silicon etching

    International Nuclear Information System (INIS)

    In an industrial inductively coupled plasma reactor dedicated to silicon etching in chlorine-based chemistry, the density of Cl2 molecules and the gas temperature are measured by means of laser absorption techniques, the density of SiClx (x≤2) radicals by broadband absorption spectroscopy, the density of SiCl4 and ions by mass spectrometry, and the total gas pressure with a capacitance gauge. These measurements permit us to estimate the mole fractions of Cl, SiCl4, and etch product radicals when etching a 200 mm diameter silicon wafer. The pure Cl2 plasma is operated in well prepared chamber wall coating with a thin film of SiOCl, AlF, CCl, or TiOCl. The impact of the chemical nature of the reactor wall's coatings on these mole fractions is studied systematically. We show that the reactor wall coatings have a huge influence on the radicals densities, but this is not only from the difference on Cl-Cl recombination coefficient on different surfaces. During silicon etching, SiClx radicals sticking on the reactor walls are etched by Cl atoms and recycled into the plasma by forming volatile SiCl4. Hence, the loss of Cl atoms in etching the wall deposited silicon is at least as important as their wall recombination in controlling the Cl atoms density. Furthermore, because SiCl4 is produced at high rate by both the wafer and reactor walls, it is the predominant etching product in the gas phase. However, the percentage of redeposited silicon that can be recycled into the plasma depends on the amount of oxygen present in the plasma: O atoms produced by etching the quartz roof window fix Si on the reactor walls by forming a SiOCl deposit. Hence, the higher the O density is, the lower the SiCl4 density will be, because silicon is pumped by the reactor walls and the SiOCl layer formed is not isotropically etched by chlorine. As a result, in the same pure Cl2 plasma at 20 mTorr, the SiClx mole fraction can vary from 18% in a SiOCl-coated reactor, where the O density is the

  3. Actinide bis(porphyrinate) π-radical cations and dications, including the x-ray crystal structure of [(TPP)2Th][SbCl6

    International Nuclear Information System (INIS)

    The chemistry of actinide porphyrin complexes remains in large part undeveloped. The authors report here the first synthesis, isolation, and detailed characterization of several actinide bis-porphyrin sandwich complexes, including the neutral, π-radical monocation, and π-radical dication complexes, [(TPP)2M]/sup n+/, where M = Th(IV) or U(IV) and n = 0, 1, or 2. In addition, the x-ray crystal structure of both the neutral Th complex and its oxidized π-radical cation, [(TPP)2Th][SbCl60, have been solved. These complexes are among the very first π-radical cations where close interaction between two porphyrins occurs. Moreover, these complexes belong to an unusual class of actinide complexes where redox processes can occur in near proximity to the f-element

  4. Reverse atom transfer radical polymerization (RATRP) for anti-clotting PU-LaCl3-g-P(MPC) films

    Science.gov (United States)

    Lu, Chunyan; Zhou, Ninglin; Xiao, Yinghong; Tang, Yida; Jin, Suxing; Wu, Yue; Shen, Jian

    2013-01-01

    Low grafting density is a disadvantage both in reverse atom transfer radical polymerization (RATRP) and ATRP. In this work, the surfaces of polyurethane (PU) were treated by LaCl3·6H2O to obtain modified surfaces with hydrated layers. The reaction of surface-initiated RATRP was carried out easily, which may be attributed to the enriched hydroxyl groups on the hydrated layers. An innovation found in this work is that some free lanthanum ions (La3+) reacted with the silane coupling agent (CPTM) and the product served as mixed ligand complex. The mixed ligand complex instead of conventional 2,2‧-bipyridine was adopted to serve as a ligand in the process of RATRP. As a result, PU surfaces grafted with well-defined polymer brushes (MPC) were obtained. PU substrates before and after modification were characterized by FTIR, XPS, AFM, SEM, SCA, respectively. The results showed that zwitterionic brushes were successfully fabricated on the PU surfaces (P(MPC)), and the content of the grafted layer increased gradually with polymerization time with the grafting density as high as 97.9%. The blood compatibility of the PU substrates was evaluated by plasma recalcification profiles test and platelet adhesion tests in vitro. It was found that all PU functionalized with zwitterionic brush showed improved resistance to nonspecific protein adsorption and platelet adhesion.

  5. Alkylammonium ion radicals in layered ionic crystals of (CnH2n+1NH3)2CdCl4; n=1, 2, 3

    International Nuclear Information System (INIS)

    Single crystals of (CnH2n+1NH3)2CdCl4; n=1, 2, 3 were irradiated with 60Co γ-rays at 77 K. Electron paramagnetic resonance measurements revealed that chlorine molecular ions, Cl-2 were formed with γ-irradiation at 77 K. The crystals irradiated at 77 K were warmed to 300 K for n=1, 2 and to 200 K for n=3. The Cl-2 ions became unstable at temperatures higher than 100 K. Then there appeared quite different features of the electron paramagnetic resonance signals, which had been buried under the signals of Cl-2 at 77 K. It was confirmed by the analysis of the electron paramagnetic resonance signals that the alkylammonium ion radicals were formed. The alkylammonium ions are composed of double sheets, which are similar to the lipid bilayers of plasma membranes. A model of radiation effects on membranes is proposed from the present results. ((orig.))

  6. Reverse atom transfer radical polymerization (RATRP) for anti-clotting PU-LaCl3-g-P(MPC) films

    International Nuclear Information System (INIS)

    Highlights: ► A facile and efficient approach for surface modification of PU was introduced. ► MPC was grafted onto the surface of PU film by RATRP. ► Some free La3+ ions reacted with CPTM and the product served as mixed ligand complex. ► The obtained PUs had good blood compatibility and a possible usage in biomedicine. - Abstract: Low grafting density is a disadvantage both in reverse atom transfer radical polymerization (RATRP) and ATRP. In this work, the surfaces of polyurethane (PU) were treated by LaCl3·6H2O to obtain modified surfaces with hydrated layers. The reaction of surface-initiated RATRP was carried out easily, which may be attributed to the enriched hydroxyl groups on the hydrated layers. An innovation found in this work is that some free lanthanum ions (La3+) reacted with the silane coupling agent (CPTM) and the product served as mixed ligand complex. The mixed ligand complex instead of conventional 2,2′-bipyridine was adopted to serve as a ligand in the process of RATRP. As a result, PU surfaces grafted with well-defined polymer brushes (MPC) were obtained. PU substrates before and after modification were characterized by FTIR, XPS, AFM, SEM, SCA, respectively. The results showed that zwitterionic brushes were successfully fabricated on the PU surfaces (P(MPC)), and the content of the grafted layer increased gradually with polymerization time with the grafting density as high as 97.9%. The blood compatibility of the PU substrates was evaluated by plasma recalcification profiles test and platelet adhesion tests in vitro. It was found that all PU functionalized with zwitterionic brush showed improved resistance to nonspecific protein adsorption and platelet adhesion.

  7. Applied quantum chemistry: Spectroscopic detection and characterization of the F2BS and Cl2BS free radicals in the gas phase

    International Nuclear Information System (INIS)

    In this and previous work [D. J. Clouthier, J. Chem. Phys. 141, 244309 (2014)], the spectroscopic signatures of the X2BY (X = H, halogen, Y = O, S) free radicals have been predicted using high level ab initio theory. The theoretical results have been used to calculate the electronic absorption and single vibronic level (SVL) emission spectra of the radicals under typical jet-cooled conditions. Using these diagnostic predictions, the previously unknown F2BS and Cl2BS free radicals have been identified and characterized. The radicals were prepared in a free jet expansion by subjecting precursor mixtures of BF3 or BCl3 and CS2 vapor to an electric discharge at the exit of a pulsed molecular beam valve. The B~2A1–X~ 2B2 laser-induced fluorescence spectra were found within 150 cm−1 of their theoretically predicted positions with vibronic structure consistent with our Franck-Condon simulations. The B~2A1 state emits down to the ground state and to the low-lying A~2B1 excited state and the correspondence between the observed and theoretically derived SVL emission Franck-Condon profiles was used to positively identify the radicals and make assignments. Excited state Coriolis coupling effects complicate the emission spectra of both radicals. In addition, a forbidden component of the electronically allowed B~–X~ band system of Cl2BS is evident, as signaled by the activity in the b2 modes in the spectrum. Symmetry arguments indicate that this component gains intensity due to a vibronic interaction of the B~2A1 state with a nearby electronic state of 2B2 symmetry

  8. Applied quantum chemistry: Spectroscopic detection and characterization of the F{sub 2}BS and Cl{sub 2}BS free radicals in the gas phase

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Bing; Clouthier, Dennis J., E-mail: dclaser@uky.edu [Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Sheridan, Phillip M. [Department of Chemistry and Biochemistry, Canisius College, Buffalo, New York 14208 (United States)

    2015-03-28

    In this and previous work [D. J. Clouthier, J. Chem. Phys. 141, 244309 (2014)], the spectroscopic signatures of the X{sub 2}BY (X = H, halogen, Y = O, S) free radicals have been predicted using high level ab initio theory. The theoretical results have been used to calculate the electronic absorption and single vibronic level (SVL) emission spectra of the radicals under typical jet-cooled conditions. Using these diagnostic predictions, the previously unknown F{sub 2}BS and Cl{sub 2}BS free radicals have been identified and characterized. The radicals were prepared in a free jet expansion by subjecting precursor mixtures of BF{sub 3} or BCl{sub 3} and CS{sub 2} vapor to an electric discharge at the exit of a pulsed molecular beam valve. The B{sup ~2}A{sub 1}–X{sup ~} {sup 2}B{sub 2} laser-induced fluorescence spectra were found within 150 cm{sup −1} of their theoretically predicted positions with vibronic structure consistent with our Franck-Condon simulations. The B{sup ~2}A{sub 1} state emits down to the ground state and to the low-lying A{sup ~2}B{sub 1} excited state and the correspondence between the observed and theoretically derived SVL emission Franck-Condon profiles was used to positively identify the radicals and make assignments. Excited state Coriolis coupling effects complicate the emission spectra of both radicals. In addition, a forbidden component of the electronically allowed B{sup ~}–X{sup ~} band system of Cl{sub 2}BS is evident, as signaled by the activity in the b{sub 2} modes in the spectrum. Symmetry arguments indicate that this component gains intensity due to a vibronic interaction of the B{sup ~2}A{sub 1} state with a nearby electronic state of {sup 2}B{sub 2} symmetry.

  9. Free radical inactivation of trypsin

    International Nuclear Information System (INIS)

    Reactivities of free radical oxidants, radical OH, Br2-anion radical and Cl3COO radical and a reductant, CO2-anion radical, with trypsin and reactive protein components were determined by pulse radiolysis of aqueous solutions at pH 7, 200C. Highly reactive free radicals, radical OH, Br2-anion radical and CO2-anion radical, react with trypsin at diffusion controlled rates. Moderately reactive trichloroperoxy radical, k(Cl3COO radical + trypsin) preferentially oxidizes histidine residues. The efficiency of inactivation of trypsin by free radicals is inversely proportional to their reactivity. The yields of inactivation of trypsin by radical OH, Br2-anion radical and CO2-anion radical are low, G(inactivation) = 0.6-0.8, which corresponds to ∼ 10% of the initially produced radicals. In contrast, Cl3COO radical inactivates trypsin with ∼ 50% efficiency, i.e. G(inactivation) = 3.2. (author)

  10. Kinetic study of the OH, NO3 radicals and Cl atom initiated atmospheric photo-oxidation of iso-propenyl methyl ether

    Science.gov (United States)

    Taccone, Raúl Alberto; Moreno, Alberto; Colmenar, Inmaculada; Salgado, Sagrario; Martín, María Pilar; Cabañas, Beatriz

    2016-02-01

    Rate coefficients at room temperature and atmospheric pressure for the reaction of isopropenyl methyl ether (i-PME) (CH2dbnd C(CH3)OCH3), with OH and NO3 radicals and with Cl atoms have been determined in a 50 L Pyrex glass reaction chamber in conjunction with Fourier Transform Infrared absorption spectroscopy (FTIR) as a detection technique. The chamber is equipped with a White-type multiple-reflection mirror system with a total optical path length of ≈200 m. Additional experiments were carried out using evacuable Teflon-coated bags (volume 150 L) and a gas chromatography/mass spectrometry-time of flight (GC-TOF MS) detection system. This is the first kinetic study carried out to date for these reactions. The rate coefficients k (in units of cm3 molecule-1 s-1) obtained are: (1.14 ± 0.10) × 10-10 for the OH reaction, (2.41 ± 0.50) × 10-11, for the NO3 reaction and (7.03 ± 0.67) × 10-10 for the Cl reaction. A mechanism is proposed from the observed reaction products. The atmospheric lifetimes of the studied ether is estimated considering the rate coefficients of the reactions with OH and NO3 radicals and Cl atom. Calculated atmospheric lifetimes reveal that the dominant loss process for i-PME is clearly the night-time reaction with the NO3 radical. The radiative efficiency (RE) is obtained from the infrared spectra of the ether and the global warming potential (GWP) is then estimated. Atmospheric implications of the ether emission are discussed.

  11. Atmospheric chemistry of (CF3)2C=CH2: OH radicals, Cl atoms and O3 rate coefficients, oxidation end-products and IR spectra.

    Science.gov (United States)

    Papadimitriou, Vassileios C; Spitieri, Christina S; Papagiannakopoulos, Panos; Cazaunau, Mathieu; Lendar, Maria; Daële, Véronique; Mellouki, Abdelwahid

    2015-10-14

    The rate coefficients for the gas phase reactions of OH radicals, k1, Cl atoms, k2, and O3, k3, with 3,3,3-trifluoro-2(trifluoromethyl)-1-propene ((CF3)2C=CH2, hexafluoroisobutylene, HFIB) were determined at room temperature and atmospheric pressure employing the relative rate method and using two atmospheric simulation chambers and a static photochemical reactor. OH and Cl rate coefficients obtained by both techniques were indistinguishable, within experimental precision, and the average values were k1 = (7.82 ± 0.55) × 10(-13) cm(3) molecule(-1) s(-1) and k2 = (3.45 ± 0.24) × 10(-11) cm(3) molecule(-1) s(-1), respectively. The quoted uncertainties are at 95% level of confidence and include the estimated systematic uncertainties. An upper limit for the O3 rate coefficient was determined to be k3 global warming potential (GWP) calculations, radiative efficiency (RE) was determined from the measured IR absorption cross-sections and treating HFIB both as long (LLC) and short (SLC) lived compounds, including estimated lifetime dependent factors in the SLC case. The HFIB lifetime was estimated from kinetic measurements considering merely the OH reaction, τOH = 14.8 days and including both OH and Cl chemistry, τeff = 10.3 days. Therefore, GWP(HFIB,OH) and GWP(HFIB,eff) were estimated to be 4.1 (LLC) and 0.6 (SLC), as well as 2.8 (LLC) and 0.3 (SLC) for a hundred year time horizon. Moreover, the estimated photochemical ozone creation potential (ε(POCP)) of HFIB was calculated to be 4.60. Finally, HCHO and (CF3)2C(O) were identified as final oxidation products in both OH- and Cl-initiated oxidation, while HC(O)Cl was additionally observed in the Cl-initiated oxidation. PMID:26372403

  12. Halogen Bonding or Hydrogen Bonding between 2,2,6,6-Tetramethyl-piperidine-noxyl Radical and Trihalomethanes CHX3 (X=Cl, Br, I)

    Institute of Scientific and Technical Information of China (English)

    Xiao-ran Zhao; Xue Pang; Xiao-qing Yan; Wei-jun Jin

    2013-01-01

    The halogen and hydrogen bonding complexes between 2,2,6,6-tetramethylpiperidine-noxyl and trihalomethanes (CHX3,X=Cl,Br,I) are simulated by computational quantum chemistry.The molecular electrostatic potentials,geometrical parameters and interaction energy of halogen and hydrogen bonding complexes combined with natural bond orbital analysis are obtained.The results indicate that both halogen and hydrogen bonding interactions obey the order Cl<Br<I,and hydrogen bonding is stronger than the corresponding halogen bond ing.So,hydrogen bonding complexes should be dominant in trihalomethanes.However,it is possible that halogen bonding complex is competitive,even preponderant,in triiodomethane due to the similar interaction energy.This work might provide useful information on specific solvent effects as well as for understanding the mechanism of nitroxide radicals as a bioprobe to interact with the halogenated compounds in biological and biochemical fields.

  13. Atmospheric chemistry of CxF2x+1CH=CH2 (x=1, 2, 4, 6, and 8): Kinetics of gas-phase reactions with Cl atoms, OH radicals, and O-3

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Nielsen, OJ; Toft, A;

    2005-01-01

    Long-path length FT-IR-smog chamber techniques were used to study the title reactions in 700 Torr of N-2 or N-2/O-2, diluent at 296K. There was no discernable effect of CchiF2 chi+1-group size on the reactivity of CchiF2 chi+1CH=CH2 towards Cl atoms and OH radicals. Values of k(Cl+C(chi)Fa(2 chi+...

  14. Atmospheric Chemistry of CF3CF=CH2: Reactions With Cl Atoms, OH Radicals and Ozone

    Science.gov (United States)

    Sulbaek Andersen, M. P.; Javadi, M. S.; Nielsen, O. J.; Hurley, M. D.; Wallington, T. J.; Singh, R.

    2006-12-01

    The detrimental effects of chlorine chemistry on stratospheric ozone levels are well established. Consequently, there has been a concerted international effort to find replacements for chlorofluorocarbons (CFCs) used previously as electronic equipment cleaners, heat transfer agents, refrigerants, and carrier fluids for lubricant deposition. The replacements for CFCs, hydrofluorocarbons (HFCs) and hydrofluorochlorocarbons (HCFCs), have found widespread industrial use over the past decade. Unsaturated fluorinated hydrocarbons are a new class of compounds which have been developed to replace CFCs and HFCs in air condition units. Prior to any large-scale industrial use an assessment of the atmospheric chemistry, and hence environmental impact, of these compounds is needed. To address this need the atmospheric chemistry of CF3CF=CH2 was investigated. Smog chamber/FTIR techniques were used to determine the following properties for this compound: (i) kinetics of reactions with chlorine atoms (ii) kinetics of reactions with hydroxyl radicals (iii) kinetics of reactions with ozone, (iv) atmospheric lifetimes, (v) atmospheric degradation mechanism, and (vi) global warming potentials. The results are discussed with regard to the environmental impact of CF3CF=CH2 and the atmospheric chemistry of unsaturated fluorinated hydrocarbons.

  15. Fístula Arteriovenosa após Nefrectomia Radical: A Propósito de um Caso Clínico Arteriovenous fistula after Radical Nephrectomy:: a case report

    Directory of Open Access Journals (Sweden)

    Nádia Duarte

    2011-09-01

    Full Text Available Existem três tipos diferentes de fístulas arteriovenosas (FAV renais, as congénitas, as idiopáticas e as adquiridas, sendo as últimas as mais frequentes. Dentro destas, as resultantes da nefrectomia são uma raridade. A FAV entre a artéria renal e a veia cava inferior (VCI é uma complicação rara após nefrectomia, estando descritos cerca de 10 casos na literatura. Os autores descrevem um caso de um homem de 51 anos, insuficiente renal crónico (IRC em hemodiálise, enviado à consulta de Urologia por nódulo sólido do rim direito sugestivo de neoplasia, detectado em ressonância magnética (RMN. Foi submetido a nefrectomia radical direita, tendo sido efectuada laqueação conjunta do pedículo renal, sem intercorrências cirúrgicas. Quatro meses depois, inicia clínica de sobrecarga hídrica, de difícil controlo com a hemodiálise e surge um sopro abdominal localizado no flanco direito, contínuo. O estudo por eco-doppler abdominal e angiografia demonstrou a presença de fístula entre a artéria renal e a veia cava inferior. Foi submetido a embolização da FAV com coils, tendo-se registado migração dos mesmos para a artéria pulmonar. A sua recolha foi efectuada imediatamente com basket, sem outras intercorrências. Posteriormente, foi submetido a laparotomia com laqueação simples da artéria renal justa-aórtica, com resolução e estabilização do quadro clínico. A propósito deste caso clínico os autores discutem a abordagem diagnóstica e a hierarquia terapêutica da FAV reno-VCI nomeadamente na cirurgia directa e endovascular.There are three different types of renal arteriovenous fistula (AVF, congenital, idiopathic and acquired, being the latter the most frequent. Within these, those resulting from nephrectomy are rare. The AVF between the renal artery and the inferior vena cava (IVC is a rare complication, with about 10 cases described in literature. The authors describe the case of a 51 year old man, with chronic

  16. ESR studies of ion-molecule reactions of ether, thioether, and olefin radical cations in the CF2ClCFCl2 matrix

    International Nuclear Information System (INIS)

    Several ion-molecule reactions of radical cations with their corresponding neutral molecules have been studied by ESR spectroscopy. These reactions were observed at low temperatures (80-130 K) in a mobile halocarbon matrix following the radiolytic generation of the radical cations from dilute solutions of the parent compound at 77 K. Ether and thioether radical cations react to produce neutral carbon-centered radicals with high regiospecificity, only the oxetan-2-yl radical being detected in the oxetane (trimethylene oxide) system, while the THF-2-yl species is produced in greater abundance than the THF-3-yl species from tetrahydrofuran (THF). The mechanism of these reactions is discussed in terms of either proton transfer from the radical cation or hydrogen atom transfer from the neutral molecule. For dimethyl sulfide, the dimer radical cation is observed prior to the formation of the sup(·)CH2SMe radical. Similarly, the tetramethylethylene radical cation first forms the dimer radical cation which then undergoes a unimolecular reaction to give the 1,1,2-trimethylallyl radical. This is demonstrated by the fact that these two consecutive reactions can be observed separately rather than simultaneously by carefully controlled annealing, the dimer radical cation of tetramethylethylene being formed in high yield from the monomer cation before decomposing to the 1,1,2-trimethylallyl radical. (author)

  17. Free radical hydrogen atom abstraction from saturated hydrocarbons: A crossed-molecular-beams study of the reaction Cl + C{sub 3}H{sub 8} {yields} HCl + C{sub 3}H{sub 7}

    Energy Technology Data Exchange (ETDEWEB)

    Blank, D.A.; Hemmi, N.; Suits, A.G.; Lee, Y.T. [Lawrence Berkeley National Lab., CA (United States)

    1997-04-01

    The abstraction of hydrogen atoms from saturated hydrocarbons are reactions of fundamental importance in combustion as well as often being the rate limiting step in free radical substitution reactions. The authors have begun studying these reactions under single collision conditions using the crossed molecular beam technique on beamline 9.0.2.1, utilizing VUV undulator radiation to selectively ionize the scattered hydrocarbon free radical products (C{sub x}H{sub 2x+1}). The crossed molecular beam technique involves two reactant molecular beams fixed at 90{degrees}. The molecular beam sources are rotatable in the plane defined by the two beams. The scattered neutral products travel 12.0 cm where they are photoionized using the VUV undulator radiation, mass selected, and counted as a function of time. In the authors initial investigations they are using halogen atoms as protypical free radicals to abstract hydrogen atoms from small alkanes. Their first study has been looking at the reaction of Cl + propane {r_arrow} HCl + propyl radical. In their preliminary efforts the authors have measured the laboratory scattering angular distribution and time of flight spectra for the propyl radical products at collision energies of 9.6 kcal/mol and 14.9 kcal/mol.

  18. Influence of the reactor wall composition on radicals' densities and total pressure in Cl2 inductively coupled plasmas: I. Without silicon etching

    International Nuclear Information System (INIS)

    Laser absorption at 355 nm is used to monitor the time variations of the Cl2 density in high-density industrial inductively coupled plasma. This technique is combined with the measurement of the gas temperature from the Doppler width of the 811.5 nm line of argon, added as a trace gas and with the measurement of the total gas pressure with a Baratron gauge. These measurements permit to estimate the mole fractions of Cl2 and Cl species in Cl2 inductively coupled plasmas in a waferless reactor. The impact of the chemical nature of the reactor wall coatings on the Cl and Cl2 mole fractions is studied systematically. We show that under otherwise identical plasma conditions, the Cl mole fraction is completely different when the plasma is operated in SiOCl, AlF, CCl, or TiOCl coated reactors, because the homogeneous recombination probability of Cl atoms is strongly surface dependant. The Cl atom mole fraction reached at 100 W radiofrequency power in SiOCl coated reactor (80%) is much higher than that obtained at 900 W in a ''clean'' AlF reactor (40%). A simple zero-dimensional model permits to provide the recombination coefficient of Cl atoms, γrec: 0.005 on SiOCl film and about 0.3 on the other three coatings. It is proposed to get benefit of this very high sensitivity of Cl2 dissociation rate to the wall coating for the control of the chamber wall status from the Cl2 density measurements in standard conditions

  19. Surface loss rates of H and Cl radicals in an inductively coupled plasma etcher derived from time-resolved electron density and optical emission measurements

    International Nuclear Information System (INIS)

    A study is undertaken of the loss kinetics of H and Cl atoms in an inductively coupled plasma (ICP) reactor used for the etching of III-V semiconductor materials. A time-resolved optical emission spectroscopy technique, also referred to as pulsed induced fluorescence (PIF), has been combined with time-resolved microwave hairpin probe measurements of the electron density in a pulsed Cl2/H2-based discharge for this purpose. The surface loss rate of H, kwH, was measured in H2 plasma and was found to lie in the 125-500 s-1 range (γH surface recombination coefficient of ∼0.006-0.023), depending on the reactor walls conditioning. The PIF technique was then evaluated for the derivation of kwCl, and γCl in Cl2-based plasmas. In contrast to H2 plasma, significant variations in the electron density may occur over the millisecond time scale corresponding to Cl2 dissociation at the rising edge of the plasma pulse. By comparing the temporal evolution of the electron density and the Ar-line intensity curves with 10% of Ar added in the discharge, the authors show that a time-resolved actinometry procedure using Ar as an actinometer is valid at low to moderate ICP powers to estimate the Cl loss rate. They measured a Cl loss rate of ∼125-200 s-1 (0.03≤γCl≤0.06) at 150 W ICP power for a reactor state close to etching conditions. The Cl surface loss rate was also estimated for high ICP power (800 W) following the same procedure, giving a value of ∼130-150 s-1 (γCl∼0.04), which is close to that measured at 150 W ICP power.

  20. Pseudoaneurisma de arteria renal principal asociado a fistula cecal tras nefrectomia radical: caso clínico y revisión de la literatura

    OpenAIRE

    A. Hernando Arteche; C. Alpuente Roman; R. Martin del Toro; A. Pérez-Piqueras Gómez; F. Sainz González; JA. Cabrera Cabrera

    2014-01-01

    Las complicaciones vasculares secundarias al tratamiento quirúrgico del cáncer de riñón localizado son más frecuentes cuando se realiza una cirugía conservadora de nefronas. Sin embargo, la nefrectomía radical no está exenta de ellas. Presentamos el caso de un pseudoaneurisma de la arteria renal principal con comunicación fistulosa a colon ascendente tras nefrectomía radical. El paciente debutó con un episodio de shock hipovolémico debido a hemorragia digestiva baja.

  1. Pseudoaneurisma de arteria renal principal asociado a fistula cecal tras nefrectomia radical: caso clínico y revisión de la literatura

    Directory of Open Access Journals (Sweden)

    A. Hernando Arteche

    2014-06-01

    Full Text Available Las complicaciones vasculares secundarias al tratamiento quirúrgico del cáncer de riñón localizado son más frecuentes cuando se realiza una cirugía conservadora de nefronas. Sin embargo, la nefrectomía radical no está exenta de ellas. Presentamos el caso de un pseudoaneurisma de la arteria renal principal con comunicación fistulosa a colon ascendente tras nefrectomía radical. El paciente debutó con un episodio de shock hipovolémico debido a hemorragia digestiva baja.

  2. Li+ Ion Attachment to Chloromethyl and Chlorofluoromethyl Peroxyl Radicals: Structures and Properties of CHnCl3-nO2-Li+ and CFnCl3-nO2-Li+ (n=0-3) Complexes

    Institute of Scientific and Technical Information of China (English)

    CHENG, Shuang; LI, Hai-Yang; LIU, Ying

    2006-01-01

    The structures and stabilities of these still experimentally unknown CHnCl3-nO2-Li+ and CFnCl3-nO2-Li+ ions have been theoretically investigated by ab initio molecular orbital theory and density functional theory (DFF) in conjunction with the 6-311G(d,p), 6-311 + G(d,p), 6-311 + G(2d,p) and 6-311 + G(2df,2p) basis sets. The optimized geometries, chemical bonding and NBO analysis indicate that these complexes of CHnCl3-nO2-Li+ and CFnCl3-nO2-Li+ exist as ion-dipole molecules. The calculated affinity energies of these species exceed 41.9 kJ/mol, which are large enough to suggest the possibility that these title complexes could be detected as stable species in gas phase by Li+ ion attachment mass spectrometry.

  3. EPR spectroscopy as a tool for investigation of differences in radical status in wheat plants of various tolerances to osmotic stress induced by NaCl and PEG-treatment.

    Science.gov (United States)

    Labanowska, Maria; Filek, Maria; Kurdziel, Magdalena; Bidzińska, Ewa; Miszalski, Zbigniew; Hartikainen, Hélina

    2013-01-15

    Two kinds of wheat genotypes with different tolerance to osmotic stress (NaCl and PEG-treatment) were investigated with biochemical analyses, including the measurements of total antioxidant capacity, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity, reducing power and starch content. The results were compared with electron paramagnetic resonance (EPR) data concerning the nature and amounts of stable long lived radicals present in the control and stressed plants. In addition, the changes in manganese content upon stress conditions were monitored. Different mechanisms of protection against PEG stress in sensitive and tolerant wheat genotypes were postulated. In sensitive genotypes, electrons were created in excess in stress conditions, and were stabilized by polysaccharide molecules, whereas in tolerant genotypes, protection by antioxidants dominated. Moreover, the quinone-semiquinone balance shifted towards semiquinone, which became the place of electron trapping. NaCl-treatment yielded significant effects mainly in sensitive genotypes and was connected with the changes of water structure, leading to inactivation of reactive oxygen species by water molecules. PMID:23141807

  4. Atmospheric chemistry of CF3CF=CH2: Kinetics and mechanisms of gas-phase reactions with Cl atoms, OH radicals, and O-3

    DEFF Research Database (Denmark)

    Nielsen, O. J.; Javadi, M. S.; Andersen, Mads Peter Sulbæk;

    2007-01-01

    Long path length FTIR-smog chamber techniques were used to determine k(Cl + CF3CF=CH2) = (7.03 +/- 0.59) x 10(-11) k(OH + CF3CF=CH2) = (1.05 +/- 0.17) x 10(-12), and k(O-3 + CF3CF=CH2) = (2.77 +/- 0.21) x 10(-21) cm(3) molecule' s(-1) in 700 Torr of N-2, N-2/O-2, or air diluent at 296 K. CF3CF=CH...

  5. Reaction dynamics and photochemistry of divalent systems. [Reaction of Ba with NO sub 2 , H sub 2 O, methanol, ClO sub 2 , O sub 3; photodissociation of NO sub 3 radical and OClO

    Energy Technology Data Exchange (ETDEWEB)

    Davis, H.F.

    1992-05-01

    Results are presented of molecular beam studies of bimolecular and unimolecular reactions of Ba. Chapter 1 discusses the reaction Ba + NO{sub 2}. Formation of the dominant BaO({sup 1}{Sigma}) + NO products resulted primarily from decay of long-lived Ba{sup +}NO{sub 2}{sup {minus}} collision complexes. Secondary mechanisms led to formation of forward scattered, internally excited BaO, and BaNO + O. D{sub o}(Ba-NO) = 65{plus minus}20 kcal/mol. Reactions of ground state and electronically excited Ba with water and alcohols are examined in Chapter 2. Reaction of Ba({sup 1}S) + H{sup 2}O led to BaO + H{sub 2}, whereas excited state Ba({sup 1}D) + H{sub 2}O reacted to form BaOH + H. Collisions between Ba and CH{sub 3}OH led to BaOCH{sub 3} + H. Radical channels involve H-atom migration and are promoted by excitation of the incident Ba atom. In Chapter 3, reactions of Ba({sup 1}S) with ClO{sub 2}2 and O{sub 3} are discussed. Again, direct and complex mechanisms were observed. Formation of BaCl + O{sub 2} from decomposition of Ba{sup +}ClO{sub 2}{sup {minus}} accounted for 10% of total reaction crass section. Although Ba + O{sub 3} {yields} BaO + 0{sub 2} occurs primarily by direct reaction mechanisms, the secondary channel Ba + 0{sub 3} {yields} BaO{sub 2} + 0 involved decay of long lived Ba{sup +}O{sub 3}{sup {minus}} intermediates. D{sub o}(Ba{minus}O{sub 2}) = 120 {plus minus}20 kcal/mol. Photodissociation dynamics of NO{sub 3} is explored in chapter 4. Visible excitation leads to formation of NO + 0{sub 2} and NO{sub 2} + O. Wavelength dependence of branching ratios is investigated. D{sub o}(O-NO{sub 2}) = 48.55 kcal/mole ;and calculate {Delta}H{sub f}(NO{sub 3}) = 17.75 kcal/mole (298K). Chapter 5 discusses the photodissociation of OClO in a molecular beam. Although ClO({sup 2}II) + O({sup 3}P) is dominant, Cl({sup 2}P) + O{sub 2} also forms, with a max yield of 3.9{plus minus}0.8% near 404nm.

  6. A dinuclear [{(p-cym)Ru(II)Cl}2(μ-bpytz˙(-))](+) complex bridged by a radical anion: synthesis, spectroelectrochemical, EPR and theoretical investigation (bpytz = 3,6-bis(3,5-dimethylpyrazolyl)1,2,4,5-tetrazine; p-cym = p-cymene).

    Science.gov (United States)

    Tripathy, Suman Kumar; van der Meer, Margarethe; Sahoo, Anupam; Laha, Paltan; Dehury, Niranjan; Plebst, Sebastian; Sarkar, Biprajit; Samanta, Kousik; Patra, Srikanta

    2016-08-01

    The reaction of the chloro-bridged dimeric precursor [{(p-cym)Ru(II)Cl}(μ-Cl)]2 (p-cym = p-cymene) with the bridging ligand 3,6-bis(3,5-dimethylpyrazolyl)-1,2,4,5-tetrazine (bpytz) in ethanol results in the formation of the dinuclear complex [{(p-cym)Ru(II)Cl}2(μ-bpytz˙(-))](+), [1](+). The bridging tetrazine ligand is reduced to the anion radical (bpytz˙(-)) which connects the two Ru(II) centres. Compound [1](PF6) has been characterised by an array of spectroscopic and electrochemical techniques. The radical anion character has been confirmed by magnetic moment (corresponding to one electron paramagnetism) measurement, EPR spectroscopic investigation (tetrazine radical anion based EPR spectrum) as well as density functional theory based calculations. Complex [1](+) displays two successive one electron oxidation processes at 0.66 and 1.56 V versus Ag/AgCl which can be attributed to [{(p-cym)Ru(II)C}2(μ-bpytz˙(-))](+)/[{(p-cym)Ru(II)Cl}2(μ-bpytz)](2+) and [{(p-cym)Ru(II)Cl}2(μ-bpytz)](+)/[{(p-cym)Ru(III)Cl}2(μ-bpytz)](2+) processes (couples I and II), respectively. The reduction processes (couple III-couple V), which are irreversible, likely involve the successive reduction of the bridging ligand and the metal centres together with loss of the coordinated chloride ligands. UV-Vis-NIR spectroelectrochemical investigation reveals typical tetrazine radical anion containing bands for [1](+) and a strong absorption in the visible region for the oxidized form [1](2+), which can be assigned to a Ru(II) → π* (tetrazine) MLCT transition. The assignment of spectroscopic bands was confirmed by theoretical calculations. PMID:27435992

  7. Spectroscopic Properties of SiCl (X2Π, A2Σ+) Radical%SiCl自由基X2Π和A2Σ+态的光谱性质

    Institute of Scientific and Technical Information of China (English)

    刘慧; 邢伟; 施德恒; 孙金锋; 朱遵略

    2015-01-01

    采用内收缩多参考组态相互作用( icMRCI)方法结合Dunning等相关一致基,计算SiCl自由基X2Π和A2Σ+态的势能曲线。讨论参考能和相关能外推对X2Π和A2Σ+态光谱的影响。对势能进行相对论修正及核价修正计算。拟合势能曲线得到X2Π和A2Σ+态的光谱常数。它们与实验结果一致。利用Breit⁃Pauli算符,计算旋轨耦合效应,得到X2Π1/2和X2Π3/2的势能曲线、并计算它们的光谱常数。求解双原子分子核运动的径向Schrödinger方程,获得无转动SiCl自由基2个Λ⁃S态及X2Π态的耦合分裂态的全部振动态。得到J=0时X2Π态的自旋⁃轨道耦合常数、较高振动态的惯性转动常数以及X2Π1/2和X2Π3/2的振动能级等分子常数。%Potential energy curves (PEC) of ground X2Π and A2Σ+ states of SiCl radical are calculated with internally contracted multireference configuration interaction approach in combination with Dunning’ s correlation⁃consistent basis sets. Reference energy and correlation energy are extrapolated to complete basis set limit. Scalar relativistic and core⁃valence correlation corrections are calculated. Spectroscopic parameters of X2Π and A2Σ+ states are obtained. With Breit⁃Pauli operator, PECs of X2Π1/2 and X2Π3/2 states are computed. Spectroscopic parameters of twoΩstates are determined. Vibration manifolds are evaluated for twoΛ⁃S and twoΩstates of non⁃rotation SiCl radical by numerically solving radical Schrödinger equation of nuclear motion. For each vibrational state, vibrational levels and inertial rotation constants, spin⁃orbital coupling constants of X2Π state are determined.

  8. Urethral catheter removal 7 or 14 days after radical retropubic prostatectomy: clinical implications and complications in a randomized study Sete ou quatorze dias para a retirada da sonda vesical de demora após prostatectomia radical retropúbica: implicações clínicas e complicações em um estudo randomizado

    Directory of Open Access Journals (Sweden)

    Carlos Ary Vargas Souto

    2004-01-01

    , setenta e três pacientes submetidos à prostatectomia radical retropúbica foram prospectivamente randomizados em dois grupos: grupo 1 - 37 pacientes em que a sonda vesical foi removida 7 dias após o procedimento e, grupo 2 - 36 nos quais a sonda foi removida 14 dias após a cirurgia. Os dois grupos apresentavam características clínicas similares, os cirurgiões e técnicas foram as mesmas, e nenhuma cistografia foi realizada para avaliar a presença de vazamentos. RESULTADOS: Dois pacientes no grupo 1 apresentaram sangramento e retenção por coágulos após a retirada da sonda no sétimo dia pós-operatório, e foram manejados através da recolocação da sonda vesical por mais 7 dias. Dois pacientes do grupo 2 desenvolveram esclerose do colo vesical e foram tratados através de incisão do colo vesical com sucesso. A taxa de continência foi a mesma, com dois casos de incontinência em cada grupo. Em torno de duas fraldas por dia eram utilizadas pelos pacientes com incontinência. O seguimento médio foi de 17.5 meses (2 - 30 meses. Não houve formação de fístula urinária, urinoma ou abcesso pélvico após a retirada da sonda vesical. Dois pacientes foram excluidos da análise desta série: um faleceu devido a embolia pulmonar no terceiro dia pós-operatório, e o outro desenvolveu fístula urinária suprapúbica antes da retirada do cateter, que foi mantido por 16 dias. CONCLUSÃO: A retirada da sonda vesical 7 dias após a prostatectomia radical retropúbica, sem realização de cistografia, tem uma baixa taxa de complicações de curto prazo, equivalentes às da retirada da sonda aos 14 dias de pós-operatório.

  9. Radical Evil

    Directory of Open Access Journals (Sweden)

    Carlos Manrique

    2007-12-01

    Full Text Available There is an aporia in Kant’s analysis of evil: he defines radical evilas an invisible disposition of the will, but he also demands an inferential connection between visible evil actions and this invisible disposition. This inference,however, undermines the radical invisibility of radical evil according to Kant’s own definition of the latter. Noting how this invisibility of moral worth is a distinctive feature of Kant’s approach to the moral problem, the paper then asks why, in the Groundwork, he nonetheless forecloses a question about evil that seems to be consistent with this approach. It is argued that to account for this aporia and this foreclosure, one has to interrogate the way in which the category of religion orients Kant’s incipient philosophy of history in Die Religion.

  10. Radical Geography

    Directory of Open Access Journals (Sweden)

    H. Hataminezhad

    2012-07-01

    Full Text Available Interdisciplinary sciences emerging and specialization were result of historical conditions. Lack of common and grand theories have caused social sciences such as Geography disintegrated to many courses. The Geography science has been divided two main courses, Physical and Human through the time. Every one used another similar science in theoretical principles and methodologies for their domain development and strengthening of their bases. The Human Geography was influenced by Anthropology during nineteenth century and was affected by nineteenth century and dawn twentieth century by Sociology and from mid twentieth century until present time by Biological sciences, Psychology, Political economics and social theories. Radical Geography was one of the Human Geography branches that was influenced by Political economics and left ideology. Radical Geography emphasizes on investigation about quality of life in different spaces and attempts to change socio-economic and spatial relationships, therefore critical Geography is one of its similar approaches.

  11. Roaming Radicals

    Science.gov (United States)

    Bowman, Joel M.; Shepler, Benjamin C.

    2011-05-01

    Roaming is a recently verified unusual pathway to molecular products from unimolecular dissociation of an energized molecule. Here we present the evidence for this pathway for H2CO and CH3CHO. Theoretical analysis shows that this path visits the plateau region of the potential energy surface near dissociation to radical products. It is not clear whether roaming is a distinct isolated pathway, in addition to the conventional one via the well-known molecular saddle-point transition state. Evidence is presented to suggest that the two pathways may originate from a single, but highly complicated, dividing surface. Other examples of unusual reaction dynamics are also reviewed.

  12. Atmospheric chemistry of CF3CFHCF2OCF3 and CF3CFHCF2OCF2H: Reaction with Cl atoms and OH radicals, degradation mechanism, and global warming potentials

    DEFF Research Database (Denmark)

    Wallington, TJ; Hurley, MD; Nielsen, OJ;

    2004-01-01

    Fourier transform infrared (FTIR) smog chamber techniques were used to measure k(Cl + CF3CFHCF2OCF3) = (4.09 +/- 0.42) x 10(-17), k(OH + CF3CFHCF2OCF3) = (1.43 +/- 0.28) x 10(-15), k(Cl + CF3CFHCF2OCF2H) = (6.89 +/- 1.29) x 10(-17), and k(OH + CF3CFHCF2OCF2H) = (1.79 +/- 0.34) x 10(-15) cm(3) mol...... respectively. The 100-year time horizon global warming potentials of CF3CFHCF2OCF3 and CF3CFHCF2OCF2H relative to CO2 are 4530 and 4340. Results are discussed with respect to the atmospheric chemistry of hydrofluoroethers....

  13. Pathways for the OH + Cl2 → HOCl + Cl and HOCl + Cl → HCl + ClO Reactions.

    Science.gov (United States)

    Wang, Hongyan; Qiu, Yudong; Czakó, Gábor; Schaefer, Henry F

    2015-07-16

    High level coupled-cluster theory, with spin-orbit coupling evaluated via the Breit-Pauli operator in the interacting-states approach, is used to investigate the OH radical reaction with Cl2 and the subsequent reaction HOCl + Cl. The entrance complex, transition state, and exit complex for both reactions have been determined using the CCSD(T) method with correlation consistent basis sets up to cc-pV6Z. Also reported are CCSDT computations. The OH + Cl2 reaction is predicted to be endothermic by 2.2 kcal/mol, compared to the best experiments, 2.0 kcal/mol. The above theoretical results include zero-point vibrational energy corrections and spin-orbit contributions. The activation energy (Ea) of the OH + Cl2 reaction predicted here, 2.3 kcal/mol, could be as much as 1 kcal/mol too high, but it falls among the four experimental Ea values, which span the range 1.1-2.5 kcal/mol. The exothermicity of the second reaction HOCl + Cl → HCl + ClO is 8.4 kcal/mol, compared to experiment 8.7 kcal/mol. The activation energy for latter reaction is unknown experimentally, but predicted here to be large, 11.5 kcal/mol. There are currently no experiments relevant to the theoretical entrance and exit complexes predicted here. PMID:25965106

  14. Atmospheric chemistry of C2F5CHO: reaction with Cl atoms and OH radicals, IR spectrum of C2F5C(O)O2NO2

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Hurley, MD; Wallington, TJ;

    2003-01-01

    Smog chamber/FTIR techniques were used to measure k(Cl + C2F5CHO) = (1. 96 +/- 0.28) X 10(-12) and k(OH + C2F5CHO) = (5.26 +/- 0.80) x 10(-13) cm(3) molecule(-1) s(-1) in 700 Torr of N-2 or air at 296 +/- 2 K. The C1 initiated oxidation Of C2F5CHO in the presence of NO in air diluent gave COF2, CF3......ONO2, and C2F5C(O)O2NO2 in molar yields of 180 +/- 19 6.1 +/- 0.6 and 1.0 +/- 0.3 respectively. The IR spectrum for C2F5C(O)O2NO2 is reported. Results are discussed with respect to the potential for the atmospheric degradation of fluorinated aldehydes, CnF2n+1CHO, to contribute to the observed...... environmental burden of fluorinated carboxylic acids, CnF2n+1C(O)OH. (C) 2003 Elsevier B.V. All rights reserved....

  15. Radical prostatectomy - discharge

    Science.gov (United States)

    ... prostatectomy - discharge; Laparoscopic radical prostatectomy - discharge; LRP - discharge; Robotic-assisted laparoscopic prostatectomy - discharge ; RALP - discharge; Pelvic lymphadenectomy - ...

  16. Radical theory of rings

    CERN Document Server

    Gardner, JW

    2003-01-01

    Radical Theory of Rings distills the most noteworthy present-day theoretical topics, gives a unified account of the classical structure theorems for rings, and deepens understanding of key aspects of ring theory via ring and radical constructions. Assimilating radical theory's evolution in the decades since the last major work on rings and radicals was published, the authors deal with some distinctive features of the radical theory of nonassociative rings, associative rings with involution, and near-rings. Written in clear algebraic terms by globally acknowledged authorities, the presentation

  17. A resistive pyrolytic radical source for gas-surface reaction studies

    Science.gov (United States)

    Lee, David Y.; Jobbins, Matthew M.; Kandel, S. Alex

    2012-04-01

    We describe a thermal gas cracker designed to produce low fluxes of gas-phase radicals for use in radical-surface reaction studies. A resistively heated thin piece of highly oriented pyrolytic graphite is used as the pyrolysis filament, with the major advantage that this material remains inert at high temperatures. The instrument is built within an existing titanium sublimation pump, which simplifies construction and allows for self-pumping of the radical source. Thermal generation of Cl atoms from Cl2 was chosen to test the effectiveness of the instrument. 35Cl and 37Cl were generated with a concomitant decrease in parent 70Cl2 and 72Cl2 species, as monitored by a residual gas analyzer. The cracking fraction of Cl2 as a function of cell temperature is reported, with nearly full conversion achieved at high temperature.

  18. Free radical reactions with subtilisin Carlsberg

    International Nuclear Information System (INIS)

    Pulse radiolysis has been used to study the mechanisms of radiation-induced inactivation of enzymes. However, interpretation of the results is often complicated by the fact that the G values for enzyme inactivation are usually much smaller than the G values for the radicals formed from water radiolysis. Where inactivation by oxidative free radical attack is concerned, the problem can often be greatly simplified by the use of the free radical probe technique. These free radicals, which include the halide-type radicals Cl2-, Br2-,I2- and (CNS)2-, react much more selectively than OH radicals with amino acids. They can be used to demonstrate that selective oxidation of certain amino acid residues can lead to enzyme inactivation. The technique assists, therefore, in determining whether such sensitive amino acids are present in the active centre and are crucial to the activity of the protein. A number of enzymes have been studied by this method and the amino acid residues found to be necessary for enzymic activitya are in agreement with those identified by conventional biochemical techniques. In these enzymes, free radical attack by the halide radicals leads to inactivation by damage to a single type of amino acid residue which is involved either in catalysis or binding of the substrate. Subtilisin Carlsberg is a serine protease consisting of a poly-peptide chain lacking both cysteine and cystine residues. This paper indicates the use of the selective probe technique in demonstrating that damage to one or more histidine residues leads to inactivation of the enzyme. (author)

  19. Laparoscopic radical cystectomy

    OpenAIRE

    Fergany, Amr

    2012-01-01

    Objective Laparoscopic radical cystectomy (LRC) has emerged as a minimally invasive alternative to open radical cystectomy (ORC). This review focuses on patient selection criteria, technical aspects and postoperative outcomes of LRC. Methods Material for the review was obtained by a PubMed search over the last 10 years, using the keywords ‘laparoscopic radical cystectomy’ and ‘laparoscopic bladder cancer’ in human subjects. Results Twenty-two publications selected for relevance and content we...

  20. Laparoscopic Radical Trachelectomy

    OpenAIRE

    Rendón, Gabriel J.; Ramirez, Pedro T.; Frumovitz, Michael; Schmeler, Kathleen M.; Pareja, Rene

    2012-01-01

    Introduction: The standard treatment for patients with early-stage cervical cancer has been radical hysterectomy. However, for women interested in future fertility, radical trachelectomy is now considered a safe and feasible option. The use of minimally invasive surgical techniques to perform this procedure has recently been reported. Case Description: We report the first case of a laparoscopic radical trachelectomy performed in a developing country. The patient is a nulligravid, 30-y-old fem...

  1. A chain mechanism of radiolysis and photolysis in H[AuCl4]-polyvinyl alcohol system

    International Nuclear Information System (INIS)

    A study of optical properties of H[AuCl4]-containing polyvinyl alcohol (PVA) films allows the basis of a chain mechanism of their photolysis and radiolysis to be put forward. A suggestion is made, that in these chain reactions the Cl radical functions as an active particle, initiating the formation of two interacting chains in reactions of this radical with PVA and [AuCl4]-ions correspondingly. (author)

  2. Physiology of free radicals

    Directory of Open Access Journals (Sweden)

    Stevanović Jelka

    2011-01-01

    Full Text Available Free radicals imply that every atom, molecule, ion, group of atoms, or molecules with one or several non-paired electrons in outer orbital. Among these are: nitrogenoxide (NO•, superoxide-anion-radical (O2•-, hydroxyl radical (OH•, peroxyl radical (ROO•, alcoxyl radical (RO• and hydroperoxyl radical (HO2•. However, reactive oxygen species also include components without non-paired electrons in outer orbital (so-called reactive non-radical agents, such as: singlet oxygen (1O2, peroxynitrite (ONOO-, hydrogen-peroxide (H2O2, hypochloric acid (eg. HOCl and ozone (O3. High concentrations of free radicals lead to the development of oxidative stress which is a precondition for numerous pathological effects. However, low and moderate concentrations of these matter, which occur quite normally during cell metabolic activity, play multiple significant roles in many reactions. Some of these are: regulation of signal pathways within the cell and between cells, the role of chemoattractors and leukocyte activators, the role in phagocytosis, participation in maintaining, changes in the position and shape of the cell, assisting the cell during adaption and recovery from damage (e.g.caused by physical effort, the role in normal cell growth, programmed cell death (apoptosis and cell ageing, in the synthesis of essential biological compounds and energy production, as well as the contribution to the regulation of the vascular tone, actually, tissue vascularization.

  3. Roaming dynamics in radical addition-elimination reactions

    Science.gov (United States)

    Joalland, Baptiste; Shi, Yuanyuan; Kamasah, Alexander; Suits, Arthur G.; Mebel, Alexander M.

    2014-06-01

    Radical addition-elimination reactions are a major pathway for transformation of unsaturated hydrocarbons. In the gas phase, these reactions involve formation of a transient strongly bound intermediate. However, the detailed mechanism and dynamics for these reactions remain unclear. Here we show, for reaction of chlorine atoms with butenes, that the Cl addition-HCl elimination pathway occurs from an abstraction-like Cl-H-C geometry rather than a conventional three-centre or four-centre transition state. Furthermore, access to this geometry is attained by roaming excursions of the Cl atom from the initially formed adduct. In effect, the alkene π cloud serves to capture the Cl atom and hold it, allowing many subsequent opportunities for the energized intermediate to find a suitable approach to the abstraction geometry. These bimolecular roaming reactions are closely related to the roaming radical dynamics recently discovered to play an important role in unimolecular reactions.

  4. Interaction of quadruple bonding rhenium unit with free radicals

    International Nuclear Information System (INIS)

    The interaction of cis-Re2(RCOO)2Cl4, trans-Re2(RCOO)2Cl4, Re2(RCOO)3Cl3 and Re2(RCOO)4Cl2 (where R - alkyl group) with 1,3,5-triphenylverdazyle radical in 1,2-dichlorethane was investigated. It is discovered, that gradual substitution of halogenide ligands by carboxylates in dirhenium(III) clusters led to slowing down of reaction with a radical due to different influence of these ligands on parameters of rhenium - rhenium bond. Presented data showed perspective of Re26+-substances applications as therapeutic agents due to their low toxicity and antiradical properties that occurred by δ-component of quadruple Re-Re bond electron transition. (authors)

  5. Radical chemistry of artemisinin

    Energy Technology Data Exchange (ETDEWEB)

    Denisov, Evgenii T; Solodova, S L; Denisova, Taisa G [Institute of Problems of Chemical Physics, Russian Academy of Sciences, Chernogolovka, Moscow Region (Russian Federation)

    2010-12-29

    The review summarizes physicochemical characteristics of the natural sesquiterpene peroxide artemisinin. The kinetic schemes of transformations of artemisinin radicals under anaerobic conditions are presented and analyzed. The sequence of radical reactions of artemisinin in the presence of oxygen is considered in detail. Special emphasis is given to the intramolecular chain oxidation resulting in the transformation of artemisinin into polyatomic hydroperoxide. The kinetic characteristics of elementary reaction steps involving alkyl, alkoxyl, and peroxyl radicals generated from artemisinin are discussed. The results of testing of artemisinin and its derivatives for the antimalarial activity and the scheme of the biochemical synthesis of artemisinin in nature are considered.

  6. Kinetic isotope effects in the gas phase reactions of OH and Cl with CH3Cl, CD3Cl, and 13CH3Cl

    OpenAIRE

    A. A. Gola; B. D'Anna; Feilberg, K. L.; Sellevåg, S. R.; L. Bache-Andreassen; Nielsen, C. J.

    2005-01-01

    The kinetic isotope effects in the reactions of CH3Cl, 13CH3Cl and CD3Cl with OH radicals and Cl atoms were studied in relative rate experiments at 298±2 K and 1013±10 mbar. The reactions were carried out in a smog chamber using long path FTIR detection and the spectroscopic data analyzed employing a non-linear least squares spectral fitting method using measured high-resolution infrared spectra as well as absorption cross sections from the HITRAN database. The reaction rates of...

  7. Radical cystectomy in eldery

    OpenAIRE

    Bančević Vladimir; Aleksić Predrag; Milović Novak; Spasić Aleksandar; Kovačević Božidar; Toševski Perica; Čampara Zoran; Milošević Radovan; Cerović Snežana

    2015-01-01

    Background/Aim. Radical cystectomy is the method of choice for the treatment of muscle invasive bladder cancer. This major surgery is associated with many complications, especially in older patients. The aim of this study was to analyze preoperative comorbidity, and intraoperative and postoperative complicatons in patients older than 75 years. Methods. This clinical, retrospective study included 46 patients over 75 years, who underwent radical cystectomy. I...

  8. Free Radical Reactions in Food.

    Science.gov (United States)

    Taub, Irwin A.

    1984-01-01

    Discusses reactions of free radicals that determine the chemistry of many fresh, processed, and stored foods. Focuses on reactions involving ascorbic acid, myoglobin, and palmitate radicals as representative radicals derived from a vitamin, metallo-protein, and saturated lipid. Basic concepts related to free radical structure, formation, and…

  9. Reactivities of tetracycline and oxytetracycline with OH radicals

    International Nuclear Information System (INIS)

    Decomposition yields of tetracycline sulphate and oxytetracycline sulphate were determined in argon saturated 0.1N H2SO4 solutions. The decomposition yields of teracyclines decrease in the presence of the Cl- ions. The reaction rate constants of the OH radicals with tetracyclines were also determined. (author)

  10. [Time-resolved FTIR emission studies of laser photofragmentation and radical reactions

    International Nuclear Information System (INIS)

    Fourier transform infrared emission experiments were used to study photofragmentation processes, single collision reactions, energy transfer events, and laser-initiated radical-radical reactions: CH3 + O, Cl + C2H5, CF3CH2 + D, H + H2O, H + HF, and H + NH2

  11. Gangs, Terrorism, and Radicalization

    Directory of Open Access Journals (Sweden)

    Scott Decker

    2011-01-01

    Full Text Available What can street gangs tell us about radicalization and extremist groups? At first glance, these two groups seem to push the boundaries of comparison. In this article, we examine the important similarities and differences across criminal, deviant, and extremist groups. Drawing from research on street gangs, this article explores issues such as levels of explanation,organizational structure, group process, and the increasingly important role of technology and the Internet in the context of radicalization. There are points of convergence across these groups, but it is important to understand the differences between these groups. This review finds little evidence to support the contention that American street gangs are becoming increasingly radicalized. This conclusion is based largely on organizational differences between gangs and terror groups.

  12. Sexuality Following Radical Prostatectomy

    DEFF Research Database (Denmark)

    Fode, Mikkel; Serefoglu, Ege C; Albersen, Maarten;

    2016-01-01

    INTRODUCTION: Radical prostatectomies can result in urinary incontinence and sexual dysfunction. Traditionally, these issues have been studied separately, and the sexual problem that has received the most focus has been erectile dysfunction. AIM: To summarize the literature on sexually related side...... effects and their consequences after radical prostatectomy and focus on the occurrence and management of problems beyond erectile dysfunction. METHODS: The literature on sexuality after radical prostatectomy was reviewed through a Medline search. Original research using quantitative and qualitative...... methodologies was considered. Priority was given to studies exploring aspects of sexuality other than erectile function. MAIN OUTCOME MEASURES: The prevalence, predictive factors, and management of post-prostatectomy sexual problems beyond erectile dysfunction. RESULTS: Most patients will develop urinary...

  13. Resonant cavity spectroscopy of radical species

    Science.gov (United States)

    Ritchie, Grant

    2015-04-01

    Photo-oxidation in the troposphere is highly complex, being initiated by short lived radical species, in the daytime dominated by the hydroxyl radical, OH, with contributions from Cl atoms, and at night by either NO3 radicals or ozone. Chemical oxidation cycles, which couple OH, HO2 and peroxy (RO2) radical species, remove primary emitted trace species which are harmful to humans or to the wider environment. However, many of the secondary products produced by atmospheric photo-oxidation are also directly harmful, for example O3, NO2, acidic and multifunctional species, many of which are of low volatility and are able to partition effectively to the condensed phase, creating secondary organic aerosol (SOA), which contributes a significant fraction of tropospheric aerosol, with associated impacts on climate and human health. The accuracy of atmospheric models to predict these impacts necessarily requires accurate knowledge of the chemical oxidative cycling. Two of the simplest intermediates are the hydroperoxy radical, HO2, and the smallest and dominant organic peroxy radical, CH3O2, formed directly by the reactions of OH with CO/O2 and CH4/O2, respectively, and indirectly following the oxidation of larger VOCs. OH, HO2 and RO2 (collectively known as ROx) are rapidly cycled, being at the centre of tropospheric oxidation, and hence are some of the best targets for models to compare with field data. The reaction of HO2 and RO2 with NO constitutes the only tropospheric in-situ source of O3. Despite their importance, neither HO2 nor CH3O2 is measured directly in the atmosphere. HO2 is only measured indirectly following its conversion to OH and CH3O2 is not measured at all. Typically only the sum of RO2 radicals is measured, making no distinction between different organic peroxy radicals. This contribution will detail recent studies using (i) optical feedback cavity enhanced absorption spectroscopy with both quantum and inter-band cascade lasers in the mid-IR, and (ii

  14. Homegrown religious radicalization

    DEFF Research Database (Denmark)

    Khawaja, Iram

    and their families. Existing literature and ways of thinking about the social psychological process of radicalization will be reviewed, such as social identity theory and transformative learning theory, and a theoretical framework based on a focus on belonging, recognition and the sense of community......It has been reported that a growing number of youngsters from Western Europe are engaging in conflicts motivated by religious and political conflicts in the Middle East. This paper aims at exploring the reasons behind this seemingly religious radicalization from the point of view of the youngsters...

  15. Violent Radicalization in Europe

    DEFF Research Database (Denmark)

    Dalgaard-Nielsen, Anja

    2010-01-01

    When, why, and how do people living in a democracy become radicalized to the point of being willing to use or directly support the use of terrorist violence against fellow citizens? This question has been at the center of academic and public debate over the past years as terrorist attacks...

  16. Radical School Reform.

    Science.gov (United States)

    Gross, Beatrice, Ed.; Gross, Ronald, Ed.

    This book provides a comprehensive examination of the nature of the school crisis and the ways in which radical thinkers and educators are dealing with it. Excerpts from the writings of Jonathan Kozol, John Holt, Kenneth Clark, and others are concerned with the realities of education in ghettos and suburbs. Paul Goodman, Marshall McLuhan, Sylvia…

  17. Radically enhanced molecular recognition

    KAUST Repository

    Trabolsi, Ali

    2009-12-17

    The tendency for viologen radical cations to dimerize has been harnessed to establish a recognition motif based on their ability to form extremely strong inclusion complexes with cyclobis(paraquat-p-phenylene) in its diradical dicationic redox state. This previously unreported complex involving three bipyridinium cation radicals increases the versatility of host-guest chemistry, extending its practice beyond the traditional reliance on neutral and charged guests and hosts. In particular, transporting the concept of radical dimerization into the field of mechanically interlocked molecules introduces a higher level of control within molecular switches and machines. Herein, we report that bistable and tristable [2]rotaxanes can be switched by altering electrochemical potentials. In a tristable [2]rotaxane composed of a cyclobis(paraquat-p-phenylene) ring and a dumbbell with tetrathiafulvalene, dioxynaphthalene and bipyridinium recognition sites, the position of the ring can be switched. On oxidation, it moves from the tetrathiafulvalene to the dioxynaphthalene, and on reduction, to the bipyridinium radical cation, provided the ring is also reduced simultaneously to the diradical dication. © 2010 Macmillan Publishers Limited. All rights reserved.

  18. On Radical Feminism

    Institute of Scientific and Technical Information of China (English)

    翟良锴

    2015-01-01

    <正>All men are created equal.For centuries,human have been struggling for their rights.Women,as a special social force,are fighting vigorously for their equal rights with men.According to an introduction to feminism,there are three main types of feminism:socialist,reformist and radical(Feminism 101).In order

  19. Radical Financial Innovation

    OpenAIRE

    Robert J. Shiller

    2004-01-01

    Radical financial innovation is the development of new institutions and methods that permit risk management to be extended far beyond its former realm, covering important new classes of risks. This paper compares past such innovation with potential future innovation, looking at the process that produced past success and the possibilities for future financial innovation.

  20. OH radicals in the troposphere

    International Nuclear Information System (INIS)

    OH radicals are radicals which determine the photochemistry of the troposphere. The reactivity of OH radicals to organic substances is one of the fundamental criteria for the evaluation of abiotic decomposition. Details are given about the photochemical formation and reaction of OH radicals, the decomposition reactions of organic compounds in the gaseous phase, the determination of the specific rates of OH radical decomposition reactions, measuring methods for the determination of OH radical concentrations in the troposphere, selected results, OH concentration distributions obtained from model calculations, and the influence of trace gases on OH concentrations. A summary, conclusions, and research proposals are attached. (orig./BBR)

  1. Mixed-valence, layered, cation radical salts of the ethane-bridged dimeric tetrathiafulvalene [(EDT-TTF-CH2-)2#centre dot#+] [X-][THF]0.5, X-=FeCl4-, GaCl4-

    DEFF Research Database (Denmark)

    Mézière, C.; Fourmigué, M.; Canadell, E.;

    2000-01-01

    other give rise to both 1D- and 2D-type HOMO ... HOMO interactions whose origin is correlated with the details of the peculiar overlap patterns obtained with those dimeric tetrathiafulvalenes. The weak paramagnetism observed in the GaCl4- salt due to the organic spins of the conducting slabs is hidden...

  2. Phase equilibria and structural species in NdCl3-NaCl, NdCl3-CaCl2, PrCl3-NaCl, and PrCl3-CaCl2 systems

    International Nuclear Information System (INIS)

    This paper reports that equilibrium phase diagrams for the systems NdCl3---CaCl2 and NdCl3---NaCl were determined by differential thermal analysis. A simple eutectic was observed at 59 ± 1 mol% CaCl2 and 600 degrees ± 2 degrees C in the NdCl3---CaCl2 system. A compound NaCl · 3NdCl3 which melts incongruently at 545 degrees ± 5 degrees C to NdCl3 and a liquid containing approximately 47 mol% NaCl, and a eutectic at 68 mol% NaCl and 439 degrees ± 2 degrees C were found in the NdCl3---NaCl system. On the basis of agreements between the activities calculated by the Clausius-Clapeyron equation and Temkin's model using the present data for the NdCl3---CaCl2 system and the literature data for the PrCl3---CaCl2 system, the melts in the former system consist of Nd3+, Ca2+, and Cl- ions and in the latter system of Pr3+, Ca2+, and Cl- ions. The above approach indicates the presence of Na+, Cl-, and NdCl4- in the NdCl3-rich melts in the NdCl3--NaCl system

  3. Free radical transfer in polymers

    International Nuclear Information System (INIS)

    For the present study of free-radical transfer in polymers pulse radiolysis and product studies have been carried out in aqueous solutions using thus far only the water-soluble polymers polyacrylic acid, polymethacrylic acid and polyvinyl alcohol. When OH radicals, generated in the radiolysis of N2O-saturated aqueous solutions, react with polymers the lifetime of the polymer radical thus created very much depends on the number of radicals per polymer chain. When there are a large number of radicals per chain their bimolecular decay may be faster than the corresponding (diffusion controlled) decay of monomeric radicals, but when the macromolecule contains only few or even just one radical their lifetime is considerably prolonged. Highly charged polymers such as polyacrylic acid at high pH attain a rod-like conformation which again favors a long lifetime of the radicals. Under such conditions, radical transfer reactions can occur. For example, in polyacrylic acid OH radicals generate two kinds of radicals side by side. The radical in β-position to the carboxylate group converts into the thermodynamically more stable α-radicals by an H-transfer reaction as can be followed by spectrophotometry. Besides radical transfer reactions β-fragmentation reactions occur causing chain scission. Such reactions can be followed in a pulse radiolysis experiment by conductometry, because counter ions are released upon chain scission. Such a process is especially effective in the case of polymethacrylic acid, where it results in a chain depolymerization. An intramolecular H-abstraction is also observed in the γ-radiolysis of polyacrylic acid with the corresponding peroxyl radicals. This causes a chain reaction to occur. The resulting hydroperoxides are unstable and decarboxylate given rise to acetylacetone-like products. In polyvinyl alcohol the peroxyl radicals in α-position to the alcohol function undergo HO2-elimination. This prevents a scission of the polymer chain in the

  4. Radical surface interactions in industrial silicon plasma etch reactors

    International Nuclear Information System (INIS)

    Silicon etching in Cl2-based plasmas is an important step for the fabrication of IC circuits but the plasma surface interactions involved in this process remain poorly understood. Based on the developments in plasma and reactor wall diagnostics, this paper reviews the recent progress in the understanding of radicals' interactions with surfaces during silicon etching processes. X-ray photoelectron spectroscopy analysis of the reactor walls shows that during Si etching in Cl2/O2 plasmas, the initial Al2O3 chamber walls are coated with a thin SiOCl layer. Broadband absorption spectroscopy with UV light emitting diodes is used to measure the densities of SiClX radicals (X = 0-2) and Cl2 molecules in steady state plasmas running with the chamber walls coated with different materials. To estimate the surface sticking/recombination probability of these radicals on different surfaces, we have performed time-resolved absorption measurements in the afterglow of pulsed discharges. Our work, in agreement with previous results, shows that the Cl2/Cl density ratio in the discharge is driven mainly by the chemical nature of the chamber walls explaining why process drifts are often observed in Cl2/O2 plasmas. The recombination coefficient of Cl atoms on SiOCl surfaces is about 0.007, while it is about 0.1 on clean walls (AlF3). Based on these results, we discuss the best strategy leading to reproducible process control, the present strategy being a systematic reactor cleaning/conditioning between wafers. The SiOCl layer deposition mechanism is then discussed in detail. The sticking coefficient of SiCl on this surface is near unity, while SiCl2 appears to be weakly reactive toward it. Therefore, SiCl (and SiCl+ ions) are the main vectors of Si deposition on the reactor walls, where their subsequent oxidization by O atoms leads to the formation of a SiOCl deposit. Furthermore, we show that SiCl reaction in the plasma volume with Cl2, through the exchange reaction SiCl + Cl2 → SiCl

  5. Radical surface interactions in industrial silicon plasma etch reactors

    Science.gov (United States)

    Cunge, G.; Vempaire, D.; Ramos, R.; Touzeau, M.; Joubert, O.; Bodard, P.; Sadeghi, N.

    2010-06-01

    Silicon etching in Cl2-based plasmas is an important step for the fabrication of IC circuits but the plasma surface interactions involved in this process remain poorly understood. Based on the developments in plasma and reactor wall diagnostics, this paper reviews the recent progress in the understanding of radicals' interactions with surfaces during silicon etching processes. X-ray photoelectron spectroscopy analysis of the reactor walls shows that during Si etching in Cl2/O2 plasmas, the initial Al2O3 chamber walls are coated with a thin SiOCl layer. Broadband absorption spectroscopy with UV light emitting diodes is used to measure the densities of SiClX radicals (X = 0-2) and Cl2 molecules in steady state plasmas running with the chamber walls coated with different materials. To estimate the surface sticking/recombination probability of these radicals on different surfaces, we have performed time-resolved absorption measurements in the afterglow of pulsed discharges. Our work, in agreement with previous results, shows that the Cl2/Cl density ratio in the discharge is driven mainly by the chemical nature of the chamber walls explaining why process drifts are often observed in Cl2/O2 plasmas. The recombination coefficient of Cl atoms on SiOCl surfaces is about 0.007, while it is about 0.1 on clean walls (AlF3). Based on these results, we discuss the best strategy leading to reproducible process control, the present strategy being a systematic reactor cleaning/conditioning between wafers. The SiOCl layer deposition mechanism is then discussed in detail. The sticking coefficient of SiCl on this surface is near unity, while SiCl2 appears to be weakly reactive toward it. Therefore, SiCl (and SiCl+ ions) are the main vectors of Si deposition on the reactor walls, where their subsequent oxidization by O atoms leads to the formation of a SiOCl deposit. Furthermore, we show that SiCl reaction in the plasma volume with Cl2, through the exchange reaction SiCl + Cl2 → SiCl

  6. Controlled Radical Polymerization of Methyl Methacrylate Catalyzed by Hybrid Supported Iron Catalyst

    Institute of Scientific and Technical Information of China (English)

    LI Zhong-hui; ZHANG Yong-ming; XUE Min-zhao; ZHOU Lei; LIU Yan-gang

    2005-01-01

    A supported iron catalyst, which was prepared by anchoring FeCl2/FeCl3 on the cross-linking macroporous polyacrylate ion exchange resin, was evaluated via the controlled radical polymerization. When a small amount of CuCl2/Me6TREN was added, the controllability of the polymerization over the iron-mediated catalyst was significantly improved(Mw/Mn=1.23-1.73), affording a polymer with a low residual metal via a simple catalyst separation procedure. After suitable regeneration, the supported iron catalyst could also be recycled. UV-Vis analysis showed that the additional copper catalyst could facilitate the radical deactivation process.

  7. Toward Radicalizing Community Service Learning

    Science.gov (United States)

    Sheffield, Eric C.

    2015-01-01

    This article advocates a radicalized theoretical construction of community service learning. To accomplish this radicalization, I initially take up a discussion of traditional understandings of CSL rooted in pragmatic/progressive thought. I then suggest that this traditional structural foundation can be radicalized by incorporating Deborah…

  8. Oligorotaxane Radicals under Orders

    OpenAIRE

    WANG, YUPING; Frasconi, Marco; Liu, Wei-Guang; Sun, Junling; Wu, Yilei; Nassar, Majed S.; Botros, Youssry Y.; Goddard, William A.; Wasielewski, Michael R.; Stoddart, J. Fraser

    2016-01-01

    A strategy for creating foldameric oligorotaxanes composed of only positively charged components is reported. Threadlike components—namely oligoviologens—in which different numbers of 4,4′-bipyridinium (BIPY2+) subunits are linked by p-xylylene bridges, are shown to be capable of being threaded by cyclobis(paraquat-p-phenylene) (CBPQT4+) rings following the introduction of radical-pairing interactions under reducing conditions. UV/vis/NIR spectroscopic and electrochemical investigations sugge...

  9. Oligorotaxane Radicals under Orders

    OpenAIRE

    WANG, YUPING; Frasconi, Marco; Liu, Wei-Guang; Sun, Junling; Wu, Yilei; Nassar, Majed S.; Botros, Youssry Y.; Goddard, William A.; Wasielewski, Michael R.; Stoddart, J. Fraser

    2016-01-01

    A strategy for creating foldameric oligorotaxanes composed of only positively charged components is reported. Threadlike components—namely oligoviologens—in which different numbers of 4,4′-bipyridinium (BIPY^(2+)) subunits are linked by p-xylylene bridges, are shown to be capable of being threaded by cyclobis(paraquat-p-phenylene) (CBPQT^(4+)) rings following the introduction of radical-pairing interactions under reducing conditions. UV/vis/NIR spectroscopic and electrochemical investigations...

  10. Populismo radical y fragilidad democrática

    OpenAIRE

    Andrés Benavente Urbina

    2005-01-01

    El Populismo Radical – también llamado populismo revolucionario – es planteado por el autor como una amenaza a la democracia en América Latina, en cuanto instrumentaliza problemas económicos y sociales reales para confrontarse con el sistema institucional. En la primera parte del artículo aborda el plano conceptual, proponiéndose una caracterización tanto para el populismo clásico como para el populismo radical. En la segunda, se hace un estudio de los dos casos en que, durante el año 2005, l...

  11. 75 FR 6862 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-02-12

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY: Federal Aviation Administration (FAA),...

  12. Activation of C-Cl by ground-state aluminum atoms: an EPR and DFT investigation.

    Science.gov (United States)

    Joly, Helen A; Newton, Trevor; Myre, Maxine

    2012-01-01

    The reaction of ground-state Al atoms with dichloromethane (CH(2)Cl(2)) in an adamantane matrix at 77 K yielded two mononuclear Al species. The magnetic parameters, extracted from the axial EPR spectrum of Species A/A' (g(1) = 2.0037, g(2) = g(3) = 2.0030, a(Al,1) = 1307 MHz, a(Al,2) = a(Al,3) = 1273 MHz, a(35Cl) = 34 MHz and a(37Cl) = 28 MHz) were assigned to the Al-atom insertion product, ClCH(2)AlCl. Density functional theory (DFT) calculations of the values of the Al and Cl hyperfine interaction (hfi) of the Cl(1)-Cl(2)gauche conformer were in close agreement with the experimental values of ClCH(2)AlCl. The second species, B/B', had identical magnetic parameters to those of ClCH(2)AlCl with the exception that the Al hfi was 15% smaller. Coordination of a ligand, possessing a lone pair of electrons, to the Al atom of the insertion product, [ClCH(2)AlCl]:X, could cause the a(Al) to decrease by 15%. Alternatively, it is possible that the Cl(1)-Cl(2) anti conformer of ClCH(2)AlCl is also isolated in the matrix. Support for the spectral assignments is given by calculation of the nuclear hfi of [ClCH(2)AlCl]:H(2)O and the Cl(1)-Cl(2) anti conformer of ClCH(2)AlCl using a DFT method. The potential energy hypersurface for an Al atom approaching CH(2)Cl(2), calculated at the B3LYP level, suggests that Al atom abstraction of Cl forming AlCl and CH(2)Cl is favoured in the gas phase. When produced in a matrix, the close proximity of AlCl and CH(2)Cl could account for the formation of ClCH(2)AlCl. EPR evidence was also found for the formation of the CHCl(2) radical. PMID:22086441

  13. Oxalyl chloride, ClC(O)C(O)Cl: UV/vis spectrum and Cl atom photolysis quantum yields at 193, 248, and 351 nm

    Science.gov (United States)

    Ghosh, Buddhadeb; Papanastasiou, Dimitrios K.; Burkholder, James B.

    2012-10-01

    Oxalyl chloride, (ClCO)2, has been used as a Cl atom photolytic precursor in numerous laboratory kinetic and photochemical studies. In this study, the UV/vis absorption spectrum of (ClCO)2 and the Cl atom quantum yields in its photolysis at 193, 248, and 351 nm are reported. The UV/vis spectrum was measured between 200 and 450 nm at 296 K using diode array spectroscopy in conjunction with an absolute cross section obtained at 213.9 nm. Our results are in agreement with the spectrum reported by Baklanov and Krasnoperov [J. Phys. Chem. A 105, 97-103 (2001), 10.1021/jp0019456], which was obtained at 11 discrete wavelengths between 193.3 and 390 nm. Cl atom quantum yields, Φ(λ), were measured using pulsed laser photolysis coupled with time resolved atomic resonance fluorescence detection of Cl. The UV photolysis of (ClCO)2 has been shown in previous studies to occur via an impulsive three-body dissociation mechanism, (COCl)2 + hv → ClCO* + Cl + CO (2), where the excited ClCO radical, ClCO*, either dissociates or stabilizes ClCO* → Cl + CO (3a), → ClCO (3b). ClCO is thermally unstable at the temperatures (253-298 K) and total pressures (13-128 Torr) used in our experiments ClCO + M → Cl + CO + M (4) leading to the formation of a secondary Cl atom that was resolvable in the Cl atom temporal profiles obtained in the 248 and 351 nm photolysis of (ClCO)2. Φ(193 nm) was found to be 2.07 ± 0.37 independent of bath gas pressure (25.8-105.7 Torr, N2), i.e., the branching ratio for channel 2a or the direct formation of 2Cl + 2CO in the photolysis of (ClCO)2 is >0.95. At 248 nm, the branching ratio for channel 2a was determined to be 0.79 ± 0.15, while the total Cl atom yield, i.e., following the completion of reaction (4), was found to be 1.98 ± 0.26 independent of bath gas pressure (15-70 Torr, N2). Φ(351 nm) was found to be pressure dependent between 7.8 and 122.4 Torr (He, N2). The low-pressure limit of the total Cl atom quantum yield, Φ0(351 nm), was 2.05

  14. Effect of Cl substituent in the aromatic tetracycline ring on its reactivity with solvated electrons

    International Nuclear Information System (INIS)

    Decomposition yields of tetracycline hydrochloride (TC.HCl) and chlorotetracycline hydrochloride (ClTC.HCl) in methanol solution saturated with Ar or N2O were determined. Rate constants of the reaction esub(s)- with some antibiotics were obtained. It was demonstrated by 1H NMR that the radical formed by degradation of 7-C-Cl group is recombined with the H atoms leading to ClTC.HCl being converted into tetracycline hydrochloride (TC.HCl). (author)

  15. A radical publishing collective: the Journal of Radical Librarianship

    OpenAIRE

    Simon Barron

    2015-01-01

    The Journal of Radical Librarianship is a new open-access journal publishing scholarly work in the field of radical librarianship. The focus on critical approaches to librarianship and anti-marketisation of information is reflected not only in our subject matter but in our publishing model, our licensing model, and our organisational practices. We hope to foster open and engaging discussions about radical approaches to librarianship and information studies.

  16. Oligorotaxane Radicals under Orders.

    Science.gov (United States)

    Wang, Yuping; Frasconi, Marco; Liu, Wei-Guang; Sun, Junling; Wu, Yilei; Nassar, Majed S; Botros, Youssry Y; Goddard, William A; Wasielewski, Michael R; Stoddart, J Fraser

    2016-02-24

    A strategy for creating foldameric oligorotaxanes composed of only positively charged components is reported. Threadlike components-namely oligoviologens-in which different numbers of 4,4'-bipyridinium (BIPY(2+)) subunits are linked by p-xylylene bridges, are shown to be capable of being threaded by cyclobis(paraquat-p-phenylene) (CBPQT(4+)) rings following the introduction of radical-pairing interactions under reducing conditions. UV/vis/NIR spectroscopic and electrochemical investigations suggest that the reduced oligopseudorotaxanes fold into highly ordered secondary structures as a result of the formation of BIPY(•+) radical cation pairs. Furthermore, by installing bulky stoppers at each end of the oligopseudorotaxanes by means of Cu-free alkyne-azide cycloadditions, their analogous oligorotaxanes, which retain the same stoichiometries as their progenitors, can be prepared. Solution-state studies of the oligorotaxanes indicate that their mechanically interlocked structures lead to the enforced interactions between the dumbbell and ring components, allowing them to fold (contract) in their reduced states and unfold (expand) in their fully oxidized states as a result of Coulombic repulsions. This electrochemically controlled reversible folding and unfolding process, during which the oligorotaxanes experience length contractions and expansions, is reminiscent of the mechanisms of actuation associated with muscle fibers. PMID:27163033

  17. Bursectomy at radical gastrectomy

    Institute of Scientific and Technical Information of China (English)

    Cuneyt; Kayaalp

    2015-01-01

    Radical gastrectomy with extended lymph node dissec tion and prophylactic resection of the omentum, peri toneum over the posterior lesser sac, pancreas and/o spleen was advocated at the beginning of the 1960 s in Japan. In time, prophylactic routine resections of the pancreas and/or spleen were abandoned because of the high incidence of postoperative complications. However omentectomy and bursectomy continued to be standard parts of traditional radical gastrectomy. The bursaomentalis was thought to be a natural barrier against invasion of cancer cells into the posterior part of the stomach. The theoretical rationale for bursectomy was to reduce the risk of peritoneal recurrences by eliminating the peritoneum over the lesser sac, which might include free cancer cells or micrometastases. Over time, the indication for bursectomy was gradually reduced to only patients with posterior gastric wall tumors penetrating the serosa. Despite its theoretical advantages, its benefit for recurrence or survival has not been proven yet. The possible reasons for this inconsistency are discussed in this review. In conclusion, the value of bursectomy in the treatment of gastric cancer is still under debate and large-scale randomized studies are necessary. Until clear evidence of patient benefit is obtained, its routine use cannot be recommended.

  18. Evaluating evidence for Cl sources and oxidation chemistry in a coastal, urban environment

    Directory of Open Access Journals (Sweden)

    C. J. Young

    2013-05-01

    Full Text Available The role of chlorine atoms (Cl in atmospheric oxidation was traditionally thought to be limited to the marine boundary layer, where they are produced through heterogeneous reactions involving sea salt. However, recent observation of photolytic Cl precursors (ClNO2 and Cl2 formed from anthropogenic pollution has expanded the potential importance of Cl to include coastal and continental urban areas. Measurements of ClNO2 in Los Angeles during CalNex showed it to be an important primary (first generation radical source. Ratios of volatile organic compounds (VOCs have been proposed as a sensitive method to quantify Cl oxidation, but have shown little evidence for a significant role of Cl outside of the Arctic. We used a box model with the Master Chemical Mechanism (MCM v3.2 chemistry scheme, constrained by observations in Los Angeles, to examine the Cl-sensitivity of the most commonly used VOC ratios (i-butane, n-butane, and propane as a function of NOx and secondary radical production. Model results indicated these and faster reacting VOC tracer ratios could not detect the influence of Cl unless the sustained ratio of OH to Cl was below 200. However, the model results also show that secondary (second generation OH production resulting from Cl oxidation of VOCs is strongly influenced by NOx, and that this effect can obscure the importance of Cl as a primary oxidant. Calculated concentrations of Cl showed a maximum in mid-morning due to a photolytic source from ClNO2 and loss primarily to reactions with VOCs. The OH to Cl ratio was below 200 for approximately three hours in the morning, but Cl oxidation was not evident from the measured ratios of VOCs. Instead, model simulations show that secondary OH production causes VOC ratios to follow the values expected for OH oxidation despite the significant input of primary Cl from ClNO2 photolysis in the morning. Despite the prevalence of secondary OH as an oxidant in Los Angeles, Cl may play an important

  19. 75 FR 37994 - Airworthiness Directives; Bombardier, Inc. Model CL-600-1A11 (CL-600), CL-600-2A12 (CL-601), CL...

    Science.gov (United States)

    2010-07-01

    ... FR 6862). That NPRM proposed to correct an unsafe condition for the specified products. The MCAI... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3..., Inc. Model CL-600-1A11 (CL- 600), CL-600-2A12 (CL-601), CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-...

  20. LiCl(NaCl)-CeCl3-H2O systems at 25 deg C

    International Nuclear Information System (INIS)

    It has been found by the method of isothermal solubility that aqueous ternary systems LiCl(NaCl)-CeCl3-H2O at 25 deg C refer to the eutonic type with crystallization of the initial components LiClxH2O, NaCl, and CeCl3x7H2O

  1. Radical cations of some water-soluble organoselenium compounds: Insights from pulse radiolysis studies

    Energy Technology Data Exchange (ETDEWEB)

    Priyadarsini, K. Indira [Radiation and Photochemistry Division, Bhabha Atomic Research Center, Trombay, Mumbai 400085 (India)], E-mail: kindira@barc.gov.in; Mishra, B. [Radiation and Photochemistry Division, Bhabha Atomic Research Center, Trombay, Mumbai 400085 (India)

    2008-10-15

    Radical cations of three water-soluble organoselenium compounds, viz., selenourea, selenomethionine, and selenocystine, were produced and their reactions in the pH range 1-7 were studied using nanosecond pulse radiolysis technique. The radical cations, centered on the selenium atom, were generated by one-electron oxidation using hydroxyl ({sup {center_dot}}OH) radicals and Cl{sub 2}{sup {center_dot}}{sup -} and Br{sub 2}{sup {center_dot}}{sup -} radicals. The radical cations of selenourea were converted to dimer radical cations in the entire pH range, which in presence of oxygen released elemental selenium as one of the products. The monomer radical cations of selenomethionine are stabilized at neutral pH by the lone pair of electrons on the N atom of the amino group and undergo partial decarboxylation to produce {alpha}-amino selenyl radicals, which are reducing in nature. At highly acidic conditions, when the lone pair is not available due to protonation, they were converted to dimer radical cations. Selenocystine, being a diselenide, produced monomer radical cations on one-electron oxidation in the entire pH range and acquires stability by sharing the electrons between the two adjacent selenium atoms.

  2. Radical cystectomy in eldery

    Directory of Open Access Journals (Sweden)

    Bančević Vladimir

    2015-01-01

    Full Text Available Background/Aim. Radical cystectomy is the method of choice for the treatment of muscle invasive bladder cancer. This major surgery is associated with many complications, especially in older patients. The aim of this study was to analyze preoperative comorbidity, and intraoperative and postoperative complicatons in patients older than 75 years. Methods. This clinical, retrospective study included 46 patients over 75 years, who underwent radical cystectomy. Indications for surgery, and complications during and after the surgery were followed up. Results. Preoperatively, anemia caused by hematuria was registered in 76% of the patients. In 52% of the patients urine derivation was performed by ileal conduit, in 35% by ureterocutaneostomy and in 13% orthotopic ileal neobladder was created. The average duration of surgery was 190 (120-300 min. A total of 76% of the patients were treated by blood supstitution intraoperatively, average 630 (310-1230 mL. Concerning pathological stage of transitional cell carcinoma of urinary bladder, 26% of the patients had T2, 4% T3a, 52% T3b, and 14% T4a stage. In one case, planocellular carcinoma was diagnosed by patohistological examination, and in 2 cases prostate carcinoma was incidentally found. The average duration of hospitalization was 16 (8-35 days. Conclusion. The main reason for cystectomy in patients over 70 and 80 years was gross hematuria caused by bladder cancer, with consecutive anemia which could not be solved using endoscopic treatment or blood supstitution. As expected, a prolonged stay in hospital after cystectomy, and a higher rate of complications were recorded in this population.

  3. Asymmetrical ClO3 - Its possible formation from ClO and O2 and its possible reactions

    Science.gov (United States)

    Prasad, S. S.; Adams, W. M.

    1980-01-01

    An analysis of recent accurate experimental studies of Cl2-photosensitized O3 decomposition, in which O3 disappearance and OClO formation were directly monitored, suggests the possibility that the suppression of the quantum yield in the presence of O2 may be due to the formation of asymmetrical chlorine trioxide (ClO.O2). Other intermediaries, such as Cl2O2, which may also form in the system are not thought to explain the observations. In addition to its capacity to oxidize, which it shares with other peroxo compounds, asymmetrical ClO3 appears to undergo an interesting class of reactions in which the loosely bound O2 adduct is relatively easily displaced by reactive atoms and radicals such as chlorine.

  4. Studies of radiation-produced radicals and radical ions

    International Nuclear Information System (INIS)

    The radiolytic oxidation of anti-5-methylbicyclo[2.1.0]pentane gives the 1-methylcyclopentene radical cation as the sole rearrangement product H migration whereas oxidation of its syn isomer results in the highly selective formation of the 3-methylcyclopentene radical cation by methyl group migration. Since exactly the same stereoselectivity of olefin formation was observed in corresponding PET (photosensitized electron transfer) studies in the liquid phase, it is concluded that the rearrangement in this case also occurs through the intermediacy of radical cations. Clearly, the radical cation rearrangement must occur very rapidly (10-8--10-9s) under liquid-phase conditions at room temperature to compete with back electron transfer, and therefore the hydrogen (or methyl) migration is a fast process under these conditions. An intramolecular cycloaddition reaction was demonstrated in the radical cation rearrangement of 4-vinylcyclohexene to bicyclo[3.2.1]oct-2-ene. ESR studies show that the radiolytic oxidation of quadricyclane in Freon matrices under conditions of high substrate dilution leads to the bicyclo[3.2.0]hepta-2,6-diene radical cation as well as the previously reported norbornadiene radical cation, the former species predominating at sufficiently low concentrations

  5. Site reactivity in the free radicals induced damage to leucine residues: a theoretical study.

    Science.gov (United States)

    Medina, M E; Galano, A; Alvarez-Idaboy, J R

    2015-02-21

    Several recent computational studies have tried to explain the observed selectivity in radical damage to proteins. In this work we use Density Functional Theory and Transition State Theory including tunnelling corrections, reaction path degeneracy, the effect of diffusion, and the role of free radicals to get further insights into this important topic. The reaction between a leucine derivative and free radicals of biological significance, in aqueous and lipid media, has been investigated. Both thermochemical and kinetic analyses, in both hydrophilic and hydrophobic environments, have been carried out. DPPH, ˙OOH, ˙OOCH3, ˙OOCH2Cl, ˙OOCHCl2 and ˙OOCHCH2 radicals do not react with the target molecule. The reactions are proposed to be kinetically controlled. The leucine gamma site was the most reactive for the reactions with ˙N3, ˙OOCCl3, ˙OCH3, ˙OCH2Cl, and ˙OCHCl2 radicals, with rate constants equal to 1.97 × 10(5), 3.24 × 10(4), 6.68 × 10(5), 5.98 × 10(6) and 8.87 × 10(8) M(-1) s(-1), respectively, in aqueous solution. The ˙Cl, ˙OH and ˙OCCl3 radicals react with leucine at the beta, gamma, and delta positions at rates close to the diffusion limit with the alpha position which is the slowest path and the most thermodynamically favored. The presented results confirm that the Bell-Evans-Polanyi principle does not apply for the reactions between amino acid residues and free radicals. Regarding the influence of the environment on the reactivity of the studied series of free radicals towards leucine residues, it is concluded that hydrophilic media slightly lower the reactivity of the studied radicals, compared to hydrophobic ones, albeit the trends in reactivity are very similar. PMID:25592549

  6. Halogen radicals contribute to photooxidation in coastal and estuarine waters.

    Science.gov (United States)

    Parker, Kimberly M; Mitch, William A

    2016-05-24

    Although halogen radicals are recognized to form as products of hydroxyl radical ((•)OH) scavenging by halides, their contribution to the phototransformation of marine organic compounds has received little attention. We demonstrate that, relative to freshwater conditions, seawater halides can increase photodegradation rates of domoic acid, a marine algal toxin, and dimethyl sulfide, a volatile precursor to cloud condensation nuclei, up to fivefold. Using synthetic seawater solutions, we show that the increased photodegradation is specific to dissolved organic matter (DOM) and halides, rather than other seawater salt constituents (e.g., carbonates) or photoactive species (e.g., iron and nitrate). Experiments in synthetic and natural coastal and estuarine water samples demonstrate that the halide-specific increase in photodegradation could be attributed to photochemically generated halogen radicals rather than other photoproduced reactive intermediates [e.g., excited-state triplet DOM ((3)DOM*), reactive oxygen species]. Computational kinetic modeling indicates that seawater halogen radical concentrations are two to three orders of magnitude greater than freshwater (•)OH concentrations and sufficient to account for the observed halide-specific increase in photodegradation. Dark (•)OH generation by gamma radiolysis demonstrates that halogen radical production via (•)OH scavenging by halides is insufficient to explain the observed effect. Using sensitizer models for DOM chromophores, we show that halogen radicals are formed predominantly by direct oxidation of Cl(-) and Br(-) by (3)DOM*, an (•)OH-independent pathway. Our results indicate that halogen radicals significantly contribute to the phototransformation of algal products in coastal or estuarine surface waters. PMID:27162335

  7. Time-resolved FTIR emission studies of laser photofragmentation and radical reactions

    Energy Technology Data Exchange (ETDEWEB)

    Leone, S.R. [Univ. of Colorado, Boulder (United States)

    1993-12-01

    Recent studies have focused specifically on collision processes, such as single collision energy transfer, reaction dynamics, and radical reactions. The authors employ novel FTIR techniques in the study of single collision energy transfer processes using translationally fast H atom, as well as radical-radical reactions, e.g. CH{sub 3} + O, CF{sub 3} + H(D), and Cl + C{sub 2}H{sub 5}. The fast atoms permit unique high energy regions of certain transition states of combustion species to be probed for the first time.

  8. Radical production in biological systems

    International Nuclear Information System (INIS)

    This paper describes our effort to develop a metric for radiation exposure that is more fundamental than adsorbed dose and upon which a metric for exposure to chemicals could be based. This metric is based on the production of radicals by the two agents. Radicals produced by radiation in biological systems commonly assumed to be the same as those produced in water despite the presence of a variety of complex molecules. This may explain why the extensive efforts to describe the relationship between energy deposition (track structure) and molecular damage to DNA, based on the spectrum of radicals produced, have not been successful in explaining simple biological effects such as cell killing. Current models assume that DNA and its basic elements are immersed in water-like media and only model the production and diffusion of water-based radicals and their interaction with DNA structures; these models lack the cross sections associated with each macro-component of DNA and only treat water-based radicals. It has been found that such models are not realistic because DNA is not immersed in pure water. A computer code capable of simulating electron tracks, low-energy electrons, energy deposition in small molecules, and radical production and diffusion in water like media has been developed. This code is still in at a primitive stage and development is continuing. It is being used to study radical production by radiation, and radical diffusion and interactions in simple molecular systems following their production. We are extending the code to radical production by chemicals to complement our PBPK modeling efforts. It therefore has been developed primarily for use with radionuclides that are in biological materials, and not for radiation fields

  9. Guest Editorial: Processes of Radicalization and De-Radicalization

    Directory of Open Access Journals (Sweden)

    Donatella Della Porta

    2012-05-01

    Full Text Available The study of radicalization and de-radicalization, understood as processes leading towards the increased or decreased use of political violence, is central to the question of how political violence emerges, how it can be prevented, and how it can be contained. The focus section of this issue of the International Journal of Conflict and Violence addresses radicalization and de-radicalization, seeking to develop a more comprehensive understanding of the processes, dynamics, and mechanisms involved and taking an interdisciplinary approach to overcome the fragmentation into separate disciplines and focus areas. Contributions by Pénélope Larzillière, Felix Heiduk, Bill Kissane, Hank Johnston, Christian Davenport and Cyanne Loyle, Veronique Dudouet, and Lasse Lindekilde address repressive settings, legitimacy, institutional aspects, organizational outcomes, and dynamics in Europe, Asia, Africa, and North and South America.

  10. Kinetics and mechanism of protection of thymine from sulphate radical anion under anoxic conditions

    Indian Academy of Sciences (India)

    M Sudha Swaraga; M Adinarayana

    2003-04-01

    The rates of photooxidation of thymine in presence of peroxydisulphate (PDS) have been determined by measuring the absorbance of thymine at 264 nm spectrophotometrically. The rates and the quantum yields () of oxidation of thymine by sulphate radical anion have been determined in the presence of different concentrations of caffeic acid. Increase in [caffeic acid] is found to decrease the rate of oxidation of thymine suggesting that caffeic acid acts as an efficient scavenger of SO$^{\\bullet -}_{4}$ and protects thymine from it. Sulphate radical anion competes for thymine as well as for caffeic acid. The rate constant of sulphate radical anion with caffeic acid has been calculated to be 1.24 × 1010 dm3 mol-1 s-1. The quantum yields of photooxidation of thymine have been calculated from the rates of oxidation of thymine and the light intensity absorbed by PDS at 254 nm, the wavelength at which PDS is activated to sulphate radical anion. From the results of experimentally determined quantum yields (exptl) and the quantum yields calculated (cl) assuming caffeic acid acting only as a scavenger of SO$^{\\bullet -}_{4}$ radicals show that exptl values are lower than cl values. The ' values, which are experimentally found quantum yield values at each caffeic acid concentration and corrected for SO$^{\\bullet-}_{4}$ scavenging by caffeic acid, are also found to be greater than exptl values. These observations suggest that the thymine radicals are repaired by caffeic acid in addition to scavenging of sulphate radical anions.

  11. Synthesis of polystyrene with high melting temperature through BDE/CuCl catalyzed polymerization

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    No matter what the polymerization manner was, polystyrene withunique high Tm (Tm = 170-285℃) was obtained through polymerization of styrene if the amount of BDE/CuCl catalyst was highly increased (mol ratio: St:CuCl = 25:1-2.5:1). Partial crystallinity of the PSt was observed by characterizations of X-ray diffraction and DSC. Spectra of 1H-NMR and 13C-NMR showed that syndiotactic structure contained in the obtained PSt was 5% more than that in aPSt (atactic polystyrene). According to the proposed "coordinated radical cage" mechanism, the coordinated state between radical and catalyst center metal Cu should be more closely packed with increasing the BDE/CuCl catalyst amount, which was induced to partial stereospecific polymerization in the coordinated radical polymerization of St.

  12. Redox Properties of Free Radicals.

    Science.gov (United States)

    Neta, P.

    1981-01-01

    Describes pulse radiolysis as a useful means in studing one-electron redox potentials. This method allows the production of radicals and the determination of their concentration and rates of reaction. (CS)

  13. Cl atom initiated oxidation of 1-alkenes under atmospheric conditions

    Science.gov (United States)

    Walavalkar, M.; Sharma, A.; Alwe, H. D.; Pushpa, K. K.; Dhanya, S.; Naik, P. D.; Bajaj, P. N.

    2013-03-01

    In view of the importance of the oxidation pathways of alkenes in the troposphere, and the significance of Cl atom as an oxidant in marine boundary layer (MBL) and polluted industrial atmosphere, the reactions of four 1-alkenes (C6-C9) with Cl atoms are investigated. The rate coefficients at 298 K are measured to be (4.0 ± 0.5), (4.4 ± 0.7), (5.5 ± 0.9) and (5.9 ± 1.7) × 10-10 cm3 molecule-1 s-1 for 1-hexene, 1-heptene, 1-octene and 1-nonene, respectively. The quoted errors include the experimental 2σ, along with the error in the reference rate coefficients. From the systematic increase in the rate coefficients with the number of carbon atoms, an approximate value for the average rate coefficient for hydrogen abstraction per CH2 group in alkenes is estimated to be (4.9 ± 0.3) × 10-11 cm3 molecule-1 s-1. Based on these rate coefficients, the contribution of Cl atom reactions towards the degradation of these molecules is found to be comparable to that of OH radical reactions, under MBL conditions. The products identified in gas phase indicate that Cl atom addition occurs mainly at the terminal carbon, leading to the formation of 1-chloro-2-ketones and 1-chloro-2-ols. The major gas phase products from the alkenyl radicals (formed by H atom abstraction) are different positional isomers of long chain enols and enones. A preference for dissociation leading to an allyl radical, resulting in aldehydes, lower by three carbon atoms, is indicated. The observed relative yields suggest that in general, the increased contribution of the reactions of Cl atoms towards degradation of 1-alkenes in NOx free air does not result in an increase in the generation of small aldehydes (carbon number < 4), including chloroethanal, as compared to that in the reaction of 1-butene.

  14. Radical polymerization of monoethyl itaconate

    OpenAIRE

    Katsikas Lynne; Nišević Nataša; Ignjatović Milka; Adamović Vladimir; Đakov Tatjana A.; Popović Ivanka G.

    2003-01-01

    The radical polymerization of monoethyl itaconate (MEI) was investigated in bulk and in solution at 60°C using a,a'-azobisisobutyronitrile as initiator. It was established that the obtained polymer poly(monoethyl itaconate) was insoluble in its monomer, implying that the bulk polymerization of MEI was a precipitation polymerization. The polymerization kinetics of MEI were discussed and compared to the polymerization kinetics of structurally similar alkyl itaconates. The homogeneous radical po...

  15. Ecoporn, Irrationalities and Radical Environmentalism

    OpenAIRE

    Măntescu, Liviu

    2016-01-01

    This study explores the ‘irrationalities’ of deep ecology activism in the context of radical environmentalism by using the empirical example of ecoporn. Fuck For Forest is an environmental Non-Governmental Organisation which undertakes fund-raising for re-forestation and forest protection by means of pornography. Following twelve months of ethnographic fieldwork, this study presents first research results on a radical environmental project which does not promote democratic and established pro...

  16. Free radical reactions of monochloramine and hydroxylamine in aqueous solution

    International Nuclear Information System (INIS)

    The use of Advanced Oxidation Technologies to destroy organic contaminants in drinking water may be impacted by the presence of disinfection chemicals such as monochloramine (NH2Cl). To allow a quantitative evaluation of the effect of NH2Cl on the destruction of organics in water rate constants for its reaction with the hydrated electron, the hydroxyl radical and the hydrogen atom were determined in this study. The corresponding values of (2.2±0.2)x1010, (2.8±0.2)x109, and (1.2±0.1)x109 M-1 s-1, respectively, were incorporated into a kinetic computer model whose predictions were in good agreement with experimental chloramine removal under large scale, steady-state electron-beam irradiation conditions. Rate constants were also determined for the reaction of the hydroxyl radical and hydrogen atom with the chloramine hydration product hydroxylamine to supplement established literature data. Hydroxyl radical rate constants for the basic (NH2OH) and acidic (NH3OH+) forms were determined as (8.5±0.4)x109 and ≤5x107 M-1 s-1, respectively, while for hydrogen atom reaction, corresponding rate constants of (4.5±0.1)x107 and (3.6±1.5)x105 M-1 s-1 were found

  17. 76 FR 46597 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-08-03

    .... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes... Bombardier, Inc. model-- Task(s)-- Initial compliance time (whichever occurs later)-- CL-600-2A12 (CL-601... icing. accumulation of 4,800 after the effective inclusive; and CL-600-2B16 (CL- total flight hours;...

  18. A hydrochemical investigation using 36Cl/Cl in groundwaters

    OpenAIRE

    Metcalfe, R.

    2003-01-01

    This report describes 36Cl studies which were undertaken during the H14 financial year. 6 groundwater samples were collected for 36Cl analysis. The results of this study suggest that 36Cl data could potentially be useful for interpreting groundwater origins and flow paths.

  19. The games radicals play : special issue on free radicals and radical ions

    OpenAIRE

    Walton, John C; Ffrancon Williams

    2015-01-01

    Chemistry and Physics have aptly been described as “most excellent children of Intellect and Art” [1]. Both these “children” engage with many playthings, and molecules rank as one of their first favorites, especially radicals, which are amongst the most lively and exciting. Checking out radicals dancing to the music of entropy round their potential energy ballrooms is surely both entertaining and enlightening. Radicals’ old favorite convolutions are noteworthy, but the new styles, modes and a...

  20. Crystalline bipyridinium radical complexes and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Fahrenbach, Albert C.; Barnes, Jonathan C.; Li, Hao; Stoddart, J. Fraser; Basuray, Ashish Neil; Sampath, Srinivasan

    2015-09-01

    Described herein are methods of generating 4,4'-bipyridinium radical cations (BIPY.sup..cndot.+), and methods for utilizing the radical-radical interactions between two or more BIPY.sup..cndot.+ radical cations that ensue for the creation of novel materials for applications in nanotechnology. Synthetic methodologies, crystallographic engineering techniques, methods of physical characterization, and end uses are described.

  1. Crystalline bipyridinium radical complexes and uses thereof

    Science.gov (United States)

    Fahrenbach, Albert C.; Barnes, Jonathan C.; Li, Hao; Stoddart, J. Fraser; Basuray, Ashish Neil; Sampath, Srinivasan

    2015-09-01

    Described herein are methods of generating 4,4'-bipyridinium radical cations (BIPY.sup..cndot.+), and methods for utilizing the radical-radical interactions between two or more BIPY.sup..cndot.+ radical cations that ensue for the creation of novel materials for applications in nanotechnology. Synthetic methodologies, crystallographic engineering techniques, methods of physical characterization, and end uses are described.

  2. Peroxy radical partitioning during the AMMA radical intercomparison exercise

    Directory of Open Access Journals (Sweden)

    M. D. Andrés-Hernández

    2010-11-01

    Full Text Available Peroxy radicals were measured onboard two scientific aircrafts during the AMMA (African Monsoon Multidisciplinary Analysis campaign in summer 2006. This paper reports results from the flight on 16 August 2006 during which measurements of HO2 by laser induced fluorescence spectroscopy at low pressure (LIF-FAGE and total peroxy radicals (RO2* = HO2+ΣRO2, R = organic chain by two similar instruments based on the peroxy radical chemical amplification (PeRCA technique were subject of a blind intercomparison. The German DLR-Falcon and the British FAAM-BAe-146 flew wing tip to wing tip for about 30 min making concurrent measurements on 2 horizontal level runs at 697 and 485 hPa over the same geographical area in Burkina Faso. A full set of supporting measurements comprising photolysis frequencies, and relevant trace gases like CO, NO, NO2, NOy, O3 and a wider range of VOCs were collected simultaneously.

    Results are discussed on the basis of the characteristics and limitations of the different instruments used. Generally, no data bias are identified and the RO2* data available agree quite reasonably within the instrumental errors. The [RO2*]/[HO2] ratios, which vary between 1:1 and 3:1, as well as the peroxy radical variability, concur with variations in photolysis rates and in other potential radical precursors. Model results provide additional information about dominant radical formation and loss processes.

  3. Peroxy radical partitioning during the AMMA radical intercomparison exercise

    Directory of Open Access Journals (Sweden)

    M. D. Andrés-Hernández

    2010-04-01

    Full Text Available Peroxy radicals were measured onboard two scientific aircrafts during the AMMA (African Monsoon Multidisciplinary Analysis campaign in summer 2006. This paper reports results from the flight on 16 August 2006 during which measurements of HO2 by laser induced fluorescence spectroscopy at low pressure (LIF-FAGE and total peroxy radicals (RO2*=HO2+ΣRO2, R= organic chain by two similar instruments based on the peroxy radical chemical amplification (PerCA technique were subject of a blind intercomparison. The German DLR-Falcon and the British FAAM-BAe-146 flew wing tip to wing tip for about 30 min making concurrent measurements on 2 horizontal level runs at 697 and 485 hPa over the same geographical area in Burkina Faso. A full set of supporting measurements comprising photolysis frequencies, and relevant trace gases like CO, NO, NO2, NOy, O3 and a wider range of VOCs were collected simultaneously.

    Results are discussed on the basis of the characteristics and limitations of the different instruments used. Generally, no data bias are identified and the RO2* data available agree quite reasonably within the instrumental errors. The [RO2*]/[HO2] ratios, which vary between 1:1 and 3:1, as well as the peroxy radical variability, concur with variations in photolysis rates and in other potential radical precursors. Model results provide additional information about dominant radical formation and loss processes.

  4. Standard Electrode Potentials Involving Radicals in Aqueous Solution: Inorganic Radicals

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, David A.; Huie, Robert E.; Koppenol, Willem H.; Lymar, Sergei V.; Merenyi, Gabor; Neta, Pedatsur; Ruscic, Branko; Stanbury, David M.; Steenken, Steen; Wardman, Peter

    2015-12-01

    Recommendations are made for standard potentials involving select inorganic radicals in aqueous solution at 25 °C. These recommendations are based on a critical and thorough literature review and also by performing derivations from various literature reports. The recommended data are summarized in tables of standard potentials, Gibbs energies of formation, radical pKa’s, and hemicolligation equilibrium constants. In all cases, current best estimates of the uncertainties are provided. An extensive set of Data Sheets is appended that provide original literature references, summarize the experimental results, and describe the decisions and procedures leading to each of the recommendations

  5. Radical-Enhanced Chinese Character Embedding

    OpenAIRE

    Sun, Yaming; Lin, Lei; Tang, Duyu; Yang, Nan; Ji, Zhenzhou; Wang, Xiaolong

    2014-01-01

    We present a method to leverage radical for learning Chinese character embedding. Radical is a semantic and phonetic component of Chinese character. It plays an important role as characters with the same radical usually have similar semantic meaning and grammatical usage. However, existing Chinese processing algorithms typically regard word or character as the basic unit but ignore the crucial radical information. In this paper, we fill this gap by leveraging radical for learning continuous r...

  6. Constitutional Isomerism of BiW6Cl15: (BiCl)[W6Cl14] and (BiCl2)[W6Cl13

    OpenAIRE

    Meyer, Hans-Juergen

    2009-01-01

    Abstract The compound (BiCl)[W6Cl14] was previously characterized as a product of the reduction of tungsten hexachloride with elemental bismuth. Another modification of BiW6Cl15 is now presented as (BiCl2)[W6Cl13], based on the results of an X-ray single crystal structure determination (space group P21/c, a = 1354.3(2) pm, b = 1234.4(2) pm, c = 1538.9(2) pm, and ? = 118.76(1) ?). The structure of (BiCl2)[W6Cl13] contains chains of [(W6Cl8i)Cl4aCl2/2a-a]- clusters bridged by chlorin...

  7. Laparoscopic radical and partial cystectomy

    Directory of Open Access Journals (Sweden)

    Challacombe Ben

    2005-01-01

    Full Text Available Radical cystectomy remains the standard treatment for muscle invasive organ confined bladder carcinoma. Laparoscopic radical cystoprostatectomy (LRC is an advanced laparoscopic procedure that places significant demands on the patient and the surgeon alike. It is a prolonged procedure which includes several technical steps and requires highly developed laparoscopic skills including intra-corporeal suturing. Here we review the development of the technique, the indications, complications and outcomes. We also examine the potential benefits of robotic-assisted LRC and explore the indications and technique of laparoscopic partial cystectomy.

  8. Radical democratic politics and feminism

    Directory of Open Access Journals (Sweden)

    Martínez Labrin, Soledad

    2006-05-01

    Full Text Available In the article I present a reflection around the radical democratic project proposed by Chantal Mouffe and Ernesto Laclau. Specifically, I examine the application of the project in the context of the “new social movements” and especially, of feminist movement. I state the need of drawing attention to universalism and essentialism as the main obstacles to generate a collective proposal without margins. Nevertheless, doubts remind about the possibility of building up a feminism tailored by the radical democratic project, in a stage in which the political action of such a movement is characterized by categories that are closed and crystallized

  9. Quantification of a radical beam source for methyl radicals

    International Nuclear Information System (INIS)

    A radical beam source for methyl radicals (CH3) was characterized applying ionization-threshold mass spectrometry. The beam source is based on thermal dissociation of methane (CH4) or azomethane (N2(CH3)2) in a heated tungsten capillary. A flux of (3±1)x1013 cm-2 s-1 CH3 radicals is produced using methane as precursor gas and a capillary temperature of 1650 K. Alternatively, a flux of (3±1)x1014 cm-2 s-1 CH3 is produced using azomethane as precursor gas and a capillary temperature of 1150 K. The dominant production of methyl from the precursor methane occurs due to reaction 2 CH4+M→2 CH3+H2+M at the hot tungsten surface. The dominant production of methyl from azomethane occurs due to the reaction N2(CH3)2→2 CH3+N2. Besides methyl radicals, only stable molecules contribute to the emitted flux; within the detection limit, no atomic hydrogen is observed. From the comparison of ionization-threshold mass spectrometry and standard mass spectrometry, it is concluded that the cracking pattern of methane varies with the methane gas temperature. This is explained by the vibrational assisted dissociation of methane

  10. Measurement of free radical kinetics in pulsed plasmas by UV and VUV absorption spectroscopy and by modulated beam mass spectrometry

    International Nuclear Information System (INIS)

    This paper reviews recent progress in the development of time-resolved diagnostics to probe high-density pulsed plasma sources. We focus on time-resolved measurements of radicals' densities in the afterglow of pulsed discharges to provide useful information on production and loss mechanisms of free radicals. We show that broad-band absorption spectroscopy in the ultraviolet and vacuum ultraviolet spectral domain and threshold ionization modulated beam mass spectrometry are powerful techniques for the determination of the time variation of the radicals' densities in pulsed plasmas. The combination of these complementary techniques allows detection of most of the reactive species present in industrial etching plasmas, giving insights into the physico-chemistry reactions involving these species. As an example, we discuss briefly the radicals' kinetics in the afterglow of a SiCl4/Cl2/Ar discharge. (paper)

  11. NaCl islands decorated with 2D or 3D 3,4,9,10-perylene-tetracarboxylic-dianhydride nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Sun Xiaonan [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, NL-9747 AG Groningen (Netherlands); Silly, Fabien, E-mail: Fabien.silly@cea.fr [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, NL-9747 AG Groningen (Netherlands); CEA, IRAMIS, SPCSI, Nanostructures and Organic Semiconductors Laboratory, F-91191 Gif-sur-Yvette (France); UPMC, IPCM, UMR CNRS 7201, 4 place Jussieu, F-75005 Paris (France)

    2010-01-15

    The formation of PTCDA (3,4,9,10-perylene-tetracarboxylic-dianhydride) nanostrutures on Au(1 1 1)-(22x{radical}(3)) covered with NaCl islands has been studied using scanning tunneling microscopy (STM). Atomically resolved STM images show that NaCl grows as (1 0 0)-terminated layers on Au(1 1 1)-(22x{radical}(3)). Local atomic hexagonal packing has also been observed in the NaCl(1 0 0) layer. At submonolayer NaCl coverage, PTCDA forms two-dimensional islands on the Au(1 1 1) surface and nucleate preferentially at the NaCl island step edges. When the Au surface is fully covered with NaCl layers, PTCDA molecules form three-dimensional molecular clusters decorating the step edges of NaCl layers.

  12. Optical properties of the radical anion derived from {alpha}-alanine by deamination

    Energy Technology Data Exchange (ETDEWEB)

    Zagorski, Z.P.; Przybytniak, G.K. [Institute of Nuclear Chemistry and Technology, Warsaw (Poland)

    1997-12-31

    The free radical anion CH{sub 3}CHCOO derived during high energy irradiation from {alpha}-alanine by deamination has been investigated until now by EPR, in irradiated single crystals, for basic research or in completely randomized polycrystalline material for {gamma}-dosimetric purposes. It has been found by spectrophotometry of irradiated single crystals that the free radical absorbs light at {lambda}{sub max}=350 nm. The same radical anion is observed by pulse radiolysis of {alpha}-chloropropionic or propionic anion in aqueous solutions by Cl resp. {alpha}-H abstraction.Basic and applied aspects of the identity of the radical anion obtained in different ways are discussed, as well as consequences for dosimetric techniques. (author). 11 refs, 4 figs.

  13. Detecting Social Polarization and Radicalization

    DEFF Research Database (Denmark)

    Qureshi, Pir Abdul Rasool; Memon, Nasrullah; Wiil, Uffe Kock;

    2011-01-01

    This paper proposes a novel system to detect social polarization and to estimate the chances of violent radicalization associated with it. The required processes for such a system are indicated; it is also analyzed how existing technologies can be integrated into the proposed system to fulfill the...

  14. Exploring the Theories of Radicalization

    Directory of Open Access Journals (Sweden)

    Maskaliūnaitė Asta

    2015-12-01

    Full Text Available After the London bombings in July 2005, the concern of terrorism scholars and policy makers has turned to “home-grown” terrorism and potential for political violence from within the states. “Radicalization” became a new buzz word. This article follows a number of reviews of the literature on radicalization and offers another angle for looking at this research. First, it discusses the term “radicalization” and suggests the use of the following definition of radicalization as a process by which a person adopts belief systems which justify the use of violence to effect social change and comes to actively support as well as employ violent means for political purposes. Next, it proposes to see the theories of radicalization focusing on the individual and the two dimensions of his/her motivation: whether that motivation is internal or external and whether it is due to personal choice or either internal (due to some psychological traits or external compulsion. Though not all theories fall neatly within these categories, they make it possible to make comparisons of contributions from a variety of different areas thus reflecting on the interdisciplinary nature of the study of terrorism in general and radicalization as a part of it.

  15. Kinetics of nitroxyl radical reactions

    International Nuclear Information System (INIS)

    Absolute rate-constants for the reaction of the nitroxyl free radicals TAN and TMPN with radiation-chemically-formed radicals and ions have been determined. k(TAN + X) (in M-1 sec-1) = 4.0 x 109 (for X =OH), 2.9 x 1010(esub(aq)-), 8.0 x 109 (H), 7.2 x 108 (CH2OH), 4.0 x 108 (CH3CHOH), 4.3 x 108 ((CH3)2COH), 2.8 x 108 (CH2(CH3)2COH), 5.9 x 107 (glucose radical), 4.0 x 108 (c-C5H9), and k(TMPN + X) = 3.4 x 109 (OH), 7.8 x 109 (esub(aq)-), 4.9 x 109 (H), 4.4 x 108 (CH2OH), 4.9 x 108 (CH3CHOH), 3.6 x 108 ((CH3)2COH), 1.5 x 108 (CH2(CH3)2COH), 4.9 x 107 (glucose radical), 4.3 x 108 (c-C5H9). Direct measurements by means of a pulse-radiolysis conductivity technique were based on the formation and destruction of charged species in these reactions within certain pH ranges. It is indicated that the radiosensitizing nitroxyles undergo both redox and addition reactions. (author)

  16. Deuterium Substitution used as a Tool for Investigating Mechanisms of Gas-Phase Free-Radical Reactions

    Science.gov (United States)

    Wine, P. H.; Hynes, A. J.; Nicovich, J. M.

    1997-01-01

    Results are presented and discussed for a number of gas phase free radical reactions where H/D isotope effects provide valuable mechanistic insights. The cases considered are (1) the reactions of OH, NO3, and Cl with atmospheric reduced sulfur compounds, (2) the reactions of OH and OD with CH3CN and CD3CN, and (3) the reactions of alkyl radicals with HBr and DBr.

  17. Reaction between protein radicals and other biomolecules

    DEFF Research Database (Denmark)

    Østdal, Henrik; Davies, Michael Jonathan; Andersen, Henrik J

    2002-01-01

    The present study investigates the reactivity of bovine serum albumin (BSA) radicals towards different biomolecules (urate, linoleic acid, and a polypeptide, poly(Glu-Ala-Tyr)). The BSA radical was formed at room temperature through a direct protein-to-protein radical transfer from H(2)O(2....... Subsequent analysis showed a decrease in the concentration of urate upon reaction with the BSA radical, while the BSA radical in the presence of poly(Glu-Ala-Tyr) resulted in increased formation of the characteristic protein oxidation product, dityrosine. Reaction between the BSA radical and a linoleic acid...

  18. CL2QCD - Lattice QCD based on OpenCL

    CERN Document Server

    Philipsen, Owe; Sciarra, Alessandro; Bach, Matthias

    2014-01-01

    We present the Lattice QCD application CL2QCD, which is based on OpenCL and can be utilized to run on Graphic Processing Units as well as on common CPUs. We focus on implementation details as well as performance results of selected features. CL2QCD has been successfully applied in LQCD studies at finite temperature and density and is available at http://code.compeng.uni-frankfurt.de/projects/clhmc.

  19. High 36Cl/Cl ratios in Chernobyl groundwater

    International Nuclear Information System (INIS)

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A 90Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, 36Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. 36Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1–5 orders of magnitude higher than the theoretical natural 36Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of 36Cl, however other sources have to be involved to explain such contamination. 36Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of 90Sr, radionuclide which is impacted by retention and decay processes, 36Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of 36Cl from trench soil are better characterized. - Highlights: • High 36Cl/Cl ratios measured in the Chernobyl Pilot Site groundwater. • Trench T22 acts as a modern source of groundwater contamination by 36Cl but other sources are involved. • Contamination results from dilution of a contaminated “T22” soil water with rainwater. • Processes involved in the modern release need to be investigated

  20. High (36)Cl/Cl ratios in Chernobyl groundwater.

    Science.gov (United States)

    Roux, Céline; Le Gal La Salle, Corinne; Simonucci, Caroline; Van Meir, Nathalie; Fifield, L Keith; Diez, Olivier; Bassot, Sylvain; Simler, Roland; Bugai, Dmitri; Kashparov, Valery; Lancelot, Joël

    2014-12-01

    After the explosion of the Chernobyl Nuclear Power Plant in April 1986, contaminated material was buried in shallow trenches within the exclusion zone. A (90)Sr plume was evidenced downgradient of one of these trenches, trench T22. Due to its conservative properties, (36)Cl is investigated here as a potential tracer to determine the maximal extent of the contamination plume from the trench in groundwater. (36)Cl/Cl ratios measured in groundwater, trench soil water and leaf leachates are 1-5 orders of magnitude higher than the theoretical natural (36)Cl/Cl ratio. This contamination occurred after the Chernobyl explosion and currently persists. Trench T22 acts as an obvious modern point source of (36)Cl, however other sources have to be involved to explain such contamination. (36)Cl contamination of groundwater can be explained by dilution of trench soil water by uncontaminated water (rainwater or deep groundwater). With a plume extending further than that of (90)Sr, radionuclide which is impacted by retention and decay processes, (36)Cl can be considered as a suitable tracer of contamination from the trench in groundwater provided that modern release processes of (36)Cl from trench soil are better characterized. PMID:25128774

  1. 75 FR 30740 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605...

    Science.gov (United States)

    2010-06-02

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or... Directives; Bombardier, Inc. Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant... addition to Bombardier Inc. Models CL-600-2B19, CL-600-2C10 and CL-600-2D24. The latter three models...

  2. Fourier-transform microwave spectroscopy of 24Mg 35Cl generated by laser ablation

    Science.gov (United States)

    Ohshima, Yasuhiro; Endo, Yasuki

    1993-10-01

    The rotational spectrum of 24Mg 35Cl in its X 2Σ + (ν=0 and 1 ) state has been observed in the 14 GHz region by using a Fourier- transform microwave spectrometer combined with a laser-ablation source. The radical was produced by the reaction of atomic Mg vaporized by 532 nm laser light with Cl 2 diluted in Ar. The present observation of the lowest N transition by a high-resolving power instrument has provided accurate hyperfine coupling constants associated with the 35Cl nucleus of this molecule.

  3. 76 FR 477 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-01-05

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY... applicability of the directive for CL-600-2A12 aircraft, serial numbers 3001 through 3066, and for CL-...

  4. 76 FR 66203 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-10-26

    ... Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation... Bombardier, Inc. Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) airplanes, certificated...

  5. From Radical Translation to Radical Interpretation and Back

    Directory of Open Access Journals (Sweden)

    António Zilhão

    2003-12-01

    Full Text Available Both Quine and Davidson put forth programs of empirical semantics satisfying the conditions that characterize the so-called “standpoint of interpretation.” Quine’s less ambitious program of radical translation rests upon two buttresses: causality and empathy. Davidson’s more ambitious program of radical interpretation replaces causality with truth and empathy with rationality. Although the replacement of causality with intersubjective truth seems to me to be a fully justified move, I nevertheless contend that it is more realistic to develop the work of interpretation drawing upon Quine’s less ambitious requirement of empathy than upon Davidson’s view of human agency as rational agency. In order to substantiate this contention, I present an argument to the effect that Davidson’s characterization of human agency as rational is not compatible with his other requirement that truth should pro-vide the essential link connecting speech with environment and action.

  6. 76 FR 6536 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2011-02-07

    ... products. That NPRM was published in the Federal Register on November 9, 2010 (75 FR 68728). That NPRM... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant)...

  7. Electron attachment to fluorocarbon radicals

    Science.gov (United States)

    Shuman, Nicholas

    2014-10-01

    Most plasma environments contain populations of short-lived species such as radicals, the chemistry of which can have significant effects on the overall chemistry of the system. However, few experimental measurements of the kinetics of electron attachment to radicals exist due to the inherent difficulties of working with transient species. Calculations from first principles have been attempted, but are arduous and, because electron attachment is so sensitive to the specifics of the potential surface, their accuracy has not been established. Electron attachment to small fluorocarbon radicals is particularly important, as the data are needed for predictive modeling of plasma etching of semiconductor materials, a key process in the industrial fabrication of microelectronics. We have recently developed a novel flowing afterglow technique to measure several types of otherwise difficult to study plasma processes, including thermal electron attachment to radicals. Variable Electron and Neutral Density Attachment Mass Spectrometry (VENDAMS) exploits dissociative electron attachment in a weakly ionized plasma as a radical source. Here, we apply VENDAMS to a series of halofluorocarbon precursors in order to measure the kinetics of thermal electron attachment to fluorocarbon radicals. Results are presented for CF2, CF3, C2F5,C2F3,1-C3F7, 2-C3F7, and C3F5 from 300 K to 900 K. Both the magnitude and the temperature dependences of rate coefficients as well as product branching between associative and dissociative attachment are highly system specific; however, thermal attachment to all species is inefficient, never exceeding 5% of the collision rate. The data are analyzed using a recently developed kinetic modeling approach, which uses extended Vogt-Wannier theory as a starting point, accounts for dynamic effects such as coupling between the electron and nuclear motions through empirically validated functional forms, and finally uses statistical theory to determine the fate of

  8. Radical carbonylations using a continuous microflow system

    Directory of Open Access Journals (Sweden)

    Takahide Fukuyama

    2009-07-01

    Full Text Available Radical-based carbonylation reactions of alkyl halides were conducted in a microflow reactor under pressurized carbon monoxide gas. Good to excellent yields of carbonylated products were obtained via radical formylation, carbonylative cyclization and three-component coupling reactions, using tributyltin hydride or TTMSS as a radical mediator.

  9. EPR spin trapping of protein radicals

    DEFF Research Database (Denmark)

    Davies, Michael Jonathan; Hawkins, Clare L

    2004-01-01

    Electron paramagnetic resonance (EPR) spin trapping was originally developed to aid the detection of low-molecular-mass radicals formed in chemical systems. It has subsequently found widespread use in biology and medicine for the direct detection of radical species formed during oxidative stress...... selected examples of radical formation on proteins....

  10. Electron exchange involving a sulfur-stabilized ruthenium radical cation.

    Science.gov (United States)

    Shaw, Anthony P; Ryland, Bradford L; Norton, Jack R; Buccella, Daniela; Moscatelli, Alberto

    2007-07-01

    Half-sandwich Ru(II) amine, thiol, and thiolate complexes were prepared and characterized by X-ray crystallography. The thiol and amine complexes react slowly with acetonitrile to give free thiol or amine and the acetonitrile complex. With the thiol complex, the reaction is dissociative. The thiolate complex has been oxidized to its Ru(III) radical cation and the solution EPR spectrum of that radical cation recorded. Cobaltocene reduces the thiol complex to the thiolate complex. The 1H and 31P NMR signals of the thiolate complex in acetonitrile become very broad whenever the thiolate and thiol complexes are present simultaneously. The line broadening is primarily due to electron exchange between the thiolate complex and its radical cation; the latter is generated by an unfavorable redox equilibrium between the thiol and thiolate complexes. Pyramidal inversion of sulfur in the thiol complex is fast at room temperature but slow at lower temperatures; major and minor conformers of the thiol complex were observed by 31P NMR at -98 degrees C in CD2Cl2. PMID:17569530

  11. Free radicals and Dupuytren's contracture.

    OpenAIRE

    Murrell, G. A.; Francis, M. J.; Bromley, L.

    1987-01-01

    The concentration of substrate expressed as hypoxanthine capable of reacting with xanthine oxidase to release superoxide free radicals (O2-) was measured in control and Dupuytren's contracture palmar fascia. In Dupuytren's contracture palmar fascia the concentration of hypoxanthine was six times that of control and was greatest in "nodular" areas. Xanthine oxidase activity was also detected in Dupuytren's contracture palmar fascia. These results suggest a greater potential for hypoxanthine-xa...

  12. ClEST cluster :Cl_singleton2103 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2103 brain ... protein 44 Cimex lectularius nuclear gene 353 CACCAAGAAAATTACAAGTTTCTGCAG ... ATTCCGAAGAACGTGTTTATGTGCTTTGTGAACCTATCAA mb13004 1 brain ... protein 44 [Culex quinquefasciatus] XP_001847023 8 ...

  13. ClEST cluster :Cl_singleton0405 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0405 isoform a Cimex lectularius nuclear gene 310 CACCGACGCCACTCAGAGAGGGAGAGCTAAGCAG ... GAAGATTCAAGACTCTGTACCGCTGCTAAAAGGCCGCCAG fb20013 1 brain ... peptide IDL-like protein [Tribolium castaneum] EFA ...

  14. ClEST cluster :Cl_singleton0355 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0355 acyl- synthetase long- isoform b Cimex lectularius nuclear gene 19...GGAAGGTGCATTGGGAGCAATAAAAGCGATCGCATTTGTCTGTGATATCATCACTTATCCAGTGTACCTTATTCTACAACGGCCATGGG fb18010 1 acyl-CoA synthetase [Gl

  15. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  16. Spin-coupling in ferric metalloporphyrin radical cation complexes: Mössbauer and susceptibility studies

    Science.gov (United States)

    Lang, George; Boso, Brian; Erler, Brian S.; Reed, Christopher A.

    1986-03-01

    The ferric metalloporphyrin π-radical cation complexes Fe(III) (OClO3)2 (TPP.) and [Fe(III) Cl (TPP.)] [SbCl6] were examined in microcrystalline form by Mössbauer spectroscopy and magnetic susceptometry over a range of temperatures and applied fields. All measurements on the six-coordinate Fe(OClO3)2 (TPP.) were consistent with isolated molecules having an S=5/2 iron site with zero field splitting (12 cm-1) S2z that is ferromagnetically coupled to the S=1/2 porphyrin radical by an energy term (-110 cm-1) Sṡs. Thus the ground state is overall spin-3. In the five-coordinate [FeCl (TPP.)] [SbCl6] the susceptibility is in reasonable agreement with the results of a calculation based on zero field splitting (12 cm-1) S2z for the S=5/2 iron and antiferromagnetic coupling (200 cm-1) Sṡs with the radical to give an overall spin-2 ground state. However, the Mössbauer measurements require a more complicated model having the same large intramolecular iron-radical coupling, a smaller zero field splitting (3 cm-1) S2z, and weak intermolecular antiferromagnetic coupling between heme pairs given by (32 cm-1) s1ṡs2 or, equivalently, (0.65 cm-1) S1ṡS2. A slightly improved correspondence with the measured susceptibility results. The intermolecular antiferromagnetic coupling probably results from crystallization of the [FeCl (TPP.)]+ cations in face-to-face dimers as observed in other closely related five-coordinate iron (III) porphyrins.

  17. Radical-scavenging Activity of Natural Methoxyphenols vs. Synthetic Ones using the Induction Period Method

    OpenAIRE

    Seiichiro Fujisawa; Ichiro Yokoe; Mariko Ishihara; Norihisa Okada; Toshiko Atsumi; Yoshinori Kadoma

    2007-01-01

    The radical-scavenging activities of the synthetic antioxidants 2-allyl-4-X-phenol (X=NO2, Cl, Br, OCH3, COCH3, CH3, t-(CH3)3, C6H5) and 2,4-dimethoxyphenol, and the natural antioxidants eugenol and isoeugenol, were investigated using differential scanning calorimetry (DSC) by measuring their anti-1,1-diphenyl-2-picrylhydrazyl (DPPH) radical activity and the induction period for polymerization of methyl methacrylate (MMA) initiated by thermal decomposition of 2,2'-azobisisobutyronitrile (AIBN...

  18. Photofragment imaging study of the CH2CCH2OH radical intermediate of the OH+allene reaction

    International Nuclear Information System (INIS)

    These velocity map imaging experiments characterize the photolytic generation of one of the two radical intermediates formed when OH reacts via an addition mechanism with allene. The CH2CCH2OH radical intermediate is generated photolytically from the photodissociation of 2-chloro-2-propen-1-ol at 193 nm. Detecting the Cl atoms using [2+1] resonance-enhanced multiphoton ionization evidences an isotropic angular distribution for the Cl+CH2CCH2OH photofragments, a spin-orbit branching ratio for Cl(2P1/2):Cl(2P3/2) of 0.28, and a bimodal recoil kinetic energy distribution. Conservation of momentum and energy allows us to determine from this data the internal energy distribution of the nascent CH2CCH2OH radical cofragment. To assess the possible subsequent decomposition pathways of this highly vibrationally excited radical intermediate, we include electronic structure calculations at the G3//B3LYP level of theory. They predict the isomerization and dissociation transition states en route from the initial CH2CCH2OH radical intermediate to the three most important product channels for the OH+allene reaction expected from this radical intermediate: formaldehyde+C2H3, H+acrolein, and ethene+CHO. We also calculate the intermediates and transition states en route from the other radical adduct, formed by addition of the OH to the center carbon of allene, to the ketene+CH3 product channel. We compare our results to a previous theoretical study of the O+allyl reaction conducted at the CBS-QB3 level of theory, as the two reactions include several common intermediates

  19. Chemical repair of trypsin-histidinyl radical

    International Nuclear Information System (INIS)

    Oxyl radicals, such as hydroxyl, alkoxyl and peroxyl, react with biomolecules to produce bioradicals. Unless chemically repaired by suitable antioxidants, these bioradicals form stable products. This leads to loss of biological function of parent biomolecules with deleterious biological results, such as mutagenesis and cancer. Consequently, the understanding of the mechanisms of oxyl radical damage to biomolecules and chemical repair of such damage is crucial for the development of strategies for anticarcinogenesis and radioprotection. In this study the chemical repair of the histidinyl radical generated upon the trichloromethylperoxyl radical reaction with trypsin vas investigated by gamma radiolysis. The trypsin histidinyl radical is a resonance-stabilized heterocyclic free radical which was found to be unreactive with oxygen. The efficacy of the chemical repair of the trypsin-histidinyl radical by endogenous antioxidants which are electron donors (e.g. 5-hydroxytryptophan, uric acid) is compared to that of antioxidants which are H-atom donors (e. g. glutathione). 9 refs., 2 figs., 1 tab

  20. Kinetics of the ClO + HO2 reaction over the temperature range T = 210-298 K.

    Science.gov (United States)

    Ward, Michael K M; Rowley, David M

    2016-02-17

    The rate coefficient for the atmospherically important radical reaction: which leads to ozone depletion, has been studied over the temperature range T = 210-298 K and at ambient pressure p = 760 ± 20 Torr. The reaction was studied using laser flash photolysis radical generation coupled with broadband charge coupled device absorption spectroscopy employing a two-dimensional charge-coupled-device (CCD) detection system. ClO radicals were generated following the photolysis of Cl2 and Cl2O gas mixtures diluted in nitrogen and oxygen. ClO radicals were monitored using broadband fingerprinting of their characteristic vibronic (A(2)Π ← X(2)Π) spectral structure, representing a definitive monitoring of this radical. Addition of hydroperoxy radical precursors to the gas mixture (methanol and oxygen) subsequently led to a competition for photolytically generated Cl atoms and a simultaneous prompt formation of both ClO and HO2 radicals. Detailed analysis and modelling of the radical production routes provided a degree of constraint into numerical integration simulations which were then used to interrogate and fit to ClO temporal profiles to extract the rate coefficient k1. The ambient temperature (T = 298 K) rate coefficient reported is k1 = (8.5 ± 1.5) × 10(-12) cm(3) molecule(-1) s(-1). The rate coefficient, k1, is described by the Arrhenius expression:where errors are 1σ statistical only. This significant rate coefficient is greater than previously reported, with a stronger negative temperature dependence than previously observed. Consequently this suggests that the contribution of to ozone loss, in particular at mid-latitudes might be currently underestimated in models. This work reports atmospheric pressure kinetic parameters for this reaction which are greater than those reported from low pressure studies, perhaps supporting ClO and HO2 association as predicted by previous theoretical studies of this process and highlighting the need for further pressure

  1. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells

    International Nuclear Information System (INIS)

    Research highlights: → Bone marrow-derived mast cells (BMMCs) secrete functional VEGF but do not degranulate after Cobalt chloride-induced hypoxia. → CoCl2-induced VEGF secretion in mast cells occurs by a Ca2+-insensitive but brefeldin A and Tetanus toxin-sensitive mechanism. → Trolox and N-acetylcysteine inhibit hypoxia-induced VEGF secretion but only Trolox inhibits FcεRI-dependent anaphylactic degranulation in mast cells. → Src family kinase Fyn activation after free radical production is necessary for hypoxia-induced VEGF secretion in mast cells. -- Abstract: Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl2) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl2 promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl2-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl2-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl2 in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals-dependent Fyn kinase activation.

  2. VEGF secretion during hypoxia depends on free radicals-induced Fyn kinase activity in mast cells

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Roman, Jonathan; Ibarra-Sanchez, Alfredo; Lamas, Monica [Departamento de Farmacobiologia, Centro de Investigacion y de Estudios Avanzados del IPN (Cinvestav, IPN) (Mexico); Gonzalez Espinosa, Claudia, E-mail: cgonzal@cinvestav.mx [Departamento de Farmacobiologia, Centro de Investigacion y de Estudios Avanzados del IPN (Cinvestav, IPN) (Mexico)

    2010-10-15

    Research highlights: {yields} Bone marrow-derived mast cells (BMMCs) secrete functional VEGF but do not degranulate after Cobalt chloride-induced hypoxia. {yields} CoCl{sub 2}-induced VEGF secretion in mast cells occurs by a Ca{sup 2+}-insensitive but brefeldin A and Tetanus toxin-sensitive mechanism. {yields} Trolox and N-acetylcysteine inhibit hypoxia-induced VEGF secretion but only Trolox inhibits Fc{epsilon}RI-dependent anaphylactic degranulation in mast cells. {yields} Src family kinase Fyn activation after free radical production is necessary for hypoxia-induced VEGF secretion in mast cells. -- Abstract: Mast cells (MC) have an important role in pathologic conditions such as asthma and chronic obstructive pulmonary disease (COPD), where hypoxia conduce to deleterious inflammatory response. MC contribute to hypoxia-induced angiogenesis producing factors such as vascular endothelial growth factor (VEGF), but the mechanisms behind the control of hypoxia-induced VEGF secretion in this cell type is poorly understood. We used the hypoxia-mimicking agent cobalt chloride (CoCl{sub 2}) to analyze VEGF secretion in murine bone marrow-derived mast cells (BMMCs). We found that CoCl{sub 2} promotes a sustained production of functional VEGF, able to induce proliferation of endothelial cells in vitro. CoCl{sub 2}-induced VEGF secretion was independent of calcium rise but dependent on tetanus toxin-sensitive vesicle-associated membrane proteins (VAMPs). VEGF exocytosis required free radicals formation and the activation of Src family kinases. Interestingly, an important deficiency on CoCl{sub 2}-induced VEGF secretion was observed in Fyn kinase-deficient BMMCs. Moreover, Fyn kinase was activated by CoCl{sub 2} in WT cells and this activation was prevented by treatment with antioxidants such as Trolox and N-acetylcysteine. Our results show that BMMCs are able to release VEGF under hypoxic conditions through a tetanus toxin-sensitive mechanism, promoted by free radicals

  3. An MCM modeling study of nitryl chloride (ClNO2) impacts on oxidation, ozone production and nitrogen oxide partitioning in polluted continental outflow

    OpenAIRE

    T. P. Riedel; G. M. Wolfe; K. T. Danas; J. B. Gilman; Kuster, W. C.; Bon, D. M; Vlasenko, A.; S.-M. Li; Williams, E.J.; B. M. Lerner; Veres, P. R; Roberts, J.M; J. S. Holloway; Lefer, B.; S. S. Brown

    2014-01-01

    Nitryl chloride (ClNO2) is produced at night by reactions of dinitrogen pentoxide (N2O5) on chloride containing surfaces. ClNO2 is photolyzed during the morning hours after sunrise to liberate highly reactive chlorine atoms (Cl·). This chemistry takes place primarily in polluted environments where the concentrations of N2O5 precursors (nitrogen oxide radicals and ozone) are high, though it likely occurs in remote regions at lower intensities. Recent field measurements hav...

  4. An MCM modeling study of nitryl chloride (ClNO2) impacts on oxidation, ozone production and nitrogen oxide partitioning in polluted continental outflow

    OpenAIRE

    T. P. Riedel; G. M. Wolfe; Danas, K. T.; J. B. Gilman; W. C. Kuster; Bon, D. M; Vlasenko, A.; Li, S.-M.; E. J. Williams; B. M. Lerner; P. R. Veres; Roberts, J.M.; J. S. Holloway; Lefer, B; S. S. Brown

    2014-01-01

    Nitryl chloride (ClNO2) is produced at night by reactions of dinitrogen pentoxide (N2O5) on chloride containing surfaces. ClNO2 is photolyzed during the morning hours after sunrise to liberate highly reactive chlorine atoms (Cl·). This chemistry takes place primarily in polluted environments where the concentrations of N2O5 precursors (nitrogen oxide radicals and ozone) are high, though it likely occurs in remote regions at lower intensities. Recent field measurements hav...

  5. OpenCL programming guide

    CERN Document Server

    Munshi, Aaftab; Mattson, Timothy G; Fung, James; Ginsburg, Dan

    2011-01-01

    Using the new OpenCL (Open Computing Language) standard, you can write applications that access all available programming resources: CPUs, GPUs, and other processors such as DSPs and the Cell/B.E. processor. Already implemented by Apple, AMD, Intel, IBM, NVIDIA, and other leaders, OpenCL has outstanding potential for PCs, servers, handheld/embedded devices, high performance computing, and even cloud systems. This is the first comprehensive, authoritative, and practical guide to OpenCL 1.1 specifically for working developers and software architects. Written by five leading OpenCL authorities, OpenCL Programming Guide covers the entire specification. It reviews key use cases, shows how OpenCL can express a wide range of parallel algorithms, and offers complete reference material on both the API and OpenCL C programming language. Through complete case studies and downloadable code examples, the authors show how to write complex parallel programs that decompose workloads across many different devices. They...

  6. Historia clínica

    OpenAIRE

    Juan Martínez Hernández

    2006-01-01

    La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el pres...

  7. Enantiopure Radical Cation Salt Based on Tetramethyl-Bis(ethylenedithio-Tetrathiafulvalene and Hexanuclear Rhenium Cluster

    Directory of Open Access Journals (Sweden)

    Flavia Pop

    2016-01-01

    Full Text Available Electrocrystallization of the (S,S,S,S enantiomer of tetramethyl-bis(ethylenedithio-tetrathiafulvalene donor 1 in the presence of the dianionic hexanuclear rhenium (III cluster [Re6S6Cl8]2− affords a crystalline radical cation salt formulated as [(S-1]2·Re6S6Cl8, in which the methyl substituents of the donors adopt an unprecedented all-axial conformation. A complex set of intermolecular TTF···TTF and cluster···TTF interactions sustain an original tridimensional architecture.

  8. Iron and iron derived radicals

    International Nuclear Information System (INIS)

    We have discussed some reactions of iron and iron-derived oxygen radicals that may be important in the production or treatment of tissue injury. Our conclusions challenge, to some extent, the usual lines of thought in this field of research. Insofar as they are born out by subsequent developments, the lessons they teach are two: Think fast! Think small! In other words, think of the many fast reactions that can rapidly alter the production and fate of highly reactive intermediates, and when considering the impact of competitive reactions on such species, think how they affect the microenvironment (on the molecular scale) ''seen'' by each reactive molecule. 21 refs., 3 figs., 1 tab

  9. Aromatic-radical oxidation chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Glassman, I.; Brezinsky, K. [Princeton Univ., NJ (United States)

    1993-12-01

    The research effort has focussed on discovering an explanation for the anomalously high CO{sub 2} concentrations observed early in the reaction sequence of the oxidation of cyclopentadiene. To explain this observation, a number of plausible mechanisms have been developed which now await experimental verification. One experimental technique for verifying mechanisms is to probe the reacting system by perturbing the radical concentrations. Two forms of chemical perturbation of the oxidation of cyclopentadiene were begun during this past year--the addition of NO{sub 2} and CO to the reacting mixture.

  10. Laser spectroscopy of hydrocarbon radicals

    Energy Technology Data Exchange (ETDEWEB)

    Chen, P. [Harvard Univ., Cambridge, MA (United States)

    1993-12-01

    The author reports the application of supersonic jet flash pyrolysis to the specific preparation of a range of organic radicals, biradicals, and carbenes in a skimmed molecular beam. Each species was produced cleanly and specifically, with little or no secondary reactions by the thermal dissociation of appropriately designed and synthesized organic precursors. Photoelectron spectra of the three isomeric C{sub 3}H{sub 2} carbenes, ortho-benzyne, and the {alpha},3-dehydrotoluene biradical, were used to establish adiabatic ionization potentials for use in thermochemical determinations.

  11. 76 FR 59067 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2011-09-23

    ... ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3.... Model CL-600-2B16 (CL- 601-3A, CL-601-3R, and CL-604 Variants) Airplanes AGENCY: Federal Aviation...) events have occurred where the Air-Driven Generator (ADG) failed to provide power on CL-600-2B19...

  12. Detection of a secondary muoniated radical

    Energy Technology Data Exchange (ETDEWEB)

    McCollum, Brett M.; Brodovitch, Jean-Claude [TRIUMF and Department of Chemistry, Simon Fraser University, Burnaby, BC, V5A 1S6 (Canada); Clyburne, Jason A.C. [Department of Chemistry, Saint Mary' s University, Halifax, NS, B3H 3C3 (Canada); Percival, Paul W., E-mail: percival@sfu.c [TRIUMF and Department of Chemistry, Simon Fraser University, Burnaby, BC, V5A 1S6 (Canada); West, Robert [Organosilicon Research Center, University of Wisconsin, Madison, WI 53706 (United States)

    2009-04-15

    Muoniated free radicals are formed by addition of muonium to unsaturated molecules. Successful detection by transverse-field muon spin rotation (muSR) usually requires pure or highly concentrated samples and a muonium reaction rate in excess of 10{sup 9} M{sup -1}s{sup -1} to ensure that the muon spin polarization is coherently transferred to the radical. For this reason muoniated radicals reported to date are all the primary radical products of Mu reaction. Thus, it was expected that Mu addition to a silylene would result in detection of a silyl radical. However, the muon hyperfine constant determined by experiment is much smaller than the value predicted by density functional calculations. Instead, it is consistent with a disilanyl radical, the secondary radical formed by reaction of the initially formed silyl radical with a second silylene molecule. From an analysis of the signal amplitude it was deduced that the second-order rate constant for reaction of the muoniated silyl radical with the parent silylene is 5.7x10{sup 8} M{sup -1}s{sup -1}. This work represents the first example of direct detection of a secondary radical product by transverse-field muSR.

  13. Reactivity of OH radicals with chlorobenzoic acids-A pulse radiolysis and steady-state radiolysis study

    DEFF Research Database (Denmark)

    Zona, Robert; Solar, Sonja; Getoff, Nikola;

    2010-01-01

    The reactions of OH radicals with 2-, 3-, 4-chlorobenzoic acids (ClBzA) and chlorobenzene (ClBz), k(OH+substrates)=(4.5−6.2)×109 dm3 mol−1 s−1, have been studied by pulse radiolysis in N2O saturated solutions. The absorption maxima of the OH-adducts were in the range of 320−340 nm. Their decay wa...... to degradation. The order for the efficiency of dehalogenation was 4->2->3-ClBzA. Several primary radiolytic products could be detected by HPLC. To evaluate the toxicity of final products a bacterial bioluminescence test was carried out....

  14. Effect of free radicals released from pulmonary alveolar phagocytes on development of radiation pneumonia in rats

    International Nuclear Information System (INIS)

    Measuring the hydroxyproline (HyP) content in rat lungs and the chemiluminescence (CL) of bronchus alveolar lavage fluid cell (BALFC) at 0.5, 1 and 2 months after irradiation with 60Co γ-rays respectively, we found that the amount of BALFC and its CL stimulated by zymosan and the pulmonary HyP content were apparently increased after irradiation, and these alternations took a favourable turn when selenium was supplemented to irradiated rats, suggesting that selenium protected the rats from radiation injury of lung. In addition, we found that there were certain interrelations between the multiplication of pulmonary fibrocytes and the free radicals released from accumulated BALFC in pulmonary alveoli, indicating that the free radicals produced from alveolar phagocytes may be an important factor in development of rat radiation pneumonia

  15. Inland Concentrations of Cl2 and ClNO2 in Southeast Texas Suggest Chlorine Chemistry Significantly Contributes to Atmospheric Reactivity

    Directory of Open Access Journals (Sweden)

    Cameron B. Faxon

    2015-10-01

    Full Text Available Measurements of molecular chlorine (Cl2, nitryl chloride (ClNO2, and dinitrogen pentoxide (N2O5 were taken as part of the DISCOVER-AQ Texas 2013 campaign with a High Resolution Time-of-Flight Chemical Ionization Mass Spectrometer (HR-ToF-CIMS using iodide (I- as a reagent ion. ClNO2 concentrations exceeding 50 ppt were regularly detected with peak concentrations typically occurring between 7:00 a.m. and 10:00 am. Hourly averaged Cl2 concentrations peaked daily between 3:00 p.m. and 4:00 p.m., with a 29-day average of 0.9 ± 0.3 (1σ ppt. A day-time Cl2 source of up to 35 ppt∙h−1 is required to explain these observations, corresponding to a maximum chlorine radical (Cl• production rate of 70 ppt∙h−1. Modeling of the Cl2 source suggests that it can enhance daily maximum O3 and RO2• concentrations by 8%–10% and 28%–50%, respectively. Modeling of observed ClNO2 assuming a well-mixed nocturnal boundary layer indicates O3 and RO2• enhancements of up to 2.1% and 38%, respectively, with a maximum impact in the early morning. These enhancements affect the formation of secondary organic aerosol and compliance with air quality standards for ozone and particulate matter.

  16. Historia clínica

    Directory of Open Access Journals (Sweden)

    Juan Martínez Hernández

    2006-01-01

    Full Text Available La historia clínica ha estado regulada hasta la actualidad por diferentes disposiciones legislativas con base en la Ley General de Sanidad 14/1986, de 25 de abril. Con la Ley 41/2002, de 14 de noviembre, básica y reguladora de la autonomía del paciente y de derechos y obligaciones en materia de información y documentación clínica, se actualizan los derechos y obligaciones de los pacientes o usuarios y profesionales, entre ellos los relativos a la historia clínica. En el presente artículo, se expone el contenido de la Ley 41/2002 y referencias a otras normas legislativas y fuentes bibliográficas. La Ley define la historia clínica, sus contenidos, funciones y usos, su soporte y conservación, aclara la propiedad de la historia clínica y recoge las características de acceso y custodia, así como la privacidad y confidencialidad de la historia clínica.

  17. Preoperative Nomogram Predicting the 10-Year Probability of Prostate Cancer Recurrence After Radical Prostatectomy

    OpenAIRE

    Stephenson, Andrew J.; Scardino, Peter T.; Eastham, James A.; Bianco, Fernando J.; Dotan, Zohar A.; Fearn, Paul A.; Michael W Kattan

    2006-01-01

    An existing preoperative nomogram predicts the probability of prostate cancer recurrence, defined by prostate-specific antigen (PSA), at 5 years after radical prostatectomy based on clinical stage, serum PSA, and biopsy Gleason grade. In an updated and enhanced nomogram, we have extended the predictions to 10 years, added the prognostic information of systematic biopsy results, and enabled the predictions to be adjusted for the year of surgery. Cox regression analysis was used to model the cl...

  18. Green light radiation effects on free radicals inhibition in cellular and chemical systems.

    Science.gov (United States)

    Comorosan, Sorin; Polosan, Silviu; Jipa, Silviu; Popescu, Irinel; Marton, George; Ionescu, Elena; Cristache, Ligia; Badila, Dumitru; Mitrica, Radu

    2011-01-10

    Free radicals generation is inhibited through green light (GL) irradiation in cellular systems and in chemical reactions. Standard melanocyte cultures were UV-irradiated and the induced cellular reactive oxygen species (ROS) were quantified by the fluorescence technique. The same cell cultures, previously protected by a 24h GL exposure, displayed a significantly lower ROS production. A simple chemical reaction is subsequently chosen, in which the production of free radicals is well defined. Paraffin wax and mineral oil were GL irradiated during thermal degradation and the oxidation products checked by chemiluminescence [CL] and Fourier transform infrared spectra [FT-IR]. The same clear inhibition of the radical oxidation of alkanes is recorded. A quantum chemistry modeling of these results is performed and a mechanism involving a new type of Rydberg macromolecular systems with implications for biology and medicine is suggested. PMID:20934350

  19. Phase diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl

    International Nuclear Information System (INIS)

    Equilibrium diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl were studied over the temperature range 200-800degC by differential thermal analysis techniques. A peritectic was observed in the NdCl3-LiCl system. The eutectic occurred at 456±2degC and 30.7mol% NdCl3 and the peritectic occurred at 467±1degC. A single eutectic was observed in the PrCl3-LiCl system with no evidence of solid solution or compound formation. The eutectic occurred at 464±1degC and 30.6mol% PrCl3 in the PrCl3-LiCl system. Binary phase diagrams for the two systems were proposed from the DTA results. (author)

  20. Sensitization of microorganisms and enzymes by radiation-induced selective inorganic radical anions

    International Nuclear Information System (INIS)

    Bacterial survival and enzymatic inactivation were examined following exposure to radiolytically-generated radical anions, X-2, where X=Cl, Br, I or CNS-. Depending on pH, radical anions react selectively or specifically with cysteine, tryptophan, tyrosine and histidine. Consequently, when one or more of these amino acids is crucial for enzymatic activity or bacterial survival and is attacked by a radical anion, a high degree or radiosensitization may be realized. Halide radical anions can form free chlorine, bromine or iodine. However, these bactericidal halogens are destroyed by reaction with the hydrated electron, e-sub(aq), or at pHs>9, as occurs, for example, when a medium saturated with nitrous oxide, N2O, and e-sub(aq) scavenger, is replaced by nitrogen or oxygen. Increasing concentration of other e-sub(aq) scavengers, such as phosphate buffer, promotes formation of halogen from halides. The conditions producing formation and elimination of halogens in irradiated media must be appreciated to avoid confusing radiosensitization by X2 to X-2. Radiosensitization by radical anions of several microorganisms: S. faecalis, S. typhimurium, E. coli, and M. radiodurens is described. A crucial amino acid for survival of S. faecalis appears to be tyrosine, while both tyrosine and tryptophan seem essential for recovery of S. typhimurium from effects of ionizing radiation. It is postulated that the radiosensitizing action of radical anions involves inhibition of DNA repair of strand-breaks by depriving the cells of energy. In view of the high OH scavenging power of foods, it is concluded that the radiosensitization of bacteria and enzymes in foods by radical anions, except for special cases, is not practical. Rather, radical anions serve to identify crucial amino acids to radiosensitization mechanisms in model systems, and possibly in radiotherapy. (author)

  1. Sensitization of Microorganisms and Enzymes by Radiation-Induced Selective Inorganic Radical Anions

    International Nuclear Information System (INIS)

    Bacterial survival and enzymatic inactivation were examined following exposure to radiolytically-generated radical anions, X-2 , where X = Cl, Br, I, or CNS. Depending on pH, radical anions react selectively or specifically with cysteine, tryptophan, tyrosine and histidine. Consequently, when one or more of these amino acids is crucial for enzymatic activity or bacterial survival and is attacked by a radical anion, a high degree or radiosensitization may be realized. Halide radical anions can form free chlorine, bromine or iodine. However, these bactericidal halogens are destroyed by reaction with the hydrated electron, e-aq, or at pHs > 9, as occurs, for example, when a medium saturated with nitrous oxide, N2O , and e-aq scavenger, is replaced by nitrogen or oxygen. Increasing concentration of other e-aq scavengers, such as phosphate buffer, promotes formation of halogen from halides. The conditions producing formation and élimination o f halogens in irradiated media m ust be appreciated to avoid confusing radiosensitization by X2 to X-2. Radiosensitization by radical anions o f several microorganisms: S. faecalis, S. typhimurium, E. coli, and M. radiodurens is described. A crucial amino acid for survival of S. faecalis appears to be tyrosine, while both tyrosine and tryptophan seem essential for recovery of S. typhimurium from effects of ionizing radiation. It is postulated that the radiosensitizing action o f radical anions involves inhibition of DNA repair of strand-breaks by depriving the cells of energy. In view of the high OH scavenging power of foods, it is concluded that the radiosensitization of bacteria and enzymes in foods by radical anions, except for special cases, is not practical. Rather, radical anions serve to identify crucial amino acids to radiosensitization mechanisms in model systems, and possibly in radiotherapy. (author)

  2. A Radically Configurable Six-State Compound

    OpenAIRE

    Barnes, Jonathan C.; Fahrenbach, Albert C.; Cao, Dennis; Dyar, Scott M.; Frasconi, Marco; Giesener, Marc A.; Benítez, Diego; Tkatchouk, Ekaterina; Chernyashevskyy, Oleksandr; Shin, Weon Ho; Li, Hao; Sampath, Srinivasan; Stern, Charlotte L.; Sarjeant, Amy A.; Hartlieb, Karel J.

    2013-01-01

    Most organic radicals possess short lifetimes and quickly undergo dimerization or oxidation. Here, we report on the synthesis by radical templation of a class of air- and water-stable organic radicals, trapped within a homo[2]catenane composed of two rigid and fixed cyclobis (paraquat-p-phenylene) rings. The highly energetic octacationic homo[2]catenane, which is capable of accepting up to eight electrons, can be configured reversibly, both chemically and electrochemically, bet...

  3. Quantitative determination of atmospheric hydroperoxyl radical

    Energy Technology Data Exchange (ETDEWEB)

    Springston, Stephen R. (Upton, NY); Lloyd, Judith (Westbury, NY); Zheng, Jun (Stony Brook, NY)

    2007-10-23

    A method for the quantitative determination of atmospheric hydroperoxyl radical comprising: (a) contacting a liquid phase atmospheric sample with a chemiluminescent compound which luminesces on contact with hydroperoxyl radical; (b) determining luminescence intensity from the liquid phase atmospheric sample; and (c) comparing said luminescence intensity from the liquid phase atmospheric sample to a standard luminescence intensity for hydroperoxyl radical. An apparatus for automating the method is also included.

  4. Photodynamically generated bovine serum albumin radicals

    DEFF Research Database (Denmark)

    Silvester, J A; Timmins, G S; Davies, Michael Jonathan

    1998-01-01

    Porphyrin-sensitized photoxidation of bovine serum albumin (BSA) results in oxidation of the protein at (at least) two different, specific sites: the Cys-34 residue giving rise to a thiyl radical (RS.); and one or both of the tryptophan residues (Trp-134 and Trp-214) resulting in the formation of...... by a range of proteases. The generation of protein-derived radicals also results in an enhancement of photobleaching of the porphyrin, suggesting that protein radical generation is linked to porphyrin photooxidation....

  5. Involvement of free radicals in breast cancer

    OpenAIRE

    Ríos-Arrabal, Sandra; Artacho-Cordón, Francisco; León, Josefa; Román-Marinetto, Elisa; del Mar Salinas-Asensio, María; Calvente, Irene; Núñez, Maria Isabel

    2013-01-01

    Researchers have recently shown an increased interest in free radicals and their role in the tumor microenvironment. Free radicals are molecules with high instability and reactivity due to the presence of an odd number of electrons in the outermost orbit of their atoms. Free radicals include reactive oxygen and nitrogen species, which are key players in the initiation and progression of tumor cells and enhance their metastatic potential. In fact, they are now considered a hallmark of cancer. ...

  6. 75 FR 68728 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10 (CL-215), CL-215-6B11 (CL-215T...

    Science.gov (United States)

    2010-11-09

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10 (CL- 215), CL-215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes...: * * * * * Seven cases of on-ground hydraulic accumulator screw cap or end cap failure have been experienced on...

  7. 76 FR 41653 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2A12 (CL-601) and CL-600-2B16 (CL-601-3A...

    Science.gov (United States)

    2011-07-15

    ... products. That NPRM was published in the Federal Register on January 5, 2011 (76 FR 477). That NPRM...; 2. Is not a ``significant rule'' under the DOT Regulatory Policies and Procedures (44 FR 11034.... Model CL-600-2A12 (CL- 601) and CL-600-2B16 (CL-601-3A, CL-601-3R, and CL-604 Variants) Airplanes...

  8. Aromatic hydroxylation. 8. A radiation chemical study of the oxidation of hydroxycyclohexadienyl radicals

    International Nuclear Information System (INIS)

    Substituted hydroxycyclohexadienyl radicals have been generated by pulse radiolysis of N2O-saturated aqueous solutions of monosubstituted benzene derivatives. Their rates of disproportionation/dimerization and of oxidation by Fe(CN)63- and by IrCl62- have been measured by optical and conductimetric methods. For the fluoro- and chlorohydroxycyclohexadienyl radicals disproportionation is shown to involve hydrogen atom abstraction rather than electron transfer. However, the Fe(CN)63- oxidation of the substituted hydroxycyclohexadienyl radicals occurs by a rate-determining electron transfer followed by a fast proton loss rather than by hydrogen atom abstraction or synchronous removal of an electron and a proton. A plot of the log of the rate constants for oxidation against Hammett σ+ constants gives a good linear relationship with a rho value of -3.0 +/- 0.1. With the more powerful oxidant IrCl6-, the electron-transfer oxidation of all but the least reactive hydroxycyclohexadienyl radicals is diffusion controlled

  9. Aromatic hydroxylation. 8. A radiation chemical study of the oxidation of hydroxycyclohexadienyl radicals

    Energy Technology Data Exchange (ETDEWEB)

    Buxton, G.V.; Langan, J.R.; Smith, J.R.L.

    1986-11-06

    Substituted hydroxycyclohexadienyl radicals have been generated by pulse radiolysis of N/sub 2/O-saturated aqueous solutions of monosubstituted benzene derivatives. Their rates of disproportionation/dimerization and of oxidation by Fe(CN)/sub 6//sup 3 -/ and by IrCl/sub 6//sup 2 -/ have been measured by optical and conductimetric methods. For the fluoro- and chlorohydroxycyclohexadienyl radicals disproportionation is shown to involve hydrogen atom abstraction rather than electron transfer. However, the Fe(CN)/sub 6//sup 3 -/ oxidation of the substituted hydroxycyclohexadienyl radicals occurs by a rate-determining electron transfer followed by a fast proton loss rather than by hydrogen atom abstraction or synchronous removal of an electron and a proton. A plot of the log of the rate constants for oxidation against Hammett sigma/sup +/ constants gives a good linear relationship with a rho value of -3.0 +/- 0.1. With the more powerful oxidant IrCl/sub 6//sup -/, the electron-transfer oxidation of all but the least reactive hydroxycyclohexadienyl radicals is diffusion controlled.

  10. ClEST cluster :Cl_singleton1875 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1875 beta-carotene -monooxygenase Cimex lectularius nuclear gene 443 CAGACGAAGACATGT ... CGCTTTATGGAAGTACAGATACAAGTGTGAAG mb05043 1 Retinal pigment ... epithelium-specific protein b [Danio rerio] AAH921 ...

  11. ClEST cluster :Cl_contig0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0243 barrier-to-autointegration factor Cimex lectularius nuclear gene 428 ...TAATAAATACAGTATGATGTGCG fb29038 fs25084 mb23031 3 barrier to autointegration factor [Rhodnius prolixus] AEL79235 5.9E-56 GO:0003677 ...

  12. ClEST cluster :Cl_singleton0811 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0811 nuclear ... transcription factor gamma Cimex lectularius nuclear ... gene 506 GATGGTTGG ... GGGTACATACTGAGGATAACAAACGTCGAACTTTACAGCG fs11035 1 nuclear ... transcription factor Y gamma isoform 1 [Nasonia vi ...

  13. ClEST cluster :Cl_singleton1046 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1046 u2 small nuclear ... ribonucleoprotein a Cimex lectularius nuclear ... gene 633 TTGTTTG ... CGCTCACGAGC fs21006 1 PREDICTED: probable U2 small nuclear ... ribonucleoprotein A'-like [Bombus terrestris] XP_0 ...

  14. ClEST cluster :Cl_singleton1703 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1703 p8 nuclear ... protein Cimex lectularius nuclear ... gene 541 AGTCGTTCGACAACGTTCAAACAAT ... AACGGTTAAGCATTTGTACTTACGTTAT fw21041 1 DNA-binding nuclear ... protein p8 [Triatoma infestans] ABR27869 2.01616E- ...

  15. ClEST cluster :Cl_singleton2134 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2134 rna-binding region ... rnp-1 domain-containing protein Cimex lectularius nuclear ge ... GTGTACCTTGCAAAAGTGATTTATCATC mb16086 1 RNA-binding region ... RNP-1 domain-containing protein [Dictyostelium dis ...

  16. ClEST cluster :Cl_singleton1569 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1569 b-cell ... receptor-associated protein 31-like Cimex lectularius nuclear gene 410 C ... CTCTGTTCCTCTCCATTGTGATTCGACGATTCGTGTCT fw16029 1 B-cell ... receptor-associated protein 31-like [Acyrthosiphon ...

  17. ClEST cluster :Cl_singleton2269 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2269 germ cell -less protein Cimex lectularius nuclear gene 466 CACACACGCGCTTCATAAAAA ... TCAATATTCTTGA mb21032 1 PREDICTED: similar to germ cell -less protein [Tribolium castaneum] XP_967783 3.440 ...

  18. ClEST cluster :Cl_singleton0908 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0908 bone marrow stromal cell -derived ubiquitin-like protein Cimex lectularius nucle ... s15049 1 PREDICTED: similar to bone marrow stromal cell -derived ubiquitin-like protein [Tribolium castaneu ...

  19. ClEST cluster :Cl_singleton0360 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0360 cell ... cycle control protein 50a-like isoform 1 Cimex lectularius nuclear gene 41 ... ACAAAATGCATGAATGCCTTGTCACCAAC fb18030 1 PREDICTED: cell ... cycle control protein 50A-like isoform 2 [Nasonia ...

  20. ClEST cluster :Cl_contig0436 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0436 lethal essential for life ... l2efl Cimex lectularius nuclear gene 432 TAAGAATCTCTCCCG ... GACGTTATT fs18066 fw18019 2 lethal(2)essential for life ... protein-like protein [Maconellicoccus hirsutus] AB ...

  1. ClEST cluster :Cl_singleton1657 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1657 pumilio ... 2 Cimex lectularius nuclear gene 590 TGATGATGAAAGATCAGTACGCCAATTATGTCGT ... ATATGATACATCAAATAAATTATTTGAGA fw20025 1 PREDICTED: pumilio ... homolog 2-like isoform 1 [Acyrthosiphon pisum] XP_ ...

  2. ClEST cluster :Cl_singleton2448 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2448 probable gdp-fucose ... transporter-like Cimex lectularius nuclear gene 314 ACGAATT ... AAAGTTTTCCCTGTCA mb31096 1 PREDICTED: probable GDP-fucose ... transporter-like [Acyrthosiphon pisum] XP_00194993 ...

  3. ClEST cluster :Cl_singleton1765 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1765 rab11 family -interacting protein 4a-like Cimex lectularius nuclear gene 578 GGT ... GGCGAGGGTTTTGATGCTTGAAG fw23061 1 PREDICTED: rab11 family -interacting protein 4A-like isoform 1 [Acyrthosiph ...

  4. ClEST cluster :Cl_singleton0942 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0942 tbc1 domain family ... member 4-like Cimex lectularius nuclear gene 488 GCATTCGTATT ... CCACCATAAAGGAGCAA fs16074 1 PREDICTED: TBC1 domain family ... member 4-like [Acyrthosiphon pisum] XP_001947975 6 ...

  5. ClEST cluster :Cl_contig0251 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0251 member ras oncogene family ... Cimex lectularius nuclear gene 413 GAGTGTGTAAACTTAAAATA ... 3 PREDICTED: similar to RAB18 member RAS oncogene family ... [Tribolium castaneum] XP_970378 2.6E-29 ...

  6. ClEST cluster :Cl_singleton0243 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0243 solute carrier family ... 35 member f5-like Cimex lectularius nuclear gene 403 GAAA ... AATAAAACTCCCAA fb12090 1 PREDICTED: solute carrier family ... 35 member F5-like [Nasonia vitripennis] XP_0016016 ...

  7. ClEST cluster :Cl_singleton1038 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1038 pleckstrin homology domain- family ... a (phosphoinositide binding specific) member ... : similar to pleckstrin homology domain-containing family ... A (phosphoinositide binding specific) member 3 [Tr ...

  8. ClEST cluster :Cl_singleton0344 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0344 l antigen family ... member 3 Cimex lectularius nuclear gene 461 CCAAGTAAAAATTTAAAT ... AGGGCAAATTATGGCTTCGCCCTCTATCTG fb17054 1 L antigen family ... member 3 isoform 1 [Nasonia vitripennis] NP_001155 ...

  9. ClEST cluster :Cl_singleton1438 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1438 sodium pump ... alpha subunit Cimex lectularius nuclear gene 282 GAGTCTGGTTCCAGTGCT ... ACTGGACTCACACACGCCAAAGCT fw09093 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 1.10687E ...

  10. ClEST cluster :Cl_singleton0353 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0353 sodium pump ... alpha subunit Cimex lectularius nuclear gene 155 GGCTGTCGGACCTCCACC ... CATAAAATATCTGTAGAAGAACTA fb18007 1 putative sodium pump ... alpha subunit [Danaus plexippus] EHJ73788 2.28502E ...

  11. ClEST cluster :Cl_singleton1521 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1521 Histone-lysine ... N-methyltransferase SETMAR Cimex lectularius nuclear gene 357 CT ... TTCATAAAGATATTTGAAAGTTTCGTTCAACT fw14041 1 Histone-lysine ... N-methyltransferase SETMAR [Harpegnathos saltator] ...

  12. ClEST cluster :Cl_contig0318 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0318 histone-lysine ... n-methyltransferase setmar Cimex lectularius nuclear gene 571 TTTGA ... AATTTTCGAGTTTTTTCACTTTTC fw04055 mb08029 2 histone-lysine ... N-methyltransferase SETMAR [Bos taurus] NP_0010771 ...

  13. ClEST cluster :Cl_singleton1580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1580 histone-lysine ... n-methyltransferase setmar-like Cimex lectularius nuclear gene 3 ... AGTACATTAACTCATCTTTTC fw17018 1 PREDICTED: histone-lysine ... N-methyltransferase SETMAR-like [Bombus terrestris ...

  14. ClEST cluster :Cl_singleton0551 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0551 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... CTATCTATCCCGTCTG fb26037 1 PREDICTED: RNA-directed DNA ... polymerase from mobile element jockey-like [Acyrth ...

  15. ClEST cluster :Cl_singleton1396 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1396 dna ... repair and recombination protein rad54b-like Cimex lectularius nuclear gene ... ACGATTACTATTTTTTTCCTTCGAGCCTT fw08090 1 PREDICTED: DNA ... repair and recombination protein RAD54B-like [Acyr ...

  16. ClEST cluster :Cl_singleton0669 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0669 n -adenine-specific dna ... methyltransferase 2-like Cimex lectularius nuclear gene ... GATGATAAAACTGTAAAAA fs03050 1 N-6 adenine-specific DNA ... methyltransferase 2 [Nasonia vitripennis] NP_00112 ...

  17. ClEST cluster :Cl_singleton1305 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1305 dna -directed rna polymerase ii kda polypeptide Cimex lectularius nuclear gene 4 ... TGAAGAAAGATTCAAAGAGGCGATCAAGGACAGGAAGGAA fw05060 1 DNA -directed RNA polymerase II 13.3 kda polypeptide [T ...

  18. ClEST cluster :Cl_singleton0185 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0185 dna -directed rna polymerases and iii subunit rpabc1-like Cimex lectularius nucl ... CTTCTGCTAAGCAATCACTCGTGGACATG fb10023 1 PREDICTED: DNA -directed RNA polymerases I II and III subunit RPAB ...

  19. ClEST cluster :Cl_singleton0563 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0563 dna -directed rna polymerases i and iii subunit rpac1 Cimex lectularius nuclear ... GTGAAATGCACTAAAAACCCACACTGCCG fb27031 1 PREDICTED: DNA -directed RNA polymerases I and III subunit RPAC1 [ ...

  20. ClEST cluster :Cl_singleton0580 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0580 rna-directed dna ... polymerase from mobile element jockey- partial Cimex lectulari ... ACCTTTATTAATCACATTCCGAGCCTA fb28040 1 RNA-directed DNA ... polymerase from mobile element jockey [Harpegnatho ...

  1. ClEST cluster :Cl_singleton0423 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0423 dna ... replication licensing factor mcm9-like Cimex lectularius nuclear gene 423 C ... CAAAGAAAGAGTGAGGCGTTAAATGCATC fb20074 1 PREDICTED: DNA ... replication licensing factor MCM9-like [Bos taurus ...

  2. ClEST cluster :Cl_singleton2256 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2256 aminopeptidase -like Cimex lectularius nuclear gene 480 GTACACACTACACAGCACTGAGT ... TCACGTTTTCCCAAGACAAAGCTTG mb20082 1 PREDICTED: LOW QUALITY ... PROTEIN: putative aminopeptidase W07G4.4-like [Bom ...

  3. ClEST cluster :Cl_singleton0131 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0131 hemicentin 1 Cimex lectularius nuclear gene 552 TATCAGCACCAATTCCTTCAATTCCTGAAGA ... TACATGTGTCAGGGGAGCAACAAAG fb07055 1 PREDICTED: LOW QUALITY ... PROTEIN: hemicentin-1-like [Meleagris gallopavo] X ...

  4. ClEST cluster :Cl_singleton0993 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0993 low quality ... protein: wd repeat and fyve domain-containing protein 3-like Cimex ... GTGTTTCGCACGCCGCAGTGGTGGC fs18057 1 PREDICTED: LOW QUALITY ... PROTEIN: WD repeat and FYVE domain-containing prot ...

  5. ClEST cluster :Cl_singleton0484 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0484 protein polybromo-1 Cimex lectularius nuclear gene 500 GGGAGTCGTGAAGATGGTCGTGAA ... TAAGACTGACGAGTATGATGATATA fb23037 1 PREDICTED: LOW QUALITY ... PROTEIN: protein polybromo-1-like [Bombus terrestr ...

  6. ClEST cluster :Cl_singleton0415 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0415 ctp synthase Cimex lectularius nuclear gene 485 CGGTGAAACGTACGTTCTTGATGATGGAGGG ... CTTTCACCAGACCTCATTGTTTGCC fb20048 1 PREDICTED: LOW QUALITY ... PROTEIN: CTP synthase-like [Bombus impatiens] XP_0 ...

  7. ClEST cluster :Cl_contig0368 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0368 astakine variant 1 Cimex lectularius nuclear gene 522 GAACAGTTTCAGTCGGCGACTGGTTGAC ... CAGTAAATAACTGTGAT fb05079 mb05073 2 PREDICTED: LOW QUALITY ... PROTEIN: astakine-like [Bombus terrestris] XP_0034 ...

  8. ClEST cluster :Cl_singleton0904 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0904 male -specific lethal 3 homolog Cimex lectularius nuclear gene 394 CTCGCAGGTTGAG ... GAATTCGACTTGGGATAGATTCGTTACCG fs15038 1 PREDICTED: male -specific lethal 3 homolog [Acyrthosiphon pisum] XP ...

  9. ClEST cluster :Cl_singleton1087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1087 calreticulin Cimex lectularius nuclear gene 333 CGAAACCCAGCTCGAGACGATGAGGGCTCTT ... calreticulin [Rhodnius prolixus] ACI23246 4.17952E-42 ... GO:0006457 GO:0005783 GO:0051082 GO:0005509 ...

  10. ClEST cluster :Cl_contig0178 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0178 transposase-like Cimex lectularius nuclear gene 625 AACTTCGTCAGAAAATAAAACTCTCTTCCA ... asGA2_TC010512 [Tribolium castaneum] EFA01186 1.5E-42 ... GO:0004803 GO:0015074 GO:0006313 GO:0003677 ...

  11. ClEST cluster :Cl_contig0085 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0085 leucine aminopeptidase Cimex lectularius nuclear gene 650 ACTACTCAAAATTTTTGTTTCTGG ... 1 5 GJ21638 [Drosophila virilis] XP_002049525 2.0E-42 ... GO:0008238 GO:0007498 ...

  12. ClEST cluster :Cl_singleton2379 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2379 tubulin polymerization ... promoting protein Cimex lectularius nuclear gene 406 AAA ... TTGCGGATTACAACAAATTCCTCGAGGATCTG mb25089 1 tubulin polymerization ... promoting protein [Triatoma matogrossensis] ADN299 ...

  13. ClEST cluster :Cl_singleton0582 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0582 stress -induced-phosphoprotein 1 Cimex lectularius nuclear gene 592 GGAAAAGGTTAT ... AAGGCACGAGAAATTATTCCCACCGATATTACATTTTACA fb28049 1 Stress -induced-phosphoprotein 1 [Acromyrmex echinatior] E ...

  14. ClEST cluster :Cl_singleton0472 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0472 oxidative stress -induced growth inhibitor 1 Cimex lectularius nuclear gene 476 ... CCGATTACCACAAGATATGGCAGATGATGA fb22084 1 Oxidative stress -induced growth inhibitor 1 [Camponotus floridanus] ...

  15. ClEST cluster :Cl_singleton1313 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1313 27 kda hemolymph ... Cimex lectularius nuclear gene 441 CCATTACGGCCGGGGAGAGTGGAATGA ... GAGGTGTTGATGAAAGAAATAA fw05075 1 PREDICTED: 27 kDa hemolymph ... protein-like [Acyrthosiphon pisum] XP_001947666 2. ...

  16. ClEST cluster :Cl_contig0283 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0283 bladder cancer -associated Cimex lectularius nuclear gene 641 AGAGTCAGGATTGACTGTTTC ... TTAAAATATAAGC fb02042 fs13007 2 PREDICTED: bladder cancer -associated protein-like [Nasonia vitripennis] XP_0 ...

  17. ClEST cluster :Cl_contig0334 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0334 1-acyl-sn-glycerol-3-phosphate ... acyltransferase Cimex lectularius nuclear gene 551 ... fw03026 fw07037 2 PREDICTED: 1-acyl-sn-glycerol-3-phosphate ... acyltransferase alpha-like isoform 2 [Acyrthosipho ...

  18. ClEST cluster :Cl_singleton0136 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0136 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 573 GTACG ... TTTTTCAGCTCTGGCTGACAT fb07076 1 Putative inorganic phosphate ... cotransporter [Harpegnathos saltator] EFN85104 8.7 ...

  19. ClEST cluster :Cl_singleton1944 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1944 deoxyribose-phosphate ... aldolase Cimex lectularius nuclear gene 535 GATATCTGAAATG ... TG mb07072 1 PREDICTED: similar to 2-deoxyribose-5-phosphate ... aldolase homolog [Tribolium castaneum] XP_972358 7 ...

  20. ClEST cluster :Cl_singleton0117 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0117 phosphatidylinositol-4-phosphate ... 3-kinase c2 domain-containing beta polypeptide ... CAAAAG fb07013 1 PREDICTED: phosphatidylinositol-4-phosphate ... 3-kinase C2 domain-containing subunit alpha-like [ ...

  1. ClEST cluster :Cl_singleton2005 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2005 glycerol-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 411 ATCGAGCTC ... GTATTGCTGATCTTGTCACCACTTGTTAC mb09081 1 glycerol-3-phosphate ... dehydrogenase [Drosophila ficusphila] BAB39756 2.6 ...

  2. ClEST cluster :Cl_singleton0341 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0341 ribose-phosphate ... pyrophosphokinase Cimex lectularius nuclear gene 379 TTCTATGTG ... TGCTGTTATTCCATATTTGCCCTATAGCAAGCA fb17043 1 ribose-phosphate ... pyrophosphokinase 1 2 [Culex quinquefasciatus] XP_ ...

  3. ClEST cluster :Cl_contig0206 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0206 sodium-dependent phosphate ... transporter Cimex lectularius nuclear gene 554 TCTAGTCG ... 8 mb18034 3 PREDICTED: similar to sodium-dependent phosphate ... transporter [Tribolium castaneum] XP_001809051 9.4 ...

  4. ClEST cluster :Cl_singleton0167 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0167 sugar phosphate ... exchanger 2-like isoform 2 Cimex lectularius nuclear gene 506 C ... TATTCGCATACGCTGCATCAATG fb09027 1 PREDICTED: sugar phosphate ... exchanger 2-like isoform 2 [Apis mellifera] XP_397 ...

  5. ClEST cluster :Cl_singleton1124 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1124 glyceraldehyde-3-phosphate ... dehydrogenase Cimex lectularius nuclear gene 609 CTC ... TTTGAATTGTTA fs25045 1 PREDICTED: glyceraldehyde-3-phosphate ... dehydrogenase-like [Acyrthosiphon pisum] XP_001943 ...

  6. ClEST cluster :Cl_singleton0888 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0888 mannose-6-phosphate ... isomerase Cimex lectularius nuclear gene 314 GTTGGCTTGTGTGG ... AAGGAGTTGGCTGCTGTAC fs14088 1 PREDICTED: mannose-6-phosphate ... isomerase-like [Bombus impatiens] XP_003491147 1.3 ...

  7. ClEST cluster :Cl_singleton1290 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1290 glucose-6-phosphate ... 1-epimerase-like Cimex lectularius nuclear gene 605 AGAGGAA ... CGAATGTGGTCTCAGGAAG fw05014 1 PREDICTED: glucose-6-phosphate ... 1-epimerase-like [Apis mellifera] XP_003251860 4.4 ...

  8. ClEST cluster :Cl_singleton1771 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1771 inorganic phosphate ... cotransporter Cimex lectularius nuclear gene 540 GGTTTTAAAA ... AGGTCCGATT fw23080 1 PREDICTED: putative inorganic phosphate ... cotransporter-like isoform 2 [Acyrthosiphon pisum] ...

  9. ClEST cluster :Cl_singleton1772 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1772 myosin heavy chain Cimex lectularius nuclear gene 539 GAGTCAGACTCGCTCCAGCTCCCTC ... AACAAAGAAA fw23081 1 PREDICTED: myosin heavy chain muscle ... isoform 1 [Acyrthosiphon pisum] XP_001952092 5.076 ...

  10. ClEST cluster :Cl_contig0096 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0096 muscle ... lim protein Cimex lectularius nuclear gene 588 AACTTGTTAGTGTGATAAAACCGTCGGC ... TCTGAATA fw01077 fw02081 fw16071 fw23005 fw24093 5 muscle ... LIM protein isoform 2 [Bombyx mori] NP_001037398 6 ...

  11. ClEST cluster :Cl_contig0487 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0487 synaptic glycoprotein sc2 Cimex lectularius nuclear gene 366 GTTGTTTTATCTGATTCGGAG ... PREDICTED: steroid Alpha ReducTase family member (art -1)-like [Saccoglossus kowalevskii] XP_002732370 2. ...

  12. ClEST cluster :Cl_singleton0302 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0302 150 kda oxygen-regulated protein Cimex lectularius nuclear gene 290 CGATCGAGACT ... AAAGAGAAGGGGACAGTGGAGCTCCCAAG fb15026 1 PREDICTED: hypoxia ... up-regulated protein 1-like isoform 4 [Nasonia vit ...

  13. ClEST cluster :Cl_singleton0264 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0264 dnaj homolog subfamily a member 2 Cimex lectularius nuclear gene 633 GGACTTTTGA ... TGGCAGTAGAATGGCCAAAGAGATCAGGACAATGTGTAGT fb13059 1 molecular ... chaperone [Rhodnius prolixus] AEL79216 3.81379E-61 ...

  14. ClEST cluster :Cl_singleton0071 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0071 nucleosome-remodeling factor subunit nurf301 Cimex lectularius nuclear gene 605 ... GGCACCGTCATC fb05014 1 PREDICTED: similar to fetal alzheimer ... antigen falz [Tribolium castaneum] XP_001811424 2. ...

  15. ClEST cluster :Cl_singleton1298 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1298 nadh dehydrogenase Cimex lectularius nuclear gene 236 GAGTTCTAAGTCGTCTGGTCCTGAA ... TTTGAAAA fw05041 1 NADH dehydrogenase [ubiquinone] iron -sulfur protein 5 [Acyrthosiphon pisum] NP_00115530 ...

  16. ClEST cluster :Cl_contig0235 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0235 tyrosine tryptophan ... Cimex lectularius nuclear gene 453 CGACCCTGATGGACGGTGGAAATTACA ... GACATTGCCT fb16033 fw14092 mb16034 3 phenylalanine-tryptophan ... hydroxylase [Gryllus bimaculatus] BAJ83477 2.8E-78 ...

  17. ClEST cluster :Cl_singleton0416 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0416 ornithine aminotransferase Cimex lectularius nuclear gene 438 TATC...CAGTTTGCCGAGTATATCACCCGTTATTT fb20049 1 PREDICTED: probable ornithine aminotransferase-like [Glycine max] XP_003531161 4.30167E-26 GO:0008483 ...

  18. ClEST cluster :Cl_singleton2093 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton2093 selenoprotein t Cimex lectularius nuclear gene 435 GAGAAGGAGATTCCG...GAGACGGGAAGAATA mb12059 1 selenoprotein T [Glossina morsitans morsitans] ADD19835 7.29481E-59 GO:0045454 GO:0008430 GO:0005575 ...

  19. ClEST cluster :Cl_contig0079 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0079 death -associated protein Cimex lectularius nuclear gene 811 GAGTGATCATAGTGAGAACGGT ... ATTCTGTA fb07073 fb13017 fs15001 fw07030 mb18092 5 death -associated protein-like protein [Maconellicoccus h ...

  20. ClEST cluster :Cl_singleton1627 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1627 death -associated protein kinase 1 Cimex lectularius nuclear gene 571 TCCCAATGGG ... CCTACAGCGGAGT fw19023 1 PREDICTED: similar to DAP (Death -Associated Protein) Kinase homolog family member ( ...

  1. ClEST cluster :Cl_singleton0883 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0883 dehydrogenase domain protein Cimex lectularius nuclear gene 257 TCGATTACAACTGAA ... AAAAGGCTACTGACG fs14067 1 unnamed protein product [Azospirillum ... lipoferum 4B] YP_005037771 4.11457E-19 GO:0016616 ...

  2. ClEST cluster :Cl_singleton0781 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0781 membrane magnesium ... transporter 1-like Cimex lectularius nuclear gene 546 TCTAAA ... TACATGAATTGTTTAGTTTAATTATCTCTGT fs09088 1 Membrane magnesium ... transporter 1-B [Acromyrmex echinatior] EGI59871 6 ...

  3. Optimal pain management for radical prostatectomy surgery

    DEFF Research Database (Denmark)

    Joshi, Grish P; Jaschinski, Thomas; Bonnet, Francis; Kehlet, Henrik

    2015-01-01

    evidence to develop an optimal pain management protocol in patients undergoing radical prostatectomy. Most studies assessed unimodal analgesic approaches rather than a multimodal technique. There is a need for more procedure-specific studies comparing pain and analgesic requirements for open and minimally...... invasive surgical procedures. Finally, while we wait for appropriate procedure specific evidence from publication of adequate studies assessing optimal pain management after radical prostatectomy, we propose a basic analgesic guideline.......BACKGROUND: Increase in the diagnosis of prostate cancer has increased the incidence of radical prostatectomy. However, the literature assessing pain therapy for this procedure has not been systematically evaluated. Thus, optimal pain therapy for patients undergoing radical prostatectomy remains...

  4. Near-Ring Radicals and Class Pairs

    Institute of Scientific and Technical Information of China (English)

    L.Godloza; N.J.Groenewald; W.A.Olivier

    2005-01-01

    For near-ring ideal mappings p1 and p2, we investigate radical theoretical properties of and the relationship among the class pairs (p1: p2), (Sp2: Sp1) and (Rp2:Rp1). Conditions on p1 and p2 are given for a general class pair to form a radical class of various types. These types include the Plotkin and KA-radical varieties. A number of examples are shown to motivate the suitability of the theory of Hoehnke-radicals over KA-radicals when radical pairs of near-rings are studied. In particular, it is shown that (pc: P3) forms a KA-radical class, where Pc denotes the class of completely prime nearrings and P3 the class of 3-prime near-rings. This gives another near-ring generalization of the 2-primal ring concept. The theory of radical pairs are also used to show that in general the class of 3-semiprime near-rings is not the semisimple class of the 3-prime radical.

  5. Dynamics of Radical-Mediated Enzyme Catalyses

    Science.gov (United States)

    Warncke, Kurt

    1997-11-01

    An emergent class of enzymes harnesses the extreme reactivity of electron-deficient free radical species to perform some of the most difficult reactions in biology. The regio- and stereo-selectivity achieved by these enzymes defies long-held ideas that radical reactions are non-specific. The common primary step in these catalyses is metal- or metallocenter-assisted generation of an electron-deficient organic "initiator radical". The initiator radical abstracts a hydrogen atom from the substrate, opening a new reaction channel for rearrangement to the product. Our aim is to elucidate the detailed molecular mechanisms of the radical pair separation and radical rearrangement steps. Radical pair separation and substrate radical rearrangement are tracked by using time-resolved (10-7 to 10-3 s) techniques of pulsed-electron paramagnetic resonance spectroscopy (FT-EPR, ESEEM). Synchronous time-evolution of the reactions is attained by triggering with a visible laser pulse. Transient non-Boltzmann population of the states of the spin-coupled systems, and resultant electron spin polarization, facilitates study at or near room temperature under conditions where the enzymes are operative. The systems examined include ethanolamine deaminase, a vitamin B12 coenzyme-dependent enzyme, ribonucleotide reductase and photosynthetic reaction centers. The electronic and nuclear structural and kinetic information obtained from the pulsed-EPR studies is used to address how the initiator radicals are stabilized against deleterious recombination with the metal, and to distinguish the participation of concerted versus sequential rearrangement pathways.

  6. Investigation of the electron spin resonance of matrix isolated ClO

    International Nuclear Information System (INIS)

    The matrix isolation of ClO in a CO2 matrix is investigated with the aim of providing a detection method for ClO in the stratosphere. Of main concern is the identification and interpretation of the so far unkown ESR-spectrum of matrixisolated ClO. After trapping of ClO in a CO2 matrix at 10 K a highly anisotropic ESR-spectrum is observed which can be attributed to ClO. The shape and the g-values of the spectrum are characteristic for a 2PIsub(3/2) groundstate. Some minor structure discernible on the spectrum can be related to ClO at different trapping sites. After annealing the sample at T > 45 K, the radical concentration diminishes and the gsub(perpendicular to) peak splits into four peaks which correspond to the hyperfinesplitting of ClO. The values of the g and A tensors are determined by comparing the experimental spectrum with computer simulated spectra. In a simple crystal field model these values are compared with molecular parameters of ClO deduced from gas phase spectra. (orig.)

  7. The Games Radicals Play: Special Issue on Free Radicals and Radical Ions

    Directory of Open Access Journals (Sweden)

    John C. Walton

    2015-02-01

    Full Text Available Chemistry and Physics have aptly been described as “most excellent children of Intellect and Art” [1]. Both these “children” engage with many playthings, and molecules rank as one of their first favorites, especially radicals, which are amongst the most lively and exciting. Checking out radicals dancing to the music of entropy round their potential energy ballrooms is surely both entertaining and enlightening. Radicals’ old favorite convolutions are noteworthy, but the new styles, modes and arrangements appearing on the scene are even more interesting. Some of these are ephemeral and enjoy only a brief appearance, others are retro-types reappearing in new guises, still others are genuinely new and “go viral” in the scientific world. This Special Issue of Molecules contains the observations and reflections of a select group of chemists and physicists fascinated by this spectacle. It contains an eclectic mix reflecting on new modes and advances as well as on permutations and combinations that revive mature themes. [...

  8. Absolute rate constants for the reaction of NO with a series of peroxy radicals in the gas at 295 K

    DEFF Research Database (Denmark)

    Sehested, J.; Nielsen, O.J.; Wallington, T.J.

    The rate constants for the reaction of NO with a series of peroxy radicals: CH3O2, C2H5O2, (CH3)3CCH2O2, (CH3)3CC(CH3)2CH2O2, CH2FO2, CH2ClO2, CH2BrO2, CHF2O2, CF2ClO2, CHF2CF2O2, CF3CF2O2, CFCl2CH2O2 and CF2ClCH2O2 were measured at 298 K and a total pressure of 1 atm. The rate constants were obt...... obtained using the absolute technique of pulse radiolysis combined with time-resolved UV-VIS spectroscopy. The results are discussed in terms of reactivity trends and the atmospheric chemistry of peroxy radicals....

  9. Photoionisation of the tropyl radical

    Directory of Open Access Journals (Sweden)

    Kathrin H. Fischer

    2013-04-01

    Full Text Available We present a study on the photoionisation of the cycloheptatrienyl (tropyl radical, C7H7, using tunable vacuum ultraviolet synchrotron radiation. Tropyl is generated by flash pyrolysis from bitropyl. Ions and electrons are detected in coincidence, permitting us to record mass-selected photoelectron spectra. The threshold photoelectron spectrum of tropyl, corresponding to the X+ 1A1’ ← X 2E2” transition, reveals an ionisation energy of 6.23 ± 0.02 eV, in good agreement with Rydberg extrapolations, but slightly lower than the value derived from earlier photoelectron spectra. Several vibrations can be resolved and are reassigned to the C–C stretch mode ν16+ and to a combination of ν16+ with the ring breathing mode ν2+. Above 10.55 eV dissociative photoionisation of tropyl is observed, leading to the formation of C5H5+ and C2H2.

  10. Radical surgery in septic abortion.

    Science.gov (United States)

    Chatterjee, P; Ghosh, M; Ghosh, S

    1979-08-01

    At R.G. Kar Medical College Hospital, Calcutta, 10 cases of septic abortion from 1975-1977 were studied. Hysterectomies were preformed on 4 cases due to emergency situations including traumatised uterine fundus and perforated cervix, and on 6 cases after conservative treatment. Upon performing laparotomy in 9 cases, a uterine rent was detected; in 1 case there was a perforation in the posterior wall of the cervix, and in 5 cases mechanical obstructions due to internal adhesions to the uterine rent were found. 4 patients died primarily because of the patients seeking help too late. It is suggested that under high risk circumstances, laparotomy is advantageous to conservative medical management since bowel injuries and mechanical obstructions can only be detected by laparotomy. Radical surgery, however, should be undertaken before the patients general condition deteriorates to the point that the patient cannot tolerate surgical intervention. PMID:12336028

  11. Students' Ideas and Radical Constructivism

    Science.gov (United States)

    Sánchez Gómez, Pedro J.

    2016-08-01

    In this article, I study, from the point of view of the analytic philosophy of mind, the compatibility of students' ideas studies (SIS) with radical constructivism (RC). I demonstrate that RC is based on a psychology of narrow mental states; that is, the idea that the mental content of an individual can be fully characterised without any reference external to her or him. I show that this fact imposes some severe restrictions to SIS to be incorporated into RC. In particular, I argue that only qualitative studies can comply with the requirement of narrowness. Nevertheless, I propose that quantitative works can be employed as sources of types in order to study token actual students. I use this type-token dichotomy to put forward an outline of a theory of the relation between school contents and mental contents. In this view, token mental contents regarding a given topic can be defined, and probed, only by resorting to typical school contents.

  12. Students' Ideas and Radical Constructivism

    Science.gov (United States)

    Sánchez Gómez, Pedro J.

    2016-04-01

    In this article, I study, from the point of view of the analytic philosophy of mind, the compatibility of students' ideas studies (SIS) with radical constructivism (RC). I demonstrate that RC is based on a psychology of narrow mental states; that is, the idea that the mental content of an individual can be fully characterised without any reference external to her or him. I show that this fact imposes some severe restrictions to SIS to be incorporated into RC. In particular, I argue that only qualitative studies can comply with the requirement of narrowness. Nevertheless, I propose that quantitative works can be employed as sources of types in order to study token actual students. I use this type-token dichotomy to put forward an outline of a theory of the relation between school contents and mental contents. In this view, token mental contents regarding a given topic can be defined, and probed, only by resorting to typical school contents.

  13. Iron and iron derived radicals

    Energy Technology Data Exchange (ETDEWEB)

    Borg, D.C.; Schaich, K.M.

    1987-04-01

    We have discussed some reactions of iron and iron-derived oxygen radicals that may be important in the production or treatment of tissue injury. Our conclusions challenge, to some extent, the usual lines of thought in this field of research. Insofar as they are born out by subsequent developments, the lessons they teach are two: Think fastexclamation Think smallexclamation In other words, think of the many fast reactions that can rapidly alter the production and fate of highly reactive intermediates, and when considering the impact of competitive reactions on such species, think how they affect the microenvironment (on the molecular scale) ''seen'' by each reactive molecule. 21 refs., 3 figs., 1 tab.

  14. Inhibitory effects of chitosan on superoxide anion radicals and lipid free radicals

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    With the electron spin resonance (ESR) technique, the inhibitory effects of chitosan on superoxide anion radicals and linoleic acid lipid radicals were found. The inhibitory ratio E for these two kinds of radicals is in proportion to the concentration of chitosan. It was also observed that E for linoleic acid lipid radicals increased with the increase of the degree of deacetylation and decreased with the increase of the molecular weight of chitosan.

  15. Experimental studies of the kinetics of small polyatomic free radicals in combustion reactions; Moniatomisten radikaalien kinetiikka palamisreaktioissa, kokeellinen tutkimus

    Energy Technology Data Exchange (ETDEWEB)

    Seetula, J. [Helsinki Univ. (Finland). Lab. of Physical Chemistry

    1996-12-01

    The kinetics of the reactions of CH{sub 2}Cl, CHClBr, CH{sub 3}CCl{sub 2} and CCl{sub 3}, with Cl{sub 2} has been investigated in a tubular reactor coupled to a photoionization mass spectrometer. The radicals of interest, R, were generated homogeneously in the reactor by pulse 248 nm exciplex laser photolysis. The decay of R was monitored as a function of Cl{sub 2} concentration under pseudo-first-order condition to determine the rate constant as a function of temperature pressure. The reactions were studied separately over a temperature range up to a temperature of 873 K. The rate constants of CH{sub 2}Cl, CHClBr and CH{sub 3}CCl{sub 2} radicals determined were fitted to three-parameter Arrhenius-type expression (with units of cm{sup 3} molecule{sup -1} s{sup -1}): k(CH{sub 2}Cl) = 1.05x10{sup -16} x (T){sup 1.4} x exp(-357 J mol{sup -1} / RT), k(CHClBr) = 5.83x10{sup -20} x (T){sup 2.3} x exp(-300 J mol{sup -1}/ RT) and k(CH{sub 3}CCl{sub 2}) 1.10x10{sup -}2{sup 6} x (T){sup 4.3} x exp(15000 J mol{sup -1}/ RT). The rate constants CCl{sub 3} radical were fitted to a two-parameter Arrhenius expression (units in cm{sup 3} molecule{sup -1} s{sup -1}): k(CCl{sub 3}) = (8.1 +- 6.7)10{sup -l3} exp[-(25.0 +- 8.7) kJ mol{sup -1}/ RT]. An Arrhenius expression for the reaction of Cl+CCl{sub 4} -> <- CCl{sub 3}+Cl{sub 2} is also obtained from the kinetics of the reaction of CCl{sub 3} radical with Cl{sub 2} combined with the known heat of formation and entropy values of CCl{sub 3} free radical to be as follows (in units cm{sup 3} molecule{sup -1-}5 s{sup -1}): k(Cl+CCl{sub 4}) = (3.9 + 3.2)10{sup -10} exp[-(71 + 9) kJ mol{sup -1}/ RT]. The error limits stated are l{sigma}+Student`s t and base on statistical uncertainties only. (author)

  16. Mechanism of HgCl2 cytotoxicity in cultured mammalian cells.

    Science.gov (United States)

    Cantoni, O; Christie, N T; Swann, A; Drath, D B; Costa, M

    1984-09-01

    Treatment of intact Chinese hamster ovary cells with HgCl2 produced a rapid, concentration-dependent induction of DNA single-strand breaks (SSB) as revealed by alkaline elution analysis. Direct addition of HgCl2 to cell lysates did not result in DNA strand breaks. HgCl2 treatment of cells also caused a rapid leakage of superoxide radicals that were detected in their media by measurement of the reduction of exogenously added cytochrome c. There was a linear relationship between the production of radicals and the induction of DNA strand breaks, and there were also excellent temporal correlations in these parameters. Addition of oxygen radical scavengers, such as the enzymes superoxide dismutase and catalase, to the extracellular media significantly reduced the extent of DNA damage caused by HgCl2 without a similar attenuation of its uptake into cells, as did the autoclaved enzymes. Similarly, addition of radical scavengers such as glycerol or ascorbate inhibited the DNA damage but also reduced the uptake of the metal by almost the same degree. Thus, because of secondary effects on uptake of the metal, the radical scavenger experiments could not address the importance of oxygen radicals in the DNA damage caused by HgCl2. SSB were enhanced when cells were treated with HgCl2 and diethylmaleate or diethyldithiocarbamate, agents that deplete cellular reduced glutathione or inhibit the intracellular activity of superoxide dismutase, respectively. Thus, DNA damage in cells rendered sensitive to radicals was greater when these cultures were subsequently treated with HgCl2. The binding of 203HgCl2 to the DNA of intact Chinese hamster ovary cells was also studied. These studies were made possible by the relatively high stability of Hg(II) interaction with DNA and by utilizing a gentle method of DNA isolation that minimized redistribution of intracellular Hg(II) complexes after cells were lysed. The amount of Hg(II) bound to DNA varied from approximately 7 to 35 Hg atoms per 10

  17. Synchrotron radiation structure analyses of the light-induced radical pair of a hexaarylbiimidazolyl derivative. Origin of the spin-multiplicity change

    CERN Document Server

    Kawano, M; Matsubara, K; Imabayashi, H; Mitsumi, M; Toriumi, K; Ohashi, Y

    2002-01-01

    In situ synchrotron radiation structure analyses of a light-induced radical pair from o-Cl-HABI were performed by using an X-ray vacuum camera at 23-70K at the BL02B1 station of SPring-8. The combined results of X-ray analysis with theoretical calculation, IR, and UV-vis spectroscopy reveal that a slight conformational change of the radical pair causes the drastic spin-multiplicity change during 2-140K. (author)

  18. Hemispheric average Cl atom concentration from 13C/12C ratios in atmospheric methane

    Directory of Open Access Journals (Sweden)

    D. Lowe

    2004-05-01

    Full Text Available Methane is a significant atmospheric trace gas in the context of greenhouse warming and climate change. The dominant sink of atmospheric methane is the hydroxyl radical (OH. Recently, a mechanism for production of chlorine radicals (Cl in the marine boundary layer (MBL via bromine autocatalysis has been proposed. The importance of this mechanism in producing a methane sink is not clear at present because of the difficulty of in-situ direct measurement of Cl. However, the large kinetic isotope effect of Cl compared with OH produces a large fractionation of 13C compared with 12C in atmospheric methane. This property can be used to estimate the likely size of the methane sink attributable to MBL Cl. By taking account of the mixing of MBL air into the free troposphere, we estimate that the global methane sink due to reaction with Cl atoms in the MBL could be as large as 19 Tg yr−1, or about 3.3% of the total CH4 sink.

  19. Radical Behaviorism and Buddhism: Complementarities and Conflicts

    Science.gov (United States)

    Diller, James W.; Lattal, Kennon A.

    2008-01-01

    Comparisons have been made between Buddhism and the philosophy of science in general, but there have been only a few attempts to draw comparisons directly with the philosophy of radical behaviorism. The present review therefore considers heretofore unconsidered points of comparison between Buddhism and radical behaviorism in terms of their…

  20. Radical-Local Teaching and Learning

    DEFF Research Database (Denmark)

    Hedegaard, Mariane; Chaiklin, Seth

    radical-local teaching and learning approach. The first half of the book introduces the idea of radical-local teaching and learning and develops the theoretical background for this perspective, drawing on the cultural-historical research tradition, particularly from Vygotsky, El'konin, Davydov...

  1. What Is Radical in School Geography Today?

    Science.gov (United States)

    Morgan, John

    2011-01-01

    This article addresses the question of what "radical school geography" might look like in the present historical moment. It traces the history of a distinctive "radical" tradition in school geography, most prominently associated with the work of John Huckle, who argued for the importance of understanding the content and pedagogy of school…

  2. Free Radical Mechanisms in Autoxidation Processes.

    Science.gov (United States)

    Simic, Michael G.

    1981-01-01

    Discusses the use of steady-state radiation chemistry and pulse radiolysis for the generation of initial free radicals and formation of peroxy radicals in the autoxidation process. Provides information regarding the autoxidation process. Defines autoxidation reactions and antioxidant action. (CS)

  3. Populismo radical y fragilidad democrática

    Directory of Open Access Journals (Sweden)

    Andrés Benavente Urbina

    2005-12-01

    Full Text Available El Populismo Radical – también llamado populismo revolucionario – es planteado por el autor como una amenaza a la democracia en América Latina, en cuanto instrumentaliza problemas económicos y sociales reales para confrontarse con el sistema institucional. En la primera parte del artículo aborda el plano conceptual, proponiéndose una caracterización tanto para el populismo clásico como para el populismo radical. En la segunda, se hace un estudio de los dos casos en que, durante el año 2005, las movilizaciones sociales, que a su vez eran expresiones del populismo revolucionario, provocaron agudas crisis de gobernabilidad en Bolivia y Ecuador, precipitando cambios de gobierno en dichos países. La tercera parte, a manera de conclusión, vincula a las expresiones del populismo radical o revolucionario con la fragilidad de las democracias de la región latinoamericana, y por lo mismo, compartiendo las premisas de la Secretaria de Estado norteamericana Condoleezza Rice, el autor sostiene la necesidad de proteger la democracia con mecanismo efectivos y no meramente declarativos, dado que llama la atención la omisión de la comunidad internacional ante las movilizaciones sociales violentas y rupturistas que atentan en contra del ordenamiento institucional democrático, como ha ocurrido doblemente en Bolivia, argumentando que no se ha producido un quiebre de la Constitución en cuanto funcionan los mecanismos sucesorios regulares. La democracia no es sólo la apelación formal a tales mecanismos, sino el cabal respeto al Estado Derecho y la efectiva vigencia de las libertades personales.

  4. Kinetics of the self reaction of cyclohexyl radicals.

    Science.gov (United States)

    Loginova, Ksenia A; Knyazev, Vadim D

    2011-08-11

    The kinetics of the self-reaction of cyclohexyl radicals was studied by laser photolysis/photoionization mass spectroscopy. Overall rate constants were obtained in direct real-time experiments in the temperature region 303-520 K and at bath gas (helium with up to 5% of radical precursors) densities (3.00-12.0) × 10(16) molecules cm(-3). Cyclohexyl radicals were produced by a combination of the 193 nm photolysis of oxalyl chloride ((CClO)(2)) with the subsequent fast reaction of Cl atoms with cyclohexane, and their initial concentrations were determined from real-time profiles of HCl. The observed overall c-C(6)H(11) + c-C(6)H(11) rate constants demonstrate negative temperature dependence, which can be described by the following expressions: k(1) = 4.8 × 10(-12) exp(+542 K/T) cm(3) molecule(-1) s(-1), with estimated uncertainty of 16% over the 303-520 K temperature range. The fraction of disproportionation equal to 41 ± 7% was determined at 305 K; analysis of earlier experimental determinations of the disproportionation-to-recombination branching ratio leads to recommending this room-temperature value for other temperatures. The corresponding temperature dependences of the recombination (1a, bicyclohexyl product) and the disproportionation (1b, cyclohexene and cyclohexane products) channels are k(1a) = 2.8 × 10(-12) exp(+542 K/T) and k(1b) = 2.0 × 10(-12) exp(+542 K/T) cm(3) molecule(-1) s(-1), with estimated uncertainties of 20% and 29%, respectively. PMID:21702489

  5. Physicochemical aspects of isomerisation of free radicals

    Energy Technology Data Exchange (ETDEWEB)

    Denisov, Evgenii T; Denisova, Taisa G [Institute of Problems of Chemical Physics, Russian Academy of Sciences, Chernogolovka, Moscow Region (Russian Federation)

    2004-11-30

    Kinetic data on intramolecular abstraction of hydrogen atoms in alkyl, alkoxyl and peroxyl radicals are generalised and analysed. It is shown that the activation energies of these reactions are affected by ring strain. The kinetic parameters of mono- and bimolecular elimination reactions are compared. The difference between the activation energies of these reactions is interpreted using the model of intersecting parabolas. The same model is used to discuss the results of analysis of cyclisation of alkyl radicals; the ring strain energy is shown to play an important role in the activation of these reactions. It is noted that the difference between the electron affinities of the C, N and O atoms is clearly manifested in the cyclisation of aminyl and {omega}-formylalkyl radicals. The kinetic parameters of cyclisation and bimolecular radical addition reactions are compared. The experimental data on the transfer of the vinyl and aryl groups in alkyl radicals are analysed.

  6. 77 FR 56525 - Special Conditions: Bombardier, Model CL-600-2B16 Airplane (CL-601-3A, CL-601-3R, and CL-604...

    Science.gov (United States)

    2012-09-13

    ... April 11, 2000 (65 FR 19477-19478), as well as at http://DocketsInfo.dot.gov/ . Docket: Background... Administration 14 CFR Part 25 Special Conditions: Bombardier, Model CL-600-2B16 Airplane (CL- 601-3A, CL-601-3R, and CL-604 Variants); Enhanced Flight Vision System AGENCY: Federal Aviation Administration (FAA),...

  7. Alkoxy radical, RCH2O, as a free radical product in x-irradiated single crystals of nucleosides and nucleotides

    International Nuclear Information System (INIS)

    The RCH2O radical is formed in x-irradiated 3'-cytidylic acid (3'CMP), 5-chlorodeoxyuridine (ClUdR), 5-bromodeoxyuridine (BUdR), adenosinexHCl (ARxHCl), and deoxyadenosine monohydrate (AdRxH2O) owing to the net loss of hydrogen from O5/sub prime/ of the primary hydroxylic group. ESR measurements were made between 78 and 100 K on single crystals of 3'CMP, ClUdR, BUdR, and ARxHCl and on polycrystalline AdRxH2O. The range of principal g values is g/sub max/=2.054--2.093, g/sub int/=2.005--2.009, g/sub min/ =1.995--2.000. The range of sum of the isotropic β-hydrogen hyperfine couplings is A/sup β/1/sub iso/ +A/sup β/2/sub iso/=141--156 G. The g tensors and A/sup β//sub iso/ values are used to determine which oxygen nonbonding orbital contains the bulk of the unpaired electron density. The unpaired electron 2p orbital symmetry axis is perpendicular to a plane determined by X(H) xxxO--C. Of the two relevant hydrogen bonds in the undamaged molecule, the X--HxxxO bond remains intact whereas the hydrogen in the O--HxxxY bond is displaced. The equation A/sup β//sub iso/=B0+B2 cos2theta, with B0 =0 and B2=101 +- 13 G describes the dependency of the β-hydrogen hyperfine coupling on the torsion angle theta, between the unpaired electron symmetry axis and the C--H/sub β/ bond of the RCH2O radical. Mechanisms of formation, factors in stabilization, and reactions of decay are discussed

  8. Combined results of searches for the standard model Higgs boson in pp collisions at {radical}(s)=7 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chatrchyan, S.; Khachatryan, V.; Sirunyan, A.M.; Tumasyan, A. [Yerevan Physics Institute, Yerevan (Armenia); Adam, W.; Bergauer, T.; Dragicevic, M.; Eroe, J.; Fabjan, C.; Friedl, M.; Fruehwirth, R.; Ghete, V.M.; Hammer, J.; Hoch, M.; Hoermann, N.; Hrubec, J.; Jeitler, M.; Kiesenhofer, W.; Krammer, M.; Liko, D. [Institut fuer Hochenergiephysik der OeAW, Wien (Austria); and others

    2012-03-29

    Combined results are reported from searches for the standard model Higgs boson in proton-proton collisions at {radical}(s)=7 TeV in five Higgs boson decay modes: {gamma}{gamma}, bb, {tau}{tau}, WW, and ZZ. The explored Higgs boson mass range is 110-600 GeV. The analysed data correspond to an integrated luminosity of 4.6-4.8 fb{sup -1}. The expected excluded mass range in the absence of the standard model Higgs boson is 118-543 GeV at 95% CL. The observed results exclude the standard model Higgs boson in the mass range 127-600 GeV at 95% CL, and in the mass range 129-525 GeV at 99% CL. An excess of events above the expected standard model background is observed at the low end of the explored mass range making the observed limits weaker than expected in the absence of a signal. The largest excess, with a local significance of 3.1{sigma}, is observed for a Higgs boson mass hypothesis of 124 GeV. The global significance of observing an excess with a local significance {>=}3.1{sigma} anywhere in the search range 110-600 (110-145) GeV is estimated to be 1.5{sigma}(2.1{sigma}). More data are required to ascertain the origin of the observed excess.

  9. Hydroxyl-radical-induced oxidation of cyclic dipeptides: Reactions of free peptide radicals and their peroxyl radicals

    International Nuclear Information System (INIS)

    In the course of this study investigations were carried out into the reactions of hydroxyl radicals and hydrogen atoms with cyclic dipeptides as well as the subsequent reactions of peptide radicals and their peroxyl radicals in aqueous solution. The radiolysis products formed in the absence and presence of oxygen or transient metal complexes were characterized and determined on a quantitative basis. The linking of information from product analyses to the kinetic data for transient species obtained by time-resolving UV/VIS and conductivity measurements (pulse radiolysis) as well as computer-assisted simulations of individual events during the reaction permitted an evaluation of the mechanisms underlying the various processes and an identification of interim products with short life-times, which did or did not belong to the group of radicals. Through the characterization of key reactions of radicals and peroxyl radicals of this substance class a major advance has been made towards a better understanding of the role of radicals in the peptide compound and the mechanisms involved in indirect radiation effects on long-chain peptides and proteins. (orig.)

  10. ORGASMIC FUNCTION AFTER RADICAL PROSTATECTOMY

    Directory of Open Access Journals (Sweden)

    D. Yu. Pushkar

    2014-07-01

    Full Text Available Objective: to study orgasmic function (OF in patients undergoing radical prostatectomy (RPE.Subjects and methods. Seventy-nine patients who had undergone RPE for locally advanced prostate cancer without hormone and radiation therapies were examined. The patients’ mean age was 59.3 years. The mean EF-IIEF domain score was 24.4. OF was estimated by IIEF question 10 and the authors’ questionnaire. The Spearman rank correction coefficient and Mann-Whitney U-Wilcoxon tests were used.Results. After RPE, there was a reduction in the mean IIEF question 10 score from 3.9 (confidence interval 3.7–4.1 to 3.3 (3–3.5 (p = 0.000. The following changes were found in orgasm intensity: no changes in 43 %, mild worsening in 42 %, severe worsening in 8 %, and enhancement in 4 %; orgasm could not be achieved in 4 % of the patients. Pain usually of low intensity was reported by 8.8 %. The poor factors for preserving OF were its low baseline level, elderly age, or severe post-RPE erectile dysfunction.Conclusion. There were significant OF changes after RPE, which should be kept in mind while treating this category of patients.

  11. Multicomponent versus domino reactions: One-pot free-radical synthesis of β-amino-ethers and β-amino-alcohols

    Directory of Open Access Journals (Sweden)

    Bianca Rossi

    2015-01-01

    Full Text Available Following an optimized multicomponent procedure, an aryl amine, a ketone, and a cyclic ether or an alcohol molecule are assembled in a one-pot synthesis by nucleophilic radical addition of ketyl radicals to ketimines generated in situ. The reaction occurs under mild conditions by mediation of the TiCl4/Zn/t-BuOOH system, leading to the formation of quaternary β-amino-ethers and -alcohols. The new reaction conditions guarantee good selectivity by preventing the formation of secondary products. The secondary products are possibly derived from a competitive domino reaction, which involves further oxidation of the ketyl radicals.

  12. Generation of radicals by bimolecular reactions

    Energy Technology Data Exchange (ETDEWEB)

    Denisov, Evgenii T; Denisova, Taisa G [Institute of Problems of Chemical Physics, Russian Academy of Sciences, Chernogolovka, Moscow Region (Russian Federation)

    2002-05-31

    The published data on bimolecular processes of radical generation in chain degradation, polymerisation, oxidation and halogenation reactions of organic compounds are systematised and analysed within the framework of the parabolic model of homolytic bimolecular reactions. The specific features of these highly endothermic reactions are discussed with a special emphasis on their striking similarity to radical abstraction processes with identical reaction centres in the transition state. The feasibility of theoretical evaluation of the activation energies and the rate constants of bimolecular reactions in radical generation is demonstrated. The bibliography includes 86 references.

  13. ClEST cluster :Cl_singleton1421 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1421 atp-binding sub-family ... a member 4 Cimex lectularius nuclear gene 647 CTTGTATTTG ... AGAATGACTATGACG fw09043 1 ATP-binding cassette sub-family ... A (ABC1) member 4 [Bos taurus] DAA31386 ...

  14. ClEST cluster :Cl_contig0172 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0172 solute carrier family ... 25 member 38-like Cimex lectularius nuclear gene 712 GCATTAA ... 028 fw22041 3 PREDICTED: similar to solute carrier family ... 25 member 38 [Tribolium castaneum] XP_973832 3.3E- ...

  15. ClEST cluster :Cl_singleton1312 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n1312 1-o -acylceramide synthase Cimex lectularius nuclear gene 643 GAGATGCAAACACAAGCT ... GTGAGAGTTAATATTTTGTAAATGAAA fw05074 1 PREDICTED: gro up XV pho spho lipase A2-like iso fo rm 1 [Acyrtho sipho ... n pisum] XP_001951433 1.03386E-80 GO :0008415 ...

  16. ClEST cluster :Cl_contig0274 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0274 apo lipo pro tein o -like Cimex lectularius nuclear gene 708 TCAAGCAAGGAGTCGGGTAATAGGA ... ACTCCTTTACACCACTGCAGGCGGTTCTG fs20086 mb19060 2 hypo thetical pro tein SINV_00148 [So leno psis invicta] EF ... Z14864 9.0E-17 N:GO :0035556 GO :0005834 GO :0004871 GO :0007186 ...

  17. ClEST cluster :Cl_singleton2087 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleto n2087 3-hydro xyiso butyrate dehydro genase Cimex lectularius nuclear gene 440 GAGTTTAGC ... TGAGTACAATCGATCCATCAGTTTCAAAAGAACT mb12038 1 3-hydro xyiso butyrate dehydro genase [Vibrio ... vulnificus MO 6- ... 24/O ] YP_004191179 1.0524E-25 GO :0005488 GO :0044281 GO : ... 0044237 GO :0016616 ...

  18. ClEST cluster :Cl_contig0030 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_co ntig0030 farneso ic acid o -methyl transferase Cimex lectularius nuclear gene 558 GCCAGTTAAGT ... 07060 fw08004 fw10082 fw14025 10 uncharacterized pro tein LO C100164577 [Acyrtho sipho n pisum] NP_00123309 ... 2 3.0E-48 GO :0016740 ...

  19. ClEST cluster :Cl_contig0419 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig0419 vacuolar atp synthase ... subunit e ... Cime x le ctularius nucle ar ge ne ... 450 GGGCACTCGCAGTTA ... ACC fs20066 fw20016 2 Vacuolar proton pump subunit E ... [Camponotus floridanus] E FN63114 2.4E -37 GO:004277 ...

  20. ClEST cluster :Cl_contig0422 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_contig042 2 dead box atp-dependent rna Cimex lectularius nuclear gene 448 CATTTTAGCTGGAGTTTCAC ... AACATATCTTGCAACTTACAACCAAGTGTTCGAGAG fb07086 fw20024 2 ... DEAD box ATP-dependent RNA helicase putative [Ixo ... des scapularis] XP_002407896 4.7E-42 ...

  1. ClEST cluster :Cl_singleton0812 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0812 s-phase kinase-associated protein 1 Cimex lectularius nuclear gene 430 GGCCTCTT ... kinase-associated protein [Danaus plexippus] EHJ6542 9 6.56821E-42 ... GO:0016301 GO:0016310 GO:0006511 GO:0 ...

  2. ClEST cluster :Cl_singleton1538 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton1538 dead (asp-glu-ala-asp) box polypeptide 5 Cimex lectularius nuclear...fw14079 1 similar to DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase 68kDa) [Xenopus laevis] NP_001079703 6.59566E-23 ...

  3. Some reactions of oxidizing radicals with enzymes in aqueous solution

    International Nuclear Information System (INIS)

    A range of oxidizing radicals including some inorganic radical anions and the superoxide radical, can be generated by radiolysis of aqueous solutions. These radicals are more selective in their reactions with amino acids than the hydroxyl radical. Factors controlling the apparent reactivity of radical anions with proteins, such as free radical equilibria and ion-binding, are described. The superoxide radical inactivates papain by reaction with the cysteine residue. This reaction has been studied in solutions subjected to radiations of varying linear energy transfer. (Auth.)

  4. Radical pancreaticoduodenectomy for benign disease.

    LENUS (Irish Health Repository)

    Kavanagh, D O

    2008-01-01

    Whipple\\'s procedure is the treatment of choice for pancreatic and periampullary malignancies. Preoperative histological confirmation of malignancy is frequently unavailable and some patients will subsequently be found to have benign disease. Here, we review our experience with Whipple\\'s procedure for patients ultimately proven to have benign disease. The medical records of all patients who underwent Whipple\\'s procedure during a 15-year period (1987-2002) were reviewed; 112 patients underwent the procedure for suspected malignancy. In eight cases, the final histology was benign (7.1%). One additional patient was known to have benign disease at resection. The mean age was 50 years (range: 30-75). The major presenting features included jaundice (five), pain (two), gastric outlet obstruction (one), and recurrent gastrointestinal haemorrhage (one). Investigations included ultrasound (eight), computerised tomography (eight), endoscopic retrograde cholangiopancreatography (seven; of these, four patients had a stent inserted and three patients had sampling for cytology), and endoscopic ultrasound (two). The pathological diagnosis included benign biliary stricture (two), chronic pancreatitis (two), choledochal cyst (one), inflammatory pseudotumour (one), cystic duodenal wall dysplasia (one), duodenal angiodysplasia (one), and granular cell neoplasm (one). There was no operative mortality. Morbidity included intra-abdominal collection (one), anastomotic leak (one), liver abscess (one), and myocardial infarction (one). All patients remain alive and well at mean follow-up of 41 months. Despite recent advances in diagnostic imaging, 8% of the patients undergoing Whipple\\'s procedure had benign disease. A range of unusual pathological entities can mimic malignancy. Accurate preoperative histological diagnosis may have allowed a less radical operation to be performed. Endoscopic ultrasound-guided fine needle aspirate (EUS-FNA) may reduce the need for Whipple\\'s operation

  5. Radical Pancreaticoduodenectomy for Benign Disease

    Directory of Open Access Journals (Sweden)

    D. O. Kavanagh

    2008-01-01

    Full Text Available Whipple's procedure is the treatment of choice for pancreatic and periampullary malignancies. Preoperative histological confirmation of malignancy is frequently unavailable and some patients will subsequently be found to have benign disease. Here, we review our experience with Whipple's procedure for patients ultimately proven to have benign disease. The medical records of all patients who underwent Whipple's procedure during a 15-year period (1987–2002 were reviewed; 112 patients underwent the procedure for suspected malignancy. In eight cases, the final histology was benign (7.1%. One additional patient was known to have benign disease at resection. The mean age was 50 years (range: 30–75. The major presenting features included jaundice (five, pain (two, gastric outlet obstruction (one, and recurrent gastrointestinal haemorrhage (one. Investigations included ultrasound (eight, computerised tomography (eight, endoscopic retrograde cholangiopancreatography (seven; of these, four patients had a stent inserted and three patients had sampling for cytology, and endoscopic ultrasound (two. The pathological diagnosis included benign biliary stricture (two, chronic pancreatitis (two, choledochal cyst (one, inflammatory pseudotumour (one, cystic duodenal wall dysplasia (one, duodenal angiodysplasia (one, and granular cell neoplasm (one. There was no operative mortality. Morbidity included intra-abdominal collection (one, anastomotic leak (one, liver abscess (one, and myocardial infarction (one. All patients remain alive and well at mean follow-up of 41 months. Despite recent advances in diagnostic imaging, 8% of the patients undergoing Whipple'’s procedure had benign disease. A range of unusual pathological entities can mimic malignancy. Accurate preoperative histological diagnosis may have allowed a less radical operation to be performed. Endoscopic ultrasound–guided fine needle aspirate (EUS-FNA may reduce the need for Whipple's operation in

  6. Coupled evolution of BrOx-ClOx-HOx-NOx chemistry during bromine-catalyzed ozone depletion events in the arctic boundary layer

    OpenAIRE

    M. J. Evans; Jacob, Daniel James; Atlas, E.; Cantrell, C; Eisele, F.; Flocke, F.; Fried, A.; Mauldin, R; Ridley, B.; Wert, B; Talbot, R.; Blake, D.; B. Heikes; Snow, J.; Walega, J

    2003-01-01

    Extensive chemical characterization of ozone (O3) depletion events in the Arctic boundary layer during the TOPSE aircraft mission in March–May 2000 enables analysis of the coupled chemical evolution of bromine (BrOx), chlorine (ClOx), hydrogen oxide (HOx) and nitrogen oxide (NOx) radicals during these events. We project the TOPSE observations onto an O3 chemical coordinate to construct a chronology of radical chemistry during O3 depletion events, and we compare this chronology to results from...

  7. Measurement of the absorption cross sections of SiCl_4, SiCl_3, SiCl_2 and Cl at H Lyman-α wavelength

    OpenAIRE

    Mével, R.; Catoire, L.; M. Fikri; Roth, P.

    2013-01-01

    Atomic resonance absorption spectroscopy coupled with a shock tube is a powerful technique for studying high temperature dynamics of reactive systems. Presently, high temperature pyrolysis of SiCl_4–Ar mixtures has been studied behind reflected shock waves. Using time-resolved absorption profiles at 121.6 nm and a detailed reaction model, the absorption cross sections of SiCl_4, SiCl_3, SiCl_2 and Cl have been measured. Results agree well with available data for SiCl_4 and constitute, to our ...

  8. Understanding in-situ ozone production in the summertime through radical observations and modelling studies during the Clean air for London project

    Science.gov (United States)

    Whalley, Lisa; Stone, Daniel; Sharp, Thomas; Garraway, Shani; Bannan, Thomas; Percival, Carl; Hopkins, James; Holmes, Rachel; Hamilton, Jacqui; Lee, James; Laufs, Sebastian; Kleffmann, Jörg; Heard, Dwayne

    2014-05-01

    With greater than 50 % of the global population residing in urban conurbations, poor urban air quality has a demonstrable effect on human health. OH and HO2 radicals, (collectively termed HOx) together with RO2 radicals, mediate virtually all of the oxidative chemistry in the atmosphere, being responsible for the transformation of primary emissions into secondary pollutants such as NO2, O3 and particulates. Here we present measurements of OH, HO2, partially speciated RO2 (distinguishing smaller alkane related RO2 from larger alkane/alkene/aromatic related RO2), ClNO2 and OH reactivity measurements taken during the ClearfLo campaign in central London in the summer of 2012. Comparison with calculations from a detailed box model utilising the Master Chemical Mechanism v3.2 tested our ability to reproduce radical levels, and enabled detailed radical budgets to be determined, highlighting for example the important role of the photolysis of nitrous acid (HONO) and carbonyl species as radical sources. Speciation of RO2 enabled the break-down of ozone production from different classes of VOCs to be calculated directly and compared with model calculations. Summertime observations of radicals have helped to identify that increases in photolytic sources of radicals on warm, sunny days can significantly increase local ozone concentrations leading to exceedances of EU air quality recommendations of 60 ppbV. The photolytic breakdown of ClNO2 to Cl atoms can more than double radical concentrations in the early morning; although the integrated increase in radical concentrations over a 24 hr period in model runs when ClNO2 photolysis is included is more modest. On average we calculate just under a 1 ppb increase in ozone due to the presence of ClNO2 in London air. OH reactivity was found to be greatest during morning and evening rush hours. Good agreement between the modelled OH reactivity and observations could be achieved when reactivity associated with model generated photo

  9. User involvement competence for radical innovation

    DEFF Research Database (Denmark)

    Lettl, Christopher

    One important market related capability for firms which seek to develop radical innovations is the competence to involve the 'right' users at the 'right' time in the 'right' form. While former studies have identified a rather passive role of users in the radical innovation process, this paper...... focuses on the involvement of such users that are in the position to play an active role as inventors and (co)-developers. A multiple case study analysis was conducted in the field of medical technology. Five radical innovation projects within four firms were selected including medical robots and computer......-assisted navigation systems. The case study analysis reveals that firms who closely interact with specific users benefit significantly for their radical innovation work. These users have a high motivation toward new solutions, are open to new technologies, possess diverse competencies, and are embedded into a very...

  10. Radicalization and the Use of Social Media

    Directory of Open Access Journals (Sweden)

    Robin Thompson

    2011-01-01

    Full Text Available The use of social media tools by individuals and organizations to radicalize individuals for political and social change has become increasingly popular as the Internet penetrates more of the world and mobile computing devices are more accessible. To establish a construct for radicalization,the power and reach of social media will be described so there is common understanding of what social media is and how it is utilized by various individuals and groups. The second section will answer the question of why social media applications are the perfect platform for the radical voice. Finally, the use of social media and its influence in radicalizing populations in Northern Africa and the Middle East during 2011 will be analyzed and recommendations proposed.

  11. Neo-liberal Governing of 'Radicals'

    DEFF Research Database (Denmark)

    Lindekilde, Lasse

    2012-01-01

    The Danish government’s counter-radicalization Action Plan of 2009 had intended and unintended effects. Primarily targeting Danish Muslims, it employs neoliberal governmentality approaches of governance through individual support and response, information and knowledge, empowerment, surveillance ...

  12. Free radical scavenging activity of papaya juice

    International Nuclear Information System (INIS)

    Papaya juice is an efficient scavenger of highly reactive hydroxyl radicals (OH radical) formed during 60Co irradiation of water. The OH anion radicals were detected by the electron spin resonance (ESR) technique of spin trapping using DMPO (5,5-dimethyl-1-pyrroline-N-oxide) or by a colorimetric assay in which salicylate is converted into polyhydroxybenzoic acids. Papaya juice is also able to quench the ESR signal of a stable free radical (TEMPOL) and the ESR signal of the DMPO-OH adduct. The active substance(s) in papaya juice are heat-stable, dialyzable, and soluble in water but not in lipid solvents. The active agents do not appear to be ascorbate, tocopherol, or carotenoids. (author)

  13. RADICALLY CONTESTED ASSERTIONS IN ECOSYSTEM MANAGEMENT

    Science.gov (United States)

    Ecosystem management is a magnet for controversy, in part because some of its formulations rest on questionable assertions that are radically contested. These assertions are important to understanding much of the conflict surrounding ecosystem management and, therrefore, deserve...

  14. Customers as Partners in Radical Service Innovation

    DEFF Research Database (Denmark)

    Scupola, Ada; Nicolajsen, Hanne Westh

    2009-01-01

    ongoing collaboration where creativity and trial and error are crucial. These needs require new ways of communicating and interacting between customer and consultants. Originality/value- This article is original because it generates new insights into conditions and challenges in radical innovations in......  Purpose- The main purpose of this paper is to investigate customer involvement and related challenges in radical service innovations in engineering consulting services Design/methodology/approach - The paper uses a case study approach and so called rich descriptions to investigate customer...... involvement, roles and related challenges and conditions in radical service innovations.Findings- One main finding is that customers can engage in radical service innovations in engineering consultancy services and may play a decisive role. In doing this they most likely take on all the three user involvement...

  15. A radical approach to asperparaline C

    Czech Academy of Sciences Publication Activity Database

    Amatov, Tynchtyk; Jahn, Ullrich

    Praha: Czech Chemical Society, 2015. s. 41. [Liblice 2015. Advances in Organic, Bioorganic and Pharmaceutical Chemistry /50./. 06.11.2015-08.11.2015, Olomouc] Institutional support: RVO:61388963 Keywords : asperparalines * bridged diketopiperazines * radical reactions Subject RIV: CC - Organic Chemistry

  16. Innovation Type, Radicalness, and the Adoption Process.

    Science.gov (United States)

    Damanpour, Fariborz

    1988-01-01

    Reviews studies on the impact of organizational factors on the adoption of innovations along three dimensions (innovation type, innovation radicalness, and stages of adoption), finding considerable agreement. Proposes a research agenda for future studies. (SR)

  17. Rigid Ideals and Radicals of Ore Extensions

    Institute of Scientific and Technical Information of China (English)

    Chan Yong Hong; Tai Keun Kwak; S. Tariq Rizvi

    2005-01-01

    For an endomorphism σ of a ring R, Krempa called σ a rigid endomorphism if aσ(a) = 0 implies a= 0 for a ∈ R. A ring R is called rigid if there exists a rigid endomorphism of R. In this paper, we extend the σ-rigid property of a ring R to an ideal of R. For a σ-ideal Ⅰ of a ring R, we call Ⅰ a σ-rigid ideal if aσ(a) ∈Ⅰ implies a ∈Ⅰ for a ∈ R. We characterize σ-rigid ideals and study related properties. The connections of the prime radical and the upper nil radical of R with the prime radical and the upper nil radical of the Ore extension R[x; σ, δ], respectively, are also investigated.

  18. Fast beam studies of free radical photodissociation

    Energy Technology Data Exchange (ETDEWEB)

    Neumark, D.M. [Lawrence Berkeley Laboratory, CA (United States)

    1993-12-01

    The authors have developed a novel technique for studying the photodissociation spectroscopy and dynamics of free radicals. In these experiments, radicals are generated by laser photodetachment of a fast (6-8 keV) mass-selected negative ion beam. The resulting radicals are photodissociated with a second laser, and the photofragments are collected and detected with high efficiency using a microchannel plate detector. The overall process is: ABC{sup -} {yields} ABC + e{sup -} {yields} A + BC, AB + C. Two types of fragment detection schemes are used. To map out the photodissociation cross-section of the radical, the photodissociation laser is scanned and the total photofragment yield is measured as a function of wavelength. In other experiments, the photodissociation frequency is fixed and the photofragment masses, kinetic energy release, and scattering angle is determined for each photodissociation event.

  19. clOpenCL - supporting distributed heterogeneous computing in HPC clusters

    OpenAIRE

    Alves, Albano; Rufino, José; Pina, António; Santos, Luis Paulo

    2013-01-01

    Clusters that combine heterogeneous compute device architectures, coupled with novel programming models, have created a true alternative to traditional (homogeneous) cluster computing, allowing to leverage the performance of parallel applications. In this paper we introduce clOpenCL, a platform that supports the simple deployment and efficient running of OpenCL-based parallel applications that may span several cluster nodes, expanding the original single-node OpenCL model. clOpenCL is deploye...

  20. Radicalization and the Use of Social Media

    OpenAIRE

    Robin Thompson

    2011-01-01

    The use of social media tools by individuals and organizations to radicalize individuals for political and social change has become increasingly popular as the Internet penetrates more of the world and mobile computing devices are more accessible. To establish a construct for radicalization,the power and reach of social media will be described so there is common understanding of what social media is and how it is utilized by various individuals and groups. The second section will answer the q...

  1. Modelling of tropospheric ozone and radical chemistry

    OpenAIRE

    Burkert, Jörn

    2003-01-01

    This work describes in detail the photochemistry of ozone and radicals in both remote clean air and heavily polluted regions. The results of two field studies are presented: the Indian Ocean Experiment (INDOEX) and the Peroxy Radical Initiative for Measurements in the Environment (PRIME).The :b:INDOEX:/b: campaign studied the chemistry of remote areas of the Indian Ocean and the influence of the outflow from the Indian subcontinent on these regions. Measurements of trace gases (NMHC, O3, RO2*...

  2. Free Radicals, Antioxidants in Disease and Health

    OpenAIRE

    Pham-Huy, Lien Ai; He, Hua; Pham-Huy, Chuong

    2008-01-01

    Free radicals and oxidants play a dual role as both toxic and beneficial compounds, since they can be either harmful or helpful to the body. They are produced either from normal cell metabolisms in situ or from external sources (pollution, cigarette smoke, radiation, medication). When an overload of free radicals cannot gradually be destroyed, their accumulation in the body generates a phenomenon called oxidative stress. This process plays a major part in the development of chronic and degene...

  3. The stabilization energies of polyenyl radicals

    Science.gov (United States)

    Luo, Yu-Ran; Holmes, John L.

    1994-10-01

    The resonance stabilization energies, Es, of polyenyl radicals can be estimated by the equation Es( N)=-13.2+[3.95-15.8(2) -2/ n] kcal mol -1, where N is the number of C, C-π bonds in the polyenyl radicals. This correlation has been extended for predicting the weakest HC, CC and COH bond dissociation energies in vitamin A and similar compounds.

  4. OUR 6-YEAR EXPERIENCE IN RADICAL CYSTECTOMY

    OpenAIRE

    Cevdet Kaya; Orhan Koca; Muzaffer Oğuz Keleş; Gülhan Yılmaz; Metin Öztürk; Hüseyin Kanberoğlu; M. İhsan Karaman

    2009-01-01

    Objective: Bladder cancer is the second most common cancer of the urinary tract. Radical cystectomy and urinary diversion is the gold standard treatment model of invasive bladder cancer.Patient and Methods: We evaluated 71 patients who underwent radical cystectomy, retrospectively according to their demographic properties, pre-operative and post-operative pathologies and method of urinary diversion and the complications between January 2003 and 2008.Results: Mean follow-up was 28.8 months aft...

  5. Project Radicalization: Why do "they" hate "us"?

    OpenAIRE

    Eggert, Lasse; Foged, Mathias; Jensen, Martin

    2014-01-01

    The phenomenon of global terrorism is still not fully understood by the international community whether within the contingents of public decision-makers, security agencies and researchers. Radicalization as explanation and analytical tool for understanding terrorism has relatively recently gained new prominence. In this project the question of which discourses can be found in the scientific material within the research field of terrorism and radicalization is addressed. A sample of scientifi...

  6. An experimental and theoretical study of the electronic spectrum of the HBCl free radical

    Science.gov (United States)

    Gharaibeh, Mohammed A.; Nagarajan, Ramya; Clouthier, Dennis J.; Tarroni, Riccardo

    2015-01-01

    Following our previous discovery of the spectra of the HBX (X = F, Cl, and Br) free radicals [S.-G. He, F. X. Sunahori, and D. J. Clouthier, J. Am. Chem. Soc. 127, 10814 (2005)], the A ˜ 2 A ″ Π - X ˜ 2 A ' band systems of the HBCl and DBCl free radicals have been studied in detail. The radicals have been prepared in a pulsed electric discharge jet using a precursor mixture of BCl3 and H2 or D2 in high pressure argon. Laser-induced fluorescence (LIF) and single vibronic level emission spectra have been recorded to map out the ground and excited state vibrational energy levels. The band system involves a linear-bent transition between the two Renner-Teller components of what would be a 2Π electronic state at linearity. We have used high level ab initio theory to calculate the ground and excited state potential energy surfaces and have determined the vibronic energy levels variationally. The theory results were used to assign the LIF spectra which involve transitions from the ground state zero-point level to high vibrational levels of the excited state. The correspondence between theory and experiment, including the transition frequencies, upper state band symmetries, and H, B, and Cl isotope shifts, was used to validate the assignments.

  7. An experimental and theoretical study of the electronic spectrum of the HBCl free radical

    Energy Technology Data Exchange (ETDEWEB)

    Gharaibeh, Mohammed A. [Department of Chemistry, The University of Jordan, Amman 11942 (Jordan); Nagarajan, Ramya; Clouthier, Dennis J., E-mail: dclaser@uky.edu [Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Tarroni, Riccardo [Dipartimento di Chimica Industriale “Toso Montanari,” Università di Bologna, Viale Risorgimento 4, 40136 Bologna (Italy)

    2015-01-07

    Following our previous discovery of the spectra of the HBX (X = F, Cl, and Br) free radicals [S.-G. He, F. X. Sunahori, and D. J. Clouthier, J. Am. Chem. Soc. 127, 10814 (2005)], the A{sup ~2}A{sup ″}Π−X{sup ~2}A{sup ′} band systems of the HBCl and DBCl free radicals have been studied in detail. The radicals have been prepared in a pulsed electric discharge jet using a precursor mixture of BCl{sub 3} and H{sub 2} or D{sub 2} in high pressure argon. Laser-induced fluorescence (LIF) and single vibronic level emission spectra have been recorded to map out the ground and excited state vibrational energy levels. The band system involves a linear-bent transition between the two Renner-Teller components of what would be a {sup 2}Π electronic state at linearity. We have used high level ab initio theory to calculate the ground and excited state potential energy surfaces and have determined the vibronic energy levels variationally. The theory results were used to assign the LIF spectra which involve transitions from the ground state zero-point level to high vibrational levels of the excited state. The correspondence between theory and experiment, including the transition frequencies, upper state band symmetries, and H, B, and Cl isotope shifts, was used to validate the assignments.

  8. Polymorphism and Metallic Behavior in BEDT-TTF Radical Salts with Polycyano Anions

    Directory of Open Access Journals (Sweden)

    Carlos J. Gómez-García

    2012-04-01

    Full Text Available Up to five different crystalline radical salts have been prepared with the organic donor BEDT-TTF and three different polynitrile anions. With the polynitrile dianion tcpd2− (=C[C(CN2]32−, two closely related radical salts: α'-(ET4tcpd·THF (1 (THF = tetrahydrofurane and α'-(ET4tcpd·H2O (2 have been prepared, depending on the solvent used in the synthesis. With the mono-anion tcnoetOH− (=[(NC2CC(OCH2CH2OHC(CN2]− two polymorphs with similar physical properties but different crystal packings have been synthesized: θ-(ET2(tcnoetOH (3 and β''-(ET2(tcnoetOH (4. Finally, with the mono-anion tcnoprOH− (=[(NC2CC(OCH2CH2CH2OHC(CN2]− we have prepared a metallic radical salt: β''-(ET2(tcnoprOH(CH2Cl2CH3Cl0.5 (5. Salts 1‑4 are semiconductors with high room temperature conductivities and activation energies in the range 0.1–0.5 eV, whereas salt 5 is metallic down to 0.4 K although it does not show any superconducting transition above this temperature.

  9. An experimental and theoretical study of the electronic spectrum of the HBCl free radical

    International Nuclear Information System (INIS)

    Following our previous discovery of the spectra of the HBX (X = F, Cl, and Br) free radicals [S.-G. He, F. X. Sunahori, and D. J. Clouthier, J. Am. Chem. Soc. 127, 10814 (2005)], the A~2A″Π−X~2A′ band systems of the HBCl and DBCl free radicals have been studied in detail. The radicals have been prepared in a pulsed electric discharge jet using a precursor mixture of BCl3 and H2 or D2 in high pressure argon. Laser-induced fluorescence (LIF) and single vibronic level emission spectra have been recorded to map out the ground and excited state vibrational energy levels. The band system involves a linear-bent transition between the two Renner-Teller components of what would be a 2Π electronic state at linearity. We have used high level ab initio theory to calculate the ground and excited state potential energy surfaces and have determined the vibronic energy levels variationally. The theory results were used to assign the LIF spectra which involve transitions from the ground state zero-point level to high vibrational levels of the excited state. The correspondence between theory and experiment, including the transition frequencies, upper state band symmetries, and H, B, and Cl isotope shifts, was used to validate the assignments

  10. Control of radical chemistry in the AdoMet-radical enzymes

    OpenAIRE

    Duschene, Kaitlin S.; Veneziano, Susan E.; Silver, Sunshine C.; Broderick, Joan B.

    2009-01-01

    The radical AdoMet superfamily comprises a diverse set of >2800 enzymes that utilize iron-sulfur clusters and S-adenosylmethionine (SAM or AdoMet) to initiate a diverse set of radical-mediated reactions. The intricate control these enzymes exercise over the radical transformations they catalyze is an amazing feat of elegance and sophistication in biochemistry. This review focuses on the accumulating evidence for how these enzymes control this remarkable chemistry, including controlling the re...

  11. Reactions of alkoxy radicals in aqueous solutions

    International Nuclear Information System (INIS)

    The kinetic and mechanistic properties of alkoxy radicals in organic solvents are briefly reviewed. Owing to the scarcity of such data in aqueous solutions and since reactions at the membrane/water interface may be also biologically important, we have studied the reactivity of these radicals in water and the results of our investigations are reported. Alkoxy radicals were generated by photolytic or radiolytic cleavage of peroxide precursors (tert-butyl hydroperoxide and di-tert-butyl peroxide as well as hydroperoxides of polyunsaturated fatty acids). A quantitative correlation between the structure of various substances, in particular, phenolic antioxidants, and their activity in inhibiting the alkoxy radical-induced bleaching of the water-soluble carotenoid crocin will be discussed. Rate constants for intermolecular reactions of t-BuO. radicals were determined by pulse radiolysis. The diffusion-controlled reaction with the catechol antioxidant nordihydroguaiaretic acid demonstrates an effective competition with the very rapid intra molecular β-fragmentation in water. The results aupport the view that a considerable amount of alkoxy radicals interact with substrates before they can rearrange intramolecularly

  12. Reactions of alkoxy radicals in aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Bors, W.; Tait, D.; Michel, C.; Saran, M.; Erben-Russ, M. (Gesellschaft fuer Strahlen- und Umweltforschung m.b.H. Muenchen, Neuherberg (Germany, F.R.). Abt. fuer Strahlenbiologie)

    1984-01-01

    The kinetic and mechanistic properties of alkoxy radicals in organic solvents are briefly reviewed. Owing to the scarcity of such data in aqueous solutions and since reactions at the membrane/water interface may be also biologically important, we have studied the reactivity of these radicals in water and the results of our investigations are reported. Alkoxy radicals were generated by photolytic or radiolytic cleavage of peroxide precursors (tert-butyl hydroperoxide and di-tert-butyl peroxide as well as hydroperoxides of polyunsaturated fatty acids). A quantitative correlation between the structure of various substances, in particular, phenolic antioxidants, and their activity in inhibiting the alkoxy radical-induced bleaching of the water-soluble carotenoid crocin will be discussed. Rate constants for intermolecular reactions of t-BuO. radicals were determined by pulse radiolysis. The diffusion-controlled reaction with the catechol antioxidant nordihydroguaiaretic acid demonstrates an effective competition with the very rapid intra molecular ..beta..-fragmentation in water. The results aupport the view that a considerable amount of alkoxy radicals interact with substrates before they can rearrange intramolecularly.

  13. Inactivation of Bacillus atrophaeus by OH radicals

    Science.gov (United States)

    Ono, Ryo; Yonetamari, Kenta; Tokumitsu, Yusuke; Yonemori, Seiya; Yasuda, Hachiro; Mizuno, Akira

    2016-08-01

    The inactivation of Bacillus atrophaeus by OH radicals is measured. This study aims to evaluate the bactericidal effects of OH radicals produced by atmospheric-pressure nonthermal plasma widely used for plasma medicine; however, in this study, OH radicals are produced by vacuum ultraviolet (VUV) photolysis of water vapor instead of plasma to allow the production of OH radicals with almost no other reactive species. A 172 nm VUV light from a Xe2 excimer lamp irradiates a He–H2O mixture flowing in a quartz tube to photodissociate H2O to produce OH, H, O, HO2, H2O2, and O3. The produced reactive oxygen species (ROS) flow out of the quartz tube nozzle to the bacteria on an agar plate and cause inactivation. The inactivation by OH radicals among the six ROS is observed by properly setting the experimental conditions with the help of simulations calculating the ROS densities. A 30 s treatment with approximately 0.1 ppm OH radicals causes visible inactivation.

  14. Radioprotective thermally generated free-radical dextrins

    Institute of Scientific and Technical Information of China (English)

    Piotr TOMASIK; Oskar MICHALSKI; Ewa BIDZINSKA; Antonina CEBULSKA-WASILEWSKA; Krystyna DYREK; Maciej FIEDOROWICZ; Pawel OLKO

    2008-01-01

    Effect of doses of the X-ray radiation from 0 to 400 Gy upon granular cornstarch and dextrins (British gums, BG) thermally generated from it at 230-300℃ was recognized with quantitative EPR and IR ab-sorption spectroscopy, molecular mass distribution in the depolymerization products, Scanning Elec-tron Microscopy, and X-ray diffractometry. Fractal analysis of the profiles of molecular mass distribu-tion showed that the depolymerization involved debranching of amylopectin. Roasting of cornstarch produced BG which differed in concentration and EPR parameters of stable free radicals from BG generated by X-ray radiation. Two types of stable free radicals, with Gaussian and Lorentzian shapes of EPR signals, were recognized. The shapes of the signals and temperature dependence on free radical intensity indicated exchanging interactions of the antiferromagnetic type, causing partial quenching of the spins at -196℃ (77K). Upon X-ray irradiation, new radicals were generated, the number and stability of which strongly depended on the types of radicals present before irradiation. These radicals slowly ceased because of a repolymerization of BG on storage.

  15. 75 FR 59071 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2B16 (CL-604 Variants (Including CL-605...

    Science.gov (United States)

    2010-09-27

    ... in the Federal Register on June 2, 2010 (75 FR 30740). That NPRM proposed to correct an unsafe...'' under the DOT Regulatory Policies and Procedures (44 FR 11034, February 26, 1979); and 3. Will not have.... Model CL-600-2B16 (CL- 604 Variants (Including CL-605 Marketing Variant)) Airplanes AGENCY:...

  16. Structure and function of collectin liver 1 (CL-L1) and collectin 11 (CL-11, CL-K1)

    DEFF Research Database (Denmark)

    Selman, Lana; Hansen, Soren

    2012-01-01

    The collectins are a group of innate immune proteins structurally characterized by their content of a carbohydrate recognition domain and a collagen-like region. Collectin liver 1 (CL-L1) and collectin 11 (CL-11, alias collectin kidney 1, CL-K1) are the more recently described members of this group...

  17. Radicalization and Radical Catalysis of Biomass Sugars: Insights from First-principles Studies

    Science.gov (United States)

    Yang, Gang; Zhu, Chang; Zou, Xianli; Zhou, Lijun

    2016-01-01

    Ab initio and density functional calculations are conducted to investigate the radicalization processes and radical catalysis of biomass sugars. Structural alterations due to radicalization generally focus on the radicalized sites, and radicalization affects H-bonds in D-fructofuranose more than in D-glucopyranose, potentially with outcome of new H-bonds. Performances of different functionals and basis sets are evaluated for all radicalization processes, and enthalpy changes and Gibbs free energies for these processes are presented with high accuracy, which can be referenced for subsequent experimental and theoretical studies. It shows that radicalization can be utilized for direct transformation of biomass sugars, and for each sugar, C rather than O sites are always preferred for radicalization, thus suggesting the possibility to activate C-H bonds of biomass sugars. Radical catalysis is further combined with Brønsted acids, and it clearly states that functionalization fundamentally regulates the catalytic effects of biomass sugars. In presence of explicit water molecules, functionalization significantly affects the activation barriers and reaction energies of protonation rather than dehydration steps. Tertiary butyl and phenyl groups with large steric hindrances or hydroxyl and amino groups resulting in high stabilities for protonation products drive the protonation steps to occur facilely at ambient conditions. PMID:27405843

  18. Radicalization and Radical Catalysis of Biomass Sugars: Insights from First-principles Studies

    Science.gov (United States)

    Yang, Gang; Zhu, Chang; Zou, Xianli; Zhou, Lijun

    2016-07-01

    Ab initio and density functional calculations are conducted to investigate the radicalization processes and radical catalysis of biomass sugars. Structural alterations due to radicalization generally focus on the radicalized sites, and radicalization affects H-bonds in D-fructofuranose more than in D-glucopyranose, potentially with outcome of new H-bonds. Performances of different functionals and basis sets are evaluated for all radicalization processes, and enthalpy changes and Gibbs free energies for these processes are presented with high accuracy, which can be referenced for subsequent experimental and theoretical studies. It shows that radicalization can be utilized for direct transformation of biomass sugars, and for each sugar, C rather than O sites are always preferred for radicalization, thus suggesting the possibility to activate C-H bonds of biomass sugars. Radical catalysis is further combined with Brønsted acids, and it clearly states that functionalization fundamentally regulates the catalytic effects of biomass sugars. In presence of explicit water molecules, functionalization significantly affects the activation barriers and reaction energies of protonation rather than dehydration steps. Tertiary butyl and phenyl groups with large steric hindrances or hydroxyl and amino groups resulting in high stabilities for protonation products drive the protonation steps to occur facilely at ambient conditions.

  19. Control of radical chemistry in the AdoMet-radical enzymes

    Science.gov (United States)

    Duschene, Kaitlin S.; Veneziano, Susan E.; Silver, Sunshine C.; Broderick, Joan B.

    2009-01-01

    Summary The radical AdoMet superfamily comprises a diverse set of >2800 enzymes that utilize iron-sulfur clusters and S-adenosylmethionine (SAM or AdoMet) to initiate a diverse set of radical-mediated reactions. The intricate control these enzymes exercise over the radical transformations they catalyze is an amazing feat of elegance and sophistication in biochemistry. This review focuses on the accumulating evidence for how these enzymes control this remarkable chemistry, including controlling the reactivity between the iron-sulfur cluster and AdoMet, and controlling the subsequent radical transformations. PMID:19269883

  20. Control of radical chemistry in the AdoMet radical enzymes.

    Science.gov (United States)

    Duschene, Kaitlin S; Veneziano, Susan E; Silver, Sunshine C; Broderick, Joan B

    2009-02-01

    The radical AdoMet superfamily comprises a diverse set of >2800 enzymes that utilize iron-sulfur clusters and S-adenosylmethionine (SAM or AdoMet) to initiate a diverse set of radical-mediated reactions. The intricate control these enzymes exercise over the radical transformations they catalyze is an amazing feat of elegance and sophistication in biochemistry. This review focuses on the accumulating evidence for how these enzymes control this remarkable chemistry, including controlling the reactivity between the iron-sulfur cluster and AdoMet, and controlling the subsequent radical transformations. PMID:19269883

  1. Isotope Effects in the Reactions of Chloroform Isotopologues with Cl, OH and OD

    DEFF Research Database (Denmark)

    Nilsson, Elna Johanna Kristina; Johnson, Matthew Stanley; Nielsen, Claus J.

    2009-01-01

    The kinetic isotope effects in the reactions of CHCl3, CDCl3, and 13CHCl3 with Cl, OH, and OD radicals have been determined in relative rate experiments at 298 ( 1 K and atmospheric pressure monitored by long path FTIR spectroscopy. The spectra were analyzed using a nonlinear least-squares spectral.......002, kCHCl3+OD/kCDCl3+OD ) 3.95 ( 0.03, and kCHCl3+OD/k13CHCl3+OD ) 1.032 ( 0.004. Larger isotope effects in the OH reactions than in the Cl reactions are opposite to the trends for CH4 and CH3Cl reported in the literature. The origin of these differences was investigated using electronic structure...

  2. Spatial profile monitoring of etch products of silicon in HBr/Cl2/O2/Ar plasma

    International Nuclear Information System (INIS)

    The authors have developed a radical-distribution monitoring system for obtaining the spatial profiles of etching products. This system combines Abel inversion and actinometry to estimate the local densities of radicals. The profiles of Si, SiCl, and SiCl2 in HBr/Cl2/O2/Ar plasma are captured with this monitoring system. From the gradient analysis of silicon-containing etch products, they found that the source of SiCl2 is the wafer surface and Si and SiCl are produced in the plasma. In other words, SiCl2 is produced by the etching reactions on the wafer and diffuses into the plasma to be the source of Si or SiCl through dissociation. In the etcher used for this experiment, etching gases are supplied from a top plate inducing downward flows. At a pressure as low as 0.4 Pa, the effect of convection on etch products is also observed. Increasing total gas flow rate intensifies convection and changes the spatial profile of SiCl2. However, on the wafer surface, the convective effect saturated at a total flow rate of 200 SCCM (SCCM denotes cubic centimeter per minute at STP). The ratio of the emission intensities of SiCl2 and supplied etching gases was found to be a convenient index for visualizing the effect of gas flow. The shapes of the gas jet from both 170- and 50-mm-diameter gas inlets were drawn in contour plots. The jet from the narrow inlet swept away the etch products in the center of the wafer

  3. ESR study on carboxymethyl chitosan radicals in an aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Saiki, Seiichi, E-mail: saiki.seiichi@jaea.go.j [Graduate School of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo, Tokyo 113-8656 (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Nagasawa, Naotsugu; Hiroki, Akihiro; Morishita, Norio; Tamada, Masao [Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Muroya, Yusa; Kudo, Hisaaki [Graduate School of Engineering, University of Tokyo, 7-3-1 Hongo, Bunkyo, Tokyo 113-8656 (Japan); Katsumura, Yosuke [Graduate School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo, Tokyo 113-8656 (Japan); Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakata-Shirane, Tokai, Naka, Ibaraki 319-1195 (Japan)

    2010-03-15

    Carboxymethyl chitosan (CMCTS) at a highly concentrated aqueous solution forms hydrogel by ionizing irradiation. To study on radiation-induced reaction mechanism of CMCTS in an aqueous solution, CMCTS radicals formed by reactions with OH radical were observed by ESR method. As a result of ESR spectral analysis, CMCTS radicals were identified as radicals on carboxymethyl groups.

  4. Mechanism of the Initial Thermal Decomposition of CL-20 via Molecular Dynamics Simulation%CL-20初始热分解反应机理的分子动力学计算

    Institute of Scientific and Technical Information of China (English)

    张力; 陈朗; 王晨; 伍俊英

    2012-01-01

    基于Reaxff反应力场,采用NPT、NVT系综和Berendsen方法,通过分子动力学计算研究了不同密度和温度下CL-20单分子和超晶胞的初始热解路径.结果表明,CL-20分子中的两种N-NO2键能生成NO2·自由基.单分子CL-20初始热分解中,两种不同类型的N-NO2化学键均能发生断裂生成NO2·自由基和R-(NO2)n(n≤5)碎片,NO2·自由基形成N2O4,N2O4分解为NO、NO3等碎片或重新生成两个NO2·自由基,NO2·自由基与其他中间体发生反应生成N2、HNO3等碎片.CL-20超晶胞的热解初始反应路径与单分子的初始热解反应路径相同,但由于非键相互作用,使得生成NO2·自由基的总量减少.超晶胞CL-20发生热解反应生成的HNO3碎片会继续分解成H2O和N2O5等碎片.%The initial thermal decomposition pathways of supercell structure and signal molecule of CL-20 explosive at various densities and temperatures were studied by molecular dynamics simulations, using Reaxff force field and NPT, NVT ensemble and Berendsen methods. The results show that two types of N—NO2 bond in CL-20 molecule can both form NO2 · radical. The initial pathway of CL-20 molecule is only the N—NO2 dissociation to form NO2 radical fragments and R - (NO2)n (n≤5), then two NO2 · radical fragments quickly form N2O4 , N2O4 could be broken to form NO and NO3 or return to two NO2 · radical fragments, the NO2 · radical and other intermediate fragments form the products as N2 and HNO3. The initial thermal decomposition pathway of supercell is the same with the initial thermal decomposition pathway of signal molecule, but because of the no bond interacting in the CL-20 solid, the number of NO2 · radical is less than the number of NO2 · radical from CL-20 molecule. HNO3 molecules, the thermal fragments of CL-20 supercell, can be decomposed to H2O and N2O5.

  5. Thermodynamic modeling and experimental investigations of the CsCl-CaCl2-PuCl3 system

    International Nuclear Information System (INIS)

    The CsCl-CaCl2-PCl3 ternary diagram was calculated from the known binary diagrams. The various principle features, ternary eutectics and peritectics, were verified experimentally by differential thermal analysis. Also, the phase boundaries lying in the polythermal section between a PuCL3 mole fraction of 0.4 on the CsCl-PuCl3 binary and CaCl2 were determined experimentally in some detail. Because the measurements agree well with the prediction, it is assumed that the calculation together with the experimental verification of some of the points has established the entire ternary phase diagram. In addition, d-spacing data from the X-ray diffraction pattern of the compound CsPu2Cl7 are reported. (orig.)

  6. OH Radical and a Drizzling Water Jet Production from the Ball-Lightning Discharge in Water

    Science.gov (United States)

    Maeyama, Mitsuaki; Tanaka, Yasutomo

    The ball lightning, or fireball discharge using the typical electrode configuration was reported to produce a long-living spherical plasmoid with radius exceed 10 cm at atmospheric pressure. In this study, we investigated the relationship between a optical output emitted from OH radicals and discharge conditions of the ball-lightning electrode configuration, and discussed its possibility to the water treatment process. As a results, in both polarity cases of the charged voltage V0, a ball-lightning discharge and the optical emission from OH radicals as a major radiation can be generated on the condition |V0| > 4 kV in tap water. Furthermore, an intensive upward water jet from the rod electrode is observed in case of positive polarity and in 0.2% NaCl solution, which is composed of drizzling water drops near the rod electrode.

  7. The role of organic solvent radical cations in separations ligand degradation

    International Nuclear Information System (INIS)

    The dodecane radical cation reaction rate constant with CMPO was measured using ps electron pulse radiolysis/ absorption spectroscopy as k = (1.30 ± 0.11) x 1010 M-1s-1 in dodecane/0.10 M CH2Cl2 solution. No reactivity increase occurred when these solutions were pre-contacted with nitric acid, similar to the behavior observed for TODGA. To corroborate these kinetic data with steady-state radiolysis measurements, where acid pre-contacted CMPO showed significantly less degradation, it is proposed that the dodecane radical cation always reacts directly with TODGA, but for CMPO the charge-transfer occurs with the CMPO·HNO3 complex formed in the acid contacted solvent. (author)

  8. Heterogeneous Computing with OpenCL

    CERN Document Server

    Gaster, Benedict; Kaeli, David R; Mistry, Perhaad; Schaa, Dana

    2011-01-01

    Heterogeneous Computing with OpenCL teaches OpenCL and parallel programming for complex systems that may include a variety of device architectures: multi-core CPUs, GPUs, and fully-integrated Accelerated Processing Units (APUs) such as AMD Fusion technology. Designed to work on multiple platforms and with wide industry support, OpenCL will help you more effectively program for a heterogeneous future. Written by leaders in the parallel computing and OpenCL communities, this book will give you hands-on OpenCL experience to address a range of fundamental parallel algorithms. The authors explore m

  9. Reactions Between Humic Acid Solutions and Excessive ClO2 or Cl2

    Institute of Scientific and Technical Information of China (English)

    GE Yuan-xin; ZHU Zhi-liang; MA Hong-mei; ZHAO Jian-fu

    2007-01-01

    Reactions between humic acid solutions and excessive ClO2 or Cl2 have been investigated. Under various experimental conditions, the removal efficiency of TOC, UV254 and A140 from humic acid solutions were examined. The relationship between the removal efficiency and the consumption of ClO2 or Cl2 was discussed. The results showed that the maximum demand of ClO2 was 2.19 mg/mg TOC for the humic acid solution under the experimental conditions, and that of Cl2 was 1.88 mg/mg TOC. The variation tendency of ClO2 consumption was similar to that of Cl2. TOC of humic acid solutions decreased 15.2% and 15.6% after the reaction with ClO2 or Cl2 respectively. Under the experimental conditions, 21.4% of unsaturated bonds and 52.8% of humic acid color were removed by ClO2 in 168 h. As for Cl2, removal efficiency of unsaturated bonds and humic acid color were 16.8% and 41.7% respectively. Larger molecules from humic acid were oxidized to smaller molecules by ClO2 and Cl2. Higher oxidation potential of ClO2 than that of Cl2 was also indicated by variation of UV254/A410 ratios. The similar tendency, that exhibited faster variation in the initial 24 h, existed for all the research factors.

  10. Modeling Radicalization Phenomena in Heterogeneous Populations.

    Science.gov (United States)

    Galam, Serge; Javarone, Marco Alberto

    2016-01-01

    The phenomenon of radicalization is investigated within a mixed population composed of core and sensitive subpopulations. The latest includes first to third generation immigrants. Respective ways of life may be partially incompatible. In case of a conflict core agents behave as inflexible about the issue. In contrast, sensitive agents can decide either to live peacefully adjusting their way of life to the core one, or to oppose it with eventually joining violent activities. The interplay dynamics between peaceful and opponent sensitive agents is driven by pairwise interactions. These interactions occur both within the sensitive population and by mixing with core agents. The update process is monitored using a Lotka-Volterra-like Ordinary Differential Equation. Given an initial tiny minority of opponents that coexist with both inflexible and peaceful agents, we investigate implications on the emergence of radicalization. Opponents try to turn peaceful agents to opponents driving radicalization. However, inflexible core agents may step in to bring back opponents to a peaceful choice thus weakening the phenomenon. The required minimum individual core involvement to actually curb radicalization is calculated. It is found to be a function of both the majority or minority status of the sensitive subpopulation with respect to the core subpopulation and the degree of activeness of opponents. The results highlight the instrumental role core agents can have to hinder radicalization within the sensitive subpopulation. Some hints are outlined to favor novel public policies towards social integration. PMID:27166677

  11. Modeling Radicalization Phenomena in Heterogeneous Populations.

    Directory of Open Access Journals (Sweden)

    Serge Galam

    Full Text Available The phenomenon of radicalization is investigated within a mixed population composed of core and sensitive subpopulations. The latest includes first to third generation immigrants. Respective ways of life may be partially incompatible. In case of a conflict core agents behave as inflexible about the issue. In contrast, sensitive agents can decide either to live peacefully adjusting their way of life to the core one, or to oppose it with eventually joining violent activities. The interplay dynamics between peaceful and opponent sensitive agents is driven by pairwise interactions. These interactions occur both within the sensitive population and by mixing with core agents. The update process is monitored using a Lotka-Volterra-like Ordinary Differential Equation. Given an initial tiny minority of opponents that coexist with both inflexible and peaceful agents, we investigate implications on the emergence of radicalization. Opponents try to turn peaceful agents to opponents driving radicalization. However, inflexible core agents may step in to bring back opponents to a peaceful choice thus weakening the phenomenon. The required minimum individual core involvement to actually curb radicalization is calculated. It is found to be a function of both the majority or minority status of the sensitive subpopulation with respect to the core subpopulation and the degree of activeness of opponents. The results highlight the instrumental role core agents can have to hinder radicalization within the sensitive subpopulation. Some hints are outlined to favor novel public policies towards social integration.

  12. Modeling Radicalization Phenomena in Heterogeneous Populations

    Science.gov (United States)

    2016-01-01

    The phenomenon of radicalization is investigated within a mixed population composed of core and sensitive subpopulations. The latest includes first to third generation immigrants. Respective ways of life may be partially incompatible. In case of a conflict core agents behave as inflexible about the issue. In contrast, sensitive agents can decide either to live peacefully adjusting their way of life to the core one, or to oppose it with eventually joining violent activities. The interplay dynamics between peaceful and opponent sensitive agents is driven by pairwise interactions. These interactions occur both within the sensitive population and by mixing with core agents. The update process is monitored using a Lotka-Volterra-like Ordinary Differential Equation. Given an initial tiny minority of opponents that coexist with both inflexible and peaceful agents, we investigate implications on the emergence of radicalization. Opponents try to turn peaceful agents to opponents driving radicalization. However, inflexible core agents may step in to bring back opponents to a peaceful choice thus weakening the phenomenon. The required minimum individual core involvement to actually curb radicalization is calculated. It is found to be a function of both the majority or minority status of the sensitive subpopulation with respect to the core subpopulation and the degree of activeness of opponents. The results highlight the instrumental role core agents can have to hinder radicalization within the sensitive subpopulation. Some hints are outlined to favor novel public policies towards social integration. PMID:27166677

  13. Analysis of radicals induced in irradiated foods

    International Nuclear Information System (INIS)

    By electron spin resonance (ESR) spectroscopy, we revealed free radicals in γ-ray irradiated foods; black pepper, green coffee bean and ginseng. We also analyzed the decay behavior of radiation induced free radicals during storage of irradiated foods. The ESR spectrum of experimental irradiated foods consists of a sextet signal centered at g=2.0 and a singlet signal at the same g-value position and a singlet signal at g=4.0. The singlet signal at g=2.0 is originated from organic free radicals and its peak intensity showed the dependence of γ-ray irradiation dose levels. The signal intensity was decreased during storage. Only after 3 hours of radiation treatment the peak intensity was decreased fast and after that the intensity was decreased slowly. The relaxation times, T1 and T2, of radiation induced free radicals showed the variations before and after irradiation. During long time storage period it was shown that T1 was increased and T2 was decreased. By analysis of decay process using the simulation methods based on the theory of reaction speed, it is considered that at least two kinds of radicals were induced in irradiated foods during long time storage. (author)

  14. Tuning the Reactivity of Radical through a Triplet Diradical Cu(II) Intermediate in Radical Oxidative Cross-Coupling

    Science.gov (United States)

    Zhou, Liangliang; Yi, Hong; Zhu, Lei; Qi, Xiaotian; Jiang, Hanpeng; Liu, Chao; Feng, Yuqi; Lan, Yu; Lei, Aiwen

    2015-11-01

    Highly selective radical/radical cross-coupling is paid more attention in bond formations. However, due to their intrinsic active properties, radical species are apt to achieve homo-coupling instead of cross-coupling, which makes the selective cross-coupling as a great challenge and almost untouched. Herein a notable strategy to accomplish direct radical/radical oxidative cross-coupling has been demonstrated, that is metal tuning a transient radical to a persistent radical intermediate followed by coupling with another transient radical. Here, a transient nitrogen-centered radical is tuned to a persistent radical complex by copper catalyst, followed by coupling with a transient allylic carbon-centered radical. Firstly, nitrogen-centered radical generated from N-methoxybenzamide stabilized by copper catalyst was successfully observed by EPR. Then DFT calculations revealed that a triplet diradical Cu(II) complex formed from the chelation N-methoxybenzamide nitrogen-centered radical to Cu(II) is a persistent radical species. Moreover, conceivable nitrogen-centered radical Cu(II) complex was observed by high-resolution electrospray ionization mass spectrometry (ESI-MS). Ultimately, various allylic amides derivatives were obtained in good yields by adopting this strategy, which might inspire a novel and promising landscape in radical chemistry.

  15. Free Radical Scavenging Activity of Leaves of Alocasia indica (Linn)

    OpenAIRE

    Mulla, W. A.; Salunkhe, V. R.; Kuchekar, S. B.; Qureshi, M. N.

    2009-01-01

    The free radical scavenging potential of the plant Alocasia indica(Linn.) was studied by using different antioxidant models of screening like scavenging of 1,1-diphenyl-2-picryl hydrazyl radical, nitric oxide radical, superoxide anion radical, hydroxyl radical, iron chelating activity, total antioxidant capacity, non-enzymatic glycosylation of haemoglobin, rapid screening for antioxidant compounds by thin layer chromatography. The hydroalcoholic extract at 1000 μg/ml showed maximum scavenging...

  16. Formation of semiquinone radical anion and free radical scavenging reactions of plumbagin. A pulse radiolysis study

    International Nuclear Information System (INIS)

    Kinetics and mechanism of scavenging of reducing free radicals by plumbagin (5-hydroxy-2-methyl-1,4-naphthoquinone) are studied using pulse radiolysis technique. It scavenged superoxide radical, hydroxyethyl radical and hydrated electron with bimolecular rate constants of 8.9 × 107, 2.3 × 109 and 1.6 × 1010 M-1 s-1, respectively in aqueous-alcohol medium. Plumbagin also scavenged linoleic acid peroxyl radical and tyrosyl radical with bimolecular rate constants of 1.0 × 108 and 7.0 × 106 M-1 s-1, respectively. Further, redox properties of plumbagin and its transients are studied using standard redox couples and cyclic voltammetry. (author)

  17. Isolation of Hypervalent Group-16 Radicals and Their Application in Organic-Radical Batteries.

    Science.gov (United States)

    Imada, Yasuyuki; Nakano, Hideyuki; Furukawa, Ko; Kishi, Ryohei; Nakano, Masayoshi; Maruyama, Hitoshi; Nakamoto, Masaaki; Sekiguchi, Akira; Ogawa, Masahiro; Ohta, Toshiaki; Yamamoto, Yohsuke

    2016-01-20

    Using a newly prepared tridentate ligand, we isolated hypervalent sulfur and selenium radicals for the first time and characterized their structures. X-ray crystallography, electron spin resonance spectroscopy, and density functional theory calculations revealed a three-coordinate hypervalent structure. Utilizing the reversible redox reactions between hypervalent radicals and the corresponding anions bearing Li(+), we developed organic radical batteries with these compounds as cathode-active materials. Furthermore, an all-radical battery, with these compounds as the cathode and a silyl radical as the anode, was developed that exhibited a practical discharge potential of ∼ 1.8 V and stable cycle performance, demonstrating the potential of these materials for use in metal-free batteries that can replace conventional Li-ion batteries where Li is used in the metal form. PMID:26721786

  18. Influence of the medium on the reaction rate of the t-butoxyl radical with iron(II)

    International Nuclear Information System (INIS)

    Complete text of publication follows. Tert-butoxyl radicals (t-BuO.) were generated by homolytic photodecomposition of di-tert-butylperoxide using ruby laser flashes at 347 nm. The reaction of t-BuO. radicals with Fe2+ was studied under pseudo-first order conditions. The quantum yield Φ(Fe3+) was determined by measuring the absorbance of Fe3+ ion as [FeCl]2+ complex at 360 nm 2 μs after the flash. According to the equation derived from the reaction scheme, the rate constant k3 was obtained from the relative rate constant kr (kr=k0/k3) and the value of k0; the latter refers to the overall rate of the competing disappearance of t-BuO. radicals from the system (reaction 2), including the highest contribution of β-cleavage. The rate constant k0 was determined using diphenylmethanol instead of Fe2+. The known rate constant of the reaction of t-BuO. radical with diphenylmethanol giving ketyl radicals (6.9 x 106 dm3 mol-1 s-1) was applied. The quantum yield of ketyl radicals was determined by measuring the maximum of absorbance at 535 nm. At acid concentration of 0.023 mol dm-3 HCl the rate constant k3 = 3.4 x 108 dm3 mol-1 s-1 was determined. The relative rate constant increased with an increase of the hydrochloric acid concentration which has been ascribed to the lower stability of t-BuO. radical at higher acidity of the medium. The effect of polarity of the medium on the reaction rate was also determined. Decreasing k3 in media of increasing polarity were explained by increasing of the β-scission rate of t-BuO. radical with increasing polarity of the medium

  19. un clúster empresarial

    Directory of Open Access Journals (Sweden)

    Laura Marcela López Posada

    2006-01-01

    Full Text Available Los clústeres empresariales se han constituido en mecanismos para impulsar la competitividad de sectores en regiones y tradicionalmente han sido analizados desde la perspectiva económica (por su aporte en variables macroeconómicas, pero para su consolidación todo conglomerado empresarial requiere la comprensión de relaciones sociales, culturales y políticas. Resulta difícil estudiar estas relaciones desde teorías organizacionales tradicionales como la estructuralista o la contingencial, y se debe recurrir a otras perspectivas como el neoinstitucionalismo sociológico, enfoque que es utilizado en la presente investigación. La investigación fundamento del artículo se hizo en un sector considerado dinámico para el eje cafetero como es el de herramientas, la cual fue abordada desde un enfoque cualitativo mediante la aplicación de dos guías de entrevista semiestructurada (se aplicaron a treinta empresas de la cadena productiva y a nueve entidades de apoyo, diario de campo y análisis de fuentes documentales. Se concluye que en el clúster predominan el individualismo, la descon- fianza y la ausencia de elementos identitarios, simultáneamente con fuertes lazos comerciales y prácticas de gestión que se han institucionalizado por procesos isomórficos.

  20. Cs3ScCl6.

    Science.gov (United States)

    Ward, Matthew D; Ibers, James A

    2014-06-01

    Crystals of tricaesium scandium(III) hexa-chloride were obtained as a side product from the reaction of U, SnCl2, Sc, and S in a CsCl flux at 1073 K. Cs3ScCl6 crystallizes in the Rb3YCl6 structure type. The asymmetric unit comprises three Cs sites, two Sc sites, and six Cl sites, all of which have site symmetry 1, except for the two Sc sites that have site symmetries of 2 and -1, respectively. The structure is composed of isolated [ScCl6](3-) octa-hedra that are surrounded by Cs(+) cations. Two Cs(+) cations have inter-actions with eight Cl(-) anions, while the third has inter-actions with ten Cl(-) anions. PMID:24940185

  1. Radical kinetics and characterization of the free radicals in gamma irradiated red pepper

    International Nuclear Information System (INIS)

    Kinetic behaviors and characterization of the natural and γ-induced radicals in irradiated red pepper have been investigated by electron spin resonance (ESR) spectroscopy to explore the possibility of using this technique in detecting irradiated red pepper and to evaluate the eventual dosimetric features of this widely used food. Unirradiated samples exhibited a single resonance line centered at g=2.0050±0.0005. Photo-exposure of the samples was found to increase the signal intensity. An increase in temperature created a drastic decrease in the concentration of natural radicals responsible for the single resonance line. Irradiation was observed to induce increases in the intensity of single resonance line (signal I) and a radiation specific doublet and/or triplet (signal II) also centered at g=2.0050 but detectable only at high spectrometer gains. The intensities of both signals increased with increasing radiation dose. The signals I and II were found to decay with different rates depending on the temperature. The results of a fitting procedure applied to the experimental signal decay curves and those obtained from room temperature spectra simulation calculations were used together to determine radical species and their spectral characteristics giving rise to the observed experimental spectra. Four radical species, three carbohydrate and one semiquinone radical assigned as radicals A, B, C and D, respectively, were found to best explain the experimental results. All the radicals show large g and hyperfine splitting anisotropies varying between g=2.0028-2.0062 and 1.07-2.58 mT, respectively. The half lives of the radicals were found to depend strongly on temperature. The activation energy calculated using temperature dependent half-life data were the highest for radical A (33.68 kcal/mol) and smallest for radical C (11.83 kcal/mol)

  2. Free-radical chemistry of thiourea in aqueous solution, induced by OH radical, H atom, α-hydroxyalkyl radicals, photoexcited maleimide, and the solvated electron

    International Nuclear Information System (INIS)

    Hydroxyl radicals react with thiourea (and its tetramethyl derivative) yielding dimeric radical cations which are characterized by strong absorptions at 400 nm (450 nm). An analysis of the kinetics of the buildup of these absorptions gives evidence for the intermediacy of OH-adducts and the monomeric radical cations. The dimeric radical cations are also generated in the reactions of triplet-excited maleimide with those thioureas. Moreover, in acidic solutions even reducing radicals such as the H atom and α-hydroxy alkyl radicals give rise to these intermediates in full yields, albeit displaying different kinetics. Potential mechanistic implications are discussed. The dimeric thiourea radical cations are strong oxidants and readily oxidize the anions of phenol and 2'-deoxyguanosine. The solvated electron gives rise to an intermediate which is rapidly protonated by water (pKa > 11). Quantum mechanical calculations support the assignment of the 400 nm (450 nm) absorption to the respective dimeric thiourea radical cation. (author)

  3. Thermodynamic Optimization of DyCl3 -NaCl System

    Institute of Scientific and Technical Information of China (English)

    叶信宇; 孙益民; 张静; 谈君君

    2005-01-01

    In this paper, the phase diagram of the DyCl3 -NaCl system is optimized and calculated with CALPHAD ( calculation of phase diagram ) technology. A set of thermodynamic functions of compounds Na3 DyCl6, NaDyCl4, and NaDY2 Cl7 have been optimized and calculated based on an interactive computer-assisted analysis. The optimized thermodynamic parameters, calculated phase diagram and experimental phase diagram are thermodynamically serf-consistent.

  4. Solubility polytherms of NaCl(KCl)-GdCl3-H2O system

    International Nuclear Information System (INIS)

    The isothermal method in the temperature range from 25 up to 100 deg C has been used to study the solubility in the NaCl-GdCl3-H2O and KCl-GdCl3-H2O systems. The limits of the NaCl, KCl and GdCl3x6H2O crystallization are discriminated. Solubility polytherms of the systems are plotted

  5. Exploring how lead users develop radical innovation

    DEFF Research Database (Denmark)

    Lettl, Christopher; Gemuenden, Hans Georg; Hienerth, C.

    2008-01-01

    In this study, we explore how lead users develop radical innovations outside of manufacturing firms. We analyze the transition from a very early stage of activities to the ultimate commercialization of these innovations. The focus in this context is on the initiatives undertaken by lead users in...... lead users as surgeons launch entrepreneurial activities and bridge periods in which established medical equipment manufacturers would not risk investing in radical innovations. By doing so, lead users create the conditions usually provided in manufacturer-initiated lead user projects, including the...... supply of diversified knowledge, the development and coordination of a network for further development of the innovation, and initial tests of technical or market feasibility. Our findings have implications for manufacturing firms that wish to design radical innovation projects with (individual) lead...

  6. Radiation chemistry of aromatic dimer radical cations

    International Nuclear Information System (INIS)

    π-π Interactions of aromatic molecules are paid attention much in many fields, especially biology, chemistry, and applied physics, represented as protein, DNA, electron donor-accepter complexes, charge transfers, and self assembly molecules. Aromatic molecules including benzene rings are the simplest case to study the π-π interactions. To interpret the charge resonance (CR) structure in the dimer radical cations, spectroscopic and ESR methods have been carried out. The spectroscopic study on the dimer radical ion of molecules with two chromophores would be profitable to identify the electronic and configurational properties. In this article, dynamics of the dimer radical cation of benzenes, polystyrenes, and resist polymers is described on the basis of direct observation of CR band by the nanosecond pulse radiolysis and low temperature γ-radiolysis methods. (author)

  7. Radical abdominoplasty, including body shaping: representative cases.

    Science.gov (United States)

    Mühlbauer, W

    1989-01-01

    Even in the age of liposuction there exist certain situations for which abdominoplasty in its radical form is indicated--for example, redundant skin after radical weight loss, the stigmata of postpregnancy syndrome, and localized accumulation of adipose tissue--the lipodystrophies and resistant generalized obesity. Redundant skin after radical weight loss is resected simultaneously around the abdomen, the lumbar regions, the perineum, and the thighs. The typical stigmata of postpregnancy syndrome may be excised through an extended abdominoplasty combined with simultaneous excision and pexy of the inner aspects of the thighs leaving a "bikini" scar behind. A mastopexy may be added. Genetically predisposed localized lipodystrophies in the abdominal lumbar, and upper thigh region may be resected through a circular abdominoplasty with or without simultaneous resection of the perineum and inner thighs. Abdominal aprons often contain umbilical or ventral hernias that may need to be repaired simultaneously. Representative cases are presented and dangers and complications are discussed. PMID:2741749

  8. Reactions of Hot Cl38 Atoms in Mixtures of Carbon Tetrachloride with Aliphatic Alcohols

    International Nuclear Information System (INIS)

    Investigations of the chemical effects of nuclear reactions in binary systems are expected to yield much useful information. Study of the recoil processes of the halogen derivatives when the second component is suitably chosen and its concentration varied in a wide range might permit inferences to be made on the role and mechanism of the various stabilizing processes. Considering the results obtained with CCl4-Cl2, CCl4-SiCl4, CCl4-C6H6 and CCl4-c-hexane mixtures as well as the energy scavenger property of alcohol, it seemed of interest to study the contribution of the alcohols to the stabilization of hot Cl38. Chemical processes induced by hot Cl38 from the nuclear reaction Cl97 (n, γ)Cl38 were investigated in mixtures of CCl4-ROH (where R = CH3-, C2H5-, C3H7- and (CH3)2CH-). The irradiations were performed in the thermal column of the 2 MW VVRS reactor using rather short exposure times to keep the radiation chemical effects at negligible level. The organic fractions were separated from the inorganic ones by extraction and the former were analysed by gas chromatographic method. Total retention and the yield of the complete set of organic chlorine compounds were determined in terms of alcohol concentration. Some interesting results are that the yield of reaction products in which the OH radical of aliphatic alcohol has been replaced by Cl38 increases with increasing alcohol concentration with a simultaneous decrease in the labelled CCI4 yield and that, in addition to the monochlorine derivates with less carbon atoms than the alcohol molecule, a considerable amount of chloroform is formed with maximum yield at a given alcohol concentration. The relative contributions of the hot and the epithermal stabilization processes of energetic Cl38 and the mechanism of the various reactions are discussed. (author)

  9. Effect of translational energy on the reactions involving excited N(2D) and Cl2

    International Nuclear Information System (INIS)

    Studies are reported on the effect of translational energy on the chemical mechanisms for collisional deactivation of electronically excited recoil 13N(2D) atoms by Cl2. These studies were carried out in gas baths of 99.9, 99.0 and 90.0 mol percent of neon relative to the combined concentrations of the Cl2 quenching gas, and an additional probe reagent. N2 and NO were selected as probe reagents for their ability to remove the 13N-atoms as the 13NN product state-selectively and nonselectively, respectively. The behavior of recoil 13N(2D) atoms with Cl2 was indirectly monitored through the dependence of the 13NN yield on halogen quencher concentration. In turn, the effect of translational energy on this behavior was revealed by comparing the dependence of this yield on Cl2 between different bath gas concentrations. The observed results showed that thermalized 13N(2D) atoms behaved predictably with Cl2 in that 13NCl(X3Σ-) was formed. In the absence of secondary reactions, as was the case when Cl2 + N2 mixtures were used, the halonitrene radical dissociated to the ground-state atoms. However, its quantitative conversion to 13NNO could be seen in the presence of trace concentrations of NO. At higher translational energies, the transient halonitrene concentration was greatly reduced. This change was not attributed to its increased reactivity towards Cl2, but rather to a change in the primary reaction involving 13N(2D) and Cl2 which yielded an intermediate other than the halonitrene. (orig.)

  10. Iron(III)-Mediated Radical Nitration of Bisarylsulfonyl Hydrazones: Synthesis of Bisarylnitromethyl Sulfones.

    Science.gov (United States)

    Sar, Dinabandhu; Bag, Raghunath; Bhattacharjee, Debajyoti; Deka, Ramesh Chandra; Punniyamurthy, Tharmalingam

    2015-07-01

    Iron(III)-mediated radical nitration of bisarylsulfonyl hydrazones is described. In this protocol, the nontoxic and inexpensive Fe(NO3)3·9H2O plays a dual role as catalyst as well as nitro source. The mild conditions, broad substrate scope, and the functional group compatibility are the significant features. The reaction pathway has been demonstrated using DFT calculations, and the products can be subsequently converted into oximes using SnCl2·2H2O in high yields. PMID:26036359

  11. Cirugía radical conservadora en la otitis media crónica

    OpenAIRE

    Victoriano Machín González; Isabel Benito Soler; Rodolfo Vieito Espiñeira; Mildre Ortiz Núñez

    1999-01-01

    Se revisaron 40 historias clínicas de pacientes a los cuales se les practicó una cirugía radical conservadora de la mastoides, por presentar otitis media crónica osteítica. Los pacientes recibieron atención en el servicio de Otorrinolaringología del Hospital Clinicoquirúrgico Docente "Joaquín Albarrán", en el período comprendido entre 1990 y 1996. Se comprobó la presencia de Pseudomonas aeruginosa en un alto porcentaje de nuestros casos, y se logró un oído seco en 36 pacientes, con la consigu...

  12. Synthesis of polystyrene with high melting temperature through BDE/CuCl catalyzed polymerization

    Institute of Scientific and Technical Information of China (English)

    WAN; Xiaolong

    2001-01-01

    Lecomte, P., Drapier, I., Dubios, P. et al., Controlled radical polymerization of methyl methacrylate in the presence of palladium acetate, triphenyl phosphine, and carbon tetrachloride, Macromolecules, 1997, 30: 7631.[12]Kotani, Y., Kamigaito, Y., Sawamoto, M., Re(V)-mediated living radical polymerization of styrene: ReO2I(PPh3)2/RI initiating system, Macromolecules, 1999, 32: 2420.[13]Makino, T., Tokunaga, E., Hogen-Esch, T. E., Controlled atom transfer radical polymerizations of methyl methacrylate under micellar conditions, Polym. Prep., 1998, 39(1): 288.[14]Gaynor, S. G., Qiu, J., Matyjaszewski, K., Controlled/"living" radical polymerization applied to water-borne system, Macromolecule, 1998, 31: 5951.[15]Qiu, J., Gaynor, S. G., Matyjaszewski, K., Controlled/"living" radical polymerization of n-butyl methacrylate by reverse atom transfer radical polymerization, Macromolecules, 1999, 32: 2872.[16]Shipp, D. A., McMurtry, G. P., Gaynor, S. G. et al., Water-borne block copolymer synthesis and a simple and effective one-pot synthesis of acrylate-methacrylate block copolymers by atom transfer radical polymerization, Polym. Prep., 1999, 40(2): 448.[17]Nishikawa, T., Kamigaito, M., Sawamoto, M., Living radical polymerization in water and alcohols: suspension polymerization of methyl methacrylate with RuCl2(PPh3)3 complex, Macromolecules, 1999, 32: 2204.[18]Wan, X. L., Ying, S. K., "Living" radical emulsion polymerization of styrene under Cu0/Bpy/CCl4 and CuCl2/Bpy/AIBN system, Chinese J. Polym. Sci., 2000, (1): 27.[19]Wan, X. L., Ying, S. K., Controlled radical polymerization catalyzed by Cu/BDE complex in water medium, 1. Polymerization of styrene and synthesis of poly(St-b-MMA), J. Appl. Polym. Sci., 2000, 75(1): 802.[20]Wan, X. L., Ying, S. K., Synthesis of block copolymers by emulsion "living"/controlled radical polymerization of vinyl monomers in sequence, Polym. Prep., 1999, 40: 1055.[21]Keller, R. N., Wycoff, H. D., The synthesis

  13. Preparation and study of dialkyl nitroxide radicals

    International Nuclear Information System (INIS)

    These radicals are obtained by oxidation of N-hydroxy-imides with lead tetracetate or p-nitro-perbenzoic acid. These imides are prepared by heating dicarboxylic acids anhydrides with benzyloxy-amine followed by catalytic hydrogenation of N-benzyloxy-imides so obtained. Two series of radicals have mainly been studied, the first concerning five-membered cyclic imides, the second six-membered cyclic imides, these molecules having methyls substituents or no on the carbon ring. N. M. R. spectra of some O-benzyl-imides have been analysed. These different results have made it possible to study the conformation and stereochemistry of these imides. (author)

  14. Free Radicals in Adolescent Varicocele Testis

    OpenAIRE

    Carmelo Romeo; Giuseppe Santoro

    2014-01-01

    We examine the relationship between the structure and function of the testis and the oxidative and nitrosative stress, determined by an excessive production of free radicals and/or decreased availability of antioxidant defenses, which occur in the testis of adolescents affected by varicocele. Moreover, the effects of surgical treatment on oxidative stress were provided. We conducted a PubMed and Medline search between 1980 and 2014 using “adolescent,” “varicocele,” “free radicals,” “oxidative...

  15. Free-radical kinetics of coal liquefaction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, M.; Smith, J.M.; McCoy, B.J.

    1994-07-16

    A rate expression with first- and second-order terms in the concentration of extractable compounds in solid coal particles is derived from a fundamental free-radical mechanism. The expression was suggested empirically by prior experiments for coal liquefaction in the presence of a hydrogen-donor solvent. Radical reactions are considered to occur in both coal and in solvent. The long-chain approximation justifies the neglect of initiation, hydrogen abstraction, and termination rates as quantitatively insignificant relative to propagation reaction rates.

  16. Resonance ionization detection of combustion radicals

    Energy Technology Data Exchange (ETDEWEB)

    Cool, T.A. [Cornell Univ., Ithaca, NY (United States)

    1993-12-01

    Fundamental research on the combustion of halogenated organic compounds with emphasis on reaction pathways leading to the formation of chlorinated aromatic compounds and the development of continuous emission monitoring methods will assist in DOE efforts in the management and disposal of hazardous chemical wastes. Selective laser ionization techniques are used in this laboratory for the measurement of concentration profiles of radical intermediates in the combustion of chlorinated hydrocarbon flames. A new ultrasensitive detection technique, made possible with the advent of tunable VUV laser sources, enables the selective near-threshold photoionization of all radical intermediates in premixed hydrocarbon and chlorinated hydrocarbon flames.

  17. Theoretical study of the reactivity trends in the Cl-abstraction reactions of CHCl3 + CHX·−/CX$_{2}^{·−}$ (X = Cl, Br and I)

    Indian Academy of Sciences (India)

    Jun Xi Liang; Zhi Yuan Geng; Yong Cheng Wang

    2011-09-01

    To better understand how and to what extent the halosubstituted carbene radical anions effect the chlorine abstraction of CHCl3, a detailed theoretical investigation has been performed at the UMP2/6-311++G (d, p)/RECP level of theory. The model system CHCl3+CHX·−/CX$^{·−}_{2}$ (X = Cl, Br, and I) has been chosen for the present study. According to the detailed discussions of geometries and energetics of the optimized stationary points, our theoretical findings suggest that the Cl-abstraction reactions by CHX·− are energetically favourable, indicating the less massive substitution X in CHX·− the easier abstraction reaction, as compared to those by CX$^{·−}_{2}$, which are energetically unfavourable and would be endothermic.

  18. Theoretical study on the gas phase reaction of allyl chloride with hydroxyl radical.

    Science.gov (United States)

    Zhang, Yunju; Chao, Kai; Sun, Jingyu; Zhang, Wanqiao; Shi, Haijie; Yao, Cen; Su, Zhongmin; Pan, Xiumei; Zhang, Jingping; Wang, Rongshun

    2014-02-28

    The reaction of allyl chloride with the hydroxyl radical has been investigated on a sound theoretical basis. This is the first time to gain a conclusive insight into the reaction mechanism and kinetics for important pathways in detail. The reaction mechanism confirms that OH addition to the C=C double bond forms the chemically activated adducts, IM1 (CH2CHOHCH2Cl) and IM2 (CH2OHCHCH2Cl) via low barriers, and direct H-abstraction paths may also occur. Variational transition state model and multichannel RRKM theory are employed to calculate the temperature-, pressure-dependent rate constants. The calculated rate constants are in good agreement with the experimental data. At 100 Torr with He as bath gas, IM6 formed by collisional stabilization is the major products in the temperature range 200-600 K; the production of CH2CHCHCl via hydrogen abstractions becomes dominant at high temperatures (600-3000 K). PMID:24588171

  19. Recycling Of Bomb Produced Cl 36

    Science.gov (United States)

    Lazarev, V.; Blinov, A.; Huber, Th.; Kubo, F.; Nolte, E.

    The success of accelerated mass-spectrometry (AMS) has allowed the measuring of very small quantities of radioactive nuclides with the ratio to their stable isotope up to 10-14. With the help of this method the concentration of 36Cl in natural samples can be investigated. The main sources of 36Cl in the atmosphere are a) The natural production in nuclear reactions induced by the interaction of high energy cosmic rays with atmospheric Ar. b) The production by the interaction of high neutron fluxes emitted by the nuclear weapon tests with stable chlorine. c) The production in different reactors with the following release (e.g. Chernobyl accident). The analysis of 36Cl time profile in Greenland showed the fast removal of chlorine from the atmosphere so that nowadays only the natural production of 36Cl is of importance. However the measurement of 36Cl in modern precipitation revealed the significant excess of its concentration over the simulated predictions. The recycling of chlorine as an explanation of the observed discrepancy is ar- gued. The biosphere could take up a part of the fallen down bomb produced 36Cl and releases it into the troposphere in the form of CH3Cl. To check the hypothesis the experiment to collect methyl chloride from the air and to measure 36Cl was set up. The high observed ratio 36 Cl/Cl proves that the chlorine recycling really takes place. Additionally, in order to get more information about the distribution of 36Cl the measurements of its concentration in lakes with long flushing times were performed. With the help of modeling the different sources of 36Cl can be distinguished. The dominant source of 36Cl in many Alpine lakes is chlorine, released during the accident on the Chernobyl nuclear power plant.

  20. Glutathione--hydroxyl radical interaction: a theoretical study on radical recognition process.

    Directory of Open Access Journals (Sweden)

    Béla Fiser

    Full Text Available Non-reactive, comparative (2 × 1.2 μs molecular dynamics simulations were carried out to characterize the interactions between glutathione (GSH, host molecule and hydroxyl radical (OH(•, guest molecule. From this analysis, two distinct steps were identified in the recognition process of hydroxyl radical by glutathione: catching and steering, based on the interactions between the host-guest molecules. Over 78% of all interactions are related to the catching mechanism via complex formation between anionic carboxyl groups and the OH radical, hence both terminal residues of GSH serve as recognition sites. The glycine residue has an additional role in the recognition of OH radical, namely the steering. The flexibility of the Gly residue enables the formation of further interactions of other parts of glutathione (e.g. thiol, α- and β-carbons with the lone electron pair of the hydroxyl radical. Moreover, quantum chemical calculations were carried out on selected GSH/OH(• complexes and on appropriate GSH conformers to describe the energy profile of the recognition process. The relative enthalpy and the free energy changes of the radical recognition of the strongest complexes varied from -42.4 to -27.8 kJ/mol and from -21.3 to 9.8 kJ/mol, respectively. These complexes, containing two or more intermolecular interactions, would be the starting configurations for the hydrogen atom migration to quench the hydroxyl radical via different reaction channels.

  1. Radical scavenging ability of some compounds isolated from Piper cubeba towards free radicals.

    Science.gov (United States)

    Aboul-Enein, Hassan Y; Kładna, Aleksandra; Kruk, Irena

    2011-01-01

    The purpose of this study was to identify the antioxidant activity of 16 compounds isolated from Piper cubeba (CNCs) through the extent of their capacities to scavenge free radicals, hydroxyl radical (HO(•)), superoxide anion radical O•(2)(-) and 2,2-diphenyl-1-picrylhydrazyl radical (DPPH(•)), in different systems. Electron paramagnetic resonance (EPR) and 5,5-dimethyl-1-pyrroline-N-oxide, DMPO, as the spin trap, and chemiluminescence techniques were applied. Using the Fenton-like reaction [Fe(II) + H(2)O(2)], CNCs were found to inhibit DMPO-OH radical formation ranging from 5 to 57% at 1.25 mmol L(-1) concentration. The examined CNCs also showed a high DPPH antiradical activity (ranging from 15 to 99% at 5 mmol L(-1) concentration). Furthermore, the results indicated that seven of the 16 tested compounds may catalyse the conversion of superoxide radicals generated in the potassium superoxide/18-crown-6 ether system, thus showing superoxide dismutase-like activity. The data obtained suggest that radical scavenging properties of CNCs might have potential application in many plant medicines. PMID:21681910

  2. Inactivation efficiencies of radical reactions with biologically active DNA

    International Nuclear Information System (INIS)

    Dilute aqueous solutions of biologically active ΦX174 DNA may serve as a simplified model system of the cell. Damage to the DNA after irradiation with γ-rays, may be ascribed to reactions with radical OH, radical H and esub(aq)- or secondary radicals, arising from reactions of water radicals with added scavengers. Conversion of primary (water) radicals into secondary (scavenger) radicals leads to a considerable protection of the DNA, which however, would have been larger if these secondary radicals did not contribute to DNA inactivation. The inactivation yield due to isopropanol or formate (secondary) radicals depends on dose rate as well as DNA concentration. Furthermore the inactivation efficiencies of the reactions of both the primary and the secondary radicals with single-stranded DNA could be established. (author)

  3. 76 FR 34014 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10, CL-215-6B11 (CL-215T Variant), and...

    Science.gov (United States)

    2011-06-10

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10, CL- 215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes AGENCY.... Model CL-215-1A10 airplanes, serial numbers 1051 through 1125 inclusive; Model CL-215- 6B11...

  4. Carbon-13 isotopic selectivity in the infrared multiphoton photolysis of CF2Cl2-O2 mixtures

    International Nuclear Information System (INIS)

    The infrared multiphoton chemistry of CF2Cl2-O2 mixtures has been studied at laser frequencies where the product CF2O is highly enriched in carbon-13 yield. Yield enhancements with no loss of isotopic selectivity are attributed to suppression of radical-atom recombination reactions. It is demonstrated that addition of up to 60 Torr of either excess O2 or N2 suppresses a thermal, non-selective channel important at higher fluences. A selectivity factor greater than 30 is observed for 4 Torr CF2Cl2 in the presence of 80 Torr of oxygen

  5. Radiation-electrochemistry of the colloidal gold micro-electrode: Hydrogen formation by organic free radicals

    International Nuclear Information System (INIS)

    Various organic free radicals as well as Ni+ ions produce hydrogen in the presence of some 10-4 M of colloidal gold. The gold catalyst was prepared via the reduction of HAuCl4 either thermally by citrate or by γ-irradiation. The organic radicals were radiolytically produced. The mechanism of H2 formation includes electron transfer from the organic radicals to the gold particles, storage of a large number of electrons per gold particle, conversion of the electrons into adsorbed H-atoms and desorption of the latter to form H2. - The rates of some of these steps were measured using the method of pulse radiolysis. 1-Hydroxy-1-methyl ethyl radicals, (CH3)2COH, react with colloidal gold particles almost diffusion controlled provided that the gold particles are not charged with excess electrons. Charged gold particles react at a substantially lower rate. The stored electrons live seconds or even minutes depending on their number per gold particle. In the stationary state, up to 0.38 Coulomb of electrons could be stored per liter of a 2.9x10-4 molar gold solution, each gold particle carrying about 39 electrons. A comparison is also made between the catalytic activities of colloidal gold and silver. Due to the relative fast conversion of electrons into adsorbed H-atoms, colloidal gold has less capacity for the storage of electrons than colloidal silver. - The dependence of the hydrogen yield on the pH of the solution, the concentration of gold, the size of the gold particles, the concentration of the polyvinyl alcohol stabilizer, and the intensity of radiation was also investigated. At high intensities, some of the radicals are destroyed in a gold catalysed disproportionation. (orig.)

  6. Simulations of BCl3/Cl2/Ar plasmas with comparisons to diagnostic data

    International Nuclear Information System (INIS)

    A reaction mechanism is reported that describes BCl3/Cl2/Ar plasmas used in the etching of metal lines in microelectronics fabrication processes. Although many of the fundamental electron-impact cross sections for this system are not well known, a reasonable set of reaction paths and rate coefficients has been derived to describe low-pressure reactors with high plasma density. The reaction mechanism describes 59 possible gas-phase events and 18 plasma-surface interactions. A well-mixed reactor model is used to develop the reaction set and to test it against absolute experimental measurements of electron and Cl- densities, as well as relative measurements of BCl and Cl radicals in an inductively coupled research reactor. The experimental data cover a wide range of operating conditions and gas mixtures. The model provides quantitative agreement with measurements over the whole range of conditions and diagnostics, capturing most of the observed trends. In addition, the model predicts relative ion ratios and Cl/Cl2 density ratios as measured by molecular beam mass spectrometry. Comparisons of results from the zero-dimensional model and a two-dimensional continuum plasma model, using the same reaction mechanisms, further validate the chemistry set and show the strengths and weaknesses of the well-stirred reactor approach. Sensitivity analysis shows the dominant reactions contributing to model predictions of species densities. copyright 1998 American Vacuum Society

  7. Radical recombinations in acetylene-air flames

    NARCIS (Netherlands)

    Zeegers, P.J.Th.; Alkemade, C.T.J.

    1965-01-01

    In this paper an analysis is given of the behaviour of excess radical concentrations, H, OH and O as a function of height above the reaction zone in premixed acetylene-air flames at 2–200° to 2400°K and 1 atmosphere pressure. The intensity was measured of the Li resonance line which is related to th

  8. Free-radical inactivation of muscle aldolase

    International Nuclear Information System (INIS)

    Rabbit muscle aldolase has been shown to be deactivated by addition of irradiated crystals of various sugars and amino acids. Inactivation observed immediately upon dissolution is ascribed to reaction with free radicals, whereas post-dissolution inactivation is ascribed to acid-catalyzed reaction with nonradical radiolysis products. (U.S.)

  9. Lipophilic fluorescent products of free radicals

    Czech Academy of Sciences Publication Activity Database

    Ivica, Josko; Wilhelm, Jiří

    2014-01-01

    Roč. 158, č. 3 (2014), s. 365-372. ISSN 1213-8118 R&D Projects: GA ČR(CZ) GAP303/11/0298 Institutional support: RVO:67985823 Keywords : lipofuscin-like pigments * lipid peroxidation * free radicals * fluorescence Subject RIV: CE - Biochemistry Impact factor: 1.200, year: 2014

  10. Discourses of postmodern epistemology: Radical impetus lost?

    OpenAIRE

    Mueller, Martin

    2006-01-01

    Exhibiting a highly divisive agenda postmodernism has created profound chasms across scientific communities. In development studies its radical impetus has translated into the postdevelopment perspective which violently repudiates the modernist development project. This paper crystallises two distinct discourses of working upon the epistemological raw material of postmodernism: an exclusivist discourse, which reinforces the chasm by isolating postmodernism, and an inclusivist discourse, which...

  11. Identity and Islamic Radicalization in Western Europe

    NARCIS (Netherlands)

    S.M. Murshed (Syed); S. Pavan (Sara)

    2009-01-01

    textabstractThis paper argues that both socio-economic disadvantage and political factors, such as the West’s foreign policy with regard to the Muslim world, along with historical grievances, play a part in the development of Islamic radicalized collective action in Western Europe. We emphasise the

  12. Designed metalloprotein stabilizes a semiquinone radical.

    Science.gov (United States)

    Ulas, Gözde; Lemmin, Thomas; Wu, Yibing; Gassner, George T; DeGrado, William F

    2016-04-01

    Enzymes use binding energy to stabilize their substrates in high-energy states that are otherwise inaccessible at ambient temperature. Here we show that a de novo designed Zn(II) metalloprotein stabilizes a chemically reactive organic radical that is otherwise unstable in aqueous media. The protein binds tightly to and stabilizes the radical semiquinone form of 3,5-di-tert-butylcatechol. Solution NMR spectroscopy in conjunction with molecular dynamics simulations show that the substrate binds in the active site pocket where it is stabilized by metal-ligand interactions as well as by burial of its hydrophobic groups. Spectrochemical redox titrations show that the protein stabilized the semiquinone by reducing the electrochemical midpoint potential for its formation via the one-electron oxidation of the catechol by approximately 400 mV (9 kcal mol(-1)). Therefore, the inherent chemical properties of the radical were changed drastically by harnessing its binding energy to the metalloprotein. This model sets the basis for designed enzymes with radical cofactors to tackle challenging chemistry. PMID:27001731

  13. Radical Chemistry in the Gas Phase

    Czech Academy of Sciences Publication Activity Database

    Alcaraz, Ch.; Fischer, I.; Schröder, Detlef

    New York: John Wiley and Sons, 2012 - (Chatgilialoglu, C.; Studer, A.), s. 477-502 ISBN 978-0-470-97125-3 Grant ostatní: European Research Council(XE) AdG HORIZOMS Institutional research plan: CEZ:AV0Z40550506 Keywords : radicals * reactive intermediates * gas phase * photoionization * unimolecular reactions * bimolecular reactions Subject RIV: CF - Physical ; Theoretical Chemistry

  14. Radical Islamism and Migrant Integration in Denmark

    DEFF Research Database (Denmark)

    Goli, Marco; Rezaei, Shahamak

    2011-01-01

    for – or consequence of - their societal integration. Conventional wisdom suggests: “The more you associate yourself with the cherished and established goals and means, the more you will disassociate yourself from Radical Islamism”, and vice versa. We believe that, quite surprisingly, an empirical test of this idea...

  15. Designed metalloprotein stabilizes a semiquinone radical

    Science.gov (United States)

    Ulas, Gözde; Lemmin, Thomas; Wu, Yibing; Gassner, George T.; Degrado, William F.

    2016-04-01

    Enzymes use binding energy to stabilize their substrates in high-energy states that are otherwise inaccessible at ambient temperature. Here we show that a de novo designed Zn(II) metalloprotein stabilizes a chemically reactive organic radical that is otherwise unstable in aqueous media. The protein binds tightly to and stabilizes the radical semiquinone form of 3,5-di-tert-butylcatechol. Solution NMR spectroscopy in conjunction with molecular dynamics simulations show that the substrate binds in the active site pocket where it is stabilized by metal-ligand interactions as well as by burial of its hydrophobic groups. Spectrochemical redox titrations show that the protein stabilized the semiquinone by reducing the electrochemical midpoint potential for its formation via the one-electron oxidation of the catechol by approximately 400 mV (9 kcal mol-1). Therefore, the inherent chemical properties of the radical were changed drastically by harnessing its binding energy to the metalloprotein. This model sets the basis for designed enzymes with radical cofactors to tackle challenging chemistry.

  16. Neglected Side Effects After Radical Prostatectomy

    DEFF Research Database (Denmark)

    Frey, Anders Ullmann; Sønksen, Jens; Fode, Mikkel

    2014-01-01

    INTRODUCTION: A series of previously neglected sexually related side effects to radical prostatectomy (RP) has been identified over the recent years. These include orgasm-associated incontinence (OAI), urinary incontinence in relation to sexual stimulation (UISS), altered perception of orgasm, or...

  17. Ultraviolet photodissociation dynamics of the phenyl radical

    International Nuclear Information System (INIS)

    Ultraviolet (UV) photodissociation dynamics of jet-cooled phenyl radicals (C6H5 and C6D5) are studied in the photolysis wavelength region of 215-268 nm using high-n Rydberg atom time-of-flight and resonance enhanced multiphoton ionization techniques. The phenyl radicals are produced from 193-nm photolysis of chlorobenzene and bromobenzene precursors. The H-atom photofragment yield spectra have a broad peak centered around 235 nm and are in good agreement with the UV absorption spectra of phenyl. The H + C6H4 product translational energy distributions, P(ET)'s, peak near ∼7 kcal/mol, and the fraction of average translational energy in the total excess energy, T>, is in the range of 0.20-0.35 from 215 to 268 nm. The H-atom product angular distribution is isotropic. The dissociation rates are in the range of 107-108 s-1 with internal energy from 30 to 46 kcal/mol above the threshold of the lowest energy channel H +o-C6H4 (ortho-benzyne), comparable with the rates from the Rice-Ramsperger-Kassel-Marcus theory. The results from the fully deuterated phenyl radical are identical. The dissociation mechanism is consistent with production of H +o-C6H4, as the main channel from unimolecular decomposition of the ground electronic state phenyl radical following internal conversion of the electronically excited state.

  18. DNP with Trityl Radicals in Deuterated Polyethylene

    Science.gov (United States)

    Wang, Li; Meyer, W.; Berlin, A.; Herick, J.; Hess, C.; Reicherz, G.

    2016-02-01

    Chemically doping with trityl radicals was performed in fully deuterated polyethylene. The behavior of paramagnetic centers has been investigated by ESR X-band spectrometer. The highest deuteron polarization was 8% at 2.5 T and 1 K with a spin concentration of 3 × 1019 spins/g.

  19. Heterogeneous computing with OpenCL

    CERN Document Server

    2013-01-01

    Heterogeneous Computing with OpenCL teaches OpenCL and parallel programming for complex systems that may include a variety of device architectures: multi-core CPUs, GPUs, and fully-integrated Accelerated Processing Units (APUs) such as AMD Fusion technology. Designed to work on multiple platforms and with wide industry support, OpenCL will help you more effectively program for a heterogeneous future. Written by leaders in the parallel computing and OpenCL communities, this book will give you hands-on OpenCL experience to address a range of fundamental parallel algorithms. The authors explore memory spaces, optimization techniques, graphics interoperability, extensions, and debugging and profiling. Intended to support a parallel programming course, Heterogeneous Computing with OpenCL includes detailed examples throughout, plus additional online exercises and other supporting materials.

  20. Hydroxyl Radical Dosimetry for High Flux Hydroxyl Radical Protein Footprinting Applications Using a Simple Optical Detection Method.

    Science.gov (United States)

    Xie, Boer; Sharp, Joshua S

    2015-11-01

    Hydroxyl radical protein footprinting (HRPF) by fast photochemical oxidation of proteins (FPOP) is a powerful benchtop tool used to probe protein structure, interactions, and conformational changes in solution. However, the reproducibility of all HRPF techniques is limited by the ability to deliver a defined concentration of hydroxyl radicals to the protein. This ability is impacted by both the amount of radical generated and the presence of radical scavengers in solution. In order to compare HRPF data from sample to sample, a hydroxyl radical dosimeter is needed that can measure the effective concentration of radical that is delivered to the protein, after accounting for both differences in hydroxyl radical generation and nonanalyte radical consumption. Here, we test three radical dosimeters (Alexa Fluor 488, terepthalic acid, and adenine) for their ability to quantitatively measure the effective radical dose under the high radical concentration conditions of FPOP. Adenine has a quantitative relationship between UV spectrophotometric response, effective hydroxyl radical dose delivered, and peptide and protein oxidation levels over the range of radical concentrations typically encountered in FPOP. The simplicity of an adenine-based dosimeter allows for convenient and flexible incorporation into FPOP applications, and the ability to accurately measure the delivered radical dose will enable reproducible and reliable FPOP across a variety of platforms and applications. PMID:26455423

  1. On the ClC halogen bond: a rotational study of CF3Cl-CO.

    Science.gov (United States)

    Caminati, Walther; Evangelisti, Luca; Feng, Gang; Giuliano, Barbara M; Gou, Qian; Melandri, Sonia; Grabow, Jens-Uwe

    2016-07-21

    The rotational spectra of two isotopologues (CF3(35)Cl-CO and CF3(37)Cl-CO) of the CF3Cl-CO adduct have been investigated and analyzed using supersonic-jet Fourier transform microwave spectroscopy, and found to have the features of a symmetric top. Rotational, centrifugal distortion, and nuclear quadrupole ((35)Cl and (37)Cl) coupling constants have been precisely obtained from high-resolution measurements. The two subunits of the complex are held together via a ClC halogen bond interaction. Information on the internal dynamics and the dissociation energy of the complex is provided. PMID:27049637

  2. Studies of free radicals by ultraviolet excimer laser photolysis. Progress report, 1 April 1980-1 November 1980

    International Nuclear Information System (INIS)

    An experimental technique has been developed to produce and directly study vibrationally excited free radicals. Pulses of light from an ultraviolet excimer laser are used to photodissociate small molecules to generate free radicals with high internal excitation. The radicals are detected directly by the technique of time and wavelength-resolved infrared emission spectroscopy using a background-limited copper-doped germanium infrared detector. New results have been obtained on the CH3 radical. A complete spectrum of the CH3 umbrella band reveals for the first time accurate positions of the vibrational progression in this band. Photofragmentation of (CH3)2Hg has yielded detailed information on the vibrational distribution, rotational temperature, and deactivation rates of the CH3 stretch mode. A technique to study chemical chain reactions using low power, radical-specific, laser initiation and realtime kinetics detection had previously been demonstrated. The results provide a general method to study a large number of chain reaction combustion systems in greater detail. New results on more complex chain reactions such as Cl2/butane reveal that highly detailed infrared emission spectra of various products of the chain and their time evolution is possible. Partitioning of energy between vibrational degrees of freedom and translational heating is obtained over the course of the combustion

  3. Stress influenced increase in phenolic content and radical scavenging capacity of Rhodotorula glutinis CCY 20-2-26

    OpenAIRE

    Salar, Raj Kumar; Certik, Milan; Brezova, Vlasta; Brlejova, Marta; Hanusova, Vladimira; Breierová, Emília

    2012-01-01

    Rhodotorula glutinis CCY 20-2-26 when grown under controlled stress of either NaCl (1–5 %) or H2O2 (1–5 mM) on basal media exhibited a twofold increase in its total phenolic contents. The radical scavenging capacities (RSCs) as determined by ABTS test were found to be highest in 4 mM H2O2 (1.44 mM TEAC mg−1) and 4 % NaCl (1.13 mM TEAC mg−1) as compared to control samples (0.41 mM TEAC mg−1). Similarly, the RSCs as determined by DPPH test were also highest in 4 % NaCl (1.83 mM TEAC mg−1) and 4...

  4. Investigation of the formation of benzoyl peroxide, benzoic anhydride, and other potential aerosol products from gas-phase reactions of benzoylperoxy radicals

    Science.gov (United States)

    Strollo, Christen M.; Ziemann, Paul J.

    2016-04-01

    The secondary organic aerosol (SOA) products of the reaction of benzaldehyde with Cl atoms and with OH radicals in air in the absence of NOx were investigated in an environmental chamber in order to better understand the possible role of organic peroxy radical self-reactions in SOA formation. SOA products and authentic standards were analyzed using mass spectrometry and liquid chromatography, and results show that the yields of benzoyl peroxide (C6H5C(O)OO(O)CC6H5) and benzoic anhydride (C6H5C(O)O(O)CC6H5), two potential products from the gas-phase self-reaction of benzoylperoxy radicals (C6H5C(O)OO·), were less than 0.1%. This is in contrast to results of recent studies that have shown that the gas-phase self-reactions of β-nitrooxyperoxy radicals formed from reactions of isoprene with NO3 radicals form dialkyl peroxides that contribute significantly to gas-phase and SOA products. Such reactions have also been proposed to explain the gas-phase formation of extremely low volatility dimers from autooxidation of terpenes. The results obtained here indicate that, at least for benzoylperoxy radicals, the self-reactions form only benzoyloxy radicals. Analyses of SOA composition and volatility were inconclusive, but it appears that the SOA may consist primarily of oligomers formed through heterogeneous/multiphase reactions possibly involving some combination of phenol, benzaldehyde, benzoic acid, and peroxybenzoic acid.

  5. Free Radicals in Superfluid Liquid Helium Nanodroplets: A Pyrolysis Source for the Production of Propargyl Radical

    CERN Document Server

    Küpper, J; Miller, R E; K\\"upper, Jochen; Merritt, Jeremy M.; Miller, Roger E.

    2002-01-01

    An effusive pyrolysis source is described for generating a continuous beam of radicals under conditions appropriate for the helium droplet pick-up method. Rotationally resolved spectra are reported for the $\

  6. THE RADICAL ONLINE: INDIVIDUAL RADICALIZATION PROCESSES AND THE ROLE OF THE INTERNET

    Directory of Open Access Journals (Sweden)

    Daniel Koehler

    2014-12-01

    Full Text Available This paper examines in detail the role of the Internet in individual radicalization processes of eight German former right-wing extremists. Applying Grounded Theory methodology the qualitative interviews were analyzed in several coding and re-coding phases. The findings are integrated into the existing literature afterwards. Besides well known factors, such as more effective communication, anonymity and better networking opportunities, this study found evidence that the Internet is a major driving factor to establish and foster the development of radical contrast societies (cf. Koehler, 2015 transmitting radical and violent ideologies and translating them into political activism. As a venue for information exchange, ideological development and training, the individual radicalization process was characteristically shaped or even made possible through the Internet. This paper also shows the high value of qualitative research regarding the topic in contrast to usually employed quantitative analysis of webpage content.

  7. Effects of NaCl and NH4Cl on the initial atmospheric corrosion of zinc

    International Nuclear Information System (INIS)

    Effects of NaCl and NH4Cl on the initial atmospheric corrosion of zinc were investigated via quartz crystal microbalance (QCM) in laboratory at 80% RH and 25 deg C. The results show that both NaCl and NH4Cl can accelerate the initial atmospheric corrosion of zinc. The combined effect of NaCl and NH4Cl on the corrosion of zinc is greater than that caused by NH4Cl and less than that caused by NaCl. Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), scanning electron microscopy and electron dispersion X-ray analysis (SEM/EDAX) were used to characterize the corrosion products of zinc. (NH4)2ZnCl4, Zn5(OH)8Cl2 . H2O and ZnO present on zinc surface in the presence of NH4Cl while Zn5(OH)8Cl2 . H2O and ZnO are the dominant corrosion products on NaCl-treated zinc surface. Probable mechanisms are presented to explain the experimental results

  8. AMS measurement of the reaction 35Cl(n,γ)36Cl

    International Nuclear Information System (INIS)

    36Cl is a long-lived radionuclide (t1/2=301000 a), which is dominantly produced via the reaction 35Cl(n,γ)36Cl. In the present work we focused on: First, the production of an independent 36Cl/35Cl reference material for AMS and second, the determination of the Maxwellian averaged cross section (MACS) of 35Cl(n,γ)36Cl at 25 keV neutron energy, i.e. the energy range which is important for astrophysical network calculations. Approaching the first goal, NaCl pellets were irradiated with thermal neutrons in Vienna and Budapest. The neutron fluence, used for the calculation of the 36Cl/35Cl ratio of the irradiated samples, was determined via gold fluence monitors. For the determination of the neutron capture cross section of 35Cl at stellar energies, AMS measurements were performed on two samples, which were irradiated with neutrons of a Maxwell-Boltzmann energy distribution of 25 keV. Combining the AMS- and the neutron-fluence data, the MACS for 35Cl at 25 keV was calculated. The neutron irradiations, the measuring procedure of 36Cl at VERA and our new results are presented.

  9. Atmospheric chemistry of 4 : 2 fluorotelomer alcohol (n-C4F9CH2CH2OH): Products and mechanism of Cl atom initiated oxidation in the presence of NOx

    DEFF Research Database (Denmark)

    Andersen, Mads Peter Sulbæk; Nielsen, OJ; Hurley, MD; Ball, JC; Wallington, TJ; Ellis, DA; Martin, JW; Mabury, SA

    2005-01-01

    Smog chamber/FTIR techniques were used to study the Cl atom initiated oxidation of 4:2 fluorotelomer alcohol (C4F9CH2CH2OH, 4:2 FTOH) in the presence of NOx in 700 Torr of N-2/O-2 diluent at 296 K. Chemical activation effects play an important role in the atmospheric chemistry of the peroxy, and...... possibly the alkoxy, radicals derived from 4:2 FTOH. Cl atoms react with C4F9CH2CH2OH to give C4F9CH2C.HOH radicals which add O-2 to give chemically activated alpha-hydroxyperoxy radicals, [C4F9CH2C(OO.)HOH]*. In 700 Torr of N-2/ O-2 at 296 K, approximately 50% of the [C4F9CH2C(OO.)HOH]* radicals decompose...... ``promptly'' to give HO2 radicals and C4F9CH2CHO, the remaining [C4F9CH2C(OO.)HOH]* radicals undergo collisional deactivation to give thermalized peroxy radicals, C4F9CH2C(OO.)HOH. Decomposition to HO2 and C4F9CH2CHO is the dominant atmospheric fate of the thermalized peroxy radicals. In the presence of...

  10. 76 FR 66620 - Airworthiness Directives; Bombardier, Inc. Model CL-215-1A10, CL-215-6B11 (CL-215T Variant), and...

    Science.gov (United States)

    2011-10-27

    ... Procedures (44 FR 11034, February 26, 1979); and 3. Will not have a significant economic impact, positive or.... Model CL-215-1A10, CL- 215-6B11 (CL-215T Variant), and CL-215-6B11 (CL-415 Variant) Airplanes AGENCY... comments. SUMMARY: We are adopting a new airworthiness directive (AD) for certain Bombardier, Inc. Model...

  11. Classical radical hysterectomy and nerve-sparing radical hysterectomy in the treatment of cervical cancer

    OpenAIRE

    Marcin Makowski; Marek Nowak; Marian Szpakowski; Jacek Władziński; Anna Serwach-Nowińska; Łukasz Janas; Jacek R. Wilczyński

    2014-01-01

    Aim of the study: To compare Piver III radical hysterectomy (RH) with nerve-sparing radical hysterectomy (NSRH) for cervical cancer patients in terms of postoperative physiology of pelvic autonomic nerves and perioperative complications. Material and methods : Seventy-three consecutive patients with invasive cervical cancer underwent RH (53 cases) or NSRH (20 cases) from 2001 to 2012 at the Department of Gynecology and Gynecologic Oncology of Polish Mother’s Memorial Hospital – Research...

  12. Spectroscopy of free radicals and radical containing entrance-channel complexes in superfluid helium nanodroplets

    OpenAIRE

    Küpper, J.; Merritt, J.

    2007-01-01

    The spectroscopy of free radicals and radical containing entrance-channel complexes embedded in superfluid helium nano-droplets is reviewed. The collection of dopants inside individual droplets in the beam represents a micro-canonical ensemble, and as such each droplet may be considered an isolated cryo-reactor. The unique properties of the droplets, namely their low temperature (0.4 K) and fast cooling rates ( ~ 1016 K s-1)provides novel opportunities for the formation and high-resolution st...

  13. Environmentally Persistent Free Radicals (EPFRs) - 2. Are Free Hydroxyl Radicals Generated in Aqueous Solutions?

    OpenAIRE

    Khachatryan, Lavrent; Dellinger, Barry

    2011-01-01

    A chemical spin trap, 5,5-dimethyl-1-pyrroline-N-oxide (DMPO), in conjunction with electron paramagnetic resonance (EPR) spectroscopy was employed to measure the production of hydroxyl radical (.OH) in aqueous suspensions of 5% Cu(II)O/silica (3.9% Cu) particles containing environmentally persistent free radicals (EPFRs) of 2-monochlorophenol (2-MCP). The results indicate: 1) a significant differences in accumulated DMPO-OH adducts between EPFR containing particles and non-EPFR control sample...

  14. Role of oxygen free radicals in patients with acute pancreatitis

    OpenAIRE

    Park, Byung Kyu; Chung, Jae Bock; Lee, Jin Heon; Suh, Jeong Hun; Park, Seung Woo; Song, Si Young; Kim, Hyeyoung; Kim, Kyung Hwan; Kang, Jin Kyung

    2003-01-01

    AIM: The generation of oxygen free radicals has been implicated in the pathogenesis of experimental pancreatitis. The aim of this study was to determine the role of oxygen free radicals in patients with acute pancreatitis.

  15. Structure model and synthesis of NdCl3-FeCl3-graphite intercalation compounds

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The distribution of the elements and microstructure of NdCl3-FeCl3-graphite intercalation compounds (GICs) were shown by scanning electron microscope (SEM) and energy dispersive spectroscopy (EDS). The results show that Nd element intercalates into graphite, forming NdCl3-FeCl3-GICs, and the distribution of Nd and Fe is nearly even. On the basis of the data, a structure model for RECl3-GICs was founded, and the characteristic layer distance and the index of interval energy were calculated. The calculated results agree with experimental ones, and the relative errors are ±2%. Thus it can be seen that the (111) face is optimal direction for intercalation reaction of TbCl3 LuCl3, and the (001) face is that for LaCl3 GdCl3, because of the lowest interval energy.

  16. Radical Scavenging Activities of Tannin Extracted from Amaranth (Amaranthus caudatus L.).

    Science.gov (United States)

    Jo, Hyeon-Ju; Chung, Kang-Hyun; Yoon, Jin A; Lee, Kwon-Jai; Song, Byeong Chun; An, Jeung Hee

    2015-06-01

    This study investigates the bioactivity of tannin from amaranth (Amaranthus caudatus L.) extracts. The antioxidant activities of the extracts from amaranth leaves, flowers, and seeds were evaluated. Tannin from leaves of amaranth has been evaluated for superoxide scavenging activity by using DPPH and ABTS(+) analysis, reducing power, protective effect against H2O2-induced oxidative damage in L-132 and BNL-CL2 cells, and inhibition of superoxide radical effects on HL-60 cells. At a concentration of 100 μg/ml, tannin showed protective effects and restored cell survival to 69.2% and 41.8% for L-132 and BNL-CL2 cells, respectively. Furthermore, at the same concentration, tannin inhibited 41% of the activity of the superoxide radical on HL-60 cells and 43.4% of the increase in nitric oxide levels in RAW 264.7 cells. The expression levels of the antioxidant-associated protein SOD-1 were significantly increased in a concentration-dependent manner in RAW 264.7 cells treated with tannin from amaranth leaves. These results suggest that tannin from the leaves of Amaranthus caudatus L. is a promising source of antioxidant component that can be used as a food preservative or nutraceutical. PMID:25639718

  17. Nitryl chloride as a 'new' radical source and its role in production of ozone in polluted troposphere: an overview of the results from four field campaigns in China

    Science.gov (United States)

    Wang, Tao; Tham, Yee Jun; Xue, Likun; Wang, Zhe; Wang, Xinfeng; Wang, Weihao; Wang, Hao; Yun, Hui; Lu, Keding; Shao, Min; Louie, Peter K. K.; Blake, Donald R.; Brown, Steven S.; Zhang, Yuanhang

    2016-04-01

    Nitryl chloride (ClNO2) - a trace gas produced from heterogeneous reactions of dinitrogen pentoxide (N2O5) on aerosols containing chorine - can significantly affect radical budget and concentrations of ozone and other secondary pollutants. However, the abundance, formation kinetics, and impact of ClNO2are not fully understood under different environmental conditions. This presentation gives an overview of recent field campaigns of ClNO2 and related chemical constituents in China, including one at a mountain top (957 m a.s.l) in Hong Kong of South China in winter 2013 and three in North China (urban Ji'nan, semi-rural Wangdu, and Mt Tai (1534 m a.s.l)) in summer 2014. ClNO2 and N2O5 were measured with a chemical ionization mass spectrometry (CIMS) system with iodide as the primary ions. Ambient concentrations of several hundreds ppts and up to 4.7 ppbv of ClNO2were observed in these locations, suggesting existence of elevated ClNO2 in both coastal and inland atmospheres of China. Measurements in North China exhibited generally low concentrations of N2O5, indicative of its fast uptake of on aerosols under aerosol and humid conditions. Indications of anthropogenic sources of chloride were observed at all these sites. The impact of photolysis of ClNO2 on radical budget and ozone enhancement was assessed with a MCM model which was updated with detailed chlorine chemistry and constrained by measurement data for the southern and a northern site. The results show that the ClNO2 could increase ozone production by 2-16% in the following day. Overall, our study re-affirms the need to include ClNO2 related reactions in photochemical models for prediction of ground-level ozone in polluted environments.

  18. Free radicals, antioxidants and functional foods: Impact on human health

    OpenAIRE

    Lobo, V.; Patil, A.; A Phatak; N Chandra

    2010-01-01

    In recent years, there has been a great deal of attention toward the field of free radical chemistry. Free radicals reactive oxygen species and reactive nitrogen species are generated by our body by various endogenous systems, exposure to different physiochemical conditions or pathological states. A balance between free radicals and antioxidants is necessary for proper physiological function. If free radicals overwhelm the body's ability to regulate them, a condition known as oxidative stress...

  19. The Serbian Radical movement 1881-1903: A historical aspect

    OpenAIRE

    Protić Milan St.

    2005-01-01

    Focusing on the initial stage (until 1903) of the Serbian Radical movement the paper attempts to delineate and explicate the main phases of its political maturation. In its initial stage Serbian Radicalism passed through several significant phases. The earliest phase (1869-80) may be named the period of rudimentary Radicalism. The movement was unorganized and oscillated between the ideas of socialism, anarchism and peasant democracy. The year 1881 saw the founding of the Radical Party as the ...

  20. Synthesis of glycopolymer architectures by reversible-deactivation radical polymerization

    OpenAIRE

    Ali Ghadban; Luca Albertin

    2013-01-01

    This review summarizes the state of the art in the synthesis of well-defined glycopolymers by Reversible-Deactivation Radical Polymerization (RDRP) from its inception in 1998 until August 2012. Glycopolymers architectures have been successfully synthesized with four major RDRP techniques: Nitroxide-mediated radical polymerization (NMP), cyanoxyl-mediated radical polymerization (CMRP), atom transfer radical polymerization (ATRP) and reversible addition-fragmentation chain transfer (RAFT) polym...

  1. Inguinal hernia developed after radical retropubic surgery for prostate cancer

    OpenAIRE

    Chung, Choon Sik; Jeong, Gyu Young; Kim, Seung Han; Lee, Dong Keun

    2013-01-01

    Purpose In this retrospective study, we aimed to compare the clinical characteristics of inguinal hernia developed after radical retropubic surgery for prostate cancer to the hernia without previous radical prostatectomy. Methods Twenty-three patients (group A) who had radical retropubic surgery for prostate cancer underwent laparoscopic or open tension-free inguinal hernia repair from March 2007 to February 2011. Nine hundred and forty patients (group B) without previous radical retropubic s...

  2. CL møder sptogfagsdidaktikken

    DEFF Research Database (Denmark)

    Pedersen, Michael Svendsen

    2011-01-01

    I artiklen diskuteres den didaktiske kontekst for brugen af CL (Cooperative Learning) i sprogundervisningen. Indledningsvis stilles følgende spørgsmål: Hvor kommer de indholdsfrie CL-strukturer fra, og hvad sker der når man inddrager dem i sprogundervisningen? I besvarelsen af disse spørgsmål...

  3. Some Properties of CL-space and Almost CL-space%关于CL-空间和几乎CL-空间的一些性质

    Institute of Scientific and Technical Information of China (English)

    卢允照

    2006-01-01

    讨论具有"平坦性"凸性单位球结构的Banach空间的一些性质.首先根据CL-空间的定义证明了Banach空间l1是CL-空间.通过证明l31和l3∞具有非CL-子空间证明了维数大于2的CL空间不具继承性,即具有非CL-子空间,另外,总结了有限维CL-空间与其它一些Banach空间类的等价性.最后讨论了CL-空间和几乎CL-空间包含Banach空间c0与l1的一些性质以及实对偶空间成为几乎CL-空间的两个必要条件.

  4. Al/Cl2 molten salt battery

    Science.gov (United States)

    Giner, J.

    1972-01-01

    Molten salt battery has been developed with theoretical energy density of 5.2 j/kg (650 W-h/lb). Battery, which operates at 150 C, can be used in primary mode or as rechargeable battery. Battery has aluminum anode and chlorine cathode. Electrolyte is mixture of AlCl3, NaCl, and some alkali metal halide such as KCl.

  5. Pathways of Cl- transport in human fibroblasts

    International Nuclear Information System (INIS)

    Three pathways of Cl- efflux were identified in normal human fibroblasts. Twenty percent of the total Cl- efflux is via an electrically conductive pathway with an efflux constant of 0.016 min-1. This pathway is insensitive to 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) and bumetanide but is partially inhibited by anthracene-9-carboxylic acid. Twenty-five percent of the Cl- efflux occurs via Cl- with cation cotransport having an efflux constant of 0.020 min-1. This pathway is inhibited by bumetanide and is dependent on the simultaneous presence of Na+, K+, and Cl-. Under basal conditions, the energetics of this pathway indicate that it is operating close to equilibrium. Fifty percent of the Cl- efflux occurs via an anion exchange pathway having an efflux constant of 0.040 min-1 that is inhibited by DIDS or by removal of Cl- from the extracellular medium. Together these pathways account for 95% of the total Cl- efflux

  6. Atmospheric production rate of {sup 36}Cl

    Energy Technology Data Exchange (ETDEWEB)

    Parrat, Y.; Hajdas, W.; Baltensperger, U.; Synal, H.A.; Kubik, P.W.; Gaeggeler, H.W. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Suter, M. [Eidgenoessische Technische Hochschule, Zurich (Switzerland)

    1997-09-01

    Using experimental cross sections, a new calculation of the atmospheric production rate of {sup 36}Cl was carried out. A mean production rate of 20 atoms m{sup -2}s{sup -1} was obtained, which is lower than mean {sup 36}Cl deposition rates. (author) 2 figs., 7 refs.

  7. Hybrid radical energy storage device and method of making

    Energy Technology Data Exchange (ETDEWEB)

    Gennett, Thomas; Ginley, David S.; Braunecker, Wade; Ban, Chunmei; Owczarczyk, Zbyslaw

    2016-04-26

    Hybrid radical energy storage devices, such as batteries or electrochemical devices, and methods of use and making are disclosed. Also described herein are electrodes and electrolytes useful in energy storage devices, for example, radical polymer cathode materials and electrolytes for use in organic radical batteries.

  8. Cs3ScCl6

    Directory of Open Access Journals (Sweden)

    Matthew D. Ward

    2014-06-01

    Full Text Available Crystals of tricaesium scandium(III hexachloride were obtained as a side product from the reaction of U, SnCl2, Sc, and S in a CsCl flux at 1073 K. Cs3ScCl6 crystallizes in the Rb3YCl6 structure type. The asymmetric unit comprises three Cs sites, two Sc sites, and six Cl sites, all of which have site symmetry 1, except for the two Sc sites that have site symmetries of 2 and -1, respectively. The structure is composed of isolated [ScCl6]3− octahedra that are surrounded by Cs+ cations. Two Cs+ cations have interactions with eight Cl− anions, while the third has interactions with ten Cl− anions.

  9. Hitos de la perspectiva molar del condicionamiento clásico

    OpenAIRE

    Andrés M. Pérez Acosta; Jairo A. Rozo; Herbert T. Baquero

    2003-01-01

    En este artículo se revisan los acontecimientos históricos fundamentales en la teoría del condicionamiento clásico como fenómeno psicológico comportamental o cognoscitivo, es decir, desde una perspectiva molar, en oposición a una perspectiva molecular, que es propia de las neurociencias. Se analizan los siguientes acontecimientos o hitos: la teoría reflexológica de Vladimir Bechterev, la perspectiva conductista radical de B. F. Skinner, el modelo de Rescorla y Wagner (1972),...

  10. Radical radiotherapy for carcinoma of the vulva

    Energy Technology Data Exchange (ETDEWEB)

    Slevin, N.J.; Pointon, R.C.S.

    1989-02-01

    A study was made of 58 patients with carcinoma of the vulva treated by radical radiotherapy between 1965 and 1982. The choice of treatment technique was influenced by site and extent of disease as well as the general condition of the patient. The crude 5-year survival was 26% (15/58). Local control was achieved in 40% of cases and was associated with tumour size of 4 cm or less. Radionecrosis occurred in nine cases but none of these required surgical intervention. Surgery remains the treatment of choice for carcinoma of the vulva. This report emphasizes that radical radiotherapy has a curative potential in those cases considered unsuitable for surgery and that the necrosis type and rate are within the limits of acceptable morbidity.

  11. Radical radiotherapy for carcinoma of the vulva

    International Nuclear Information System (INIS)

    A study was made of 58 patients with carcinoma of the vulva treated by radical radiotherapy between 1965 and 1982. The choice of treatment technique was influenced by site and extent of disease as well as the general condition of the patient. The crude 5-year survival was 26% (15/58). Local control was achieved in 40% of cases and was associated with tumour size of 4 cm or less. Radionecrosis occurred in nine cases but none of these required surgical intervention. Surgery remains the treatment of choice for carcinoma of the vulva. This report emphasizes that radical radiotherapy has a curative potential in those cases considered unsuitable for surgery and that the necrosis type and rate are within the limits of acceptable morbidity. (author)

  12. Editorial: RADICALISM AND POLITICS OF RELIGION

    Directory of Open Access Journals (Sweden)

    Editorial Al-Jami'ah: Journal of Islamic Studies

    2008-02-01

    Full Text Available Radical Islamism has become the “sexiest” issue in the international scholarship of religion since the September 11 tragedy in 2001. It has been associated with a number of terrorist attacks not only in the West but also in Muslim countries. Every single of radical Islamism has caught the interest of not only scholars and policy makers but also general public. Interestingly, the general assumption that religion is the source of peace has been seriously challenged, not by non-religious communities, but by the violent practices of particular religious groups, however small they are. Indeed, there are certain groups striving for Islam but by using acts which could give awful image on Islam itself and against humanity.

  13. EPR study of free radicals in bread

    Science.gov (United States)

    Yordanov, Nicola D.; Mladenova, Ralitsa

    2004-05-01

    The features of the recorded EPR spectra of paramagnetic species formed in bread and rusk are reported. The appearance of free radicals in them is only connected with their thermal treatment since the starting materials (flour and grains) exhibit very weak EPR signal. The obtained EPR spectra are complex and indicate that: (i) the relative number of paramagnetic species depends on the temperature and treating time of the raw product; (ii) the g-values are strongly temperature dependent with a tendency to coincide at t≥220 °C. Because of the relatively low (150-220 °C) temperature of thermal treatment, the studied free radicals can be assumed to appear in the course of the browning (Maillard) reaction and not to the carbonization of the material.

  14. Anion photoelectron spectroscopy of radicals and clusters

    Energy Technology Data Exchange (ETDEWEB)

    Travis, Taylor R.

    1999-12-16

    Anion photoelectron spectroscopy is used to study free radicals and clusters. The low-lying {sup 2}{Sigma} and {sup 2}{Pi} states of C{sub 2n}H (n = 1--4) have been studied. The anion photoelectron spectra yielded electron affinities, term values, and vibrational frequencies for these combustion and astrophysically relevant species. Photoelectron angular distributions allowed the author to correctly assign the electronic symmetry of the ground and first excited states and to assess the degree of vibronic coupling in C{sub 2}H and C{sub 4}H. Other radicals studied include NCN and I{sub 3}. The author was able to observe the low-lying singlet and triplet states of NCN for the first time. Measurement of the electron affinity of I{sub 3} revealed that it has a bound ground state and attachment of an argon atom to this moiety enabled him to resolve the symmetric stretching progression.

  15. Radiative forcing calculations for CH3Cl

    International Nuclear Information System (INIS)

    Methyl chloride, CH3Cl, is the major natural source of chlorine to the stratosphere. The production of CH3Cl is dominated by biological sources from the oceans and biomass burning. Production has a seasonal cycle which couples with the short lifetime of tropospheric CH3Cl to produce nonuniform global mixing. As an absorber of infrared radiation, CH3Cl is of interest for its potential affect on the tropospheric energy balance as well as for its chemical interactions. In this study, we estimate the radiative forcing and global warming potential (GWP) of CH3Cl. Our calculations use an infrared radiative transfer model based on the correlated k-distribution algorithm for band absorption. Global and annual average vertical profiles of temperature and trace gas concentration were assumed. The effects of clouds are modeled using three layers of global and annual average cloud optical properties. A radiative forcing value of 0.0053 W/m2ppbv was obtained for CH3Cl and is approximately linear in the background abundance. This value is about 2 percent of the forcing of CFC-11 and about 300 times the forcing of CO2, on a per molecule basis. The radiative forcing calculation for CH3Cl is used to estimate the global warming potential (GWP) of CH3Cl. The results give GWPs for CH3Cl of the order of 25 at a time of 20 years(CO2 = 1). This result indicates that CH3Cl has the potential to be a major greenhouse gas if significant human related emissions were introduced into the atmosphere

  16. Radical Scavenging Effects of Different Veronica species

    OpenAIRE

    Ummuhan Şebnem Harput; Yasin Genç; Newaj Khan; İclal Saracoglu

    2011-01-01

    It is well known that the excessive production of reactive oxygen species is hazardous for living organisms and damages major cellular constituents such as DNA, lipid and protein. To find new products reducing free radical damage is very important researches in recent pharmaceutical investigations. Considering this information, fourteen Veronica species are decided to research in the view point of their antioxidant capacity and the chemical content. Water extracts of the plants were tested fo...

  17. Ultraviolet photodissociation dynamics of the cyclohexyl radical

    Science.gov (United States)

    Lucas, Michael; Liu, Yanlin; Zhang, Jingsong

    2015-03-01

    Cycloalkanes are important components in conventional fuels and oil shale derived fuels and the combustion of cyclohexane fuels leads to the production of benzene, a pollutant precursor. One of the pathways from cyclohexane to benzene is through sequential hydrogen loss, including the cyclohexyl radical as an intermediate. The ultraviolet (UV) photodissociation dynamics of the cyclohexyl (c-C6H11) radical was studied for the first time using the high- n Rydberg atom time-of-flight (HRTOF) technique in the range of 232-262 nm. The translational energy distributions of the H-atom loss product channel, P (ET) 's, show a large translational energy release and a large fraction of average translational energy in the total excess energy, , from 232-262 nm. The H-atom product angular distribution is anisotropic with a positive β parameter. The most likely H-atom loss pathway is an axial H ejection from the β-carbon in cyclohexyl to form cyclohexene + H, which along with the positive β parameter, indicates that the transition dipole moment, μ, is perpendicular to the ring. The P (ET) and anisotropy of the H-atom loss product channel are significantly larger than those expected for a statistical unimolecular dissociation of a hot radical, indicating a non-statistical dissociation mechanism. The dissociation mechanism is consistent with direct dissociation on a repulsive excited state surface or on the repulsive part of the ground state surface to produce cyclohexene + H, possibly mediated by a conical intersection. Cyclohexyl is the largest radical so far showing a direct dissociation mechanism.

  18. Computed tomography after radical pancreaticoduodenectomy (Whipple's procedure)

    International Nuclear Information System (INIS)

    Whipple's procedure (radical pancreaticoduodenectomy) is currently the only curative option for patients with periampullary malignancy. The surgery is highly complex and involves multiple anastomoses. Complications are common and can lead to significant postoperative morbidity. Early detection and treatment of complications is vital, and high-quality multidetector computed tomography (MDCT) is currently the best method of investigation. This review outlines the surgical technique and illustrates the range of normal postoperative appearances together with the common complications

  19. EI igualitarismo radical de John Rawls

    OpenAIRE

    Rodríguez Zepeda, Jesús

    2004-01-01

    The main purpose of this paper is to offer an interpretation of the canonical statement of justice as fairness (A Theory of Justice) as a deeply egalitarian, even radical, argument. In order to do so, the categories of justice as fairness strongly related to the egalitarian and distributive meaning of the rawlsian liberal model and, specifically, those aimed to solve the problem of social justice, are accurately revised, namely, the fair equality of opportunity and the diff...

  20. The radical of a vertex operator algebra

    OpenAIRE

    Dong, C.; Li, H.; Mason, G.; Montague, P

    1996-01-01

    The radical $J(V)$ of a vertex operator algebra $V$ is defined to be the subspace of $V$ consisting of vectors $v$ such that the zero mode $o(v)=0$ on $V$ where $o(v)=v_{wt v-1}$ if $v$ is homogeneous. We establish various facts about $o(v),$ including the determination of $J(V)$ which is shown to be essentially equal to $(L(0)+L(-1))V.$

  1. AQUEOUS STABLE FREE RADICAL POLYMERIZATION PROCESSES

    Institute of Scientific and Technical Information of China (English)

    Andrea R. Szkurhan; Michael K. Georges

    2004-01-01

    An overview of aqueous polymerizations, which include emulsion, miniemulsion and suspension polymerizations,under stable free radical polymerization (SFRP) conditions is presented. The success of miniemulsion and suspension SFRP polymerizations is contrasted with the difficulties associated with obtaining a stable emulsion polymerization. A recently developed unique microprecipitation technique is referenced as a means of making submicron sized particles that can be used to achieve a stable emulsion SFRP process.

  2. EARLY POSTOPERATIVE COMPLICATIONS AFTER RADICAL CYSTECTOMY

    Directory of Open Access Journals (Sweden)

    V. O. Mager

    2014-08-01

    Full Text Available Radical cystectomy (RCE is associated with a considerable number of early postoperative complications as before. Based on 10 years’ experience, this paper demonstrates the frequency (33.9 % and types of early complications following RCE, as well as postoperative mortality (5.5 % and its resulting causes. Although postoperative mortality is relatively low today, the frequency of early postoperative complications remains high as before.

  3. International Radical Cystectomy Consortium: A way forward

    OpenAIRE

    Raza, Syed Johar; Field, Erinn; Kibel, Adam S.; Mottrie, Alex; Weizer, Alon Z; Wagner, Andrew; Hemal, Ashok K.; Scherr, Douglas S.; Schanne, Francis; Gaboardi, Franco; Wu, Guan; Peabody, James O.; Koauk, Jihad; Redorta, Joan Palou; Pattaras, John G.

    2014-01-01

    Robot-assisted radical cystectomy (RARC) is an emerging operative alternative to open surgery for the management of invasive bladder cancer. Studies from single institutions provide limited data due to the small number of patients. In order to better understand the related outcomes, a world-wide consortium was established in 2006 of patients undergoing RARC, called the International Robotic Cystectomy Consortium (IRCC). Thus far, the IRCC has reported its findings on various areas of operativ...

  4. Learning Curve of Robotic Radical Prostatectomy

    OpenAIRE

    Muhammed Ersagun Arslan; Abdullah Erdem Canda; Ali Fuat Atmaca; Mevlana Derya Balbay; Ziya Akbulut; Serkan Altinova; Ahmet Tunc Ozdemir

    2015-01-01

    Introduction: Prostate cancer (PrC) is the fifth most common malignancy worldwide and the second most common malignancy in men. Currently, robotic-assisted laparoscopic radical prostatectomy (RARP) has become a popular treatment for localised PrC treatment worldwide. We aimed to assess the learning curve of RARP in our institution. Methods: A total of 391 patients who underwent RARP in our clinic between February 2009 and April 2013 were included in the study. We retrospectively evaluated ...

  5. 36Cl deposition rate reconstruction from bomb pulse until present: A study based on groundwater records

    International Nuclear Information System (INIS)

    classically attributed to biological and atmospherical recycling processes or underestimation of the natural atmospheric production of the 36Cl. Additional source of 36Cl production has been envisaged through the activation of chlorine radicals from stratospherical CFCs, leading to a 36Cl production rate comparable with that of Ar spallation from the first approximation. Lastly, the latitudinal factor of the attenuation of the fallout rate is discussed and the impact of the jet streams is proposed as an explanation for the discrepancies in the attenuation rate

  6. Chemical Nonlinearities and Radical Pair Lifetime Estimation

    Science.gov (United States)

    Robinson, Gregory

    2013-03-01

    Much attention has recently developed around chemical reactions that depend on applied static magnetic fields as weak as earth's. This interest is largely motivated by experiments that implicate the role of spin-selective radical pair recombination in biological magnetic sensing. Existing literature uses a straightforward calculation to approximate the expected lifetime of coherent radical pairs as a function of the minimum RF amplitude that is observed to disrupt magnetic navigation, apparently by decohering the radical pair via electronic Zeeman excitations. But we show that chemical nonlinearities can preclude direct computation of coherent pair lifetime without considering the cellular signalling mechanisms involved, and discuss whether it can explain the surprising fragility of some animals' compass sense. In particular, we demonstrate that an autocatalytic cycle can introduce threshold effects on the disruption sensitivity to applied oscillatory magnetic fields. We will show examples in the mean-field limit and consider the consequences of noise and fluctuations in the Freidlin-Wentzell picture of perturbed dynamical systems.

  7. Complications of Radical Cystectomy and Orthotopic Reconstruction

    Directory of Open Access Journals (Sweden)

    Wei Shen Tan

    2015-01-01

    Full Text Available Radical cystectomy and orthotopic reconstruction significant morbidity and mortality despite advances in minimal invasive and robotic technology. In this review, we will discuss early and late complications, as well as describe efforts to minimize morbidity and mortality, with a focus on ileal orthotopic bladder substitute (OBS. We summarise efforts to minimize morbidity and mortality including enhanced recovery as well as early and late complications seen after radical cystectomy and OBS. Centralisation of complex cancer services in the UK has led to a fall in mortality and high volume institutions have a significantly lower rate of 30-day mortality compared to low volume institutions. Enhanced recovery pathways have resulted in shorter length of hospital stay and potentially a reduction in morbidity. Early complications of radical cystectomy occur as a direct result of the surgery itself while late complications, which can occur even after 10 years after surgery, are due to urinary diversion. OBS represents the ideal urinary diversion for patients without contraindications. However, all patients with OBS should have regular long term follow-up for oncological surveillance and to identify complications should they arise.

  8. Radical correction of Budd-Chiari syndrome

    Institute of Scientific and Technical Information of China (English)

    LI Xiao-qiang; WANG Zhong-gao; MENG Qing-you; SANG Hong-fei; QIAN Ai-min; DUAN Peng-fei; RONG Jian-jie

    2007-01-01

    Background Interventional therapy is widely accepted as the first choice for the treatment of the Budd-Chiari syndrome,but the use of radical correctional therapy should not be discarded. This study describes radical correction by controlling bleeding from distal end of pathological segment of the inferior vena cava (IVC) and discusses potential surgical errors and postoperative complications.Methods Of the 216 patients in the study, 78 were treated with simple membranectomy, 64 with dissection of the pathological segment of the IVC and vascular prosthesis or pericardial patch plasty, 60 with resection of the pathological segment of the IVC and orthotopic graft transplantation with vascular prosthesis, and 14 with resection of the occlusive main hepatic vein and its upper IVC, hepatic venous outflow plasty and vascular prosthesis orthotopic graft transplantation from the hepatic venous entrance to the IVC of right atrial ostium.Results Except 14 cases who were discharged after hepatic vein outflow plasty, four cases died postoperatively, and 198 patients were discharged without complications. The symptoms of 15 patients were relieved partially and 2 without any change. There were no deaths intraoperatively. Of the 112 cases who were followed up for 72 months, 13 suffered from a relapse.Conclusions Radical correction is a beneficial therapy in the treatment of Budd-Chiari syndrome.

  9. Radical inactivation of a biological sulphydryl molecule

    International Nuclear Information System (INIS)

    Reactive species produced from the free radical-induced chain oxidation of low molecular weight sulphydryl-containing molecules in aerated solutions deactivate the sulphydryl-containing enzyme papain, forming both reparable mixed disulphides and non-reparable products. This inactivation is highly efficient for penicillamine and glutathione, but almost negligible with cysteine, which is a protector of papain for [cysteine] / [papain] >= 5 under all conditions used. In the case of glutathione, superoxide dismutase caused only a small reduction in the inactivation and peroxide yields were small, implying that the deactivating species are not .O2- but RSOO. radicals or products from them. For penicillamine, however, dimutase was highly effective and the peroxide yields were relatively large, demonstrating that .O2- or a radical with similar capabilities for forming H2O2 and being deactivated by dismutase was involved. Although in the presence of dismutase penicillamine is a better protector of non-reparable papain inactivation than glutathione, it suffers from a deficiency in that the papain-penicillamine mixed disulphide, which is always formed, cannot be repaired by spontaneous reaction with RSH molecules. (author)

  10. The detection of hydroxyl radicals in vivo.

    Science.gov (United States)

    Freinbichler, Wolfhardt; Bianchi, Loria; Colivicchi, M Alessandra; Ballini, Chiara; Tipton, Keith F; Linert, Wolfgang; Corte, Laura Della

    2008-01-01

    Several indirect methods have been developed for the detection and quantification of highly reactive oxygen species (hROS), which may exist either as free hydroxyl radicals, bound "crypto" radicals or Fe(IV)-oxo species, in vivo. This review discusses the strengths and weaknesses associated with those most commonly used, which determine the hydroxylation of salicylate or phenylalanine. Chemical as well as biological arguments indicate that neither the hydroxylation of salicylate nor that of phenylalanine can guarantee an accurate hydroxyl radical quantitation in vivo. This is because not all hydroxylated product-species can be used for detection and the ratio of these species strongly depends on the chemical environment and on the reaction time. Furthermore, at least in the case of salicylate, the high concentrations of the chemical trap required (mM) are known to influence biological processes associated with oxidative stress. Two, newer, alternative methods described, the 4-hydroxy benzoic acid (4-HBA) and the terephthalate (TA) assays, do not have these drawbacks. In each case reaction with hROS leads to only one hydroxylated product. Thus, from a chemical viewpoint, they should provide a better hROS quantitation. Further work is needed to assess any possible biological effects of the required millimolar (4-HBA) and micromolar (TA) concentrations of the chemical traps. PMID:18262275

  11. Roles of external and cellular Cl- ions on the activation of an apical electrodiffusional Cl- pathway in toad skin.

    Science.gov (United States)

    Procopio, J; Lacaz-Vieira, F

    1990-07-01

    This study is concerned with the short-circuit current, Isc, responses of the Cl(-)-transporting cells of toad skin submitted to sudden changes of the external Cl- concentration, [Cl]o. Sudden changes of [Cl]o, carried out under apical membrane depolarization, allowed comparison of the roles of [Cl]o and [Cl]cell on the activation of the apical Cl- pathways. Equilibration of short-circuited skins symmetrically in K-Ringer's solutions of different Cl- concentrations permitted adjustment of [Cl]cell to different levels. For a given Cl- concentration (in the range of 11.7 to 117 mM) on both sides of a depolarized apical membrane, this structure exhibits a high Cl- permeability, P(Cl)apical. On the other hand, for the same range of [Cl]cell but with [Cl]o = 0, P(Cl)apical is reduced to negligible values. These observations indicate that when the apical membrane is depolarized P(Cl)apical is modulated by [Cl]o; in the absence of external Cl- ions, intracellular Cl- is not sufficient to activate P(Cl)apical. Computer simulation shows that the fast Cl- currents induced across the apical membrane by sudden shifts of [Cl]o from a control equilibrium value strictly follow the laws of electrodiffusion. For each experimental group, the computer-generated Isc versus [( Cl]cell - [Cl]o) curve which best fits the experimental data can only be obtained by a unique pair of P(Cl)apical and Rb (resistance of the basolateral membrane), thus allowing the calculation of these parameters. The electrodiffusional behavior of the net Cl- flux across the apical membrane supports the channel nature of the apical Cl- pathways in the Cl(-)-transporting cells. Cl- ions contribute significantly to the overall conductance of the basolateral membrane even in the presence of a high K concentration in the internal solution. PMID:1698229

  12. Comparative study of GaN mesa etch characteristics in Cl2 based inductively coupled plasma with Ar and BCl3 as additive gases

    International Nuclear Information System (INIS)

    GaN thin film etching is investigated and compared for mesa formation in inductively coupled plasma (ICP) of Cl2 with Ar and BCl3 gas additives using photoresist mask. Etch characteristics are studied as a function of ICP process parameters, viz., ICP power, radio frequency (RF) power, and chamber pressure at fixed total flow rate. The etch rate at each ICP/RF power is 0.1–0.2 μm/min higher for Cl2/Ar mixture mainly due to higher Cl dissociation efficiency of Ar additive that readily provides Cl ion/radical for reaction in comparison to Cl2/BCl3 mixture. Cl2/Ar mixture also leads to better photoresist mask selectivity. The etch-induced roughness is investigated using atomic force microscopy. Cl2/Ar etching has resulted in lower root-mean-square roughness of GaN etched surface in comparison to Cl2/BCl3 etching due to increased Ar ion energy and flux with ICP/RF power that enhances the sputter removal of etch product. The GaN surface damage after etching is also evaluated using room temperature photoluminescence and found to be increasing with ICP/RF power for both the etch chemistries with higher degree of damage in Cl2/BCl3 etching under same condition

  13. Formation of long-lived radicals on proteins by radical transfer from heme enzymes--a common process?

    DEFF Research Database (Denmark)

    Ostdal, H; Andersen, H J; Davies, Michael Jonathan

    1999-01-01

    albumin via the heme edge of the peroxidase. In contrast, albumin radical formation by the HRP/H2O2/free tyrosine system was only marginally affected by proteolysis, consistent with free tyrosine phenoxyl radicals being the mediators of radical transfer, without significant protein-protein interaction...

  14. Generation of acetyl free radicals by radiolysis: comparison of free radicals generated from acetaldehyde and ethylene-glycol

    International Nuclear Information System (INIS)

    The optical absorption spectra of the intermediates obtained by pulse radiolysis of N2O-saturated solutions of acetaldehyde or ethylene-glycol and the kinetics of their decays have been investigated. Results suggest that the OH· radical reactions with acetaldehyde or ethylene-glycol produce acetyl and formylmethyl radicals. Besides, these radicals are shown to reduce ferricytochrome c

  15. Spatial features of radical reactions in irradiated solids

    International Nuclear Information System (INIS)

    The Electron Spin Echo (ESE) method is used to obtain data on the spatial distribution of radical particles originated in irradiated solid matrices from two types of precursors: ionized molecules (R+-type radicals), and secondary electrons (R--type radicals). For methanol with Cd+2 acceptors and for water solutions of acids and alkalis the radical tracks are shown to have a complex structure. Possible reasons for long path lengths of secondary electrons in polar media are analyzed. Pair distribution functions, as well as their changes due to diffusion and chemical reactions, are reported for radicals generated by photolysis and radiolysis. (author)

  16. Progress in measurement of free radicals in biological systems

    International Nuclear Information System (INIS)

    Free radicals generation and oxidative stress are involved in many pathological processes including neuro-degenerated diseases, diabetes, tumorigenesis and radiation damage. Measurement of free radicals is of importance in the field of radiation protection and radiation damage. The electron spinning resonance (ESR) techniques for measurement of free radicals in biological systems are summarized according to the literature and the author's research work in this review. The recent emerging immuno-spin trapping method for analysis of protein radicals and DNA radicals is also introduced. (authors)

  17. A novel LiCl-BaCl2:Eu2+ eutectic scintillator for thermal neutron detection

    Science.gov (United States)

    Wu, Yuntao; Lukosi, Eric D.; Zhuravleva, Mariya; Lindsey, Adam C.; Melcher, Charles L.

    2015-10-01

    A natLiCl-BaCl2:Eu2+ eutectic scintillator was synthesized by the vertical Bridgman method aiming at the application of thermal neutron detection. The molar ratio of LiCl and BaCl2 was 75.1/24.9, which corresponds to the eutectic composition in the LiCl-BaCl2 system. The grown eutectic showed a periodic microstructure of BaCl2:Eu2+ and LiCl phases with 2-3 μm thickness. The α-particle induced radioluminescence spectrum of the scintillator showed an intense emission peak at 406 nm due to the Eu2+ 5d1→4f emission from the BaCl2:Eu2+ phase and an additional weak emission peak at 526 nm. The scintillation decay time was 412 ns. LiCl-BaCl2:Eu2+ eutectic samples exhibited non-correlated neutron detection efficiency and light yield as a function of crystal length, suggesting material non-uniformities within the boule. The relative light yield was equal to or greater than that of Nucsafe lithium glass. Gamma-ray exposures indicate that gamma/neutron threshold discrimination for higher energy gamma-rays will be limited.

  18. Unbound states of 32Cl and the 31S(p,gamma)32Cl reaction rate

    International Nuclear Information System (INIS)

    The 31S(p,γ)32Cl reaction is expected to provide the dominant break-out path from the SiP cycle in novae and is important for understanding enrichments of sulfur observed in some nova ejecta. We studied the 32S(3He,t)32Cl charge-exchange reaction to determine properties of proton-unbound levels in 32Cl that have previously contributed significant uncertainties to the 31S(p,γ)32Cl reaction rate. Measured triton magnetic rigidities were used to determine excitation energies in 32Cl. Proton-branching ratios were obtained by detecting decay protons from unbound 32Cl states in coincidence with tritons. An improved 31S(p,γ)32Cl reaction rate was calculated including robust statistical and systematic uncertainties.

  19. Unbound states of 32Cl and the 31S(p,\\gamma)32Cl reaction rate

    CERN Document Server

    Matoš, M; Linhardt, L E; Bardayan, D W; Nesaraja, C D; Clark, J A; Deibel, C M; O'Malley, P D; Parker, P D

    2011-01-01

    The 31S(p,\\gamma)32Cl reaction is expected to provide the dominant break-out path from the SiP cycle in novae and is important for understanding enrichments of sulfur observed in some nova ejecta. We studied the 32S(3He,t)32Cl charge-exchange reaction to determine properties of proton-unbound levels in 32Cl that have previously contributed significant uncertainties to the 31S(p,\\gamma)32Cl reaction rate. Measured triton magnetic rigidities were used to determine excitation energies in 32Cl. Proton-branching ratios were obtained by detecting decay protons from unbound 32Cl states in coincidence with tritons. An improved 31S(p,\\gamma)32Cl reaction rate was calculated including robust statistical and systematic uncertainties.

  20. Peroxy radical chemistry and OH radical production during the NO3-initiated oxidation of isoprene

    Directory of Open Access Journals (Sweden)

    P. O. Wennberg

    2012-01-01

    Full Text Available Peroxy radical reactions (RO2 + RO2 from the NO3-initiated oxidation of isoprene are studied with both gas chromatography and a chemical ionization mass spectrometry technique that allows for more specific speciation of products than in previous studies of this system. We find high nitrate yields (>~80%, consistent with other studies. We further see evidence of significant hydroxyl radical (OH formation in this system, which we propose comes from RO2 + HO2 reactions with a yield of ~42–62%. An additional OH source is the second generation oxidation of the nitrooxyhydroperoxide, which produces OH and a dinitrooxyepoxide with a yield of ~35%. The branching ratio of the radical propagating, carbonyl- and alcohol-forming, and dimer-forming channels of the RO2 + RO2 reaction are found to be ~18–38%, ~59–77%, and ~3–4%, respectively. HO2 formation in this system is lower than has been previously assumed. Addition of RO2 to isoprene is suggested as a possible route to the formation of several isoprene dimer compounds (ROOR. The nitrooxy, allylic, and C5 peroxy radicals present in this system exhibit different behavior than the limited suite of peroxy radicals that have been studied to date.

  1. Reactivity of chlorine radical with submicron palmitic acid particles: kinetic measurements and products identification

    Directory of Open Access Journals (Sweden)

    M. Mendez

    2013-06-01

    Full Text Available The heterogeneous reaction of Cl. radicals with sub-micron palmitic acid (PA particles was studied in an aerosol flow tube in the presence or in the absence of O2. Fine particles were generated by homogeneous condensation of PA vapors and introduced in the reactor where chlorine atoms are produced by photolysis of Cl2 using UV lamps surrounding the reactor. The effective reactive uptake coefficient (γ has been determined from the rate loss of PA measured by GC/MS analysis of reacted particles as a function of the chlorine exposure. In the absence of O2, γ = 14 ± 5 indicates efficient secondary chemistry involving Cl2. GC/MS analyses have shown the formation of monochlorinated and polychlorinated compounds in the oxidized particles. Although, the PA particles are solid, the complete mass can be consumed. In the presence of oxygen, the reaction is still dominated by secondary chemistry but the propagation chain length is smaller than in the absence of O2 which leads to an uptake coefficient γ = 3 ± 1. In the particulate phase, oxocarboxylic acids and dicarboxylic acids are identified by GC/MS. Formation of alcohols and monocarboxylic acids are also suspected. All these results show that solid organic particles could be efficiently oxidized by gas-phase radicals not only on their surface, but also in bulk by mechanisms which are still unclear. Furthermore the identified reaction products are explained by a chemical mechanism showing the pathway of the formation of more functionalized products. They help to understand the aging of primary tropospheric aerosol containing fatty acids.

  2. Double photodetachment from the Cl- ion

    International Nuclear Information System (INIS)

    The correlated process involving the photodetachment of two electrons from the Cl- ion has been investigated over the photon energy range 20-45 eV. In the experiment, a beam of photons from the Advanced Light Source (ALS) was collinearly merged with a counterpropagating beam of Cl- ions from a sputter ion source. The Cl+ ions produced in the interaction region were detected, and the normalized signal was used to monitor the relative cross section for the reaction. An absolute scale for the cross section was established by measuring the spatial overlap of the two beams and by determining the efficiency for collection and detection of the Cl+ ions. The overall magnitude and shape of the measured cross section for this process agrees well with an R-matrix calculation. The calculation identifies the dominant mechanism leading to the production of the Cl+ ion as being a direct nonresonant process involving the ejection of a pair of electrons from the valence shell. Less important is the indirect nonresonant process that involves the production and decay of core-excited and doubly excited states of the Cl atom in an intermediate step. Direct and indirect resonant mechanisms involving the excitation of a single 3s core electron or more than one valence electron of the Cl- ion were found to be insignificant in the energy range studied

  3. Inactivation efficiencies of radical reactions with biologically active DNA

    Science.gov (United States)

    Lafleur, M. V. M.; Retèl, J.; Loman, H.

    Dilute aqueous solutions of biologically active θX174 DNA may serve as a simplified model system of the cell. Damage to the DNA after irradiation with γ-rays, may be ascribed to reactions with .OH, .H and e -aq or secondary radicals, arising from reactions of water radicals with added scavengers. Conversion of primary (water) radicals into secondary (scavenger) radicals leads to a considerable protection of the DNA, which, however, would have been larger if these secondary radicals did not contribute to DNA inactivation. The inactivation yield due to isopropanol or formate (secondary) radicals depends on dose rate as well as DNA concentration. Furthermore the inactivation efficiencies of the reactions of both the primary and the secondary radicals with single-stranded DNA could be established.

  4. OpenCL parallel programming development cookbook

    CERN Document Server

    Tay, Raymond

    2013-01-01

    OpenCL Parallel Programming Development Cookbook will provide a set of advanced recipes that can be utilized to optimize existing code. This book is therefore ideal for experienced developers with a working knowledge of C/C++ and OpenCL.This book is intended for software developers who have often wondered what to do with that newly bought CPU or GPU they bought other than using it for playing computer games; this book is also for developers who have a working knowledge of C/C++ and who want to learn how to write parallel programs in OpenCL so that life isn't too boring.

  5. Radical intermediates involved in the bleaching of the carotenoid crocin. Hydroxyl radicals, superoxide anions and hydrated electrons

    Energy Technology Data Exchange (ETDEWEB)

    Bors, W.; Saran, M.; Michel, C. (Gesellschaft fuer Strahlen- und Umweltforschung m.b.H. Muenchen, Neuherberg (Germany, F.R.). Abt. Strahlenbiologie)

    1982-05-01

    The participation of the primary radicals in the bleaching of aqueous solutions of the carotenoid crocin by ionizing radiation was investigated, employing both X-radiolysis and pulse radiolysis. The pulse-radiolytic data demonstrated a very rapid diffusion-controlled attack by both hydroxyl radicals (radicalsOH) and hydrated electrons (e/sup -/sub(aq)), while superoxide anions (O/sub 2//sup -/) did not react at all. The site of the initial reaction of these radicals was not limited to the polyene chromophore. Slower secondary reactions involving crocin alkyl or peroxy radicals contribute mainly to the overall bleaching, in particular during steady-state irradiation.

  6. Radical intermediates involved in the bleaching of the carotenoid crocin. Hydroxyl radicals, superoxide anions and hydrated electrons

    International Nuclear Information System (INIS)

    The participation of the primary radicals in the bleaching of aqueous solutions of the carotenoid crocin by ionizing radiation was investigated, employing both X-radiolysis and pulse radiolysis. The pulse-radiolytic data demonstrated a very rapid diffusion-controlled attack by both hydroxyl radicals (radicalsOH) and hydrated electrons (e-sub(aq)), while superoxide anions (O2-) did not react at all. The site of the initial reaction of these radicals was not limited to the polyene chromophore. Slower secondary reactions involving crocin alkyl or peroxy radicals contribute mainly to the overall bleaching, in particular during steady-state irradiation. (author)

  7. Search for potential minimum positions in metal-organic hybrids, (C2H5NH3)2CuCl4 and (C6H5CH2CH2NH3)2CuCl4, by using density functional theory

    International Nuclear Information System (INIS)

    The ab-initio density functional theory analysis was applied to metal-organic hybrids, (C2H5NH3)2CuCl4 (EA) and (C6H5CH2CH2NH3)2CuCl4 (PEA), in order to estimate possible muons stopping positions. Six potential minimum positions and eight ones were revealed in PA and PEA, respectively. Those potential minimum positions can be regarded as initial stopping positions of injected muons. All of expected potential minimum points in EA were near and around the apical Cl and the CuCl2 plane of the CuCl6 octahedra. Instead, in the case of PEA, two of eight positions were close to the phenyl ring giving a possibility that there would be muon states which couple surrounding electrons via a radical formation

  8. A tese da "nova clivagem" e a base social do apoio à direita radical

    Directory of Open Access Journals (Sweden)

    Pippa Norris

    2005-03-01

    Full Text Available A ascensão da direita radical está aberta a múltiplas interpretações. A questão abordada neste artigo é saber se muitos desses partidos criaram uma base social duradoura entre os eleitores e, se assim for, quais setores sociais apresentam maior probabilidade de apoiá-los. A primeira parte discute os marcos teóricos alternativos oferecidos pelos trabalhos clássicos dos anos 1950 e 1960, a tese da "nova clivagem social" comum durante a última década e a teoria do desalinhamento partidário. Em seguida, o artigo analisa hipóteses concorrentes sobre a base social do voto na direita radical em quinze países, usando dados retirados do Survey Social Europeu de 2002 e do Estudo Comparativo de Sistemas Eleitorais, 1996-2001. A segunda parte trata do papel de indicadores socioeconômicos, enquanto a terceira parte examina a duradoura diferença entre os sexos e os padrões geracionais de apoio. A conclusão considera as implicações desses resultados para compreender a base da popularidade da direita radical e para a estabilidade e longevidade desses partidos.The rise of the radical right is open to multiple interpretations. The question addressed in this paper is whether many of these parties have fostered an enduring social base among core voters and, if so, which social sectors are most likely to support them. The first part discusses the alternative theoretical frameworks provided by the classic accounts of the 1950s and 1960s, the "new social cleavage" thesis common during the last decade, and the theory of partisan dealignment. Then, it compares evidence to analyze rival hypotheses about the social basis of the radical right vote across fifteen nations, using data drawn from the European Social Survey, 2002, and the Comparative Study of Electoral Systems, 1996-2001. The second part focuses upon the role of socioeconomic indicators, while the third part considers the enduring gender gap and patterns of generational support. The

  9. Picosecond Control of Photogenerated Radical Pair Lifetimes Using a Stable Third Radical.

    Science.gov (United States)

    Horwitz, Noah E; Phelan, Brian T; Nelson, Jordan N; Krzyaniak, Matthew D; Wasielewski, Michael R

    2016-05-12

    Photoinduced electron transfer reactions in organic donor-acceptor systems leading to long-lived radical ion pairs (RPs) have attracted broad interest for their potential applications in fields as diverse as solar energy conversion and spintronics. We present the photophysics and spin dynamics of an electron donor - electron acceptor - stable radical system consisting of a meta-phenylenediamine (mPD) donor covalently linked to a 4-aminonaphthalene-1,8-dicarboximide (ANI) electron-accepting chromophore as well as an α,γ-bisdiphenylene-β-phenylallyl (BDPA) stable radical. Selective photoexcitation of ANI produces the BDPA-mPD(+•)-ANI(-•) triradical in which the mPD(+•)-ANI(-•) RP spins are strongly exchange coupled. The presence of BDPA is found to greatly increase the RP intersystem crossing rate from the initially photogenerated BDPA-(1)(mPD(+•)-ANI(-•)) to BDPA-(3)(mPD(+•)-ANI(-•)), resulting in accelerated RP recombination via the triplet channel to produce BDPA-mPD-(3*)ANI as compared to a reference molecule lacking the BDPA radical. The RP recombination rates observed are much faster than those previously reported for weakly coupled triradical systems. Time-resolved EPR spectroscopy shows that this process is also associated with strong spin polarization of the stable radical. Overall, these results show that RP intersystem crossing rates can be strongly influenced by stable radicals nearby strongly coupled RP systems, making it possible to use a third spin to control RP lifetimes down to a picosecond time scale. PMID:27108738

  10. Radical hysterectomy with adjuvant radiotherapy versus radical radiotherapy for FIGO stage IIB cervical cancer

    International Nuclear Information System (INIS)

    The goal of this study was to compare treatment outcomes for Federation of Gynecology and Obstetrics (FIGO) stage IIB cervical carcinoma patients receiving radical surgery followed by adjuvant postoperative radiotherapy versus radical radiotherapy. Medical records of FIGO stage IIB cervical cancer patients treated between July 2008 and December 2011 were retrospectively reviewed. A total of 148 patients underwent radical hysterectomy with pelvic lymph node dissection followed by adjuvant radiotherapy (surgery-based group). These patients were compared with 290 patients that received radical radiotherapy alone (RT-based group). Recurrence rates, progression-free survival (PFS), overall survival (OS), local control rates, and treatment-related complications were compared for these two groups. Similar rates of recurrence (16.89% vs. 12.41%, p = 0.200), PFS (log-rank, p = 0.211), OS (log-rank, p = 0.347), and local control rates (log-rank, p = 0.668) were observed for the surgery-based group and the RT-based group, respectively. Moreover, the incidence of acute grade 3–4 gastrointestinal reactions and late grade 3–4 lower limb lymphedema were significantly higher for the surgery-based group versus the RT-based group. Cox multivariate analyses found no significant difference in survival outcome between the two groups, and tumor diameter and histopathology were identified as significant prognostic factors for OS. Radical radiotherapy was associated with fewer treatment-related complications and achieved comparable survival outcomes for patients with FIGO stage IIB cervical cancer compared to radical hysterectomy followed by postoperative radiotherapy

  11. Investigation of the O+allyl addition/elimination reaction pathways from the OCH(2)CHCH(2) radical intermediate.

    Science.gov (United States)

    Fitzpatrick, Benjamin L; Lau, Kai-Chung; Butler, Laurie J; Lee, Shih-Huang; Lin, Jim Jr-Min

    2008-08-28

    These experiments study the preparation of and product channels resulting from OCH(2)CHCH(2), a key radical intermediate in the O+allyl bimolecular reaction. The data include velocity map imaging and molecular beam scattering results to probe the photolytic generation of the radical intermediate and the subsequent pathways by which the radicals access the energetically allowed product channels of the bimolecular reaction. The photodissociation of epichlorohydrin at 193.3 nm produces chlorine atoms and c-OCH(2)CHCH(2) radicals; these undergo a facile ring opening to the OCH(2)CHCH(2) radical intermediate. State-selective resonance-enhanced multiphoton ionization (REMPI) detection resolves the velocity distributions of ground and spin-orbit excited state chlorine independently, allowing for a more accurate determination of the internal energy distribution of the nascent radicals. We obtain good agreement detecting the velocity distributions of the Cl atoms with REMPI, vacuum ultraviolet (VUV) photoionization at 13.8 eV, and electron bombardment ionization; all show a bimodal distribution of recoil kinetic energies. The dominant high recoil kinetic energy feature peaks near 33 kcalmol. To elucidate the product channels resulting from the OCH(2)CHCH(2) radical intermediate, the crossed laser-molecular beam experiment uses VUV photoionization and detects the velocity distribution of the possible products. The data identify the three dominant product channels as C(3)H(4)O (acrolein)+H, C(2)H(4)+HCO (formyl radical), and H(2)CO (formaldehyde)+C(2)H(3). A small signal from C(2)H(2)O (ketene) product is also detected. The measured velocity distributions and relative signal intensities at me=27, 28, and 29 at two photoionization energies show that the most exothermic product channel, C(2)H(5)+CO, does not contribute significantly to the product branching. The higher internal energy onset of the acrolein+H product channel is consistent with the relative barriers en route to

  12. Investigation of the O+allyl addition/elimination reaction pathways from the OCH2CHCH2 radical intermediate

    International Nuclear Information System (INIS)

    These experiments study the preparation of and product channels resulting from OCH2CHCH2, a key radical intermediate in the O+allyl bimolecular reaction. The data include velocity map imaging and molecular beam scattering results to probe the photolytic generation of the radical intermediate and the subsequent pathways by which the radicals access the energetically allowed product channels of the bimolecular reaction. The photodissociation of epichlorohydrin at 193.3 nm produces chlorine atoms and c-OCH2CHCH2 radicals; these undergo a facile ring opening to the OCH2CHCH2 radical intermediate. State-selective resonance-enhanced multiphoton ionization (REMPI) detection resolves the velocity distributions of ground and spin-orbit excited state chlorine independently, allowing for a more accurate determination of the internal energy distribution of the nascent radicals. We obtain good agreement detecting the velocity distributions of the Cl atoms with REMPI, vacuum ultraviolet (VUV) photoionization at 13.8 eV, and electron bombardment ionization; all show a bimodal distribution of recoil kinetic energies. The dominant high recoil kinetic energy feature peaks near 33 kcal/mol. To elucidate the product channels resulting from the OCH2CHCH2 radical intermediate, the crossed laser-molecular beam experiment uses VUV photoionization and detects the velocity distribution of the possible products. The data identify the three dominant product channels as C3H4O (acrolein)+H, C2H4+HCO (formyl radical), and H2CO (formaldehyde)+C2H3. A small signal from C2H2O (ketene) product is also detected. The measured velocity distributions and relative signal intensities at m/e=27, 28, and 29 at two photoionization energies show that the most exothermic product channel, C2H5+CO, does not contribute significantly to the product branching. The higher internal energy onset of the acrolein+H product channel is consistent with the relative barriers en route to each of these product channels

  13. Spectroscopy of free-base N-confused tetraphenylporphyrin radical anion and radical cation.

    Science.gov (United States)

    Alemán, Elvin A; Manríquez Rocha, Juan; Wongwitwichote, Wongwit; Godínez Mora-Tovar, Luis Arturo; Modarelli, David A

    2011-06-23

    The radical anions and radical cations of the two tautomers (1e and 1i) of 5,10,15,20-tetraphenyl N-confused free-base porphyrin have been studied using a combination of cyclic voltammetry, steady state absorption spectroscopy, and computational chemistry. N-Confused porphyrins (NCPs), alternatively called 2-aza-21-carba-5,10,15,20-tetraphenylporphyrins or inverted porphyrins, are of great interest for their potential as building blocks in assemblies designed for artificial photosynthesis, and understanding the absorption spectra of the corresponding radical ions is paramount to future studies in multicomponent arrays where electron-transfer reactions are involved. NCP 1e was shown to oxidize at a potential of E(ox) 0.65 V vs Fc(+)|Fc in DMF and reduce at E(red) -1.42 V, while the corresponding values for 1i in toluene were E(ox) 0.60 V and E(red) -1.64 V. The geometries of these radical ions were computed at the B3LYP/6-31+G(d)//B3LYP/6-31G(d) level in the gas phase and in solution using the polarizable continuum model (PCM). From these structures and that of H(2)TPP and its corresponding radical ions, the computed redox potentials for 1e and 1i were calculated using the Born-Haber cycle. While the computed reduction potentials and electron affinities were in excellent agreement with the experimental reduction potentials, the calculated oxidation potentials displayed a somewhat less ideal relationship with experiment. The absorption spectra of the four radical ions were also measured experimentally, with radical cations 1e(•+) and 1i(•+) displaying significant changes in the Soret and Q-band regions as well as new low energy absorption bands in the near-IR region. The changes in the absorption spectra of radical anions 1e(•-) and 1i(•-) were not as dramatic, with the changes occurring only in the Soret and Q-band regions. These results were favorably modeled using time-dependent density functional calculations at the TD-B3LYP/6-31+G(d)//B3LYP/6-31G

  14. Uma análise behaviorista radical dos sonhos A radical behaviorist analysis of the dreams

    OpenAIRE

    Francynete Melo e Silva

    2000-01-01

    Embora não haja um consenso acerca de questões sobre o que são os sonhos, porque sonhamos, etc., a maioria dos estudos sobre a natureza dos sonhos concorda que ela está relacionada a condições internas do organismo. Contrariamente, o behaviorismo radical analisa os sonhos como comportamentos privados, sendo produtos das histórias filogenética, ontogenética e cultural. Neste sentido, este trabalho tem como objetivo analisar os sonhos a partir da perspectiva behaviorista radical, considerando-o...

  15. Studies of radiation-produced radicals and radical ions. Progress report, September 1, 1982-August 31, 1983

    International Nuclear Information System (INIS)

    During the past year, radiation chemical and solid-state ESR techniques were combined to generate and characterize novel radical ions. Observations have been made on a variety of metastable organometallic radical cations derived from Group IV B metal alkyls. Matrix interactions have been discovered between radical cations and the Freon solvent. The radical cation formed from ethylene oxide is the ring-opened 2-oxa-trimethylene cation with a symmetrical C/sub 2v/ planar structure. The CF3CCl2 radical was formed after γ irradiation of the CF3CCl3 (Freon) matrix. Very large long-range proton hyperfine couplings were found in radical cations of carbonyl compounds. The C8F8- ion was studied in MTHF glass, using ESR. Two new inorganic radicals, SF4- and SF4O-, were discovered

  16. Equations for calculation of NaCl/( NaCl + CaCl2 ) ratios and salinities from hydrohalite-melting and ice-melting temperatures in the H2O-NaCl-CaCl2 system%利用H2O-NaCl-CaCl2体系水盐化合物和冰的融化温度计算NaCl/(NaCl+CaCl2)比值和盐度的方程

    Institute of Scientific and Technical Information of China (English)

    Guoxiang Chi; Pei Ni

    2007-01-01

    The composition of fluid inclusions in the H2O-NaCl-CaCl2 system has been generally graphically estimated using the melting temperatures of hydrohalite ( Tm-HH ) and ice ( Tm-ice ). Here we present two equations that can be used to calculate the relative proportion of NaCl ( i. e. , NaCt/[ NaCl + CaCl2 ], or XNaCl) and the total salinity ( i. e. , NaCl + CaCl2, wt% ) for fluid inclusions with ice as the last melting phase. XNaCl can be calculated from Tm-HH using the following equation:y= ( a + bx)-1/c where y is XNaCl, x is Tm-HH, a =0. 33124402, b = -0.031518028, and c =0. 22932736. In the cases where only Tm-ice is measured and Tm-HH is not known, Tm-ice can be used as the maximum possible Tm-HH to calculate the maximum value of XNaCl using the above equation. In these cases, the following equation can be used to calculate the maximum total salinity: y = (a +bx +cx2) -1 where y is salinity, x is Tm-HH, a = 0. 057184817, b = 0. 00078565757, and c = 5. 7262766E-6. Because the isothems in the field of ice are sub-parallel to the NaCl-CaCl2 binary side in the H2O-NaCl-CaCl2 ternary system, the errors in salinity calculation introduced by the above approximation are small ( less than 2 wt% ). A Windows program for calculation of XNacl and salinity is available at: http ://uregina. ca/~ chiguox.

  17. Global modelling of the ClNO2 production impact on tropospheric nitrogen oxides and main oxidants

    Science.gov (United States)

    Cuevas Rodríguez, Carlos Alberto; Brown, Steven S.; Lamarque, Jean-Francoise; Saiz-Lopez, Alfonso; Kinnison, Douglas E.; Lopez-Hilfiker, Felipe; Thornton, Joel A.; Jaegle, Lyatt; Fibiger, Dorothy; McDuffie, Erin E.; Sullivan, Amy P.; Weber, Rodney J.; Dibb, Jack

    2016-04-01

    Heterogeneous uptake of dinitrogen pentoxide, N2O5, to aerosol is one of the most important reactions controlling the global budget of nitrogen oxides, with subsequent impacts on oxidants such as ozone and hydroxyl radical. Most chemistry global models assume that this uptake proceeds through hydrolysis to produce nitric acid, effectively a terminal sink for nitrogen oxides. However, recent field studies have shown that the yield of nitryl chloride, ClNO2, from N2O5 uptake is significant in many locations. Because ClNO2 photolyzes subsequent to its nighttime production to recycle NO2 and produce atomic chlorine, a potent oxidant, the impact of heterogeneous N2O5 uptake and the role of ClNO2 on the scale distribution of oxidants need to be re-assessed. Here we present global simulations using the chemistry-climate model CAM-Chem, including a state of the art halogen chemistry scheme and different assumptions for the magnitude and spatial distribution of ClNO2 yields from N2O5. The model shows a significant effect of ClNO2 production on tropospheric ozone, hydroxyl radical and peroxyacyl nitrates (PAN) during northern hemisphere late winter and early spring. Simulations are compared to observations from recent field campaigns, including ClNO2 and N2O5 from the Wintertime INvestigation of Transport, Emissions and Reactivity (WINTER) study on the NSF / NCAR C-130 aircraft on the U.S. East Coast in February and March of 2015.

  18. Na3DyCl6

    Directory of Open Access Journals (Sweden)

    Christian M. Schurz

    2011-05-01

    Full Text Available Single crystals of the title compound, trisodium hexachloridodysprosate, Na3DyCl6, were obtained as a by-product of synthesis using dysprosium(III chloride and sodium chloride among others. The monoclinic structure with its typical β angle close to 90° [90.823 (4°] is isotypic with the mineral cryolite (Na3AlF6 and the high-temperature structure of the Na3MCl6 series, with M = Eu–Lu, Y and Sc. The isolated, almost perfect [DyCl6]3− octahedra are interconnected via two crystallographically different Na+ cations: while one Na+ resides on centres of symmetry (as well as Dy3+ and also builds almost perfect, isolated [NaCl6]5− octahedra, the other Na+ is surrounded by seven chloride anions forming a distorted [NaCl7]6− trigonal prism with just one cap as close secondary contact.

  19. On Sensitivity of HE CL-20

    Institute of Scientific and Technical Information of China (English)

    Yu. V. Sheikov; L. A. Andrievskikh; V. G. Vasipenko; S. A. Vakhmistrov; N. N. Zhbanova; V. B. Kosolapov; L.V.Fomicheva

    2004-01-01

    @@ 1 Introduction Recently a series of publications appeared in literature devoted to study of properties of hexanitrohexaazaisowurtzitan( CL-20), which is considered as an explosive with performance higher than that of HMX, and which has moderate sensitivity[1].

  20. RISE OF RADICALIZATION IN THE GLOBAL VILLAGE. ONLINE RADICALIZATION VS. IN-PERSON RADICALIZATION - IS THERE A DIFFERENCE?

    Directory of Open Access Journals (Sweden)

    Tanja Dramac Jiries

    2016-03-01

    Full Text Available In the vicinity of open space, some authors have called the “dark web” the perfect “breeding grounds” for generating conditions for seeds of extremism to thrive and grow. The perceived anonymity and vast information databases found here present a perfect incubator for terrorist activity. Academics and policymakers alike are as well convinced that such an open space filled with recruiter masterminds is perfectly adept at embracing the unadoptable, unconventional, or socially unfit into terrorist or jihadi organizations. Nevertheless, regardless of organizations, modernization and adoption of new technological methods in which one can obtain ideas and information, many individuals are still and to a great extent, influenced by face-to-face interactions. Intimate environments of a religious institution, somewhat of a home-like feeling in community gathering center, can equally impact a person, as can the internet and its vast informational influence. For the reason of contributing to understand the radicalization in the Global Village, this article will examine differences in online and in-person radicalization and illustrate it with some examples and attempt to make a comparison between two different exposures to information and its effects on young individuals.

  1. Isoprene, sulphoxy radical-anions and acidity

    Directory of Open Access Journals (Sweden)

    K. J. Rudziński

    2008-12-01

    Full Text Available Transformation of isoprene coupled with autoxidation of SIV in aqueous solutions was studied experimentally and by chemical-kinetic modelling over broad range of solution acidities (pH=3–9 to complement the research on aqueous-phase and heterogeneous transformation of isoprene reported recently by many laboratories. Isoprene significantly slowed down the autoxidation in acidic and basic solutions, and accelerated it slightly in neutral solutions. Simultaneously, production of sulphate ions and formation of solution acidity were significantly reduced. Formation of sulphite and sulphate derivatives of isoprene – sulphurous acid mono-(2-methyl-4-oxo-but-2-enyl ester (m/z=162.9, sulphurous acid mono-(4-hydroxy-2-methyl-but-2-enyl ester (m/z=164.9, sulphuric acid mono-(2-methyl-4-oxo-but-2-enyl ester (m/z=178.9, sulphuric acid mono-(4-hydroxy-2-methyl-but-2-enyl ester (m/z=180.9 – was indicated by mass spectroscopic analysis of post-reaction mixtures. The results of experiments were explained by changes in a subtle quantitative balance of three superimposed processes whose rates depended in different manner on the acidity of reacting solutions – the scavenging of sulphoxy radicals by isoprene, the formation of sulphoxy radicals during further reactions of isoprene radicals, and the autoxidation of SIV itself. A chemical mechanism based on this idea was explored numerically to show good agreement with experimental data. Interaction of isoprene with sulphur(IV species and oxygen can possibly result in formation of new organosulphate components of atmospheric aerosols and waters, and influence distribution of reactive sulphur and oxygen species in isoprene-emitting organisms exposed to SIV pollutants.

  2. Hydroxyl radical induced oxidation of nitrobenzene

    International Nuclear Information System (INIS)

    The hydroxylation of nitrobenzene by radiolytic techniques was examined by high-performance liquid chromatographic techniques. Owing to improvements in the method of analysis it was possible to measure phenol in air-saturated nitrobenzene solutions irradiated to low doses. The initial yields for the consumption of nitrobenzene and the formation of phenol and isomeric nitrophenols in N2O- and air-saturated systems were measured in order to establish the primary reactions of hydroxyl radicals with nitrobenzene. The initial yields for the consumption of nitrobenzene were 3.7 and 2.6 and that for total phenol were 2.3 and 2.4 in N2O- and air-saturated systems, respectively, in samples irradiated at low dose rates (0.8 krad g-1 min-1). Nearly 80 percent of the hydroxynitrocyclohexadienyl radicals disproportionate to produce isomeric nitrophenols and nitrobenzene in N2O-saturated systems without added oxidants upon irradiation at low dose rates. For a given dose the distribution of nitrophenols was dependent upon the dose rate. Observed dose rate dependence of nitrophenol production and dose rate independence of nitrobenzene consumption indicate that reactions other than disporportional and dimerization play a significant role at high dose reates. The examination of the effect of added ferricyanide ion in N2O-saturated systems showed that reliable production measurements of o- and p-nitrophenol cannot be made because of complicating secondary reactions. The initial yield for the production of m-nitrophenol was higher by a factor of greater than 3 in the presence than in the absence of ferricyanide ion. This result indicates that in the cross disproportionation reaction of m- and o- or p-hydroxynitrocyclohexadienyl radicals the meta isomer acts as an oxidizing agent and ortho and para isomers act as reducing agents. (U.S.)

  3. OpenCL programming using Python syntax

    OpenAIRE

    Massimo Di Pierro

    2013-01-01

    We describe ocl, a Python library built on top of p yOpenCL and numpy. It allows programming GPU devices using Python. Python functions which ar e marked up using the provided decorator, are converted into C99/OpenCL and compil ed using the JIT at runtime. This approach lowers the barrier to entry to programming GPU devices since it requires only Python syntax and no external compilation or linkin g steps. The resulting Pyth...

  4. Rehabilitation of erectile function following radical prostatectomy

    Institute of Scientific and Technical Information of China (English)

    Andrew R. McCullough

    2008-01-01

    The concept of muscle rehabilitation after nerve injury is not a novel idea and is practiced in many branches of medicine, including urology. Bladder rehabilitation after spinal cord injury is universally practiced. The erectile dysfunction (ED) experienced after radical prostatectomy (RP) is increasingly recognized as being primarily neurogenic followed by secondary penile smooth muscle (SM) changes. There is unfortunately no standard approach to penile rehabilitation after RP because controlled prospective human studies are not available. This article reviews the epidemiology, experimental pathophysiological models, rationale for penile rehabilitation, and currently published rehabilitation strategies.

  5. Superzoom. Italia y el compromiso radical

    OpenAIRE

    Parga Prado, Marcos

    2015-01-01

    Italy: the new domestic landscape, la ambiciosa exposición que en 1972 tuvo lugar en el MoMA, supone la consagración y a la vez escenifica la muerte de lo que algunos críticos acababan de catalogar como Arquitectura Radical, término con el que intentaban unificar el trabajo de un heterogéneo y atomizado grupo de arquitectos, principalmente italianos, comprometidos con el replanteamiento total de la definición y objetivos de la disciplina. Se ponía fin así a un corto pero intenso periodo d...

  6. Resonance Raman study of benzyl radical

    DEFF Research Database (Denmark)

    Langkilde, F.W.; Bajdor, K.; Wilbrandt, R.

    1992-01-01

    Time-resolved resonance Raman spectra are obtained of benzyl radicals created by laser flash photolysis of benzylchloride and diphenylacetone in solution. The spectra are obtained in resonance with the intense 2 2A2-1 B-2(2) transition of benzyl. The strong Raman bands are assigned to totally...... symmetric a1 modes. The remaining observed bands are tentatively assigned to fundamental modes of b1, a2, and b2 symmetry, and to overtones and combinations. The resonance Raman spectra are found to be quite different from previous fluorescence spectra of benzyl, and the origins of these differences are...

  7. Phase diagrams for the binary systems NdCl3-LiCl and PrCl3-LiCl

    OpenAIRE

    Kim, I; 岡本芳浩

    1999-01-01

    NdCl3-LiCl及びPrCl3-LiClの各2成分系の相状態を、200~800circCの範囲における示差熱分析及び急冷したサンプルの室温X線回折によって調べた。NdCl3-LiCl系では、31mol%NdCl3の組成に共晶(456circC)が見られたのに加えて、包晶点(467circC)の存在が観測された。一方、PrCl3-LiCl系では同じく31mol%PrCl3の組成に共晶(464circC)が見いだされたのみで包晶の存在は確認されなかった。これらの結晶をもとに、各2成分系の状態図を作成した。...

  8. Electric conductivity of PCl5-ZrCl4, PCl5-TaCl5, and PCl5-MoCl5 molten mixtures

    International Nuclear Information System (INIS)

    When mixing individual molecular melts of PCl5 with ZrCl4, TaCl5 or with MoCl5, an essential (by several orders) increase in electric conductivity (up to 0.02-0.1 Ohm-1·cm-1), which stems, in all probability, from the appearance of complex ions PCl4+, ZrCl5-, ZrCl62-, TaCl5- and MoCl6- in the molten mixtures as a result of chemical interaction

  9. Acetyl radical generation in cigarette smoke: Quantification and simulations

    Science.gov (United States)

    Hu, Na; Green, Sarah A.

    2014-10-01

    Free radicals are present in cigarette smoke and can have a negative effect on human health. However, little is known about their formation mechanisms. Acetyl radicals were quantified in tobacco smoke and mechanisms for their generation were investigated by computer simulations. Acetyl radicals were trapped from the gas phase using 3-amino-2, 2, 5, 5-tetramethyl-proxyl (3AP) on solid support to form stable 3AP adducts for later analysis by high-performance liquid chromatography (HPLC), mass spectrometry/tandem mass spectrometry (MS-MS/MS) and liquid chromatography-mass spectrometry (LC-MS). Simulations were performed using the Master Chemical Mechanism (MCM). A range of 10-150 nmol/cigarette of acetyl radical was measured from gas phase tobacco smoke of both commercial and research cigarettes under several different smoking conditions. More radicals were detected from the puff smoking method compared to continuous flow sampling. Approximately twice as many acetyl radicals were trapped when a glass fiber particle filter (GF/F specifications) was placed before the trapping zone. Simulations showed that NO/NO2 reacts with isoprene, initiating chain reactions to produce hydroxyl radical, which abstracts hydrogen from acetaldehyde to generate acetyl radical. These mechanisms can account for the full amount of acetyl radical detected experimentally from cigarette smoke. Similar mechanisms may generate radicals in second hand smoke.

  10. Lipid radicals: Properties and detection by spin trapping

    International Nuclear Information System (INIS)

    Unsaturated lipids are rapidly oxidized to toxic products such as lipid hydroperoxides, especially when transition metals such as iron or copper are present. In a Fenton-type reaction Fe2+ converts lipid hydroperoxides to the very short-lived lipid alkoxyl radicals. The reaction was started upon the addition of Fe2+ to an aqueous linoleic acid hydroperoxide (LOOH) emulsion and the spin trap in the absence of oxygen. Even when high concentrations of spin traps were added to the incubation mixture, only secondary radical adducts were detected, probably due to the rapid rearrangement of the primary alkoxyl radicals. With the commercially available nitroso spin trap MNP we observed a slightly immobilized ESR spectrum with only one hydrogen splitting, indicating the trapping of a methinyl fragment of a lipid radical. With DMPO or 5-diethoxyphosphoryl-5-methyl-1-pyrroline N-oxide (DEPMPO) adducts were detected with carbon-centered lipid radical, with acyl radical, and with the hydroxyl radical. We also synthesized lipophilic derivatives of the spin trap DEPMPO in order to detect lipid radical species generated in the lipid phase. With all spin traps studied a lipid-derived carbon-centered radical was obtained in the anaerobic incubation system Fe2+/LOOH indicating the trapping of a lipid radical, possibly generated as a secondary reaction product of the primary lipid alkoxyl radical formed. Under aerobic conditions an SOD-insensitive oxygen-centered radical adduct was formed with DEPMPO and its lipophilic derivatives. The observed ESR parameters were similar to those of alkoxyl radical adducts, which were independently synthesized in model experiments using Fe3+-catalyzed nucleophilic addition of methanol or t-butanol to the respective spin trap. (author)

  11. Preparation and biodistribution study of technetium-99m-labeled quercetin as a potential radical scavenging agent

    International Nuclear Information System (INIS)

    Free radicals and oxidative stress are the primary causes of several chronic diseases such as cancer and heart disease. Quercetin is a natural compound with potent antioxidant activity. We have prepared and evaluated technetium-99m (99mTc)-labeled quercetin as a potential radical scavenging radiotracer. A 99mTc-quercetin complex was prepared using quercetin, SnCl2 and Na99mTcO4 in a buffered solution over 30 min. The participation coefficient was measured in octanol and queues solutions. The stability was determined in phosphate buffered saline and serum. The biodistribution in normal mice was evaluated at 0.5, 2, 6 and 24 h post-injection. The radiochemical purity (>99%) was determined by thin layer chromatography (TLC) in normal saline solution as the mobile phase. It has a log P of 0.204. It was mainly cleared by the kidneys and showed negligible brain uptake at four time points measured post-injection. The pharmacological properties of quercetin, mainly its free radical scavenging, may potentially cat as a radiopharmaceutical agent for radical-targeted imaging of tissue with high levels of reactive oxygen species. (author)

  12. Effects of Montelukast on free radical production in whole blood and isolated human polymorphonuclear neutrophils (PMNs) in asthmatic children

    Science.gov (United States)

    Al Saadi, Muslim M.; Meo, Sultan Ayoub; Mustafa, Ali; Shafi, Ahmed; Tuwajri, Ali S. Al

    2011-01-01

    Montelukast is a highly selective leukotriene-receptor antagonist (LTRA). It is widely used in the treatment of bronchial asthma, primarily as an adjunct to corticosteroids. Reactive oxygen species (ROSs) play an important role in the pathogenesis of asthma and oxidative stress contributing to the initiation and worsening of inflammatory respiratory disorders, such as asthma. Antioxidant drugs may have a role in minimizing or preventing damage in asthmatic children. The aim of this study was to assess the antioxidant effect of montelukast on the production of free radicals in the whole blood and polymorphonuclear neutrophils (PMNs) in asthmatic children. A group of 48 (38 males and 10 females), apparently healthy asthmatic children were recruited with ages ranging between 6 and 14 years. In asthmatic children, base line (premedication) and post medication free radicals activity in the whole blood and polymorphonuclear neutrophils (PMNs) was determined by measuring chemiluminescence (CL) response through chemiluminescence luminometer. Free radical productions were significantly decreased in the whole blood, when stimulated with Phorbol Myristate Acetate (p < 0.04) and Opsonised Zymosan (p < 0.05). The free radicals were also significantly decreased in isolated polymorphonuclear neutrophils (PMNs) when stimulated with Opsonised Zymosan (p < 0.05) after the post medication treatment of montelukast in asthmatic children. Montelukast decreased the reactive oxygen species production, both in the whole blood as well as isolated PMNs in asthmatic children. PMID:23960762

  13. Fragment Coupling with Tertiary Radicals Generated by Visible-Light Photocatalysis.

    Science.gov (United States)

    Jamison, Christopher R; Overman, Larry E

    2016-08-16

    Convergent synthesis strategies in which a target molecule is prepared by a branched approach wherein two or more complex fragments are combined at a late stage are almost always preferred over a linear approach in which the overall yield of the target molecule is eroded by the efficiency of each successive step in the sequence. As a result, bimolecular reactions that are able to combine complex fragments in good yield and, where important, with high stereocontrol are essential for implementing convergent synthetic strategies. Although intramolecular reactions of carbon radicals have long been exploited to assemble polycyclic ring systems, bimolecular coupling reactions of structurally complex carbon radicals have rarely been employed to combine elaborate fragments in the synthesis of structurally intricate molecules. We highlight in this Account recent discoveries from our laboratories that demonstrate that bimolecular reactions of structurally elaborate tertiary carbon radicals and electron-deficient alkenes can unite complex fragments in high yield using nearly equimolar amounts of the two coupling partners. Our discussion begins by considering several aspects of the bimolecular addition of tertiary carbon radicals to electron-deficient alkenes that commend these transformations for the union of structurally complex, sterically bulky fragments. We then discuss how in the context of synthesizing rearranged spongian diterpenoids we became aware of the exceptional utility of coupling reactions of alkenes and tertiary carbon radicals to unite structurally complex synthetic intermediates. Our initial investigations exploit the early report of Okada that N-(acyloxy)phthalimides reductively fragment at room temperature in the presence of visible light and catalytic amounts of the photocatalyst Ru(bpy)3Cl2 to form carbon radicals that react with alkenes. We show that this reaction of a tertiary radical precursor and an enone can combine two elaborate enantioenriched

  14. Determination of 36Cl/Cl ratio in ground water using the accelerator mass spectrometry technique

    International Nuclear Information System (INIS)

    The Accelerator Mass Spectrometry (AMS) programme using the 14 MV Pelletron Accelerator at Mumbai has been initiated with major emphasis on the determination of 36Cl in water samples, of interest to hydrology and environment. In order to carry out the AMS measurement, a beam chopper to cut down beam intensity by a factor of 20 has been developed and commissioned. A multi-anode gas -si detector has been built to separate 36Cl from the interfering 36S. A new TPS system has been procured to operate the machine in the GVM mode. Standard and blank samples from Prime lab, Purdue have been employed in these measurements to standardise the technique for 36Cl/Cl ratio determination. The detector was calibrated using the stable 35,37Cl ions. The background 36Cl in the system has been measured using the blank sample from Purdue and it was estimated that the ratio of 36Cl/Cl was of the order of 10-13 in the present setup. Ground water samples collected from South India were converted to AgCl and put in the SNICS ion source for the AMS measurements. These ground water samples, with 14C content estimated to be in the range of 1 to 4 pMC indicate that the samples may be more than 35,000 years old. Using the AMS technique we have determined the 36Cl/Cl ratio values for these ground water samples. They are found to range between 2 to 5 x 10-12. Additional measurements are planned to determine the age of the water samples and to understand the reasons for the observed high values of 36Cl in these samples. (author)

  15. The Diurnal Variation of Hydrogen, Nitrogen, and Chlorine Radicals: Implications for the Heterogeneous Production of HNO2

    Science.gov (United States)

    Salawitch, R. J.; Wofsy, S. C.; Wennberg, P. O.; Cohen, R. C.; Anderson, J. G.; Fahey, D. W.; Gao, R. S.; Keim, E. R.; Woodbridge, E. L.; Stimpfle, R. M.; Koplow, J. P.; Kohn, D. W.; Webster, C. R.; May, R. D.; Pfister, L.; Gottlieb, E. W.; Michelsen, H. A.; Yue, G. K.; Prather, M. J.; Wilson, J. C.

    1994-01-01

    In situ measurements of hydrogen, nitrogen, and chlorine radicals obtained through sunrise and sunset in the lower stratosphere during SPADE are compared to results from a photochemical model constrained by observed concentrations of radical precursors and environmental conditions. Models allowing for heterogeneous hydrolysis of N205 on sulfate aerosols agree with measured concentrations of NO, NO2, and ClO throughout the day, but fail to account for high concentrations of OH and H02 observed near sunrise and sunset. The morning burst of [OH] and [HO2] coincides with the rise of [NO] from photolysis of N02, suggesting a new source of HO, that photolyzes in the near UV (350 to 400 nm) spectral region. A model that allows for the heterogeneous production of HN02 results in an excellent simulation of the diurnal variations of [OH] and [HO2].

  16. Hydrogen Radicals, Nitrogen Radicals, and the Production of Ozone in the Middle and Upper Troposphere

    Science.gov (United States)

    Bui, T. P.

    1997-01-01

    The concentrations of hydrogen radicals, OH and HO2, in the middle and upper troposphere were measured simultaneously with those of NO, O3,CO, H20, CH4, non-methane hydrocarbons, and with the ultraviolet and visible radiation field.

  17. Radical Reform Within a Liberal and Democratic Framework? Rawls and the Radical Critique of Schooling.

    Science.gov (United States)

    Claus, John F.

    1981-01-01

    The radical critique of American education portrays the schools as perpetuators of ethnic, social, and racial inequalities because they do not alter existing class relations. John Rawls' theory of social justice is discussed as an alternative approach to this situation that remains firmly grounded in the liberal tradition. (PP)

  18. Electronic paramagnetic resonance (EPR) for the study of ascorbyl radical and lipid radicals in marine organisms.

    Science.gov (United States)

    González, Paula Mariela; Aguiar, María Belén; Malanga, Gabriela; Puntarulo, Susana

    2013-08-01

    Electron paramagnetic resonance (EPR) spectroscopy detects the presence of radicals of biological interest, such as ascorbyl radical (A(•)) and lipid radicals. A(•) is easily detectable by EPR even in aqueous solution at room-temperature. Under oxidative conditions leading to changes in total ascorbate (AH(-)) content, the A(•)/AH(-) ratio could be used to estimate early oxidative stress in the hydrophilic milieu. This methodology was applied to a wide range of aquatic systems including algae, sea urchin, limpets, bivalves and fish, under physiological and oxidative stress conditions as well. The A(•)/AH(-) ratio reflected the state of one part of the oxidative defense system and provided an early and simple diagnosis of environmental stressing conditions. Oxidative damage to lipids was assessed by the EPR-sensitive adduct formation that correlates well with cell membrane damage with no interference from other biological compounds. Probe instability, tissue metabolism, and lack of spin specificity are drawback factors for employing EPR for in vivo determination of free radicals. However, the dependability of this technique, mostly by combining it with other biochemical strategies, enhances the value of these procedures as contributors to the knowledge of oxidative condition in aquatic organisms. PMID:23485428

  19. Peroxyl radical reactions with carotenoids in microemulsions: Influence of microemulsion composition and the nature of peroxyl radical precursor.

    Science.gov (United States)

    El-Agamey, Ali; McGarvey, David J

    2016-01-01

    The reactions of acetylperoxyl radicals with different carotenoids (7,7'-dihydro-β-carotene and ζ-carotene) in SDS and CTAC microemulsions of different compositions were investigated using laser flash photolysis (LFP) coupled with kinetic absorption spectroscopy. The primary objective of this study was to explore the influence of microemulsion composition and the type of surfactant used on the yields and kinetics of various transients formed from the reaction of acetylperoxyl radicals with carotenoids. Also, the influence of the site (hydrocarbon phases or aqueous phase) of generation of the peroxyl radical precursor was examined by using 4-acetyl-4-phenylpiperidine hydrochloride (APPHCl) and 1,1-diphenylacetone (11DPA) as water-soluble and lipid-soluble peroxyl radical precursors, respectively. LFP of peroxyl radical precursors with 7,7'-dihydro-β-carotene (77DH) in different microemulsions gives rise to the formation of three distinct transients namely addition radical (λmax=460 nm), near infrared transient1 (NIR, λmax=700 nm) and 7,7'-dihydro-β-carotene radical cation (77DH(•+), λmax=770 nm). In addition, for ζ-carotene (ZETA) two transients (near infrared transient1 (NIR1, λmax=660 nm) and ζ-carotene radical cation (ZETA(•+), λmax=730-740 nm)) are generated following LFP of peroxyl radical precursors in the presence of ζ-carotene (ZETA) in different microemulsions. The results show that the composition of the microemulsion strongly influences the observed yield and kinetics of the transients formed from the reactions of peroxyl radicals (acetylperoxyl radicals) with carotenoids (77DH and ZETA). Also, the type of surfactant used in the microemulsions influences the yield of the transients formed. The dependence of the transient yields and kinetics on microemulsion composition (or the type of surfactant used in the microemulsion) can be attributed to the change of the polarity of the microenvironment of the carotenoid. Furthermore, the nature of

  20. Modeling Radicalization Phenomena in Heterogeneous Populations

    CERN Document Server

    Galam, Serge

    2015-01-01

    The phenomenon of radicalization is investigated within an heterogeneous population composed of a core subpopulation, sharing a way of life locally rooted, and a recently immigrated subpopulation of different origins with ways of life which can be partly in conflict with the local one. While core agents are embedded in the country prominent culture and identity, they are not likely to modify their way of life, which make them naturally inflexible about it. On the opposite, the new comers can either decide to live peacefully with the core people adapting their way of life, or to keep strictly on their way and oppose the core population, leading eventually to criminal activities. To study the corresponding dynamics of radicalization we introduce a 3-state agent model with a proportion of inflexible agents and a proportion of flexible ones, which can be either peaceful or opponent. Assuming agents interact via weighted pairs within a Lotka-Volterra like Ordinary Differential Equation framework, the problem is an...