WorldWideScience

Sample records for chip-seq peak detection

  1. Automated asteroseismic peak detections

    Science.gov (United States)

    García Saravia Ortiz de Montellano, Andrés; Hekker, S.; Themeßl, N.

    2018-05-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible in a power density spectrum. Identification of oscillation modes is usually done by visual inspection that is time-consuming and has a degree of subjectivity. Here, we present a peak-detection algorithm especially suited for the detection of solar-like oscillations. It reliably characterizes the solar-like oscillations in a power density spectrum and estimates their parameters without human intervention. Furthermore, we provide a metric to characterize the false positive and false negative rates to provide further information about the reliability of a detected oscillation mode or the significance of a lack of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler.

  2. Automated asteroseismic peak detections

    DEFF Research Database (Denmark)

    de Montellano, Andres Garcia Saravia Ortiz; Hekker, S.; Themessl, N.

    2018-01-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However......, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible...... of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler....

  3. Multiscale peak detection in wavelet space.

    Science.gov (United States)

    Zhang, Zhi-Min; Tong, Xia; Peng, Ying; Ma, Pan; Zhang, Ming-Jin; Lu, Hong-Mei; Chen, Xiao-Qing; Liang, Yi-Zeng

    2015-12-07

    Accurate peak detection is essential for analyzing high-throughput datasets generated by analytical instruments. Derivatives with noise reduction and matched filtration are frequently used, but they are sensitive to baseline variations, random noise and deviations in the peak shape. A continuous wavelet transform (CWT)-based method is more practical and popular in this situation, which can increase the accuracy and reliability by identifying peaks across scales in wavelet space and implicitly removing noise as well as the baseline. However, its computational load is relatively high and the estimated features of peaks may not be accurate in the case of peaks that are overlapping, dense or weak. In this study, we present multi-scale peak detection (MSPD) by taking full advantage of additional information in wavelet space including ridges, valleys, and zero-crossings. It can achieve a high accuracy by thresholding each detected peak with the maximum of its ridge. It has been comprehensively evaluated with MALDI-TOF spectra in proteomics, the CAMDA 2006 SELDI dataset as well as the Romanian database of Raman spectra, which is particularly suitable for detecting peaks in high-throughput analytical signals. Receiver operating characteristic (ROC) curves show that MSPD can detect more true peaks while keeping the false discovery rate lower than MassSpecWavelet and MALDIquant methods. Superior results in Raman spectra suggest that MSPD seems to be a more universal method for peak detection. MSPD has been designed and implemented efficiently in Python and Cython. It is available as an open source package at .

  4. Peak tree: a new tool for multiscale hierarchical representation and peak detection of mass spectrometry data.

    Science.gov (United States)

    Zhang, Peng; Li, Houqiang; Wang, Honghui; Wong, Stephen T C; Zhou, Xiaobo

    2011-01-01

    Peak detection is one of the most important steps in mass spectrometry (MS) analysis. However, the detection result is greatly affected by severe spectrum variations. Unfortunately, most current peak detection methods are neither flexible enough to revise false detection results nor robust enough to resist spectrum variations. To improve flexibility, we introduce peak tree to represent the peak information in MS spectra. Each tree node is a peak judgment on a range of scales, and each tree decomposition, as a set of nodes, is a candidate peak detection result. To improve robustness, we combine peak detection and common peak alignment into a closed-loop framework, which finds the optimal decomposition via both peak intensity and common peak information. The common peak information is derived and loopily refined from the density clustering of the latest peak detection result. Finally, we present an improved ant colony optimization biomarker selection method to build a whole MS analysis system. Experiment shows that our peak detection method can better resist spectrum variations and provide higher sensitivity and lower false detection rates than conventional methods. The benefits from our peak-tree-based system for MS disease analysis are also proved on real SELDI data.

  5. Fast clustering using adaptive density peak detection.

    Science.gov (United States)

    Wang, Xiao-Feng; Xu, Yifan

    2017-12-01

    Common limitations of clustering methods include the slow algorithm convergence, the instability of the pre-specification on a number of intrinsic parameters, and the lack of robustness to outliers. A recent clustering approach proposed a fast search algorithm of cluster centers based on their local densities. However, the selection of the key intrinsic parameters in the algorithm was not systematically investigated. It is relatively difficult to estimate the "optimal" parameters since the original definition of the local density in the algorithm is based on a truncated counting measure. In this paper, we propose a clustering procedure with adaptive density peak detection, where the local density is estimated through the nonparametric multivariate kernel estimation. The model parameter is then able to be calculated from the equations with statistical theoretical justification. We also develop an automatic cluster centroid selection method through maximizing an average silhouette index. The advantage and flexibility of the proposed method are demonstrated through simulation studies and the analysis of a few benchmark gene expression data sets. The method only needs to perform in one single step without any iteration and thus is fast and has a great potential to apply on big data analysis. A user-friendly R package ADPclust is developed for public use.

  6. Bayesian approach for peak detection in two-dimensional chromatography

    NARCIS (Netherlands)

    Vivó-Truyols, G.

    2012-01-01

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual

  7. Method and apparatus for current-output peak detection

    Science.gov (United States)

    De Geronimo, Gianluigi

    2017-01-24

    A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.

  8. QRS peak detection for heart rate monitoring on Android smartphone

    Science.gov (United States)

    Pambudi Utomo, Trio; Nuryani, Nuryani; Darmanto

    2017-11-01

    In this study, Android smartphone is used for heart rate monitoring and displaying electrocardiogram (ECG) graph. Heart rate determination is based on QRS peak detection. Two methods are studied to detect the QRS complex peak; they are Peak Threshold and Peak Filter. The acquisition of ECG data is utilized by AD8232 module from Analog Devices, three electrodes, and Microcontroller Arduino UNO R3. To record the ECG data from a patient, three electrodes are attached to particular body’s surface of a patient. Patient’s heart activity which is recorded by AD8232 module is decoded by Arduino UNO R3 into analog data. Then, the analog data is converted into a voltage value (mV) and is processed to get the QRS complex peak. Heart rate value is calculated by Microcontroller Arduino UNO R3 uses the QRS complex peak. Voltage, heart rate, and the QRS complex peak are sent to Android smartphone by Bluetooth HC-05. ECG data is displayed as the graph by Android smartphone. To evaluate the performance of QRS complex peak detection method, three parameters are used; they are positive predictive, accuracy and sensitivity. Positive predictive, accuracy, and sensitivity of Peak Threshold method is 92.39%, 70.30%, 74.62% and for Peak Filter method are 98.38%, 82.47%, 83.61%, respectively.

  9. Bayesian approach for peak detection in two-dimensional chromatography.

    Science.gov (United States)

    Vivó-Truyols, Gabriel

    2012-03-20

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual one-dimensional peaks have been originated from the same compound and should then be arranged in a two-dimensional peak. The merging algorithm is based on Bayesian inference. The user sets prior information about certain parameters (e.g., second-dimension retention time variability, first-dimension band broadening, chromatographic noise). On the basis of these priors, the algorithm calculates the probability of myriads of peak arrangements (i.e., ways of merging one-dimensional peaks), finding which of them holds the highest value. Uncertainty in each parameter can be accounted by adapting conveniently its probability distribution function, which in turn may change the final decision of the most probable peak arrangement. It has been demonstrated that the Bayesian approach presented in this paper follows the chromatographers' intuition. The algorithm has been applied and tested with LC × LC and GC × GC data and takes around 1 min to process chromatograms with several thousands of peaks.

  10. Probabilistic peak detection for first-order chromatographic data

    NARCIS (Netherlands)

    Lopatka, M.; Vivó-Truyols, G.; Sjerps, M.J.

    2014-01-01

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by

  11. Bayesian Peptide Peak Detection for High Resolution TOF Mass Spectrometry.

    Science.gov (United States)

    Zhang, Jianqiu; Zhou, Xiaobo; Wang, Honghui; Suffredini, Anthony; Zhang, Lin; Huang, Yufei; Wong, Stephen

    2010-11-01

    In this paper, we address the issue of peptide ion peak detection for high resolution time-of-flight (TOF) mass spectrometry (MS) data. A novel Bayesian peptide ion peak detection method is proposed for TOF data with resolution of 10 000-15 000 full width at half-maximum (FWHW). MS spectra exhibit distinct characteristics at this resolution, which are captured in a novel parametric model. Based on the proposed parametric model, a Bayesian peak detection algorithm based on Markov chain Monte Carlo (MCMC) sampling is developed. The proposed algorithm is tested on both simulated and real datasets. The results show a significant improvement in detection performance over a commonly employed method. The results also agree with expert's visual inspection. Moreover, better detection consistency is achieved across MS datasets from patients with identical pathological condition.

  12. Variable threshold method for ECG R-peak detection.

    Science.gov (United States)

    Kew, Hsein-Ping; Jeong, Do-Un

    2011-10-01

    In this paper, a wearable belt-type ECG electrode worn around the chest by measuring the real-time ECG is produced in order to minimize the inconvenient in wearing. ECG signal is detected using a potential instrument system. The measured ECG signal is transmits via an ultra low power consumption wireless data communications unit to personal computer using Zigbee-compatible wireless sensor node. ECG signals carry a lot of clinical information for a cardiologist especially the R-peak detection in ECG. R-peak detection generally uses the threshold value which is fixed. There will be errors in peak detection when the baseline changes due to motion artifacts and signal size changes. Preprocessing process which includes differentiation process and Hilbert transform is used as signal preprocessing algorithm. Thereafter, variable threshold method is used to detect the R-peak which is more accurate and efficient than fixed threshold value method. R-peak detection using MIT-BIH databases and Long Term Real-Time ECG is performed in this research in order to evaluate the performance analysis.

  13. Probabilistic peak detection for first-order chromatographic data.

    Science.gov (United States)

    Lopatka, M; Vivó-Truyols, G; Sjerps, M J

    2014-03-19

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by such a peak. The algorithm makes use of chromatographic information (i.e. the expected width of a single peak and the standard deviation of baseline noise). As prior information of the existence of a peak in a chromatographic run, we make use of the statistical overlap theory. We formulate an exhaustive set of mutually exclusive hypotheses concerning presence or absence of different peak configurations. These models are evaluated by fitting a segment of chromatographic data by least-squares. The evaluation of these competing hypotheses can be performed as a Bayesian inferential task. We outline the potential advantages of adopting this approach for peak detection and provide several examples of both improved performance and increased flexibility afforded by our approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Detection of Golden apples' climacteric peak by laser biospeckle measurements.

    Science.gov (United States)

    Nassif, Rana; Nader, Christelle Abou; Afif, Charbel; Pellen, Fabrice; Le Brun, Guy; Le Jeune, Bernard; Abboud, Marie

    2014-12-10

    In this paper, we report a study in which a laser biospeckle technique is used to detect the climacteric peak indicating the optimal ripeness of fruits. We monitor two batches of harvested Golden apples going through the ripening phase in low- and room-temperature environments, determine speckle parameters, and measure the emitted ethylene concentration using gas chromatography as reference method. Speckle results are then correlated to the emitted ethylene concentration by a principal component analysis. From a practical point of view, this approach allows us to validate biospeckle as a noninvasive and alternative method to respiration rate and ethylene production for climacteric peak detection as a ripening index.

  15. RELIABILITY OF THE DETECTION OF THE BARYON ACOUSTIC PEAK

    International Nuclear Information System (INIS)

    MartInez, Vicent J.; Arnalte-Mur, Pablo; De la Cruz, Pablo; Saar, Enn; Tempel, Elmo; Pons-BorderIa, MarIa Jesus; Paredes, Silvestre; Fernandez-Soto, Alberto

    2009-01-01

    The correlation function of the distribution of matter in the universe shows, at large scales, baryon acoustic oscillations, which were imprinted prior to recombination. This feature was first detected in the correlation function of the luminous red galaxies of the Sloan Digital Sky Survey (SDSS). Recently, the final release (DR7) of the SDSS has been made available, and the useful volume is about two times bigger than in the old sample. We present here, for the first time, the redshift-space correlation function of this sample at large scales together with that for one shallower, but denser volume-limited subsample drawn from the Two-Degree Field Redshift Survey. We test the reliability of the detection of the acoustic peak at about 100 h -1 Mpc and the behavior of the correlation function at larger scales by means of careful estimation of errors. We confirm the presence of the peak in the latest data although broader than in previous detections.

  16. Optimizing ChIP-seq peak detectors using visual labels and supervised machine learning.

    Science.gov (United States)

    Hocking, Toby Dylan; Goerner-Potvin, Patricia; Morin, Andreanne; Shao, Xiaojian; Pastinen, Tomi; Bourque, Guillaume

    2017-02-15

    Many peak detection algorithms have been proposed for ChIP-seq data analysis, but it is not obvious which algorithm and what parameters are optimal for any given dataset. In contrast, regions with and without obvious peaks can be easily labeled by visual inspection of aligned read counts in a genome browser. We propose a supervised machine learning approach for ChIP-seq data analysis, using labels that encode qualitative judgments about which genomic regions contain or do not contain peaks. The main idea is to manually label a small subset of the genome, and then learn a model that makes consistent peak predictions on the rest of the genome. We created 7 new histone mark datasets with 12 826 visually determined labels, and analyzed 3 existing transcription factor datasets. We observed that default peak detection parameters yield high false positive rates, which can be reduced by learning parameters using a relatively small training set of labeled data from the same experiment type. We also observed that labels from different people are highly consistent. Overall, these data indicate that our supervised labeling method is useful for quantitatively training and testing peak detection algorithms. Labeled histone mark data http://cbio.ensmp.fr/~thocking/chip-seq-chunk-db/ , R package to compute the label error of predicted peaks https://github.com/tdhock/PeakError. toby.hocking@mail.mcgill.ca or guil.bourque@mcgill.ca. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  17. Aiding the Detection of QRS Complex in ECG Signals by Detecting S Peaks Independently.

    Science.gov (United States)

    Sabherwal, Pooja; Singh, Latika; Agrawal, Monika

    2018-03-30

    In this paper, a novel algorithm for the accurate detection of QRS complex by combining the independent detection of R and S peaks, using fusion algorithm is proposed. R peak detection has been extensively studied and is being used to detect the QRS complex. Whereas, S peaks, which is also part of QRS complex can be independently detected to aid the detection of QRS complex. In this paper, we suggest a method to first estimate S peak from raw ECG signal and then use them to aid the detection of QRS complex. The amplitude of S peak in ECG signal is relatively weak than corresponding R peak, which is traditionally used for the detection of QRS complex, therefore, an appropriate digital filter is designed to enhance the S peaks. These enhanced S peaks are then detected by adaptive thresholding. The algorithm is validated on all the signals of MIT-BIH arrhythmia database and noise stress database taken from physionet.org. The algorithm performs reasonably well even for the signals highly corrupted by noise. The algorithm performance is confirmed by sensitivity and positive predictivity of 99.99% and the detection accuracy of 99.98% for QRS complex detection. The number of false positives and false negatives resulted while analysis has been drastically reduced to 80 and 42 against the 98 and 84 the best results reported so far.

  18. Hydrocarbon isotope detection by elastic peak electron spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kostanovskiy, I.A., E-mail: kostanovskiyia@gmail.com [National Research University MPEI, Krasnokazarmennaya 14, 111250 Moscow (Russian Federation); Afanas’ev, V.P. [National Research University MPEI, Krasnokazarmennaya 14, 111250 Moscow (Russian Federation); Naujoks, D. [Max-Planck-Institut für Plasmaphysik, Teilinstitut Greifswald, Wendelsteinstraße 1, D-17491 Greifswald (Germany); Mayer, M. [Max-Planck-Institut für Plasmaphysik, D-85748 Garching (Germany)

    2015-07-15

    Highlights: • PCVD hydrocarbon coatings containing protium or deuterium are analyzed via NRA, ERD, XPS and EPES. • EPES analysis with modern electron energy analyzer SPECS Phoibos 225 shows a clear signal from the hydrogen isotopes. • Different primary energies and scattering angles help to quantify isotope content from EPES spectra. - Abstract: Experimental results on the hydrocarbon isotope analysis by elastic peak electron spectroscopy are presented. Amorphous hydrocarbon samples (a-C:H, a-C:D) are prepared by PCVD and analyzed by nuclear reaction analysis (NRA), elastic recoil detection analysis (ERD), X-ray photoelectron spectroscopy (XPS) and elastic peak electron spectroscopy (EPES). Electron energy spectra show a clear signal from the hydrogen isotopes deuterium and protium. Different incident energies and scattering geometries help to resolve plasmon and elastic energy losses.

  19. Hydrocarbon isotope detection by elastic peak electron spectroscopy

    International Nuclear Information System (INIS)

    Kostanovskiy, I.A.; Afanas’ev, V.P.; Naujoks, D.; Mayer, M.

    2015-01-01

    Highlights: • PCVD hydrocarbon coatings containing protium or deuterium are analyzed via NRA, ERD, XPS and EPES. • EPES analysis with modern electron energy analyzer SPECS Phoibos 225 shows a clear signal from the hydrogen isotopes. • Different primary energies and scattering angles help to quantify isotope content from EPES spectra. - Abstract: Experimental results on the hydrocarbon isotope analysis by elastic peak electron spectroscopy are presented. Amorphous hydrocarbon samples (a-C:H, a-C:D) are prepared by PCVD and analyzed by nuclear reaction analysis (NRA), elastic recoil detection analysis (ERD), X-ray photoelectron spectroscopy (XPS) and elastic peak electron spectroscopy (EPES). Electron energy spectra show a clear signal from the hydrogen isotopes deuterium and protium. Different incident energies and scattering geometries help to resolve plasmon and elastic energy losses

  20. Evaluation of different time domain peak models using extreme learning machine-based peak detection for EEG signal.

    Science.gov (United States)

    Adam, Asrul; Ibrahim, Zuwairie; Mokhtar, Norrima; Shapiai, Mohd Ibrahim; Cumming, Paul; Mubin, Marizan

    2016-01-01

    Various peak models have been introduced to detect and analyze peaks in the time domain analysis of electroencephalogram (EEG) signals. In general, peak model in the time domain analysis consists of a set of signal parameters, such as amplitude, width, and slope. Models including those proposed by Dumpala, Acir, Liu, and Dingle are routinely used to detect peaks in EEG signals acquired in clinical studies of epilepsy or eye blink. The optimal peak model is the most reliable peak detection performance in a particular application. A fair measure of performance of different models requires a common and unbiased platform. In this study, we evaluate the performance of the four different peak models using the extreme learning machine (ELM)-based peak detection algorithm. We found that the Dingle model gave the best performance, with 72 % accuracy in the analysis of real EEG data. Statistical analysis conferred that the Dingle model afforded significantly better mean testing accuracy than did the Acir and Liu models, which were in the range 37-52 %. Meanwhile, the Dingle model has no significant difference compared to Dumpala model.

  1. PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

    Science.gov (United States)

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

  2. [An automatic peak detection method for LIBS spectrum based on continuous wavelet transform].

    Science.gov (United States)

    Chen, Peng-Fei; Tian, Di; Qiao, Shu-Jun; Yang, Guang

    2014-07-01

    Spectrum peak detection in the laser-induced breakdown spectroscopy (LIBS) is an essential step, but the presence of background and noise seriously disturb the accuracy of peak position. The present paper proposed a method applied to automatic peak detection for LIBS spectrum in order to enhance the ability of overlapping peaks searching and adaptivity. We introduced the ridge peak detection method based on continuous wavelet transform to LIBS, and discussed the choice of the mother wavelet and optimized the scale factor and the shift factor. This method also improved the ridge peak detection method with a correcting ridge method. The experimental results show that compared with other peak detection methods (the direct comparison method, derivative method and ridge peak search method), our method had a significant advantage on the ability to distinguish overlapping peaks and the precision of peak detection, and could be be applied to data processing in LIBS.

  3. Chemometric Strategies for Peak Detection and Profiling from Multidimensional Chromatography.

    Science.gov (United States)

    Navarro-Reig, Meritxell; Bedia, Carmen; Tauler, Romà; Jaumot, Joaquim

    2018-04-03

    The increasing complexity of omics research has encouraged the development of new instrumental technologies able to deal with these challenging samples. In this way, the rise of multidimensional separations should be highlighted due to the massive amounts of information that provide with an enhanced analyte determination. Both proteomics and metabolomics benefit from this higher separation capacity achieved when different chromatographic dimensions are combined, either in LC or GC. However, this vast quantity of experimental information requires the application of chemometric data analysis strategies to retrieve this hidden knowledge, especially in the case of nontargeted studies. In this work, the most common chemometric tools and approaches for the analysis of this multidimensional chromatographic data are reviewed. First, different options for data preprocessing and enhancement of the instrumental signal are introduced. Next, the most used chemometric methods for the detection of chromatographic peaks and the resolution of chromatographic and spectral contributions (profiling) are presented. The description of these data analysis approaches is complemented with enlightening examples from omics fields that demonstrate the exceptional potential of the combination of multidimensional separation techniques and chemometric tools of data analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Comparison of public peak detection algorithms for MALDI mass spectrometry data analysis.

    Science.gov (United States)

    Yang, Chao; He, Zengyou; Yu, Weichuan

    2009-01-06

    In mass spectrometry (MS) based proteomic data analysis, peak detection is an essential step for subsequent analysis. Recently, there has been significant progress in the development of various peak detection algorithms. However, neither a comprehensive survey nor an experimental comparison of these algorithms is yet available. The main objective of this paper is to provide such a survey and to compare the performance of single spectrum based peak detection methods. In general, we can decompose a peak detection procedure into three consequent parts: smoothing, baseline correction and peak finding. We first categorize existing peak detection algorithms according to the techniques used in different phases. Such a categorization reveals the differences and similarities among existing peak detection algorithms. Then, we choose five typical peak detection algorithms to conduct a comprehensive experimental study using both simulation data and real MALDI MS data. The results of comparison show that the continuous wavelet-based algorithm provides the best average performance.

  5. Improving EEG signal peak detection using feature weight learning ...

    Indian Academy of Sciences (India)

    Asrul Adam

    4 School of Psychology and Counseling, Queensland University of Technology, Brisbane 4000, Australia. 5 QIMR ... The groups of Acir et al .... difference between the peak and the floating mean, which is ..... Thus, the individual features were.

  6. [A new peak detection algorithm of Raman spectra].

    Science.gov (United States)

    Jiang, Cheng-Zhi; Sun, Qiang; Liu, Ying; Liang, Jing-Qiu; An, Yan; Liu, Bing

    2014-01-01

    The authors proposed a new Raman peak recognition method named bi-scale correlation algorithm. The algorithm uses the combination of the correlation coefficient and the local signal-to-noise ratio under two scales to achieve Raman peak identification. We compared the performance of the proposed algorithm with that of the traditional continuous wavelet transform method through MATLAB, and then tested the algorithm with real Raman spectra. The results show that the average time for identifying a Raman spectrum is 0.51 s with the algorithm, while it is 0.71 s with the continuous wavelet transform. When the signal-to-noise ratio of Raman peak is greater than or equal to 6 (modern Raman spectrometers feature an excellent signal-to-noise ratio), the recognition accuracy with the algorithm is higher than 99%, while it is less than 84% with the continuous wavelet transform method. The mean and the standard deviations of the peak position identification error of the algorithm are both less than that of the continuous wavelet transform method. Simulation analysis and experimental verification prove that the new algorithm possesses the following advantages: no needs of human intervention, no needs of de-noising and background removal operation, higher recognition speed and higher recognition accuracy. The proposed algorithm is operable in Raman peak identification.

  7. Detection of Mg spinel lithologies on central peak of crater ...

    Indian Academy of Sciences (India)

    identified Fe bearing Mg-spinel-rich rock types are defined by their strong 2-μm ... The Modified Gaussian Modeling (MGM) analysis ... study the deep crustal and/or upper mantle composition and may lead to a fresh ... Lunar surface; Mg-spinel; central peak; Theophilus; remote sensing. .... The explanation of these spec-.

  8. Improved peak detection in mass spectrum by incorporating continuous wavelet transform-based pattern matching.

    Science.gov (United States)

    Du, Pan; Kibbe, Warren A; Lin, Simon M

    2006-09-01

    A major problem for current peak detection algorithms is that noise in mass spectrometry (MS) spectra gives rise to a high rate of false positives. The false positive rate is especially problematic in detecting peaks with low amplitudes. Usually, various baseline correction algorithms and smoothing methods are applied before attempting peak detection. This approach is very sensitive to the amount of smoothing and aggressiveness of the baseline correction, which contribute to making peak detection results inconsistent between runs, instrumentation and analysis methods. Most peak detection algorithms simply identify peaks based on amplitude, ignoring the additional information present in the shape of the peaks in a spectrum. In our experience, 'true' peaks have characteristic shapes, and providing a shape-matching function that provides a 'goodness of fit' coefficient should provide a more robust peak identification method. Based on these observations, a continuous wavelet transform (CWT)-based peak detection algorithm has been devised that identifies peaks with different scales and amplitudes. By transforming the spectrum into wavelet space, the pattern-matching problem is simplified and in addition provides a powerful technique for identifying and separating the signal from the spike noise and colored noise. This transformation, with the additional information provided by the 2D CWT coefficients can greatly enhance the effective signal-to-noise ratio. Furthermore, with this technique no baseline removal or peak smoothing preprocessing steps are required before peak detection, and this improves the robustness of peak detection under a variety of conditions. The algorithm was evaluated with SELDI-TOF spectra with known polypeptide positions. Comparisons with two other popular algorithms were performed. The results show the CWT-based algorithm can identify both strong and weak peaks while keeping false positive rate low. The algorithm is implemented in R and will be

  9. Detection of the relationship between peak temperature and extreme precipitation

    Science.gov (United States)

    Yu, Y.; Liu, J.; Zhiyong, Y.

    2017-12-01

    Under the background of climate change and human activities, the characteristics and pattern of precipitation have changed significantly in many regions. As the political and cultural center of China, the structure and character of precipitation in Jingjinji District has varied dramatically in recent years. In this paper, the daily precipitation data throughout the period 1960-2013 are selected for analyzing the spatial-temporal variability of precipitation. The results indicate that the frequency and intensity of precipitation presents an increasing trend. Based on the precipitation data, the maximum, minimum and mean precipitation in different temporal and spatial scales is calculated respectively. The temporal and spatial variation of temperature is obtained by using statistical methods. The relationship between temperature and precipitation in different range is analyzed. The curve relates daily precipitation extremes with local temperatures has a peak structure, increasing at the low-medium range of temperature variations but decreasing at high temperatures. The relationship between extreme precipitation is stronger in downtown than that in suburbs.

  10. Peak Detection Method Evaluation for Ion Mobility Spectrometry by Using Machine Learning Approaches

    DEFF Research Database (Denmark)

    Hauschild, Anne-Christin; Kopczynski, Dominik; D'Addario, Marianna

    2013-01-01

    machine learning methods exist, an inevitable preprocessing step is reliable and robust peak detection without manual intervention. In this work we evaluate four state-of-the-art approaches for automated IMS-based peak detection: local maxima search, watershed transformation with IPHEx, region......-merging with VisualNow, and peak model estimation (PME).We manually generated Metabolites 2013, 3 278 a gold standard with the aid of a domain expert (manual) and compare the performance of the four peak calling methods with respect to two distinct criteria. We first utilize established machine learning methods...

  11. Chemometric strategy for automatic chromatographic peak detection and background drift correction in chromatographic data.

    Science.gov (United States)

    Yu, Yong-Jie; Xia, Qiao-Ling; Wang, Sheng; Wang, Bing; Xie, Fu-Wei; Zhang, Xiao-Bing; Ma, Yun-Ming; Wu, Hai-Long

    2014-09-12

    Peak detection and background drift correction (BDC) are the key stages in using chemometric methods to analyze chromatographic fingerprints of complex samples. This study developed a novel chemometric strategy for simultaneous automatic chromatographic peak detection and BDC. A robust statistical method was used for intelligent estimation of instrumental noise level coupled with first-order derivative of chromatographic signal to automatically extract chromatographic peaks in the data. A local curve-fitting strategy was then employed for BDC. Simulated and real liquid chromatographic data were designed with various kinds of background drift and degree of overlapped chromatographic peaks to verify the performance of the proposed strategy. The underlying chromatographic peaks can be automatically detected and reasonably integrated by this strategy. Meanwhile, chromatograms with BDC can be precisely obtained. The proposed method was used to analyze a complex gas chromatography dataset that monitored quality changes in plant extracts during storage procedure. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Exploiting Speech Recognition Transcripts for Narrative Peak Detection in Short-Form Documentaries

    NARCIS (Netherlands)

    Larson, Martha; Jochems, Bart; Smits, Ewine; Ordelman, Roeland J.F.; Peters, Carol; Caputo, Barbara; Gonzalo, Julio

    2010-01-01

    Narrative peaks are points at which the viewer perceives a spike in the level of dramatic tension within the narrative flow of a video. This paper reports on four approaches to narrative peak detection in television documentaries that were developed by a joint team consisting of members from Delft

  13. Probabilistic model for untargeted peak detection in LC-MS using Bayesian statistics

    NARCIS (Netherlands)

    Woldegebriel, M.; Vivó-Truyols, G.

    2015-01-01

    We introduce a novel Bayesian probabilistic peak detection algorithm for liquid chromatography mass spectroscopy (LC-MS). The final probabilistic result allows the user to make a final decision about which points in a 2 chromatogram are affected by a chromatographic peak and which ones are only

  14. Comparative analysis of peak-detection techniques for comprehensive two-dimensional chromatography.

    Science.gov (United States)

    Latha, Indu; Reichenbach, Stephen E; Tao, Qingping

    2011-09-23

    Comprehensive two-dimensional gas chromatography (GC×GC) is a powerful technology for separating complex samples. The typical goal of GC×GC peak detection is to aggregate data points of analyte peaks based on their retention times and intensities. Two techniques commonly used for two-dimensional peak detection are the two-step algorithm and the watershed algorithm. A recent study [4] compared the performance of the two-step and watershed algorithms for GC×GC data with retention-time shifts in the second-column separations. In that analysis, the peak retention-time shifts were corrected while applying the two-step algorithm but the watershed algorithm was applied without shift correction. The results indicated that the watershed algorithm has a higher probability of erroneously splitting a single two-dimensional peak than the two-step approach. This paper reconsiders the analysis by comparing peak-detection performance for resolved peaks after correcting retention-time shifts for both the two-step and watershed algorithms. Simulations with wide-ranging conditions indicate that when shift correction is employed with both algorithms, the watershed algorithm detects resolved peaks with greater accuracy than the two-step method. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. R Peak Detection Method Using Wavelet Transform and Modified Shannon Energy Envelope.

    Science.gov (United States)

    Park, Jeong-Seon; Lee, Sang-Woong; Park, Unsang

    2017-01-01

    Rapid automatic detection of the fiducial points-namely, the P wave, QRS complex, and T wave-is necessary for early detection of cardiovascular diseases (CVDs). In this paper, we present an R peak detection method using the wavelet transform (WT) and a modified Shannon energy envelope (SEE) for rapid ECG analysis. The proposed WTSEE algorithm performs a wavelet transform to reduce the size and noise of ECG signals and creates SEE after first-order differentiation and amplitude normalization. Subsequently, the peak energy envelope (PEE) is extracted from the SEE. Then, R peaks are estimated from the PEE, and the estimated peaks are adjusted from the input ECG. Finally, the algorithm generates the final R features by validating R-R intervals and updating the extracted R peaks. The proposed R peak detection method was validated using 48 first-channel ECG records of the MIT-BIH arrhythmia database with a sensitivity of 99.93%, positive predictability of 99.91%, detection error rate of 0.16%, and accuracy of 99.84%. Considering the high detection accuracy and fast processing speed due to the wavelet transform applied before calculating SEE, the proposed method is highly effective for real-time applications in early detection of CVDs.

  16. Feature selection and classifier parameters estimation for EEG signals peak detection using particle swarm optimization.

    Science.gov (United States)

    Adam, Asrul; Shapiai, Mohd Ibrahim; Tumari, Mohd Zaidi Mohd; Mohamad, Mohd Saberi; Mubin, Marizan

    2014-01-01

    Electroencephalogram (EEG) signal peak detection is widely used in clinical applications. The peak point can be detected using several approaches, including time, frequency, time-frequency, and nonlinear domains depending on various peak features from several models. However, there is no study that provides the importance of every peak feature in contributing to a good and generalized model. In this study, feature selection and classifier parameters estimation based on particle swarm optimization (PSO) are proposed as a framework for peak detection on EEG signals in time domain analysis. Two versions of PSO are used in the study: (1) standard PSO and (2) random asynchronous particle swarm optimization (RA-PSO). The proposed framework tries to find the best combination of all the available features that offers good peak detection and a high classification rate from the results in the conducted experiments. The evaluation results indicate that the accuracy of the peak detection can be improved up to 99.90% and 98.59% for training and testing, respectively, as compared to the framework without feature selection adaptation. Additionally, the proposed framework based on RA-PSO offers a better and reliable classification rate as compared to standard PSO as it produces low variance model.

  17. Inductively coupled plasma emission spectrometric detection of simulated high performance liquid chromatographic peaks

    International Nuclear Information System (INIS)

    Fraley, D.M.; Yates, D.; Manahan, S.E.

    1979-01-01

    Because of its multielement capability, element-specificity, and low detection limits, inductively coupled plasma optical emission spectrometry (ICP) is a very promising technique for the detection of specific elemental species separated by high performance liquid chromatography (HPLC). This paper evaluated ICP as a detector for HPLC peaks containing specific elements. Detection limits for a number of elements have been evaluated in terms of the minimum detectable concentration of the element at the chromatographic peak maximum. The elements studies were Al, As, B, Ba, Ca, Cd, Co, Cr, Cu, Fe, K, Li, Mg, Mn, Mo, Na, Ni, P, Pb, Sb, Se, Sr, Ti, V, and Zn. In addition, ICP was compared with atomic absorption spectrometry for the detection of HPLC peaks composed of EDTA and NTA chelates of copper. Furthermore, ICP was compared to uv solution absorption for the detection of copper chelates. 6 figures, 4 tables

  18. ASPeak: an abundance sensitive peak detection algorithm for RIP-Seq.

    Science.gov (United States)

    Kucukural, Alper; Özadam, Hakan; Singh, Guramrit; Moore, Melissa J; Cenik, Can

    2013-10-01

    Unlike DNA, RNA abundances can vary over several orders of magnitude. Thus, identification of RNA-protein binding sites from high-throughput sequencing data presents unique challenges. Although peak identification in ChIP-Seq data has been extensively explored, there are few bioinformatics tools tailored for peak calling on analogous datasets for RNA-binding proteins. Here we describe ASPeak (abundance sensitive peak detection algorithm), an implementation of an algorithm that we previously applied to detect peaks in exon junction complex RNA immunoprecipitation in tandem experiments. Our peak detection algorithm yields stringent and robust target sets enabling sensitive motif finding and downstream functional analyses. ASPeak is implemented in Perl as a complete pipeline that takes bedGraph files as input. ASPeak implementation is freely available at https://sourceforge.net/projects/as-peak under the GNU General Public License. ASPeak can be run on a personal computer, yet is designed to be easily parallelizable. ASPeak can also run on high performance computing clusters providing efficient speedup. The documentation and user manual can be obtained from http://master.dl.sourceforge.net/project/as-peak/manual.pdf.

  19. Modified automatic R-peak detection algorithm for patients with epilepsy using a portable electrocardiogram recorder.

    Science.gov (United States)

    Jeppesen, J; Beniczky, S; Fuglsang Frederiksen, A; Sidenius, P; Johansen, P

    2017-07-01

    Earlier studies have shown that short term heart rate variability (HRV) analysis of ECG seems promising for detection of epileptic seizures. A precise and accurate automatic R-peak detection algorithm is a necessity in a real-time, continuous measurement of HRV, in a portable ECG device. We used the portable CE marked ePatch® heart monitor to record the ECG of 14 patients, who were enrolled in the videoEEG long term monitoring unit for clinical workup of epilepsy. Recordings of the first 7 patients were used as training set of data for the R-peak detection algorithm and the recordings of the last 7 patients (467.6 recording hours) were used to test the performance of the algorithm. We aimed to modify an existing QRS-detection algorithm to a more precise R-peak detection algorithm to avoid the possible jitter Qand S-peaks can create in the tachogram, which causes error in short-term HRVanalysis. The proposed R-peak detection algorithm showed a high sensitivity (Se = 99.979%) and positive predictive value (P+ = 99.976%), which was comparable with a previously published QRS-detection algorithm for the ePatch® ECG device, when testing the same dataset. The novel R-peak detection algorithm designed to avoid jitter has very high sensitivity and specificity and thus is a suitable tool for a robust, fast, real-time HRV-analysis in patients with epilepsy, creating the possibility for real-time seizure detection for these patients.

  20. Evaluation of the peak MA-6600L microwave motion detection system

    International Nuclear Information System (INIS)

    1979-02-01

    A series of tests was performed on the Peak MA-6600L motion detection system. The primary objectives of these tests were to determine sensor detection patterns and to quantitate the effects of intruder velocity. System susceptibility to fluorescent lights, oscillatory motion, and environmental factors was also examined

  1. A wavelet transform algorithm for peak detection and application to powder x-ray diffraction data.

    Science.gov (United States)

    Gregoire, John M; Dale, Darren; van Dover, R Bruce

    2011-01-01

    Peak detection is ubiquitous in the analysis of spectral data. While many noise-filtering algorithms and peak identification algorithms have been developed, recent work [P. Du, W. Kibbe, and S. Lin, Bioinformatics 22, 2059 (2006); A. Wee, D. Grayden, Y. Zhu, K. Petkovic-Duran, and D. Smith, Electrophoresis 29, 4215 (2008)] has demonstrated that both of these tasks are efficiently performed through analysis of the wavelet transform of the data. In this paper, we present a wavelet-based peak detection algorithm with user-defined parameters that can be readily applied to the application of any spectral data. Particular attention is given to the algorithm's resolution of overlapping peaks. The algorithm is implemented for the analysis of powder diffraction data, and successful detection of Bragg peaks is demonstrated for both low signal-to-noise data from theta-theta diffraction of nanoparticles and combinatorial x-ray diffraction data from a composition spread thin film. These datasets have different types of background signals which are effectively removed in the wavelet-based method, and the results demonstrate that the algorithm provides a robust method for automated peak detection.

  2. Adaptive Fourier decomposition based R-peak detection for noisy ECG Signals.

    Science.gov (United States)

    Ze Wang; Chi Man Wong; Feng Wan

    2017-07-01

    An adaptive Fourier decomposition (AFD) based R-peak detection method is proposed for noisy ECG signals. Although lots of QRS detection methods have been proposed in literature, most detection methods require high signal quality. The proposed method extracts the R waves from the energy domain using the AFD and determines the R-peak locations based on the key decomposition parameters, achieving the denoising and the R-peak detection at the same time. Validated by clinical ECG signals in the MIT-BIH Arrhythmia Database, the proposed method shows better performance than the Pan-Tompkin (PT) algorithm in both situations of a native PT and the PT with a denoising process.

  3. An R-peak detection method that uses an SVD filter and a search back system.

    Science.gov (United States)

    Jung, Woo-Hyuk; Lee, Sang-Goog

    2012-12-01

    In this paper, we present a method for detecting the R-peak of an ECG signal by using an singular value decomposition (SVD) filter and a search back system. The ECG signal was detected in two phases: the pre-processing phase and the decision phase. The pre-processing phase consisted of the stages for the SVD filter, Butterworth High Pass Filter (HPF), moving average (MA), and squaring, whereas the decision phase consisted of a single stage that detected the R-peak. In the pre-processing phase, the SVD filter removed noise while the Butterworth HPF eliminated baseline wander. The MA removed the remaining noise of the signal that had gone through the SVD filter to make the signal smooth, and squaring played a role in strengthening the signal. In the decision phase, the threshold was used to set the interval before detecting the R-peak. When the latest R-R interval (RRI), suggested by Hamilton et al., was greater than 150% of the previous RRI, the method of detecting the R-peak in such an interval was modified to be 150% or greater than the smallest interval of the two most latest RRIs. When the modified search back system was used, the error rate of the peak detection decreased to 0.29%, compared to 1.34% when the modified search back system was not used. Consequently, the sensitivity was 99.47%, the positive predictivity was 99.47%, and the detection error was 1.05%. Furthermore, the quality of the signal in data with a substantial amount of noise was improved, and thus, the R-peak was detected effectively. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  4. A semi-automatic method for peak and valley detection in free-breathing respiratory waveforms

    International Nuclear Information System (INIS)

    Lu Wei; Nystrom, Michelle M.; Parikh, Parag J.; Fooshee, David R.; Hubenschmidt, James P.; Bradley, Jeffrey D.; Low, Daniel A.

    2006-01-01

    The existing commercial software often inadequately determines respiratory peaks for patients in respiration correlated computed tomography. A semi-automatic method was developed for peak and valley detection in free-breathing respiratory waveforms. First the waveform is separated into breath cycles by identifying intercepts of a moving average curve with the inspiration and expiration branches of the waveform. Peaks and valleys were then defined, respectively, as the maximum and minimum between pairs of alternating inspiration and expiration intercepts. Finally, automatic corrections and manual user interventions were employed. On average for each of the 20 patients, 99% of 307 peaks and valleys were automatically detected in 2.8 s. This method was robust for bellows waveforms with large variations

  5. Autopiquer - a Robust and Reliable Peak Detection Algorithm for Mass Spectrometry.

    Science.gov (United States)

    Kilgour, David P A; Hughes, Sam; Kilgour, Samantha L; Mackay, C Logan; Palmblad, Magnus; Tran, Bao Quoc; Goo, Young Ah; Ernst, Robert K; Clarke, David J; Goodlett, David R

    2017-02-01

    We present a simple algorithm for robust and unsupervised peak detection by determining a noise threshold in isotopically resolved mass spectrometry data. Solving this problem will greatly reduce the subjective and time-consuming manual picking of mass spectral peaks and so will prove beneficial in many research applications. The Autopiquer approach uses autocorrelation to test for the presence of (isotopic) structure in overlapping windows across the spectrum. Within each window, a noise threshold is optimized to remove the most unstructured data, whilst keeping as much of the (isotopic) structure as possible. This algorithm has been successfully demonstrated for both peak detection and spectral compression on data from many different classes of mass spectrometer and for different sample types, and this approach should also be extendible to other types of data that contain regularly spaced discrete peaks. Graphical Abstract ᅟ.

  6. Method and apparatus for clockless analog-to-digital conversion and peak detection

    Science.gov (United States)

    DeGeronimo, Gianluigi

    2007-03-06

    An apparatus and method for analog-to-digital conversion and peak detection includes at least one stage, which includes a first switch, second switch, current source or capacitor, and discriminator. The discriminator changes state in response to a current or charge associated with the input signal exceeding a threshold, thereby indicating whether the current or charge associated with the input signal is greater than the threshold. The input signal includes a peak or a charge, and the converter includes a peak or charge detect mode in which a state of the switch is retained in response to a decrease in the current or charge associated with the input signal. The state of the switch represents at least a portion of a value of the peak or of the charge.

  7. ICPD-a new peak detection algorithm for LC/MS.

    Science.gov (United States)

    Zhang, Jianqiu; Haskins, William

    2010-12-01

    The identification and quantification of proteins using label-free Liquid Chromatography/Mass Spectrometry (LC/MS) play crucial roles in biological and biomedical research. Increasing evidence has shown that biomarkers are often low abundance proteins. However, LC/MS systems are subject to considerable noise and sample variability, whose statistical characteristics are still elusive, making computational identification of low abundance proteins extremely challenging. As a result, the inability of identifying low abundance proteins in a proteomic study is the main bottleneck in protein biomarker discovery. In this paper, we propose a new peak detection method called Information Combining Peak Detection (ICPD ) for high resolution LC/MS. In LC/MS, peptides elute during a certain time period and as a result, peptide isotope patterns are registered in multiple MS scans. The key feature of the new algorithm is that the observed isotope patterns registered in multiple scans are combined together for estimating the likelihood of the peptide existence. An isotope pattern matching score based on the likelihood probability is provided and utilized for peak detection. The performance of the new algorithm is evaluated based on protein standards with 48 known proteins. The evaluation shows better peak detection accuracy for low abundance proteins than other LC/MS peak detection methods.

  8. Low-complexity R-peak detection for ambulatory fetal monitoring

    International Nuclear Information System (INIS)

    Rooijakkers, Michael J; Rabotti, Chiara; Mischi, Massimo; Oei, S Guid

    2012-01-01

    Non-invasive fetal health monitoring during pregnancy is becoming increasingly important because of the increasing number of high-risk pregnancies. Despite recent advances in signal-processing technology, which have enabled fetal monitoring during pregnancy using abdominal electrocardiogram (ECG) recordings, ubiquitous fetal health monitoring is still unfeasible due to the computational complexity of noise-robust solutions. In this paper, an ECG R-peak detection algorithm for ambulatory R-peak detection is proposed, as part of a fetal ECG detection algorithm. The proposed algorithm is optimized to reduce computational complexity, without reducing the R-peak detection performance compared to the existing R-peak detection schemes. Validation of the algorithm is performed on three manually annotated datasets. With a detection error rate of 0.23%, 1.32% and 9.42% on the MIT/BIH Arrhythmia and in-house maternal and fetal databases, respectively, the detection rate of the proposed algorithm is comparable to the best state-of-the-art algorithms, at a reduced computational complexity. (paper)

  9. Low-complexity R-peak detection for ambulatory fetal monitoring.

    Science.gov (United States)

    Rooijakkers, Michael J; Rabotti, Chiara; Oei, S Guid; Mischi, Massimo

    2012-07-01

    Non-invasive fetal health monitoring during pregnancy is becoming increasingly important because of the increasing number of high-risk pregnancies. Despite recent advances in signal-processing technology, which have enabled fetal monitoring during pregnancy using abdominal electrocardiogram (ECG) recordings, ubiquitous fetal health monitoring is still unfeasible due to the computational complexity of noise-robust solutions. In this paper, an ECG R-peak detection algorithm for ambulatory R-peak detection is proposed, as part of a fetal ECG detection algorithm. The proposed algorithm is optimized to reduce computational complexity, without reducing the R-peak detection performance compared to the existing R-peak detection schemes. Validation of the algorithm is performed on three manually annotated datasets. With a detection error rate of 0.23%, 1.32% and 9.42% on the MIT/BIH Arrhythmia and in-house maternal and fetal databases, respectively, the detection rate of the proposed algorithm is comparable to the best state-of-the-art algorithms, at a reduced computational complexity.

  10. Improved Peak Detection and Deconvolution of Native Electrospray Mass Spectra from Large Protein Complexes.

    Science.gov (United States)

    Lu, Jonathan; Trnka, Michael J; Roh, Soung-Hun; Robinson, Philip J J; Shiau, Carrie; Fujimori, Danica Galonic; Chiu, Wah; Burlingame, Alma L; Guan, Shenheng

    2015-12-01

    Native electrospray-ionization mass spectrometry (native MS) measures biomolecules under conditions that preserve most aspects of protein tertiary and quaternary structure, enabling direct characterization of large intact protein assemblies. However, native spectra derived from these assemblies are often partially obscured by low signal-to-noise as well as broad peak shapes because of residual solvation and adduction after the electrospray process. The wide peak widths together with the fact that sequential charge state series from highly charged ions are closely spaced means that native spectra containing multiple species often suffer from high degrees of peak overlap or else contain highly interleaved charge envelopes. This situation presents a challenge for peak detection, correct charge state and charge envelope assignment, and ultimately extraction of the relevant underlying mass values of the noncovalent assemblages being investigated. In this report, we describe a comprehensive algorithm developed for addressing peak detection, peak overlap, and charge state assignment in native mass spectra, called PeakSeeker. Overlapped peaks are detected by examination of the second derivative of the raw mass spectrum. Charge state distributions of the molecular species are determined by fitting linear combinations of charge envelopes to the overall experimental mass spectrum. This software is capable of deconvoluting heterogeneous, complex, and noisy native mass spectra of large protein assemblies as demonstrated by analysis of (1) synthetic mononucleosomes containing severely overlapping peaks, (2) an RNA polymerase II/α-amanitin complex with many closely interleaved ion signals, and (3) human TriC complex containing high levels of background noise. Graphical Abstract ᅟ.

  11. Fast Metabolite Identification in Nuclear Magnetic Resonance Metabolomic Studies: Statistical Peak Sorting and Peak Overlap Detection for More Reliable Database Queries.

    Science.gov (United States)

    Hoijemberg, Pablo A; Pelczer, István

    2018-01-05

    A lot of time is spent by researchers in the identification of metabolites in NMR-based metabolomic studies. The usual metabolite identification starts employing public or commercial databases to match chemical shifts thought to belong to a given compound. Statistical total correlation spectroscopy (STOCSY), in use for more than a decade, speeds the process by finding statistical correlations among peaks, being able to create a better peak list as input for the database query. However, the (normally not automated) analysis becomes challenging due to the intrinsic issue of peak overlap, where correlations of more than one compound appear in the STOCSY trace. Here we present a fully automated methodology that analyzes all STOCSY traces at once (every peak is chosen as driver peak) and overcomes the peak overlap obstacle. Peak overlap detection by clustering analysis and sorting of traces (POD-CAST) first creates an overlap matrix from the STOCSY traces, then clusters the overlap traces based on their similarity and finally calculates a cumulative overlap index (COI) to account for both strong and intermediate correlations. This information is gathered in one plot to help the user identify the groups of peaks that would belong to a single molecule and perform a more reliable database query. The simultaneous examination of all traces reduces the time of analysis, compared to viewing STOCSY traces by pairs or small groups, and condenses the redundant information in the 2D STOCSY matrix into bands containing similar traces. The COI helps in the detection of overlapping peaks, which can be added to the peak list from another cross-correlated band. POD-CAST overcomes the generally overlooked and underestimated presence of overlapping peaks and it detects them to include them in the search of all compounds contributing to the peak overlap, enabling the user to accelerate the metabolite identification process with more successful database queries and searching all tentative

  12. Ship Analysis and Detection in High-resolution Pol-SAR Imagery Based on Peak Zone

    Directory of Open Access Journals (Sweden)

    Xu Cheng-bin

    2015-06-01

    Full Text Available To deal with the problem of false alarm in the ship detection, a method base on proportion of spiral scattering in the peak zone is proposed. By comparing the proportion of spiral scattering in the peak zone, which is available from Krogager decomposition, the ships and interfering targets are identified and analyzed. The effectiveness of this method is justified with C-band full-polarization data from RADARSAT-2. The result show that this method can discriminate ships from interfering targets such as island, water-break, nautical platforms and bridges, thus reducing the false alarm rate of ship targets detection in SAR images.

  13. Automated Peak Detection and Matching Algorithm for Gas Chromatography–Differential Mobility Spectrometry

    Science.gov (United States)

    Fong, Sim S.; Rearden, Preshious; Kanchagar, Chitra; Sassetti, Christopher; Trevejo, Jose; Brereton, Richard G.

    2013-01-01

    A gas chromatography–differential mobility spectrometer (GC-DMS) involves a portable and selective mass analyzer that may be applied to chemical detection in the field. Existing approaches examine whole profiles and do not attempt to resolve peaks. A new approach for peak detection in the 2D GC-DMS chromatograms is reported. This method is demonstrated on three case studies: a simulated case study; a case study of headspace gas analysis of Mycobacterium tuberculosis (MTb) cultures consisting of three matching GC-DMS and GC-MS chromatograms; a case study consisting of 41 GC-DMS chromatograms of headspace gas analysis of MTb culture and media. PMID:21204557

  14. Peptide Peak Detection for Low Resolution MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Yao, Jingwen; Utsunomiya, Shin-Ichi; Kajihara, Shigeki; Tabata, Tsuyoshi; Aoshima, Ken; Oda, Yoshiya; Tanaka, Koichi

    2014-01-01

    A new peak detection method has been developed for rapid selection of peptide and its fragment ion peaks for protein identification using tandem mass spectrometry. The algorithm applies classification of peak intensities present in the defined mass range to determine the noise level. A threshold is then given to select ion peaks according to the determined noise level in each mass range. This algorithm was initially designed for the peak detection of low resolution peptide mass spectra, such as matrix-assisted laser desorption/ionization Time-of-Flight (MALDI-TOF) mass spectra. But it can also be applied to other type of mass spectra. This method has demonstrated obtaining a good rate of number of real ions to noises for even poorly fragmented peptide spectra. The effect of using peak lists generated from this method produces improved protein scores in database search results. The reliability of the protein identifications is increased by finding more peptide identifications. This software tool is freely available at the Mass++ home page (http://www.first-ms3d.jp/english/achievement/software/).

  15. Peaked signals from dark matter velocity structures in direct detection experiments

    International Nuclear Information System (INIS)

    Lang, Rafael F.; Weiner, Neal

    2010-01-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies E R . The peaks of such signals are typically fairly broad, with ΔE R /E peak ∼ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape

  16. Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

    Science.gov (United States)

    Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

    2012-01-01

    Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

  17. Peak detection method evaluation for ion mobility spectrometry by using machine learning approaches.

    Science.gov (United States)

    Hauschild, Anne-Christin; Kopczynski, Dominik; D'Addario, Marianna; Baumbach, Jörg Ingo; Rahmann, Sven; Baumbach, Jan

    2013-04-16

    Ion mobility spectrometry with pre-separation by multi-capillary columns (MCC/IMS) has become an established inexpensive, non-invasive bioanalytics technology for detecting volatile organic compounds (VOCs) with various metabolomics applications in medical research. To pave the way for this technology towards daily usage in medical practice, different steps still have to be taken. With respect to modern biomarker research, one of the most important tasks is the automatic classification of patient-specific data sets into different groups, healthy or not, for instance. Although sophisticated machine learning methods exist, an inevitable preprocessing step is reliable and robust peak detection without manual intervention. In this work we evaluate four state-of-the-art approaches for automated IMS-based peak detection: local maxima search, watershed transformation with IPHEx, region-merging with VisualNow, and peak model estimation (PME).We manually generated Metabolites 2013, 3 278 a gold standard with the aid of a domain expert (manual) and compare the performance of the four peak calling methods with respect to two distinct criteria. We first utilize established machine learning methods and systematically study their classification performance based on the four peak detectors' results. Second, we investigate the classification variance and robustness regarding perturbation and overfitting. Our main finding is that the power of the classification accuracy is almost equally good for all methods, the manually created gold standard as well as the four automatic peak finding methods. In addition, we note that all tools, manual and automatic, are similarly robust against perturbations. However, the classification performance is more robust against overfitting when using the PME as peak calling preprocessor. In summary, we conclude that all methods, though small differences exist, are largely reliable and enable a wide spectrum of real-world biomedical applications.

  18. Probability of failure of the watershed algorithm for peak detection in comprehensive two-dimensional chromatography

    NARCIS (Netherlands)

    Vivó-Truyols, G.; Janssen, H.-G.

    2010-01-01

    The watershed algorithm is the most common method used for peak detection and integration In two-dimensional chromatography However, the retention time variability in the second dimension may render the algorithm to fail A study calculating the probabilities of failure of the watershed algorithm was

  19. A novel fast phase correlation algorithm for peak wavelength detection of Fiber Bragg Grating sensors.

    Science.gov (United States)

    Lamberti, A; Vanlanduit, S; De Pauw, B; Berghmans, F

    2014-03-24

    Fiber Bragg Gratings (FBGs) can be used as sensors for strain, temperature and pressure measurements. For this purpose, the ability to determine the Bragg peak wavelength with adequate wavelength resolution and accuracy is essential. However, conventional peak detection techniques, such as the maximum detection algorithm, can yield inaccurate and imprecise results, especially when the Signal to Noise Ratio (SNR) and the wavelength resolution are poor. Other techniques, such as the cross-correlation demodulation algorithm are more precise and accurate but require a considerable higher computational effort. To overcome these problems, we developed a novel fast phase correlation (FPC) peak detection algorithm, which computes the wavelength shift in the reflected spectrum of a FBG sensor. This paper analyzes the performance of the FPC algorithm for different values of the SNR and wavelength resolution. Using simulations and experiments, we compared the FPC with the maximum detection and cross-correlation algorithms. The FPC method demonstrated a detection precision and accuracy comparable with those of cross-correlation demodulation and considerably higher than those obtained with the maximum detection technique. Additionally, FPC showed to be about 50 times faster than the cross-correlation. It is therefore a promising tool for future implementation in real-time systems or in embedded hardware intended for FBG sensor interrogation.

  20. Peaked signals from dark matter velocity structures in direct detection experiments

    Science.gov (United States)

    Lang, Rafael F.; Weiner, Neal

    2010-06-01

    In direct dark matter detection experiments, conventional elastic scattering of WIMPs results in exponentially falling recoil spectra. In contrast, theories of WIMPs with excited states can lead to nuclear recoil spectra that peak at finite recoil energies ER. The peaks of such signals are typically fairly broad, with ΔER/Epeak ~ 1. We show that in the presence of dark matter structures with low velocity dispersion, such as streams or clumps, peaks from up-scattering can become extremely narrow with FWHM of a few keV only. This differs dramatically from the conventionally expected WIMP spectrum and would, once detected, open the possibility to measure the dark matter velocity structure with high accuracy. As an intriguing example, we confront the observed cluster of 3 events near 42 keV from the CRESST commissioning run with this scenario. Inelastic dark matter particles with a wide range of parameters are capable of producing such a narrow peak. We calculate the possible signals at other experiments, and find that such particles could also give rise to the signal at DAMA, although not from the same stream. Over some range of parameters, a signal would be visible at xenon experiments. We show that such dark matter peaks are a very clear signal and can be easily disentangled from potential backgrounds, both terrestrial or due to WIMP down-scattering, by an enhanced annual modulation in both the amplitude of the signal and its spectral shape.

  1. Systolic peak detection in acceleration photoplethysmograms measured from emergency responders in tropical conditions.

    Science.gov (United States)

    Elgendi, Mohamed; Norton, Ian; Brearley, Matt; Abbott, Derek; Schuurmans, Dale

    2013-01-01

    Photoplethysmogram (PPG) monitoring is not only essential for critically ill patients in hospitals or at home, but also for those undergoing exercise testing. However, processing PPG signals measured after exercise is challenging, especially if the environment is hot and humid. In this paper, we propose a novel algorithm that can detect systolic peaks under challenging conditions, as in the case of emergency responders in tropical conditions. Accurate systolic-peak detection is an important first step for the analysis of heart rate variability. Algorithms based on local maxima-minima, first-derivative, and slope sum are evaluated, and a new algorithm is introduced to improve the detection rate. With 40 healthy subjects, the new algorithm demonstrates the highest overall detection accuracy (99.84% sensitivity, 99.89% positive predictivity). Existing algorithms, such as Billauer's, Li's and Zong's, have comparable although lower accuracy. However, the proposed algorithm presents an advantage for real-time applications by avoiding human intervention in threshold determination. For best performance, we show that a combination of two event-related moving averages with an offset threshold has an advantage in detecting systolic peaks, even in heat-stressed PPG signals.

  2. A Fiber Bragg Grating Interrogation System with Self-Adaption Threshold Peak Detection Algorithm.

    Science.gov (United States)

    Zhang, Weifang; Li, Yingwu; Jin, Bo; Ren, Feifei; Wang, Hongxun; Dai, Wei

    2018-04-08

    A Fiber Bragg Grating (FBG) interrogation system with a self-adaption threshold peak detection algorithm is proposed and experimentally demonstrated in this study. This system is composed of a field programmable gate array (FPGA) and advanced RISC machine (ARM) platform, tunable Fabry-Perot (F-P) filter and optical switch. To improve system resolution, the F-P filter was employed. As this filter is non-linear, this causes the shifting of central wavelengths with the deviation compensated by the parts of the circuit. Time-division multiplexing (TDM) of FBG sensors is achieved by an optical switch, with the system able to realize the combination of 256 FBG sensors. The wavelength scanning speed of 800 Hz can be achieved by a FPGA+ARM platform. In addition, a peak detection algorithm based on a self-adaption threshold is designed and the peak recognition rate is 100%. Experiments with different temperatures were conducted to demonstrate the effectiveness of the system. Four FBG sensors were examined in the thermal chamber without stress. When the temperature changed from 0 °C to 100 °C, the degree of linearity between central wavelengths and temperature was about 0.999 with the temperature sensitivity being 10 pm/°C. The static interrogation precision was able to reach 0.5 pm. Through the comparison of different peak detection algorithms and interrogation approaches, the system was verified to have an optimum comprehensive performance in terms of precision, capacity and speed.

  3. A non-linear algorithm for current signal filtering and peak detection in SiPM

    International Nuclear Information System (INIS)

    Putignano, M; Intermite, A; Welsch, C P

    2012-01-01

    Read-out of Silicon Photomultipliers is commonly achieved by means of charge integration, a method particularly susceptible to after-pulsing noise and not efficient for low level light signals. Current signal monitoring, characterized by easier electronic implementation and intrinsically faster than charge integration, is also more suitable for low level light signals and can potentially result in much decreased after-pulsing noise effects. However, its use is to date limited by the need of developing a suitable read-out algorithm for signal analysis and filtering able to achieve current peak detection and measurement with the needed precision and accuracy. In this paper we present an original algorithm, based on a piecewise linear-fitting approach, to filter the noise of the current signal and hence efficiently identifying and measuring current peaks. The proposed algorithm is then compared with the optimal linear filtering algorithm for time-encoded peak detection, based on a moving average routine, and assessed in terms of accuracy, precision, and peak detection efficiency, demonstrating improvements of 1÷2 orders of magnitude in all these quality factors.

  4. An Adaptive and Time-Efficient ECG R-Peak Detection Algorithm.

    Science.gov (United States)

    Qin, Qin; Li, Jianqing; Yue, Yinggao; Liu, Chengyu

    2017-01-01

    R-peak detection is crucial in electrocardiogram (ECG) signal analysis. This study proposed an adaptive and time-efficient R-peak detection algorithm for ECG processing. First, wavelet multiresolution analysis was applied to enhance the ECG signal representation. Then, ECG was mirrored to convert large negative R-peaks to positive ones. After that, local maximums were calculated by the first-order forward differential approach and were truncated by the amplitude and time interval thresholds to locate the R-peaks. The algorithm performances, including detection accuracy and time consumption, were tested on the MIT-BIH arrhythmia database and the QT database. Experimental results showed that the proposed algorithm achieved mean sensitivity of 99.39%, positive predictivity of 99.49%, and accuracy of 98.89% on the MIT-BIH arrhythmia database and 99.83%, 99.90%, and 99.73%, respectively, on the QT database. By processing one ECG record, the mean time consumptions were 0.872 s and 0.763 s for the MIT-BIH arrhythmia database and QT database, respectively, yielding 30.6% and 32.9% of time reduction compared to the traditional Pan-Tompkins method.

  5. A Fiber Bragg Grating Interrogation System with Self-Adaption Threshold Peak Detection Algorithm

    Directory of Open Access Journals (Sweden)

    Weifang Zhang

    2018-04-01

    Full Text Available A Fiber Bragg Grating (FBG interrogation system with a self-adaption threshold peak detection algorithm is proposed and experimentally demonstrated in this study. This system is composed of a field programmable gate array (FPGA and advanced RISC machine (ARM platform, tunable Fabry–Perot (F–P filter and optical switch. To improve system resolution, the F–P filter was employed. As this filter is non-linear, this causes the shifting of central wavelengths with the deviation compensated by the parts of the circuit. Time-division multiplexing (TDM of FBG sensors is achieved by an optical switch, with the system able to realize the combination of 256 FBG sensors. The wavelength scanning speed of 800 Hz can be achieved by a FPGA+ARM platform. In addition, a peak detection algorithm based on a self-adaption threshold is designed and the peak recognition rate is 100%. Experiments with different temperatures were conducted to demonstrate the effectiveness of the system. Four FBG sensors were examined in the thermal chamber without stress. When the temperature changed from 0 °C to 100 °C, the degree of linearity between central wavelengths and temperature was about 0.999 with the temperature sensitivity being 10 pm/°C. The static interrogation precision was able to reach 0.5 pm. Through the comparison of different peak detection algorithms and interrogation approaches, the system was verified to have an optimum comprehensive performance in terms of precision, capacity and speed.

  6. Probabilistic peak detection in CE-LIF for STR DNA typing.

    Science.gov (United States)

    Woldegebriel, Michael; van Asten, Arian; Kloosterman, Ate; Vivó-Truyols, Gabriel

    2017-07-01

    In this work, we present a novel probabilistic peak detection algorithm based on a Bayesian framework for forensic DNA analysis. The proposed method aims at an exhaustive use of raw electropherogram data from a laser-induced fluorescence multi-CE system. As the raw data are informative up to a single data point, the conventional threshold-based approaches discard relevant forensic information early in the data analysis pipeline. Our proposed method assigns a posterior probability reflecting the data point's relevance with respect to peak detection criteria. Peaks of low intensity generated from a truly existing allele can thus constitute evidential value instead of fully discarding them and contemplating a potential allele drop-out. This way of working utilizes the information available within each individual data point and thus avoids making early (binary) decisions on the data analysis that can lead to error propagation. The proposed method was tested and compared to the application of a set threshold as is current practice in forensic STR DNA profiling. The new method was found to yield a significant improvement in the number of alleles identified, regardless of the peak heights and deviation from Gaussian shape. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Probabilistic Model for Untargeted Peak Detection in LC-MS Using Bayesian Statistics.

    Science.gov (United States)

    Woldegebriel, Michael; Vivó-Truyols, Gabriel

    2015-07-21

    We introduce a novel Bayesian probabilistic peak detection algorithm for liquid chromatography-mass spectroscopy (LC-MS). The final probabilistic result allows the user to make a final decision about which points in a chromatogram are affected by a chromatographic peak and which ones are only affected by noise. The use of probabilities contrasts with the traditional method in which a binary answer is given, relying on a threshold. By contrast, with the Bayesian peak detection presented here, the values of probability can be further propagated into other preprocessing steps, which will increase (or decrease) the importance of chromatographic regions into the final results. The present work is based on the use of the statistical overlap theory of component overlap from Davis and Giddings (Davis, J. M.; Giddings, J. Anal. Chem. 1983, 55, 418-424) as prior probability in the Bayesian formulation. The algorithm was tested on LC-MS Orbitrap data and was able to successfully distinguish chemical noise from actual peaks without any data preprocessing.

  8. Absolute peak detection efficiencies of a Ge(Li) detector for high gamma-ray energies

    International Nuclear Information System (INIS)

    Katagiri, Masaki

    1985-11-01

    Absolute peak detection efficiencies of a Ge(Li) detector for gamma-rays of 3.5 MeV to 12 MeV were measured using four (p,γ) reactions and a (n,γ) reaction. Two-line-method was used to obtaine peak detection efficiencies. The efficiencies with the both cases are agreed very well. Utilization of (n,γ) reaction is, therefore, effective for measuring these efficiencies, because high energy gamma-rays can be generated easily by using a neutron source. These results were applied to calibration of a gamma-ray standard source, emitting 6.13 MeV gamma-rays, and of intensities of 56 Co standard gamma-ray source. (author)

  9. DETECTION OF THE SECOND r-PROCESS PEAK ELEMENT TELLURIUM IN METAL-POOR STARS ,

    International Nuclear Information System (INIS)

    Roederer, Ian U.; Lawler, James E.; Cowan, John J.; Beers, Timothy C.; Frebel, Anna; Ivans, Inese I.; Schatz, Hendrik; Sobeck, Jennifer S.; Sneden, Christopher

    2012-01-01

    Using near-ultraviolet spectra obtained with the Space Telescope Imaging Spectrograph on board the Hubble Space Telescope, we detect neutral tellurium in three metal-poor stars enriched by products of r-process nucleosynthesis, BD +17 3248, HD 108317, and HD 128279. Tellurium (Te, Z = 52) is found at the second r-process peak (A ≈ 130) associated with the N = 82 neutron shell closure, and it has not been detected previously in Galactic halo stars. The derived tellurium abundances match the scaled solar system r-process distribution within the uncertainties, confirming the predicted second peak r-process residuals. These results suggest that tellurium is predominantly produced in the main component of the r-process, along with the rare earth elements.

  10. On the possibility of detecting peaks of radon concentration in working areas

    International Nuclear Information System (INIS)

    Madelaine, G.; Zettwoog, P.

    1979-01-01

    Four methods for the continuous measurement of radon concentration, are described. The first two are based on the measurement of the ionization produced by the gas α disintegration. The third one carries out scintillation measurement of radon present in a chamber. The fourth is based on the disintegration chamber principle. Concerning the possibility of detecting radon concentration peaks, the use of ionization detectors, after a feasibility study seems to be suitable

  11. Leveraging probabilistic peak detection to estimate baseline drift in complex chromatographic samples.

    Science.gov (United States)

    Lopatka, Martin; Barcaru, Andrei; Sjerps, Marjan J; Vivó-Truyols, Gabriel

    2016-01-29

    Accurate analysis of chromatographic data often requires the removal of baseline drift. A frequently employed strategy strives to determine asymmetric weights in order to fit a baseline model by regression. Unfortunately, chromatograms characterized by a very high peak saturation pose a significant challenge to such algorithms. In addition, a low signal-to-noise ratio (i.e. s/npeak detection algorithm. A posterior probability of being affected by a peak is computed for each point in the chromatogram, leading to a set of weights that allow non-iterative calculation of a baseline estimate. For extremely saturated chromatograms, the peak weighted (PW) method demonstrates notable improvement compared to the other methods examined. However, in chromatograms characterized by low-noise and well-resolved peaks, the asymmetric least squares (ALS) and the more sophisticated Mixture Model (MM) approaches achieve superior results in significantly less time. We evaluate the performance of these three baseline correction methods over a range of chromatographic conditions to demonstrate the cases in which each method is most appropriate. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. BinQuasi: a peak detection method for ChIP-sequencing data with biological replicates.

    Science.gov (United States)

    Goren, Emily; Liu, Peng; Wang, Chao; Wang, Chong

    2018-04-19

    ChIP-seq experiments that are aimed at detecting DNA-protein interactions require biological replication to draw inferential conclusions, however there is no current consensus on how to analyze ChIP-seq data with biological replicates. Very few methodologies exist for the joint analysis of replicated ChIP-seq data, with approaches ranging from combining the results of analyzing replicates individually to joint modeling of all replicates. Combining the results of individual replicates analyzed separately can lead to reduced peak classification performance compared to joint modeling. Currently available methods for joint analysis may fail to control the false discovery rate at the nominal level. We propose BinQuasi, a peak caller for replicated ChIP-seq data, that jointly models biological replicates using a generalized linear model framework and employs a one-sided quasi-likelihood ratio test to detect peaks. When applied to simulated data and real datasets, BinQuasi performs favorably compared to existing methods, including better control of false discovery rate than existing joint modeling approaches. BinQuasi offers a flexible approach to joint modeling of replicated ChIP-seq data which is preferable to combining the results of replicates analyzed individually. Source code is freely available for download at https://cran.r-project.org/package=BinQuasi, implemented in R. pliu@iastate.edu or egoren@iastate.edu. Supplementary material is available at Bioinformatics online.

  13. Detection of irradiated strawberries by identifying ESR peak of irradiated cellulose component

    International Nuclear Information System (INIS)

    Goto, Michiko; Tanabe, Hiroko

    2002-01-01

    The method of detecting low-dose irradiated strawberries by identifying ESR peak of irradiated cellulose component was studied. Ratio of peak height (S) of high magnetic field cellulose component, and noise width (N) of either irradiated or unirradiated seeds of strawberries were compared. In this study, sample was identified to be irradiated when S/N ratio of ESR spectrum of 4 min. sweep time was above 0.7. In the case of S/N ratio below 0.7, when the S/N ratio of integrated ESR spectrum, obtained from measuring 10 times with 1 min. sweep time was above 1.0, the sample was identified to be irradiated. The result suggests that S/N ratio is a good marker to detect the irradiation. The strawberries irradiated above 0.5kGy was able to be detected after 3 days storage at room temperature, after 21 days refrigeration and after 60 days freezing, respectively. (author)

  14. Dual-peak electrogenerated chemiluminescence of carbon dots for iron ions detection.

    Science.gov (United States)

    Zhang, Pengjia; Xue, Zhenjie; Luo, Dan; Yu, Wei; Guo, Zhihui; Wang, Tie

    2014-06-17

    Carbon dots (CDs) have rigorously been investigated on their unique fluorescent properties but rarely their electrogenerated chemiluminescence (ECL) behavior. We are here to report a dual-peak ECL system of CDs, one at -2.84 V (ECL-1) and the other at -1.71 V (ECL-2) during the cyclic sweep between -3.0 and 3.0 V at scan rate of 0.2 V s(-1) in 0.1 M tetrabutyl ammonium bromide (TBAB) ethanol solution, which is more efficiency to distinguish metallic ions than single-peak ECL. The electron transfer reaction between individual electrochemically reduced nanocrystal species and coreactants led to ECL-1, in which the electron injected to the conduction band of CDs in the cathodic process. Ion annihilation reactions induced direct formation of exciplexes that produced another ECL signal, ECL-2. ECL-1 showed higher sensitivity to the surrounding environment than ECL-2 and thus was used for ECL detection of metallic ions. Herein, we can serve as an internal standard method to detect iron ions. A linear relationship of the intensity ratio R of ECL-1 and ECL-2 to iron ions was observed in the concentration extending from 5 × 10(-6) to 8 × 10(-5) M with a detection limit of 7 × 10(-7) M.

  15. Multi-Scale Peak and Trough Detection Optimised for Periodic and Quasi-Periodic Neuroscience Data.

    Science.gov (United States)

    Bishop, Steven M; Ercole, Ari

    2018-01-01

    The reliable detection of peaks and troughs in physiological signals is essential to many investigative techniques in medicine and computational biology. Analysis of the intracranial pressure (ICP) waveform is a particular challenge due to multi-scale features, a changing morphology over time and signal-to-noise limitations. Here we present an efficient peak and trough detection algorithm that extends the scalogram approach of Scholkmann et al., and results in greatly improved algorithm runtime performance. Our improved algorithm (modified Scholkmann) was developed and analysed in MATLAB R2015b. Synthesised waveforms (periodic, quasi-periodic and chirp sinusoids) were degraded with white Gaussian noise to achieve signal-to-noise ratios down to 5 dB and were used to compare the performance of the original Scholkmann and modified Scholkmann algorithms. The modified Scholkmann algorithm has false-positive (0%) and false-negative (0%) detection rates identical to the original Scholkmann when applied to our test suite. Actual compute time for a 200-run Monte Carlo simulation over a multicomponent noisy test signal was 40.96 ± 0.020 s (mean ± 95%CI) for the original Scholkmann and 1.81 ± 0.003 s (mean ± 95%CI) for the modified Scholkmann, demonstrating the expected improvement in runtime complexity from [Formula: see text] to [Formula: see text]. The accurate interpretation of waveform data to identify peaks and troughs is crucial in signal parameterisation, feature extraction and waveform identification tasks. Modification of a standard scalogram technique has produced a robust algorithm with linear computational complexity that is particularly suited to the challenges presented by large, noisy physiological datasets. The algorithm is optimised through a single parameter and can identify sub-waveform features with minimal additional overhead, and is easily adapted to run in real time on commodity hardware.

  16. A novel peak detection approach with chemical noise removal using short-time FFT for prOTOF MS data.

    Science.gov (United States)

    Zhang, Shuqin; Wang, Honghui; Zhou, Xiaobo; Hoehn, Gerard T; DeGraba, Thomas J; Gonzales, Denise A; Suffredini, Anthony F; Ching, Wai-Ki; Ng, Michael K; Wong, Stephen T C

    2009-08-01

    Peak detection is a pivotal first step in biomarker discovery from MS data and can significantly influence the results of downstream data analysis steps. We developed a novel automatic peak detection method for prOTOF MS data, which does not require a priori knowledge of protein masses. Random noise is removed by an undecimated wavelet transform and chemical noise is attenuated by an adaptive short-time discrete Fourier transform. Isotopic peaks corresponding to a single protein are combined by extracting an envelope over them. Depending on the S/N, the desired peaks in each individual spectrum are detected and those with the highest intensity among their peak clusters are recorded. The common peaks among all the spectra are identified by choosing an appropriate cut-off threshold in the complete linkage hierarchical clustering. To remove the 1 Da shifting of the peaks, the peak corresponding to the same protein is determined as the detected peak with the largest number among its neighborhood. We validated this method using a data set of serial peptide and protein calibration standards. Compared with MoverZ program, our new method detects more peaks and significantly enhances S/N of the peak after the chemical noise removal. We then successfully applied this method to a data set from prOTOF MS spectra of albumin and albumin-bound proteins from serum samples of 59 patients with carotid artery disease compared to vascular disease-free patients to detect peaks with S/N> or =2. Our method is easily implemented and is highly effective to define peaks that will be used for disease classification or to highlight potential biomarkers.

  17. A fast high-voltage current-peak detection system for the ALICE transition radiation detector

    Energy Technology Data Exchange (ETDEWEB)

    Verclas, Robert [Physikalisches Institut, Ruprecht-Karls-Universitaet Heidelberg (Germany); Collaboration: ALICE-Collaboration

    2016-07-01

    During LHC operation in run 1, the gaseous detectors of ALICE occasionally experienced simultaneous trips in their high voltage which affected the majority of the high voltage channels. These trips are caused by large anode currents in the detector and are potentially related to LHC machine operations. We developed and installed a fast current-peak detection system for the ALICE Transition Radiation Detector. This system is based on FPGA technology and monitors 144 out 522 high voltage channels minimally invasively at a maximum readout rate of 2 MHz. It is an integral part of the LHC beam monitoring system. We report on the latest status.

  18. Noise-tolerant instantaneous heart rate and R-peak detection using short-term autocorrelation for wearable healthcare systems.

    Science.gov (United States)

    Fujii, Takahide; Nakano, Masanao; Yamashita, Ken; Konishi, Toshihiro; Izumi, Shintaro; Kawaguchi, Hiroshi; Yoshimoto, Masahiko

    2013-01-01

    This paper describes a robust method of Instantaneous Heart Rate (IHR) and R-peak detection from noisy electrocardiogram (ECG) signals. Generally, the IHR is calculated from the R-wave interval. Then, the R-waves are extracted from the ECG using a threshold. However, in wearable bio-signal monitoring systems, noise increases the incidence of misdetection and false detection of R-peaks. To prevent incorrect detection, we introduce a short-term autocorrelation (STAC) technique and a small-window autocorrelation (SWAC) technique, which leverages the similarity of QRS complex waveforms. Simulation results show that the proposed method improves the noise tolerance of R-peak detection.

  19. Accurate LC peak boundary detection for ¹⁶O/¹⁸O labeled LC-MS data.

    Science.gov (United States)

    Cui, Jian; Petritis, Konstantinos; Tegeler, Tony; Petritis, Brianne; Ma, Xuepo; Jin, Yufang; Gao, Shou-Jiang S J; Zhang, Jianqiu Michelle

    2013-01-01

    In liquid chromatography-mass spectrometry (LC-MS), parts of LC peaks are often corrupted by their co-eluting peptides, which results in increased quantification variance. In this paper, we propose to apply accurate LC peak boundary detection to remove the corrupted part of LC peaks. Accurate LC peak boundary detection is achieved by checking the consistency of intensity patterns within peptide elution time ranges. In addition, we remove peptides with erroneous mass assignment through model fitness check, which compares observed intensity patterns to theoretically constructed ones. The proposed algorithm can significantly improve the accuracy and precision of peptide ratio measurements.

  20. Detection of Point Sources on Two-Dimensional Images Based on Peaks

    Directory of Open Access Journals (Sweden)

    R. B. Barreiro

    2005-09-01

    Full Text Available This paper considers the detection of point sources in two-dimensional astronomical images. The detection scheme we propose is based on peak statistics. We discuss the example of the detection of far galaxies in cosmic microwave background experiments throughout the paper, although the method we present is totally general and can be used in many other fields of data analysis. We consider sources with a Gaussian profile—that is, a fair approximation of the profile of a point source convolved with the detector beam in microwave experiments—on a background modeled by a homogeneous and isotropic Gaussian random field characterized by a scale-free power spectrum. Point sources are enhanced with respect to the background by means of linear filters. After filtering, we identify local maxima and apply our detection scheme, a Neyman-Pearson detector that defines our region of acceptance based on the a priori pdf of the sources and the ratio of number densities. We study the different performances of some linear filters that have been used in this context in the literature: the Mexican hat wavelet, the matched filter, and the scale-adaptive filter. We consider as well an extension to two dimensions of the biparametric scale-adaptive filter (BSAF. The BSAF depends on two parameters which are determined by maximizing the number density of real detections while fixing the number density of spurious detections. For our detection criterion the BSAF outperforms the other filters in the interesting case of white noise.

  1. Robust QRS peak detection by multimodal information fusion of ECG and blood pressure signals.

    Science.gov (United States)

    Ding, Quan; Bai, Yong; Erol, Yusuf Bugra; Salas-Boni, Rebeca; Zhang, Xiaorong; Hu, Xiao

    2016-11-01

    QRS peak detection is a challenging problem when ECG signal is corrupted. However, additional physiological signals may also provide information about the QRS position. In this study, we focus on a unique benchmark provided by PhysioNet/Computing in Cardiology Challenge 2014 and Physiological Measurement focus issue: robust detection of heart beats in multimodal data, which aimed to explore robust methods for QRS detection in multimodal physiological signals. A dataset of 200 training and 210 testing records are used, where the testing records are hidden for evaluating the performance only. An information fusion framework for robust QRS detection is proposed by leveraging existing ECG and ABP analysis tools and combining heart beats derived from different sources. Results show that our approach achieves an overall accuracy of 90.94% and 88.66% on the training and testing datasets, respectively. Furthermore, we observe expected performance at each step of the proposed approach, as an evidence of the effectiveness of our approach. Discussion on the limitations of our approach is also provided.

  2. Effect of Co-60 single escape peak on detection of Cs-137 in analysis of radionuclide from research reactor

    International Nuclear Information System (INIS)

    Kim, M. S.; Park, S. J.

    2006-01-01

    The effect of the single escape peak of 1173 keV gamma-rays from Co-60 on the detection of Cs-137 activity is analyzed. The single escape peak of 1173 keV gamma-rays from Co-60 is located at the 662 keV, which is very close to the energy of gamma-rays from Cs-137. This single escape peak may be mistaken for the gamma-ray peak from Cs-137 activity in the case of large area of 1173 keV peak. The detection of Cs-137 is very important to the judgment of the contamination or the leakage of the material containing the fission product like reactor pool water and in the several experiments for reactor physics such as burn-up estimation. In this work, the areas of the single escape peak of the 1173 keV gamma-rays from Co-60 are measured with several full energy peak areas by using the HPGe detector. The critical limit by which we can decide whether the net count of 662 keV peak due to Co-60 would be significant or not is deduced. For this detection system, when the area of full energy peak is larger than 4.5 million, the single escape peak of 1173 keV gamma-rays from Co-60 can be regarded as the single significant peak. Therefore, it is confirmed that the detection of the Cs-137 activity is affected by the Co-60 in this case. Conservatively, for this detection system, it is recommended that the area of 1173 keV peak of Co-60 would be less than 2 million for neglecting the effect of Co-60. (authors)

  3. A new peak detection algorithm for MALDI mass spectrometry data based on a modified Asymmetric Pseudo-Voigt model.

    Science.gov (United States)

    Wijetunge, Chalini D; Saeed, Isaam; Boughton, Berin A; Roessner, Ute; Halgamuge, Saman K

    2015-01-01

    Mass Spectrometry (MS) is a ubiquitous analytical tool in biological research and is used to measure the mass-to-charge ratio of bio-molecules. Peak detection is the essential first step in MS data analysis. Precise estimation of peak parameters such as peak summit location and peak area are critical to identify underlying bio-molecules and to estimate their abundances accurately. We propose a new method to detect and quantify peaks in mass spectra. It uses dual-tree complex wavelet transformation along with Stein's unbiased risk estimator for spectra smoothing. Then, a new method, based on the modified Asymmetric Pseudo-Voigt (mAPV) model and hierarchical particle swarm optimization, is used for peak parameter estimation. Using simulated data, we demonstrated the benefit of using the mAPV model over Gaussian, Lorentz and Bi-Gaussian functions for MS peak modelling. The proposed mAPV model achieved the best fitting accuracy for asymmetric peaks, with lower percentage errors in peak summit location estimation, which were 0.17% to 4.46% less than that of the other models. It also outperformed the other models in peak area estimation, delivering lower percentage errors, which were about 0.7% less than its closest competitor - the Bi-Gaussian model. In addition, using data generated from a MALDI-TOF computer model, we showed that the proposed overall algorithm outperformed the existing methods mainly in terms of sensitivity. It achieved a sensitivity of 85%, compared to 77% and 71% of the two benchmark algorithms, continuous wavelet transformation based method and Cromwell respectively. The proposed algorithm is particularly useful for peak detection and parameter estimation in MS data with overlapping peak distributions and asymmetric peaks. The algorithm is implemented using MATLAB and the source code is freely available at http://mapv.sourceforge.net.

  4. A low-power, CMOS peak detect and hold circuit for nuclear pulse spectroscopy

    International Nuclear Information System (INIS)

    Ericson, M.N.; Simpson, M.L.; Britton, C.L.; Allen, M.D.; Kroeger, R.A.; Inderhees, S.E.

    1994-01-01

    A low-power CMOS peak detecting track and hold circuit optimized for nuclear pulse spectroscopy is presented. The circuit topology eliminates the need for a rectifying diode, reducing the effect of charge injection into the hold capacitor, incorporates a linear gate at the input to prevent pulse pileup, and uses dynamic bias control that minimizes both pedestal and droop. Both positive-going and negative-going pulses are accommodated using a complementary set of track and hold circuits. Full characterization of the design fabricated in 1.2μm CMOS including dynamic range, integral nonlinearity, droop rate, pedestal, and power measurements is presented. Additionally, analysis and design approaches for optimization of operational characteristics are discussed

  5. An Automated Measurement of Ciliary Beating Frequency using a Combined Optical Flow and Peak Detection.

    Science.gov (United States)

    Kim, Woojae; Han, Tae Hwa; Kim, Hyun Jun; Park, Man Young; Kim, Ku Sang; Park, Rae Woong

    2011-06-01

    The mucociliary transport system is a major defense mechanism of the respiratory tract. The performance of mucous transportation in the nasal cavity can be represented by a ciliary beating frequency (CBF). This study proposes a novel method to measure CBF by using optical flow. To obtain objective estimates of CBF from video images, an automated computer-based image processing technique is developed. This study proposes a new method based on optical flow for image processing and peak detection for signal processing. We compare the measuring accuracy of the method in various combinations of image processing (optical flow versus difference image) and signal processing (fast Fourier transform [FFT] vs. peak detection [PD]). The digital high-speed video method with a manual count of CBF in slow motion video play, is the gold-standard in CBF measurement. We obtained a total of fifty recorded ciliated sinonasal epithelium images to measure CBF from the Department of Otolaryngology. The ciliated sinonasal epithelium images were recorded at 50-100 frames per second using a charge coupled device camera with an inverted microscope at a magnification of ×1,000. The mean square errors and variance for each method were 1.24, 0.84 Hz; 11.8, 2.63 Hz; 3.22, 1.46 Hz; and 3.82, 1.53 Hz for optical flow (OF) + PD, OF + FFT, difference image [DI] + PD, and DI + FFT, respectively. Of the four methods, PD using optical flow showed the best performance for measuring the CBF of nasal mucosa. The proposed method was able to measure CBF more objectively and efficiently than what is currently possible.

  6. A NEW METHOD OF PEAK DETECTION FOR ANALYSIS OF COMPREHENSIVE TWO-DIMENSIONAL GAS CHROMATOGRAPHY MASS SPECTROMETRY DATA.

    Science.gov (United States)

    Kim, Seongho; Ouyang, Ming; Jeong, Jaesik; Shen, Changyu; Zhang, Xiang

    2014-06-01

    We develop a novel peak detection algorithm for the analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOF MS) data using normal-exponential-Bernoulli (NEB) and mixture probability models. The algorithm first performs baseline correction and denoising simultaneously using the NEB model, which also defines peak regions. Peaks are then picked using a mixture of probability distribution to deal with the co-eluting peaks. Peak merging is further carried out based on the mass spectral similarities among the peaks within the same peak group. The algorithm is evaluated using experimental data to study the effect of different cut-offs of the conditional Bayes factors and the effect of different mixture models including Poisson, truncated Gaussian, Gaussian, Gamma, and exponentially modified Gaussian (EMG) distributions, and the optimal version is introduced using a trial-and-error approach. We then compare the new algorithm with two existing algorithms in terms of compound identification. Data analysis shows that the developed algorithm can detect the peaks with lower false discovery rates than the existing algorithms, and a less complicated peak picking model is a promising alternative to the more complicated and widely used EMG mixture models.

  7. A NEW METHOD OF PEAK DETECTION FOR ANALYSIS OF COMPREHENSIVE TWO-DIMENSIONAL GAS CHROMATOGRAPHY MASS SPECTROMETRY DATA*

    Science.gov (United States)

    Kim, Seongho; Ouyang, Ming; Jeong, Jaesik; Shen, Changyu; Zhang, Xiang

    2014-01-01

    We develop a novel peak detection algorithm for the analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOF MS) data using normal-exponential-Bernoulli (NEB) and mixture probability models. The algorithm first performs baseline correction and denoising simultaneously using the NEB model, which also defines peak regions. Peaks are then picked using a mixture of probability distribution to deal with the co-eluting peaks. Peak merging is further carried out based on the mass spectral similarities among the peaks within the same peak group. The algorithm is evaluated using experimental data to study the effect of different cut-offs of the conditional Bayes factors and the effect of different mixture models including Poisson, truncated Gaussian, Gaussian, Gamma, and exponentially modified Gaussian (EMG) distributions, and the optimal version is introduced using a trial-and-error approach. We then compare the new algorithm with two existing algorithms in terms of compound identification. Data analysis shows that the developed algorithm can detect the peaks with lower false discovery rates than the existing algorithms, and a less complicated peak picking model is a promising alternative to the more complicated and widely used EMG mixture models. PMID:25264474

  8. Low-complexity R-peak detection in ECG signals: a preliminary step towards ambulatory fetal monitoring.

    Science.gov (United States)

    Rooijakkers, Michiel; Rabotti, Chiara; Bennebroek, Martijn; van Meerbergen, Jef; Mischi, Massimo

    2011-01-01

    Non-invasive fetal health monitoring during pregnancy has become increasingly important. Recent advances in signal processing technology have enabled fetal monitoring during pregnancy, using abdominal ECG recordings. Ubiquitous ambulatory monitoring for continuous fetal health measurement is however still unfeasible due to the computational complexity of noise robust solutions. In this paper an ECG R-peak detection algorithm for ambulatory R-peak detection is proposed, as part of a fetal ECG detection algorithm. The proposed algorithm is optimized to reduce computational complexity, while increasing the R-peak detection quality compared to existing R-peak detection schemes. Validation of the algorithm is performed on two manually annotated datasets, the MIT/BIH Arrhythmia database and an in-house abdominal database. Both R-peak detection quality and computational complexity are compared to state-of-the-art algorithms as described in the literature. With a detection error rate of 0.22% and 0.12% on the MIT/BIH Arrhythmia and in-house databases, respectively, the quality of the proposed algorithm is comparable to the best state-of-the-art algorithms, at a reduced computational complexity.

  9. Improved Peak Capacity for Capillary Electrophoretic Separations of Enzyme Inhibitors with Activity-Based Detection Using Magnetic Bead Microreactors

    Science.gov (United States)

    Yan, Xiaoyan; Gilman, S. Douglass

    2010-01-01

    A technique for separating and detecting enzyme inhibitors was developed using capillary electrophoresis with an enzyme microreactor. The on-column enzyme microreactor was constructed using NdFeB magnet(s) to immobilize alkaline phosphatase-coated superparamagnetic beads (2.8 μm diameter) inside a capillary before the detection window. Enzyme inhibition assays were performed by injecting a plug of inhibitor into a capillary filled with the substrate, AttoPhos. Product generated in the enzyme microreactor was detected by laser-induced fluorescence. Inhibitor zones electrophoresed through the capillary, passed through the enzyme microreactor, and were observed as negative peaks due to decreased product formation. The goal of this study was to improve peak capacities for inhibitor separations relative to previous work, which combined continuous engagement electrophoretically mediated microanalysis (EMMA) and transient engagement EMMA to study enzyme inhibition. The effects of electric field strength, bead injection time and inhibitor concentrations on peak capacity and peak width were investigated. Peak capacities were increased to ≥20 under optimal conditions of electric field strength and bead injection time for inhibition assays with arsenate and theophylline. Five reversible inhibitors of alkaline phosphatase (theophylline, vanadate, arsenate, L-tryptophan and tungstate) were separated and detected to demonstrate the ability of this technique to analyze complex inhibitor mixtures. PMID:20024913

  10. Improving peak detection in high-resolution LC/MS metabolomics data using preexisting knowledge and machine learning approach.

    Science.gov (United States)

    Yu, Tianwei; Jones, Dean P

    2014-10-15

    Peak detection is a key step in the preprocessing of untargeted metabolomics data generated from high-resolution liquid chromatography-mass spectrometry (LC/MS). The common practice is to use filters with predetermined parameters to select peaks in the LC/MS profile. This rigid approach can cause suboptimal performance when the choice of peak model and parameters do not suit the data characteristics. Here we present a method that learns directly from various data features of the extracted ion chromatograms (EICs) to differentiate between true peak regions from noise regions in the LC/MS profile. It utilizes the knowledge of known metabolites, as well as robust machine learning approaches. Unlike currently available methods, this new approach does not assume a parametric peak shape model and allows maximum flexibility. We demonstrate the superiority of the new approach using real data. Because matching to known metabolites entails uncertainties and cannot be considered a gold standard, we also developed a probabilistic receiver-operating characteristic (pROC) approach that can incorporate uncertainties. The new peak detection approach is implemented as part of the apLCMS package available at http://web1.sph.emory.edu/apLCMS/ CONTACT: tyu8@emory.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Normal-Gamma-Bernoulli Peak Detection for Analysis of Comprehensive Two-Dimensional Gas Chromatography Mass Spectrometry Data.

    Science.gov (United States)

    Kim, Seongho; Jang, Hyejeong; Koo, Imhoi; Lee, Joohyoung; Zhang, Xiang

    2017-01-01

    Compared to other analytical platforms, comprehensive two-dimensional gas chromatography coupled with mass spectrometry (GC×GC-MS) has much increased separation power for analysis of complex samples and thus is increasingly used in metabolomics for biomarker discovery. However, accurate peak detection remains a bottleneck for wide applications of GC×GC-MS. Therefore, the normal-exponential-Bernoulli (NEB) model is generalized by gamma distribution and a new peak detection algorithm using the normal-gamma-Bernoulli (NGB) model is developed. Unlike the NEB model, the NGB model has no closed-form analytical solution, hampering its practical use in peak detection. To circumvent this difficulty, three numerical approaches, which are fast Fourier transform (FFT), the first-order and the second-order delta methods (D1 and D2), are introduced. The applications to simulated data and two real GC×GC-MS data sets show that the NGB-D1 method performs the best in terms of both computational expense and peak detection performance.

  12. Effect of background correction on peak detection and quantification in online comprehensive two-dimensional liquid chromatography using diode array detection.

    Science.gov (United States)

    Allen, Robert C; John, Mallory G; Rutan, Sarah C; Filgueira, Marcelo R; Carr, Peter W

    2012-09-07

    A singular value decomposition-based background correction (SVD-BC) technique is proposed for the reduction of background contributions in online comprehensive two-dimensional liquid chromatography (LC×LC) data. The SVD-BC technique was compared to simply subtracting a blank chromatogram from a sample chromatogram and to a previously reported background correction technique for one dimensional chromatography, which uses an asymmetric weighted least squares (AWLS) approach. AWLS was the only background correction technique to completely remove the background artifacts from the samples as evaluated by visual inspection. However, the SVD-BC technique greatly reduced or eliminated the background artifacts as well and preserved the peak intensity better than AWLS. The loss in peak intensity by AWLS resulted in lower peak counts at the detection thresholds established using standards samples. However, the SVD-BC technique was found to introduce noise which led to detection of false peaks at the lower detection thresholds. As a result, the AWLS technique gave more precise peak counts than the SVD-BC technique, particularly at the lower detection thresholds. While the AWLS technique resulted in more consistent percent residual standard deviation values, a statistical improvement in peak quantification after background correction was not found regardless of the background correction technique used. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals

    Directory of Open Access Journals (Sweden)

    Suyi Li

    2017-01-01

    Full Text Available The noninvasive peripheral oxygen saturation (SpO2 and the pulse rate can be extracted from photoplethysmography (PPG signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects’ PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis.

  14. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals.

    Science.gov (United States)

    Li, Suyi; Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji; Diao, Shu

    2017-01-01

    The noninvasive peripheral oxygen saturation (SpO 2 ) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO 2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis.

  15. Leveraging probabilistic peak detection to estimate baseline drift in complex chromatographic samples

    NARCIS (Netherlands)

    Lopatka, M.; Barcaru, A.; Sjerps, M.J.; Vivó-Truyols, G.

    2016-01-01

    Accurate analysis of chromatographic data often requires the removal of baseline drift. A frequently employed strategy strives to determine asymmetric weights in order to fit a baseline model by regression. Unfortunately, chromatograms characterized by a very high peak saturation pose a significant

  16. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals

    Science.gov (United States)

    Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji

    2017-01-01

    The noninvasive peripheral oxygen saturation (SpO2) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis. PMID:29250135

  17. Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection.

    Directory of Open Access Journals (Sweden)

    Thadeous J Kacmarczyk

    Full Text Available Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads. Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.

  18. Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection

    Science.gov (United States)

    Kacmarczyk, Thadeous J.; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron

    2015-01-01

    Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal. PMID:26066343

  19. Multiplexing of ChIP-Seq Samples in an Optimized Experimental Condition Has Minimal Impact on Peak Detection.

    Science.gov (United States)

    Kacmarczyk, Thadeous J; Bourque, Caitlin; Zhang, Xihui; Jiang, Yanwen; Houvras, Yariv; Alonso, Alicia; Betel, Doron

    2015-01-01

    Multiplexing samples in sequencing experiments is a common approach to maximize information yield while minimizing cost. In most cases the number of samples that are multiplexed is determined by financial consideration or experimental convenience, with limited understanding on the effects on the experimental results. Here we set to examine the impact of multiplexing ChIP-seq experiments on the ability to identify a specific epigenetic modification. We performed peak detection analyses to determine the effects of multiplexing. These include false discovery rates, size, position and statistical significance of peak detection, and changes in gene annotation. We found that, for histone marker H3K4me3, one can multiplex up to 8 samples (7 IP + 1 input) at ~21 million single-end reads each and still detect over 90% of all peaks found when using a full lane for sample (~181 million reads). Furthermore, there are no variations introduced by indexing or lane batch effects and importantly there is no significant reduction in the number of genes with neighboring H3K4me3 peaks. We conclude that, for a well characterized antibody and, therefore, model IP condition, multiplexing 8 samples per lane is sufficient to capture most of the biological signal.

  20. Ion trace detection algorithm to extract pure ion chromatograms to improve untargeted peak detection quality for liquid chromatography/time-of-flight mass spectrometry-based metabolomics data.

    Science.gov (United States)

    Wang, San-Yuan; Kuo, Ching-Hua; Tseng, Yufeng J

    2015-03-03

    Able to detect known and unknown metabolites, untargeted metabolomics has shown great potential in identifying novel biomarkers. However, elucidating all possible liquid chromatography/time-of-flight mass spectrometry (LC/TOF-MS) ion signals in a complex biological sample remains challenging since many ions are not the products of metabolites. Methods of reducing ions not related to metabolites or simply directly detecting metabolite related (pure) ions are important. In this work, we describe PITracer, a novel algorithm that accurately detects the pure ions of a LC/TOF-MS profile to extract pure ion chromatograms and detect chromatographic peaks. PITracer estimates the relative mass difference tolerance of ions and calibrates the mass over charge (m/z) values for peak detection algorithms with an additional option to further mass correction with respect to a user-specified metabolite. PITracer was evaluated using two data sets containing 373 human metabolite standards, including 5 saturated standards considered to be split peaks resultant from huge m/z fluctuation, and 12 urine samples spiked with 50 forensic drugs of varying concentrations. Analysis of these data sets show that PITracer correctly outperformed existing state-of-art algorithm and extracted the pure ion chromatograms of the 5 saturated standards without generating split peaks and detected the forensic drugs with high recall, precision, and F-score and small mass error.

  1. Non-contact acquisition of respiration and heart rates using Doppler radar with time domain peak-detection algorithm.

    Science.gov (United States)

    Xiaofeng Yang; Guanghao Sun; Ishibashi, Koichiro

    2017-07-01

    The non-contact measurement of the respiration rate (RR) and heart rate (HR) using a Doppler radar has attracted more attention in the field of home healthcare monitoring, due to the extremely low burden on patients, unconsciousness and unconstraint. Most of the previous studies have performed the frequency-domain analysis of radar signals to detect the respiration and heartbeat frequency. However, these procedures required long period time (approximately 30 s) windows to obtain a high-resolution spectrum. In this study, we propose a time-domain peak detection algorithm for the fast acquisition of the RR and HR within a breathing cycle (approximately 5 s), including inhalation and exhalation. Signal pre-processing using an analog band-pass filter (BPF) that extracts respiration and heartbeat signals was performed. Thereafter, the HR and RR were calculated using a peak position detection method, which was carried out via LABVIEW. To evaluate the measurement accuracy, we measured the HR and RR of seven subjects in the laboratory. As a reference of HR and RR, the persons wore contact sensors i.e., an electrocardiograph (ECG) and a respiration band. The time domain peak-detection algorithm, based on the Doppler radar, exhibited a significant correlation coefficient of HR of 0.92 and a correlation coefficient of RR of 0.99, between the ECG and respiration band, respectively.

  2. Smart ECG Monitoring Patch with Built-in R-Peak Detection for Long-Term HRV Analysis.

    Science.gov (United States)

    Lee, W K; Yoon, H; Park, K S

    2016-07-01

    Since heart rate variability (HRV) analysis is widely used to evaluate the physiological status of the human body, devices specifically designed for such applications are needed. To this end, we developed a smart electrocardiography (ECG) patch. The smart patch measures ECG using three electrodes integrated into the patch, filters the measured signals to minimize noise, performs analog-to-digital conversion, and detects R-peaks. The measured raw ECG data and the interval between the detected R-peaks can be recorded to enable long-term HRV analysis. Experiments were performed to evaluate the performance of the built-in R-wave detection, robustness of the device under motion, and applicability to the evaluation of mental stress. The R-peak detection results obtained with the device exhibited a sensitivity of 99.29%, a positive predictive value of 100.00%, and an error of 0.71%. The device also exhibited less motional noise than conventional ECG recording, being stable up to a walking speed of 5 km/h. When applied to mental stress analysis, the device evaluated the variation in HRV parameters in the same way as a normal ECG, with very little difference. This device can help users better understand their state of health and provide physicians with more reliable data for objective diagnosis.

  3. Testing the E(sub peak)-E(sub iso) Relation for GRBs Detected by Swift and Suzaku-WAM

    Science.gov (United States)

    Krimm, H. A.; Yamaoka, K.; Sugita, S.; Ohno, M.; Sakamoto, T.; Barthelmy, S. D.; Gehrels, N.; Hara, R.; Onda, K.; Sato, G.; hide

    2009-01-01

    One of the most prominent, yet controversial associations derived from the ensemble of prompt-phase observations of gamma-ray bursts (GRBs) is the apparent correlation in the source frame between the peak energy (E(sub peak)) of the nuF(nu) spectrum and the isotropic radiated energy, E(sub iso). Since most gamma-ray bursts (GRBs) have E(sub peak) above the energy range (15-150 keV) of the Burst Alert Telescope (BAT) on Swift, determining accurate E(sub peak) values for large numbers of Swift bursts has been difficult. However, by combining data from Swift/BAT and the Suzaku Wide-band All-Sky Monitor (WAM), which covers the energy range from 50-5000 keV, for bursts which are simultaneously detected ; one can accurately fit E(sub peak) and E(sub iso) and test the relationship between them for the Swift sample. Between the launch of Suzaku in July 2005 and the end of March 2009, there were 45 gamma-ray bursts (GRBs) which triggered both Swift/BAT and WAM and an additional 47 bursts which triggered Swift and were detected by WAM, but did not trigger. A BAT-WAM team has cross-calibrated the two instruments using GRBs, and we are now able to perform joint fits on these bursts to determine spectral parameters. For those bursts with spectroscopic redshifts.. we can also calculate the isotropic energy. Here we present the results of joint Swift/BAT-Suzaku/WAM spectral fits for 86 of the bursts detected by the two instruments. We show that the distribution of spectral fit parameters is consistent with distributions from earlier missions and confirm that Swift, bursts are consistent with earlier reported relationships between Epeak and isotropic energy. We show through time-resolved spectroscopy that individual burst pulses are also consistent with this relationship.

  4. An electroencephalographic Peak Density Function to detect memorization during the observation of TV commercials.

    Science.gov (United States)

    Vecchiato, G; Di Flumeri, G; Maglione, A G; Cherubino, P; Kong, W; Trettel, A; Babiloni, F

    2014-01-01

    Nowadays, there is a growing interest in measuring the impact of advertisements through the estimation of cerebral reactions. Several techniques and methods are used and discussed in the consumer neuroscience. In such a context, the present paper provides a novel method to estimate the level of memorization occurred in subjects during the observation of TV commercials. In particular, the present work introduce the Peak Density Function (PDF) as an electroencephalographic (EEG) time-varying variable which is correlated with the cerebral events of memorization of TV commercials. The analysis has been performed on the EEG activity recorded on twenty healthy subjects during the exposition to several advertisements. After the EEG recordings, an interview has been performed to obtain the information about the memorized scenes for all the video clips watched by the subjects. Such information has been put in correlation with the occurrence of transient peaks of EEG synchronization in the theta band, by computing the PDF. The present results show that the increase of PDF is positively correlated, scene by scene, (R=0.46, pmarketers to overcome the drawbacks of the standard marketing tools (e.g., interviews, focus groups) when analyzing the impact of advertisements.

  5. The EEG Split Alpha Peak: Phenomenological Origins and Methodological Aspects of Detection and Evaluation.

    Science.gov (United States)

    Olejarczyk, Elzbieta; Bogucki, Piotr; Sobieszek, Aleksander

    2017-01-01

    Electroencephalographic (EEG) patterns were analyzed in a group of ambulatory patients who ranged in age and sex using spectral analysis as well as Directed Transfer Function, a method used to evaluate functional brain connectivity. We tested the impact of window size and choice of reference electrode on the identification of two or more peaks with close frequencies in the spectral power distribution, so called "split alpha." Together with the connectivity analysis, examination of spatiotemporal maps showing the distribution of amplitudes of EEG patterns allowed for better explanation of the mechanisms underlying the generation of split alpha peaks. It was demonstrated that the split alpha spectrum can be generated by two or more independent and interconnected alpha wave generators located in different regions of the cerebral cortex, but not necessarily in the occipital cortex. We also demonstrated the importance of appropriate reference electrode choice during signal recording. In addition, results obtained using the original data were compared with results obtained using re-referenced data, using average reference electrode and reference electrode standardization techniques.

  6. Peak clustering in two-dimensional gas chromatography with mass spectrometric detection based on theoretical calculation of two-dimensional peak shapes: the 2DAid approach.

    Science.gov (United States)

    van Stee, Leo L P; Brinkman, Udo A Th

    2011-10-28

    A method is presented to facilitate the non-target analysis of data obtained in temperature-programmed comprehensive two-dimensional (2D) gas chromatography coupled to time-of-flight mass spectrometry (GC×GC-ToF-MS). One main difficulty of GC×GC data analysis is that each peak is usually modulated several times and therefore appears as a series of peaks (or peaklets) in the one-dimensionally recorded data. The proposed method, 2DAid, uses basic chromatographic laws to calculate the theoretical shape of a 2D peak (a cluster of peaklets originating from the same analyte) in order to define the area in which the peaklets of each individual compound can be expected to show up. Based on analyte-identity information obtained by means of mass spectral library searching, the individual peaklets are then combined into a single 2D peak. The method is applied, amongst others, to a complex mixture containing 362 analytes. It is demonstrated that the 2D peak shapes can be accurately predicted and that clustering and further processing can reduce the final peak list to a manageable size. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Sensitive and specific peak detection for SELDI-TOF mass spectrometry using a wavelet/neural-network based approach.

    Directory of Open Access Journals (Sweden)

    Vincent A Emanuele

    Full Text Available SELDI-TOF mass spectrometer's compact size and automated, high throughput design have been attractive to clinical researchers, and the platform has seen steady-use in biomarker studies. Despite new algorithms and preprocessing pipelines that have been developed to address reproducibility issues, visual inspection of the results of SELDI spectra preprocessing by the best algorithms still shows miscalled peaks and systematic sources of error. This suggests that there continues to be problems with SELDI preprocessing. In this work, we study the preprocessing of SELDI in detail and introduce improvements. While many algorithms, including the vendor supplied software, can identify peak clusters of specific mass (or m/z in groups of spectra with high specificity and low false discover rate (FDR, the algorithms tend to underperform estimating the exact prevalence and intensity of peaks in those clusters. Thus group differences that at first appear very strong are shown, after careful and laborious hand inspection of the spectra, to be less than significant. Here we introduce a wavelet/neural network based algorithm which mimics what a team of expert, human users would call for peaks in each of several hundred spectra in a typical SELDI clinical study. The wavelet denoising part of the algorithm optimally smoothes the signal in each spectrum according to an improved suite of signal processing algorithms previously reported (the LibSELDI toolbox under development. The neural network part of the algorithm combines those results with the raw signal and a training dataset of expertly called peaks, to call peaks in a test set of spectra with approximately 95% accuracy. The new method was applied to data collected from a study of cervical mucus for the early detection of cervical cancer in HPV infected women. The method shows promise in addressing the ongoing SELDI reproducibility issues.

  8. Towards Real-Time Detection of Gait Events on Different Terrains Using Time-Frequency Analysis and Peak Heuristics Algorithm.

    Science.gov (United States)

    Zhou, Hui; Ji, Ning; Samuel, Oluwarotimi Williams; Cao, Yafei; Zhao, Zheyi; Chen, Shixiong; Li, Guanglin

    2016-10-01

    Real-time detection of gait events can be applied as a reliable input to control drop foot correction devices and lower-limb prostheses. Among the different sensors used to acquire the signals associated with walking for gait event detection, the accelerometer is considered as a preferable sensor due to its convenience of use, small size, low cost, reliability, and low power consumption. Based on the acceleration signals, different algorithms have been proposed to detect toe off (TO) and heel strike (HS) gait events in previous studies. While these algorithms could achieve a relatively reasonable performance in gait event detection, they suffer from limitations such as poor real-time performance and are less reliable in the cases of up stair and down stair terrains. In this study, a new algorithm is proposed to detect the gait events on three walking terrains in real-time based on the analysis of acceleration jerk signals with a time-frequency method to obtain gait parameters, and then the determination of the peaks of jerk signals using peak heuristics. The performance of the newly proposed algorithm was evaluated with eight healthy subjects when they were walking on level ground, up stairs, and down stairs. Our experimental results showed that the mean F1 scores of the proposed algorithm were above 0.98 for HS event detection and 0.95 for TO event detection on the three terrains. This indicates that the current algorithm would be robust and accurate for gait event detection on different terrains. Findings from the current study suggest that the proposed method may be a preferable option in some applications such as drop foot correction devices and leg prostheses.

  9. Head-to-head comparison of peak supine bicycle exercise echocardiography and treadmill exercise echocardiography at peak and at post-exercise for the detection of coronary artery disease.

    Science.gov (United States)

    Peteiro, Jesús; Bouzas-Mosquera, Alberto; Estevez, Rodrigo; Pazos, Pablo; Piñeiro, Miriam; Castro-Beiras, Alfonso

    2012-03-01

    Supine bicycle exercise (SBE) echocardiography and treadmill exercise (TME) echocardiography have been used for evaluation of coronary artery disease (CAD). Although peak imaging acquisition has been considered unfeasible with TME, higher sensitivity for the detection of CAD has been recently found with this method compared with post-TME echocardiography. However, peak TME echocardiography has not been previously compared with the more standardized peak SBE echocardiography. The aim of this study was to compare peak TME echocardiography, peak SBE echocardiography, and post-TME echocardiography for the detection of CAD. A series of 116 patients (mean age, 61 ± 10 years) referred for evaluation of CAD underwent SBE (starting at 25 W, with 25-W increments every 2-3 min) and TME with peak and postexercise imaging acquisition, in a random sequence. Digitized images at baseline, at peak TME, after TME, and at peak SBE were interpreted in a random and blinded fashion. All patients underwent coronary angiography. Maximal heart rate was higher during TME, whereas systolic blood pressure was higher during SBE, resulting in similar rate-pressure products. On quantitative angiography, 75 patients had coronary stenosis (≥50%). In these patients, wall motion score indexes at maximal exercise were higher at peak TME (median, 1.45; interquartile range [IQR], 1.13-1.75) than at peak SBE (median, 1.25; IQR, 1.0-1.56) or after TME (median, 1.13; IQR, 1.0-1.38) (P = .002 between peak TME and peak SBE imaging, P peak TME (median, 5; IQR, 2-12) compared with peak SBE (median, 3; IQR, 0-8) or after TME (median, 2; IQR, 0-4) (P peak TME and peak SBE imaging, P peak TME, peak SBE, and post-TME echocardiography for CAD was 84%, 75%, and 60% (P = .001 between post-TME and peak TME echocardiography, P = .055 between post-TME and peak SBE echocardiography), with specificity of 63%, 80%, and 78%, respectively (P = NS) and accuracy of 77%, 77%, and 66%, respectively (P = NS). Peak TME

  10. Analog CMOS peak detect and hold circuits. Part 2. The two-phase offset-free and derandomizing configuration

    CERN Document Server

    De Geronimo, G; Kandasamy, A

    2002-01-01

    An analog CMOS peak detect and hold (PDH) circuit, which combines high speed and accuracy, rail-to-rail sensing and driving, low power, and buffering is presented. It is based on a configuration that cancels the major error sources of the classical CMOS PDH, including offset and common mode gain, by re-using the same amplifier for tracking, peak sensing, and output buffering. By virtue of its high absolute accuracy, two or more PDHs can be used in parallel to serve as a data-driven analog memory for derandomization. The first experimental results on the new peak detector and derandomizer (PDD) circuit, fabricated in 0.35 mu m CMOS technology, include a 0.2% absolute accuracy for pulses with 500 ns peaking time, 2.7 V linear input range, 3.3 mW power dissipation, 250 mV/s droop rate, and negligible dead time. The use of such a high performance analog PDD can greatly relax the requirements on the digitization in multi-channel systems.

  11. Automatic moment segmentation and peak detection analysis of heart sound pattern via short-time modified Hilbert transform.

    Science.gov (United States)

    Sun, Shuping; Jiang, Zhongwei; Wang, Haibin; Fang, Yu

    2014-05-01

    This paper proposes a novel automatic method for the moment segmentation and peak detection analysis of heart sound (HS) pattern, with special attention to the characteristics of the envelopes of HS and considering the properties of the Hilbert transform (HT). The moment segmentation and peak location are accomplished in two steps. First, by applying the Viola integral waveform method in the time domain, the envelope (E(T)) of the HS signal is obtained with an emphasis on the first heart sound (S1) and the second heart sound (S2). Then, based on the characteristics of the E(T) and the properties of the HT of the convex and concave functions, a novel method, the short-time modified Hilbert transform (STMHT), is proposed to automatically locate the moment segmentation and peak points for the HS by the zero crossing points of the STMHT. A fast algorithm for calculating the STMHT of E(T) can be expressed by multiplying the E(T) by an equivalent window (W(E)). According to the range of heart beats and based on the numerical experiments and the important parameters of the STMHT, a moving window width of N=1s is validated for locating the moment segmentation and peak points for HS. The proposed moment segmentation and peak location procedure method is validated by sounds from Michigan HS database and sounds from clinical heart diseases, such as a ventricular septal defect (VSD), an aortic septal defect (ASD), Tetralogy of Fallot (TOF), rheumatic heart disease (RHD), and so on. As a result, for the sounds where S2 can be separated from S1, the average accuracies achieved for the peak of S1 (AP₁), the peak of S2 (AP₂), the moment segmentation points from S1 to S2 (AT₁₂) and the cardiac cycle (ACC) are 98.53%, 98.31% and 98.36% and 97.37%, respectively. For the sounds where S1 cannot be separated from S2, the average accuracies achieved for the peak of S1 and S2 (AP₁₂) and the cardiac cycle ACC are 100% and 96.69%. Copyright © 2014 Elsevier Ireland Ltd. All

  12. Automatic cardiac cycle determination directly from EEG-fMRI data by multi-scale peak detection method.

    Science.gov (United States)

    Wong, Chung-Ki; Luo, Qingfei; Zotev, Vadim; Phillips, Raquel; Chan, Kam Wai Clifford; Bodurka, Jerzy

    2018-03-31

    In simultaneous EEG-fMRI, identification of the period of cardioballistic artifact (BCG) in EEG is required for the artifact removal. Recording the electrocardiogram (ECG) waveform during fMRI is difficult, often causing inaccurate period detection. Since the waveform of the BCG extracted by independent component analysis (ICA) is relatively invariable compared to the ECG waveform, we propose a multiple-scale peak-detection algorithm to determine the BCG cycle directly from the EEG data. The algorithm first extracts the high contrast BCG component from the EEG data by ICA. The BCG cycle is then estimated by band-pass filtering the component around the fundamental frequency identified from its energy spectral density, and the peak of BCG artifact occurrence is selected from each of the estimated cycle. The algorithm is shown to achieve a high accuracy on a large EEG-fMRI dataset. It is also adaptive to various heart rates without the needs of adjusting the threshold parameters. The cycle detection remains accurate with the scan duration reduced to half a minute. Additionally, the algorithm gives a figure of merit to evaluate the reliability of the detection accuracy. The algorithm is shown to give a higher detection accuracy than the commonly used cycle detection algorithm fmrib_qrsdetect implemented in EEGLAB. The achieved high cycle detection accuracy of our algorithm without using the ECG waveforms makes possible to create and automate pipelines for processing large EEG-fMRI datasets, and virtually eliminates the need for ECG recordings for BCG artifact removal. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Reduction of Motion Artifacts and Improvement of R Peak Detecting Accuracy Using Adjacent Non-Intrusive ECG Sensors

    Directory of Open Access Journals (Sweden)

    Minho Choi

    2016-05-01

    Full Text Available Non-intrusive electrocardiogram (ECG monitoring has many advantages: easy to measure and apply in daily life. However, motion noise in the measured signal is the major problem of non-intrusive measurement. This paper proposes a method to reduce the noise and to detect the R peaks of ECG in a stable manner in a sitting arrangement using non-intrusive sensors. The method utilizes two capacitive ECG sensors (cECGs to measure ECG, and another two cECGs located adjacent to the sensors for ECG are added to obtain the information on motion. Then, active noise cancellation technique and the motion information are used to reduce motion noise. To verify the proposed method, ECG was measured indoors and during driving, and the accuracy of the detected R peaks was compared. After applying the method, the sum of sensitivity and positive predictivity increased 8.39% on average and 26.26% maximally in the data. Based on the results, it was confirmed that the motion noise was reduced and that more reliable R peak positions could be obtained by the proposed method. The robustness of the new ECG measurement method will elicit benefits to various health care systems that require noninvasive heart rate or heart rate variability measurements.

  14. Flow-Cell-Induced Dispersion in Flow-through Absorbance Detection Systems: True Column Effluent Peak Variance.

    Science.gov (United States)

    Dasgupta, Purnendu K; Shelor, Charles Phillip; Kadjo, Akinde Florence; Kraiczek, Karsten G

    2018-02-06

    Following a brief overview of the emergence of absorbance detection in liquid chromatography, we focus on the dispersion caused by the absorbance measurement cell and its inlet. A simple experiment is proposed wherein chromatographic flow and conditions are held constant but a variable portion of the column effluent is directed into the detector. The temporal peak variance (σ t,obs 2 ), which increases as the flow rate (F) through the detector decreases, is found to be well-described as a quadratic function of 1 / F . This allows the extrapolation of the results to zero residence time in the detector and thence the determination of the true variance of the peak prior to the detector (this includes contribution of all preceding components). This general approach should be equally applicable to detection systems other than absorbance. We also experiment where the inlet/outlet system remains the same but the path length is varied. This allows one to assess the individual contributions of the cell itself and the inlet/outlet system.to the total observed peak. The dispersion in the cell itself has often been modeled as a flow-independent parameter, dependent only on the cell volume. Except for very long path/large volume cells, this paradigm is simply incorrect.

  15. Design of a Biorthogonal Wavelet Transform Based R-Peak Detection and Data Compression Scheme for Implantable Cardiac Pacemaker Systems.

    Science.gov (United States)

    Kumar, Ashish; Kumar, Manjeet; Komaragiri, Rama

    2018-04-19

    Bradycardia can be modulated using the cardiac pacemaker, an implantable medical device which sets and balances the patient's cardiac health. The device has been widely used to detect and monitor the patient's heart rate. The data collected hence has the highest authenticity assurance and is convenient for further electric stimulation. In the pacemaker, ECG detector is one of the most important element. The device is available in its new digital form, which is more efficient and accurate in performance with the added advantage of economical power consumption platform. In this work, a joint algorithm based on biorthogonal wavelet transform and run-length encoding (RLE) is proposed for QRS complex detection of the ECG signal and compressing the detected ECG data. Biorthogonal wavelet transform of the input ECG signal is first calculated using a modified demand based filter bank architecture which consists of a series combination of three lowpass filters with a highpass filter. Lowpass and highpass filters are realized using a linear phase structure which reduces the hardware cost of the proposed design approximately by 50%. Then, the location of the R-peak is found by comparing the denoised ECG signal with the threshold value. The proposed R-peak detector achieves the highest sensitivity and positive predictivity of 99.75 and 99.98 respectively with the MIT-BIH arrhythmia database. Also, the proposed R-peak detector achieves a comparatively low data error rate (DER) of 0.002. The use of RLE for the compression of detected ECG data achieves a higher compression ratio (CR) of 17.1. To justify the effectiveness of the proposed algorithm, the results have been compared with the existing methods, like Huffman coding/simple predictor, Huffman coding/adaptive, and slope predictor/fixed length packaging.

  16. Calculation of the detection limits for radionuclides identified in gamma-ray spectra based on post-processing peak analysis results.

    Science.gov (United States)

    Korun, M; Vodenik, B; Zorko, B

    2018-03-01

    A new method for calculating the detection limits of gamma-ray spectrometry measurements is presented. The method is applicable for gamma-ray emitters, irrespective of the influences of the peaked background, the origin of the background and the overlap with other peaks. It offers the opportunity for multi-gamma-ray emitters to calculate the common detection limit, corresponding to more peaks. The detection limit is calculated by approximating the dependence of the uncertainty in the indication on its value with a second-order polynomial. In this approach the relation between the input quantities and the detection limit are described by an explicit expression and can be easy investigated. The detection limit is calculated from the data usually provided by the reports of peak-analyzing programs: the peak areas and their uncertainties. As a result, the need to use individual channel contents for calculating the detection limit is bypassed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Inadequate peak expiratory flow meter characteristics detected by a computerised explosive decompression device

    DEFF Research Database (Denmark)

    Miller, M.R.; Atkins, P.R.; Pedersen, O.F.

    2003-01-01

    Methods: The dynamic response of mini-Wright (MW), Vitalograph (V), TruZone (TZ), MultiSpiro (MS) and pneumotachograph (PT) flow meters was tested by delivering two differently shaped flow-time profiles from a computer controlled explosive decompression device fitted with a fast response solenoid.......1) and 257 (39.2), respectively, and at ≈200 l/min they were 51 (23.9) and 1 (0.5). All the meters met ATS accuracy requirements when tested with their waveforms. Conclusions: An improved method for testing the dynamic response of flow meters detects marked overshoot (underdamping) of TZ and MS responses...

  18. DynPeak: An Algorithm for Pulse Detection and Frequency Analysis in Hormonal Time Series

    Science.gov (United States)

    Vidal, Alexandre; Zhang, Qinghua; Médigue, Claire; Fabre, Stéphane; Clément, Frédérique

    2012-01-01

    The endocrine control of the reproductive function is often studied from the analysis of luteinizing hormone (LH) pulsatile secretion by the pituitary gland. Whereas measurements in the cavernous sinus cumulate anatomical and technical difficulties, LH levels can be easily assessed from jugular blood. However, plasma levels result from a convolution process due to clearance effects when LH enters the general circulation. Simultaneous measurements comparing LH levels in the cavernous sinus and jugular blood have revealed clear differences in the pulse shape, the amplitude and the baseline. Besides, experimental sampling occurs at a relatively low frequency (typically every 10 min) with respect to LH highest frequency release (one pulse per hour) and the resulting LH measurements are noised by both experimental and assay errors. As a result, the pattern of plasma LH may be not so clearly pulsatile. Yet, reliable information on the InterPulse Intervals (IPI) is a prerequisite to study precisely the steroid feedback exerted on the pituitary level. Hence, there is a real need for robust IPI detection algorithms. In this article, we present an algorithm for the monitoring of LH pulse frequency, basing ourselves both on the available endocrinological knowledge on LH pulse (shape and duration with respect to the frequency regime) and synthetic LH data generated by a simple model. We make use of synthetic data to make clear some basic notions underlying our algorithmic choices. We focus on explaining how the process of sampling affects drastically the original pattern of secretion, and especially the amplitude of the detectable pulses. We then describe the algorithm in details and perform it on different sets of both synthetic and experimental LH time series. We further comment on how to diagnose possible outliers from the series of IPIs which is the main output of the algorithm. PMID:22802933

  19. Real-time bilinear rotation decoupling in absorptive mode J-spectroscopy: Detecting low-intensity metabolite peak close to high-intensity metabolite peak with convenience

    Science.gov (United States)

    Verma, Ajay; Baishya, Bikash

    2016-05-01

    ;Pure shift; NMR spectra display singlet peak per chemical site. Thus, high resolution is offered at the cost of valuable J-coupling information. In the present work, real-time BIRD (BIlinear Rotation Decoupling) is applied to the absorptive-mode 2D J-spectroscopy to provide pure shift spectrum in the direct dimension and J-coupling information in the indirect dimension. Quite often in metabolomics, proton NMR spectra from complex bio-fluids display tremendous signal overlap. Although conventional J-spectroscopy in principle overcomes this problem by separating the multiplet information from chemical shift information, however, only magnitude mode of the experiment is practical, sacrificing much of the potential high resolution that could be achieved. Few J-spectroscopy methods have been reported so far that produce high-resolution pure shift spectrum along with J-coupling information for crowded spectral regions. In the present work, high-quality J-resolved spectrum from important metabolomic mixture such as tissue extract from rat cortex is demonstrated. Many low-intensity metabolite peaks which are obscured by the broad dispersive tails from high-intensity metabolite peaks in regular magnitude mode J-spectrum can be clearly identified in real-time BIRD J-resolved spectrum. The general practice of removing such spectral overlap is tedious and time-consuming as it involves repeated sample preparation to change the pH of the tissue extract sample and subsequent spectra recording.

  20. Robust detection of heart beats in multimodal records using slope- and peak-sensitive band-pass filters.

    Science.gov (United States)

    Pangerc, Urška; Jager, Franc

    2015-08-01

    In this work, we present the development, architecture and evaluation of a new and robust heart beat detector in multimodal records. The detector uses electrocardiogram (ECG) signals, and/or pulsatile (P) signals, such as: blood pressure, artery blood pressure and pulmonary artery pressure, if present. The base approach behind the architecture of the detector is collecting signal energy (differentiating and low-pass filtering, squaring, integrating). To calculate the detection and noise functions, simple and fast slope- and peak-sensitive band-pass digital filters were designed. By using morphological smoothing, the detection functions were further improved and noise intervals were estimated. The detector looks for possible pacemaker heart rate patterns and repairs the ECG signals and detection functions. Heart beats are detected in each of the ECG and P signals in two steps: a repetitive learning phase and a follow-up detecting phase. The detected heart beat positions from the ECG signals are merged into a single stream of detected ECG heart beat positions. The merged ECG heart beat positions and detected heart beat positions from the P signals are verified for their regularity regarding the expected heart rate. The detected heart beat positions of a P signal with the best match to the merged ECG heart beat positions are selected for mapping into the noise and no-signal intervals of the record. The overall evaluation scores in terms of average sensitivity and positive predictive values obtained on databases that are freely available on the Physionet website were as follows: the MIT-BIH Arrhythmia database (99.91%), the MGH/MF Waveform database (95.14%), the augmented training set of the follow-up phase of the PhysioNet/Computing in Cardiology Challenge 2014 (97.67%), and the Challenge test set (93.64%).

  1. Benchmark for Peak Detection Algorithms in Fiber Bragg Grating Interrogation and a New Neural Network for its Performance Improvement

    Science.gov (United States)

    Negri, Lucas; Nied, Ademir; Kalinowski, Hypolito; Paterno, Aleksander

    2011-01-01

    This paper presents a benchmark for peak detection algorithms employed in fiber Bragg grating spectrometric interrogation systems. The accuracy, precision, and computational performance of currently used algorithms and those of a new proposed artificial neural network algorithm are compared. Centroid and gaussian fitting algorithms are shown to have the highest precision but produce systematic errors that depend on the FBG refractive index modulation profile. The proposed neural network displays relatively good precision with reduced systematic errors and improved computational performance when compared to other networks. Additionally, suitable algorithms may be chosen with the general guidelines presented. PMID:22163806

  2. Detection and quantitative characterization of artificial extra peaks following polymerase chain reaction amplification of 14 short tandem repeat systems used in forensic investigations

    DEFF Research Database (Denmark)

    Meldgaard, Michael; Morling, N

    1997-01-01

    Detection on automated DNA sequencers of polymerase chain reaction (PCR) products of tetra- and penta-nucleotide short tandem repeat (STR) loci frequently reveals one or more extra peaks along with the true, major allele peak. The most frequent extra peak pattern is a single smaller peak which...... is one repeat unit shorter than the true allele peak. The existence of such artificial peaks is of special importance when the methods are used for forensic investigations because the artificial extra peaks may simulate true alleles when samples containing mixtures of DNA from different individuals...... are analyzed. We have investigated the relative levels of formation of extra peaks in 14 STR marker systems. We found that not only the parameters of the PCR but also factors determining the stringency during the post-PCR and pre-electrophoresis handling of samples were of importance for the formation of extra...

  3. Transrectal real-time tissue elastography targeted biopsy coupled with peak strain index improves the detection of clinically important prostate cancer.

    Science.gov (United States)

    Ma, Qi; Yang, Dong-Rong; Xue, Bo-Xin; Wang, Cheng; Chen, Han-Bin; Dong, Yun; Wang, Cai-Shan; Shan, Yu-Xi

    2017-07-01

    The focus of the present study was to evaluate transrectal real-time tissue elastography (RTE)-targeted two-core biopsy coupled with peak strain index for the detection of prostate cancer (PCa) and to compare this method with 10-core systematic biopsy. A total of 141 patients were enrolled for evaluation. The diagnostic value of peak strain index was assessed using a receiver operating characteristic curve. The cancer detection rates of the two approaches and corresponding positive cores and Gleason score were compared. The cancer detection rate per core in the RTE-targeted biopsy (44%) was higher compared with that in systematic biopsy (30%). The peak strain index value of PCa was higher compared with that of the benign lesion. PCa was detected with the highest sensitivity (87.5%) and specificity (85.5%) using the threshold value of a peak strain index of ≥5.97 with an area under the curve value of 0.95. When the Gleason score was ≥7, RTE-targeted biopsy coupled with peak strain index detected 95.6% of PCa cases, but 84.4% were detected using systematic biopsy. Peak strain index as a quantitative parameter may improve the differentiation of PCa from benign lesions in the prostate peripheral zone. Transrectal RTE-targeted biopsy coupled with peak strain index may enhance the detection of clinically significant PCa, particularly when combined with systematic biopsy.

  4. Reducing the threat of wildlife-vehicle collisions during peak tourism periods using a Roadside Animal Detection System.

    Science.gov (United States)

    Grace, Molly K; Smith, Daniel J; Noss, Reed F

    2017-12-01

    Roadside Animal Detection Systems (RADS) aim to reduce the frequency of wildlife-vehicle collisions. Unlike fencing and wildlife passages, RADS do not attempt to keep animals off the road; rather, they attempt to modify driver behavior by detecting animals near the road and warning drivers with flashing signs. A RADS was installed in Big Cypress National Park (Florida, USA) in 2012 in response to an increased number of Florida panther mortalities. To assess driver response, we measured the speed of individual cars on the road when the RADS was active (flashing) and inactive (not flashing) during the tourist season (November-March) and the off-season (April-October), which vary dramatically in traffic volume. We also used track beds and camera traps to assess whether roadside activity of large mammal species varied between seasons. In the tourist season, the activation of the RADS caused a significant reduction in vehicle speed. However, this effect was not observed in the off-season. Track and camera data showed that the tourist season coincided with peak periods of activity for several large mammals of conservation interest. Drivers in the tourist season generally drove faster than those in the off-season, so a reduction in speed in response to the RADS is more beneficial in the tourist season. Because traffic volume and roadside activity of several species of conservation interest both peak during the tourist season, our study indicates that the RADS has the potential to reduce the number of accidents during this period of heightened risk. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. "Peak tracking chip" for label-free optical detection of bio-molecular interaction and bulk sensing.

    Science.gov (United States)

    Bougot-Robin, Kristelle; Li, Shunbo; Zhang, Yinghua; Hsing, I-Ming; Benisty, Henri; Wen, Weijia

    2012-10-21

    A novel imaging method for bulk refractive index sensing or label-free bio-molecular interaction sensing is presented. This method is based on specially designed "Peak tracking chip" (PTC) involving "tracks" of adjacent resonant waveguide gratings (RWG) "micropads" with slowly evolving resonance position. Using a simple camera the spatial information robustly retrieves the diffraction efficiency, which in turn transduces either the refractive index of the liquids on the tracks or the effective thickness of an immobilized biological layer. Our intrinsically multiplex chip combines tunability and versatility advantages of dielectric guided wave biochips without the need of costly hyperspectral instrumentation. The current success of surface plasmon imaging techniques suggests that our chip proposal could leverage an untapped potential to routinely extend such techniques in a convenient and sturdy optical configuration toward, for instance for large analytes detection. PTC design and fabrication are discussed with challenging process to control micropads properties by varying their period (step of 2 nm) or their duty cycle through the groove width (steps of 4 nm). Through monochromatic imaging of our PTC, we present experimental demonstration of bulk index sensing on the range [1.33-1.47] and of surface biomolecule detection of molecular weight 30 kDa in aqueous solution using different surface densities. A sensitivity of the order of 10(-5) RIU for bulk detection and a sensitivity of the order of ∼10 pg mm(-2) for label-free surface detection are expected, therefore opening a large range of application of our chip based imaging technique. Exploiting and chip design, we expect as well our chip to open new direction for multispectral studies through imaging.

  6. Detecting and accounting for multiple sources of positional variance in peak list registration analysis and spin system grouping.

    Science.gov (United States)

    Smelter, Andrey; Rouchka, Eric C; Moseley, Hunter N B

    2017-08-01

    Peak lists derived from nuclear magnetic resonance (NMR) spectra are commonly used as input data for a variety of computer assisted and automated analyses. These include automated protein resonance assignment and protein structure calculation software tools. Prior to these analyses, peak lists must be aligned to each other and sets of related peaks must be grouped based on common chemical shift dimensions. Even when programs can perform peak grouping, they require the user to provide uniform match tolerances or use default values. However, peak grouping is further complicated by multiple sources of variance in peak position limiting the effectiveness of grouping methods that utilize uniform match tolerances. In addition, no method currently exists for deriving peak positional variances from single peak lists for grouping peaks into spin systems, i.e. spin system grouping within a single peak list. Therefore, we developed a complementary pair of peak list registration analysis and spin system grouping algorithms designed to overcome these limitations. We have implemented these algorithms into an approach that can identify multiple dimension-specific positional variances that exist in a single peak list and group peaks from a single peak list into spin systems. The resulting software tools generate a variety of useful statistics on both a single peak list and pairwise peak list alignment, especially for quality assessment of peak list datasets. We used a range of low and high quality experimental solution NMR and solid-state NMR peak lists to assess performance of our registration analysis and grouping algorithms. Analyses show that an algorithm using a single iteration and uniform match tolerances approach is only able to recover from 50 to 80% of the spin systems due to the presence of multiple sources of variance. Our algorithm recovers additional spin systems by reevaluating match tolerances in multiple iterations. To facilitate evaluation of the

  7. Does the Brain Detect 3G Mobile Phone Radiation Peaks? An Explorative In-Depth Analysis of an Experimental Study.

    Science.gov (United States)

    Roggeveen, Suzanne; van Os, Jim; Lousberg, Richel

    2015-01-01

    This study aimed to investigate whether third generation mobile phone radiation peaks result in event related potentials. Thirty-one healthy females participated. In this single-blind, cross-over design, a 15 minute mobile phone exposure was compared to two 15 minute sham phone conditions, one preceding and one following the exposure condition. Each participant was measured on two separate days, where mobile phone placement was varied between the ear and heart. EEG activity and radiofrequency radiation were recorded jointly. Epochs of 1200 ms, starting 200 ms before and lasting until 1000 ms after the onset of a radiation peak, were extracted from the exposure condition. Control epochs were randomly selected from the two sham phone conditions. The main a-priori hypothesis to be tested concerned an increase of the area in the 240-500 ms post-stimulus interval, in the exposure session with ear-placement. Using multilevel regression analyses the placement*exposure interaction effect was significant for the frontal and central cortical regions, indicating that only in the mobile phone exposure with ear-placement an enlarged cortical reactivity was found. Post-hoc analyses based on visual inspection of the ERPs showed a second significantly increased area between 500-1000 ms post-stimulus for almost every EEG location measured. It was concluded that, when a dialing mobile phone is placed on the ear, its radiation, although unconsciously, is electrically detected by the brain. The question of whether or not this cortical reactivity results in a negative health outcome has to be answered in future longitudinal experiments.

  8. Detection of thoracic vascular structures by electrical impedance tomography: a systematic assessment of prominence peak analysis of impedance changes.

    Science.gov (United States)

    Wodack, K H; Buehler, S; Nishimoto, S A; Graessler, M F; Behem, C R; Waldmann, A D; Mueller, B; Böhm, S H; Kaniusas, E; Thürk, F; Maerz, A; Trepte, C J C; Reuter, D A

    2018-02-28

    Electrical impedance tomography (EIT) is a non-invasive and radiation-free bedside monitoring technology, primarily used to monitor lung function. First experimental data shows that the descending aorta can be detected at different thoracic heights and might allow the assessment of central hemodynamics, i.e. stroke volume and pulse transit time. First, the feasibility of localizing small non-conductive objects within a saline phantom model was evaluated. Second, this result was utilized for the detection of the aorta by EIT in ten anesthetized pigs with comparison to thoracic computer tomography (CT). Two EIT belts were placed at different thoracic positions and a bolus of hypertonic saline (10 ml, 20%) was administered into the ascending aorta while EIT data were recorded. EIT images were reconstructed using the GREIT model, based on the individual's thoracic contours. The resulting EIT images were analyzed pixel by pixel to identify the aortic pixel, in which the bolus caused the highest transient impedance peak in time. In the phantom, small objects could be located at each position with a maximal deviation of 0.71 cm. In vivo, no significant differences between the aorta position measured by EIT and the anatomical aorta location were obtained for both measurement planes if the search was restricted to the dorsal thoracic region of interest (ROIs). It is possible to detect the descending aorta at different thoracic levels by EIT using an intra-aortic bolus of hypertonic saline. No significant differences in the position of the descending aorta on EIT images compared to CT images were obtained for both EIT belts.

  9. Detailed Investigation and Comparison of the XCMS and MZmine 2 Chromatogram Construction and Chromatographic Peak Detection Methods for Preprocessing Mass Spectrometry Metabolomics Data.

    Science.gov (United States)

    Myers, Owen D; Sumner, Susan J; Li, Shuzhao; Barnes, Stephen; Du, Xiuxia

    2017-09-05

    XCMS and MZmine 2 are two widely used software packages for preprocessing untargeted LC/MS metabolomics data. Both construct extracted ion chromatograms (EICs) and detect peaks from the EICs, the first two steps in the data preprocessing workflow. While both packages have performed admirably in peak picking, they also detect a problematic number of false positive EIC peaks and can also fail to detect real EIC peaks. The former and latter translate downstream into spurious and missing compounds and present significant limitations with most existing software packages that preprocess untargeted mass spectrometry metabolomics data. We seek to understand the specific reasons why XCMS and MZmine 2 find the false positive EIC peaks that they do and in what ways they fail to detect real compounds. We investigate differences of EIC construction methods in XCMS and MZmine 2 and find several problems in the XCMS centWave peak detection algorithm which we show are partly responsible for the false positive and false negative compound identifications. In addition, we find a problem with MZmine 2's use of centWave. We hope that a detailed understanding of the XCMS and MZmine 2 algorithms will allow users to work with them more effectively and will also help with future algorithmic development.

  10. Validation of an assay for quantification of free normetanephrine, metanephrine and methoxytyramine in plasma by high performance liquid chromatography with coulometric detection: Comparison of peak-area vs. peak-height measurements.

    Science.gov (United States)

    Nieć, Dawid; Kunicki, Paweł K

    2015-10-01

    Measurements of plasma concentrations of free normetanephrine (NMN), metanephrine (MN) and methoxytyramine (MTY) constitute the most diagnostically accurate screening test for pheochromocytomas and paragangliomas. The aim of this article is to present the results from a validation of an analytical method utilizing high performance liquid chromatography with coulometric detection (HPLC-CD) for quantifying plasma free NMN, MN and MTY. Additionally, peak integration by height and area and the use of one calibration curve for all batches or individual calibration curve for each batch of samples was explored as to determine the optimal approach with regard to accuracy and precision. The method was validated using charcoal stripped plasma spiked with solutions of NMN, MN, MTY and internal standard (4-hydroxy-3-methoxybenzylamine) with the exception of selectivity which was evaluated by analysis of real plasma samples. Calibration curve performance, accuracy, precision and recovery were determined following both peak-area and peak-height measurements and the obtained results were compared. The most accurate and precise method of calibration was evaluated by analyzing quality control samples at three concentration levels in 30 analytical runs. The detector response was linear over the entire tested concentration range from 10 to 2000pg/mL with R(2)≥0.9988. The LLOQ was 10pg/mL for each analyte of interest. To improve accuracy for measurements at low concentrations, a weighted (1/amount) linear regression model was employed, which resulted in inaccuracies of -2.48 to 9.78% and 0.22 to 7.81% following peak-area and peak-height integration, respectively. The imprecisions ranged from 1.07 to 15.45% and from 0.70 to 11.65% for peak-area and peak-height measurements, respectively. The optimal approach to calibration was the one utilizing an individual calibration curve for each batch of samples and peak-height measurements. It was characterized by inaccuracies ranging from -3

  11. An alternative approach for the determination of the full-peak detection efficiency in case of a close-in detection geometry

    International Nuclear Information System (INIS)

    Wispelaere, A. de; Corte, F. de

    2006-01-01

    The aim of this work is to propose an alternative method for the determination of ε p in the case of measurements restricted to one single sample-detector distance. It is based on an iterative procedure, linking the measurement of calibrated multi-γ point sources at this particular detector distance (the resulting ε p -function being disturbed by true-coincidence effects) with measurement of some coincidence-free single-γ point sources (leading to peak-to-total ratios P/T that, combined with detection efficiencies, yield correction factors for true-coincidence effects). The thus obtained ε p versus E γ curve for point-source geometry can then be converted to the actual extended sample geometry, based on the effective solid angle concept

  12. Improved Diagnostic Accuracy in Characterization of Adnexal Masses by Detection of Choline Peak Using 1H MR Spectroscopy in Comparison to Internal Reference at 3 Tesla.

    Science.gov (United States)

    Malek, Mahrooz; Pourashraf, Maryam; Gilani, Mitra Modares; Gity, Masoumeh

    2015-01-01

    The aim of this study was to assess the role of the presence of a choline peak in 3 Tesla 1H magnetic resonance spectroscopy (MRS) for differentiating benign from malignant adnexal masses. A total of 46 adnexal masses (23 malignant and 23 benign) underwent 1H MRS study prior to surgery to assess the presence of choline peak. A choline peak was detected in 16 malignant masses (69.5%) and was absent in the other 7 (30.5%). A choline peak was only detected in 6 (26%) of the benign adnexal masses. The presence of an MRS choline peak had a sensitivity of 69.5%, a specificity of 74%, a positive predictive value (PPV) of 72.7%, and a negative predictive value (NPV) of 71% for diagnosing malignant adnexal masses. A significant difference between the frequency of mean choline peaks in benign and malignant adnexal masses was observed (P valuepeak is seen in malignant adnexal masses more frequently than the benign masses, and may be helpful for diagnosing malignant adnexal masses.

  13. Total peak shape analysis: detection and quantitation of concurrent fronting, tailing, and their effect on asymmetry measurements.

    Science.gov (United States)

    Wahab, M Farooq; Patel, Darshan C; Armstrong, Daniel W

    2017-08-04

    Most peak shapes obtained in separation science depart from linearity for various reasons such as thermodynamic, kinetic, or flow based effects. An indication of the nature of asymmetry often helps in problem solving e.g. in column overloading, slurry packing, buffer mismatch, and extra-column band broadening. However, existing tests for symmetry/asymmetry only indicate the skewness in excess (tail or front) and not the presence of both. Two simple graphical approaches are presented to analyze peak shapes typically observed in gas, liquid, and supercritical fluid chromatography as well as capillary electrophoresis. The derivative test relies on the symmetry of the inflection points and the maximum and minimum values of the derivative. The Gaussian test is a constrained curve fitting approach and determines the residuals. The residual pattern graphically allows the user to assess the problematic regions in a given peak, e.g., concurrent tailing or fronting, something which cannot be easily done with other current methods. The template provided in MS Excel automates this process. The total peak shape analysis extracts the peak parameters from the upper sections (>80% height) of the peak rather than the half height as is done conventionally. A number of situations are presented and the utility of this approach in solving practical problems is demonstrated. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Detection of an inhibitory cortical gradient underlying peak shift in learning: a neural basis for a false memory.

    Science.gov (United States)

    Miasnikov, Alexandre A; Weinberger, Norman M

    2012-11-01

    Experience often does not produce veridical memory. Understanding false attribution of events constitutes an important problem in memory research. "Peak shift" is a well-characterized, controllable phenomenon in which human and animal subjects that receive reinforcement associated with one sensory stimulus later respond maximally to another stimulus in post-training stimulus generalization tests. Peak shift ordinarily develops in discrimination learning (reinforced CS+, unreinforced CS-) and has long been attributed to the interaction of an excitatory gradient centered on the CS+ and an inhibitory gradient centered on the CS-; the shift is away from the CS-. In contrast, we have obtained peak shifts during single tone frequency training, using stimulation of the cholinergic nucleus basalis (NB) to implant behavioral memory into the rat. As we also recorded cortical activity, we took the opportunity to investigate the possible existence of a neural frequency gradient that could account for behavioral peak shift. Behavioral frequency generalization gradients (FGGs, interruption of ongoing respiration) were determined twice before training while evoked potentials were recorded from the primary auditory cortex (A1), to obtain a baseline gradient of "habituatory" neural decrement. A post-training behavioral FGG obtained 24h after three daily sessions of a single tone paired with NB stimulation (200 trials/day) revealed a peak shift. The peak of the FGG was at a frequency lower than the CS while the cortical inhibitory gradient was at a frequency higher than the CS frequency. Further analysis indicated that the frequency location and magnitude of the gradient could account for the behavioral peak shift. These results provide a neural basis for a systematic case of memory misattribution and may provide an animal model for the study of the neural bases of a type of "false memory". Published by Elsevier Inc.

  15. Quantitative in vivo detection of brain cell death after hypoxia ischemia using the lipid peak at 1.3 ppm of proton magnetic resonance spectroscopy in neonatal rats.

    Science.gov (United States)

    Ahn, So Yoon; Yoo, Hye Soo; Lee, Jang Hoon; Sung, Dong Kyung; Jung, Yu Jin; Sung, Se In; Lim, Keun Ho; Chang, Yun Sil; Lee, Jung Hee; Kim, Ki Soo; Park, Won Soon

    2013-07-01

    This study was performed to determine the accuracy of proton magnetic spectroscopy ((1)H-MRS) lipid peak as a noninvasive tool for quantitative in vivo detection of brain cell death. Seven day-old Sprague Dawley rats were subjected to 8% oxygen following a unilateral carotid artery ligation. For treatment, cycloheximide was given immediately after hypoxic ischemia (HI). Lipid peak was measured using (1)H-MRS at 24 hr after HI, and then brains were harvested for fluorocytometric analyses with annexin V/propidium iodide (PI) and fluorescent probe JC-1, and for adenosine-5'-triphosphate (ATP) and lactate. Increased lipid peak at 1.3 ppm measured with (1)H-MRS, apoptotic and necrotic cells, and loss of mitochondrial membrane potential (ΔΨ) at 24 hr after HI were significantly improved with cycloheximide treatment. Significantly reduced brain ATP and increased lactate levels observed at 24 hr after HI showed a tendency to improve without statistical significance with cycloheximide treatment. Lipid peak at 1.3 ppm showed significant positive correlation with both apoptotic and necrotic cells and loss of ΔΨ, and negative correlation with normal live cells. Lipid peak at 1.3 ppm measured by (1)H-MRS might be a sensitive and reliable diagnostic tool for quantitative in vivo detection of brain cell death after HI.

  16. Double peak-induced distance error in short-time-Fourier-transform-Brillouin optical time domain reflectometers event detection and the recovery method.

    Science.gov (United States)

    Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi

    2015-10-01

    The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.

  17. Early Detection of Peak Demand Days of Chronic Respiratory Diseases Emergency Department Visits Using Artificial Neural Networks.

    Science.gov (United States)

    Khatri, Krishan L; Tamil, Lakshman S

    2018-01-01

    Chronic respiratory diseases, mainly asthma and chronic obstructive pulmonary disease (COPD), affect the lives of people by limiting their activities in various aspects. Overcrowding of hospital emergency departments (EDs) due to respiratory diseases in certain weather and environmental pollution conditions results in the degradation of quality of medical care, and even limits its availability. A useful tool for ED managers would be to forecast peak demand days so that they can take steps to improve the availability of medical care. In this paper, we developed an artificial neural network based classifier using multilayer perceptron with back propagation algorithm that predicts peak event (peak demand days) of patients with respiratory diseases, mainly asthma and COPD visiting EDs in Dallas County of Texas in the United States. The precision and recall for peak event class were 77.1% and 78.0%, respectively, and those for nonpeak events were 83.9% and 83.2%, respectively. The overall accuracy of the system is 81.0%.

  18. Maximizing the peak production rate in off-line comprehensive two-dimensional liquid chromatography with mass spectrometry detection

    NARCIS (Netherlands)

    Eeltink, S.; Dolman, S.; Ursem, M.; Swart, R.; McLeod, F.; Schoenmakers, P.J.

    2009-01-01

    This article describes an optimization strategy to obtain the best possible performance in the shortest analysis time—called the peak production rate—for comprehensive off-line two-dimensional liquid chromatography. The demands on column technology (particle size and column length) and LC conditions

  19. Detecting Mountain Peaks and Delineating Their Shapes Using Digital Elevation Models, Remote Sensing and Geographic Information Systems Using Autometric Methodological Procedures

    Directory of Open Access Journals (Sweden)

    Tomaž Podobnikar

    2012-03-01

    Full Text Available The detection of peaks (summits as the upper parts of mountains and the delineation of their shape is commonly confirmed by inspections carried out by mountaineers. In this study the complex task of peak detection and shape delineation is solved by autometric methodological procedures, more precisely, by developing relatively simple but innovative image-processing and spatial-analysis techniques (e.g., developing inventive variables using an annular moving window in remote sensing and GIS domains. The techniques have been integrated into automated morphometric methodological procedures. The concepts of peaks and their shapes (sharp, blunt, oblong, circular and conical were parameterized based on topographic and morphologic criteria. A geomorphologically high quality DEM was used as a fundamental dataset. The results, detected peaks with delineated shapes, have been integratively enriched with numerous independent datasets (e.g., with triangulated spot heights and information (e.g., etymological information, and mountaineering criteria have been implemented to improve the judgments. This holistic approach has proved the applicability of both highly standardized and universal parameters for the geomorphologically diverse Kamnik Alps case study area. Possible applications of this research are numerous, e.g., a comprehensive quality control of DEM or significantly improved models for the spatial planning proposes.

  20. Detection of novel visible-light region absorbance peaks in the urine after alkalization in patients with alkaptonuria.

    Science.gov (United States)

    Tokuhara, Yasunori; Shukuya, Kenichi; Tanaka, Masami; Mouri, Mariko; Ohkawa, Ryunosuke; Fujishiro, Midori; Takahashi, Tomoo; Okubo, Shigeo; Yokota, Hiromitsu; Kurano, Makoto; Ikeda, Hitoshi; Yamaguchi, Seiji; Inagaki, Shinobu; Ishige-Wada, Mika; Usui, Hiromi; Yatomi, Yutaka; Shimosawa, Tatsuo

    2014-01-01

    Alkaptonuria, caused by a deficiency of homogentisate 1,2-dioxygenase, results in the accumulation of homogentisic acid (2,5-dihydroxyphenylacetic acid, HGA) in the urine. Alkaptonuria is suspected when the urine changes color after it is left to stand at room temperature for several hours to days; oxidation of homogentisic acid to benzoquinone acetic acid underlies this color change, which is accelerated by the addition of alkali. In an attempt to develop a facile screening test for alkaptonuria, we added alkali to urine samples obtained from patients with alkaptonuria and measured the absorbance spectra in the visible light region. We evaluated the characteristics of the absorption spectra of urine samples obtained from patients with alkaptonuria (n = 2) and compared them with those of urine specimens obtained from healthy volunteers (n = 5) and patients with phenylketonuria (n = 3), and also of synthetic homogentisic acid solution after alkalization. Alkalization of the urine samples and HGA solution was carried out by the addition of NaOH, KOH or NH4OH. The sample solutions were incubated at room temperature for 1 min, followed by measurement of the absorption spectra. Addition of alkali to alkaptonuric urine yielded characteristic absorption peaks at 406 nm and 430 nm; an identical result was obtained from HGA solution after alkalization. The absorbance values at both 406 nm and 430 nm increased in a time-dependent manner. In addition, the absorbance values at these peaks were greater in strongly alkaline samples (NaOH- KOH-added) as compared with those in weakly alkaline samples (NH4OH-added). In addition, the peaks disappeared following the addition of ascorbic acid to the samples. We found two characteristic peaks at 406 nm and 430 nm in both alkaptonuric urine and HGA solution after alkalization. This new quick and easy method may pave the way for the development of an easy method for the diagnosis of alkaptonuria.

  1. Detection of novel visible-light region absorbance peaks in the urine after alkalization in patients with alkaptonuria.

    Directory of Open Access Journals (Sweden)

    Yasunori Tokuhara

    Full Text Available BACKGROUND: Alkaptonuria, caused by a deficiency of homogentisate 1,2-dioxygenase, results in the accumulation of homogentisic acid (2,5-dihydroxyphenylacetic acid, HGA in the urine. Alkaptonuria is suspected when the urine changes color after it is left to stand at room temperature for several hours to days; oxidation of homogentisic acid to benzoquinone acetic acid underlies this color change, which is accelerated by the addition of alkali. In an attempt to develop a facile screening test for alkaptonuria, we added alkali to urine samples obtained from patients with alkaptonuria and measured the absorbance spectra in the visible light region. METHODS: We evaluated the characteristics of the absorption spectra of urine samples obtained from patients with alkaptonuria (n = 2 and compared them with those of urine specimens obtained from healthy volunteers (n = 5 and patients with phenylketonuria (n = 3, and also of synthetic homogentisic acid solution after alkalization. Alkalization of the urine samples and HGA solution was carried out by the addition of NaOH, KOH or NH4OH. The sample solutions were incubated at room temperature for 1 min, followed by measurement of the absorption spectra. RESULTS: Addition of alkali to alkaptonuric urine yielded characteristic absorption peaks at 406 nm and 430 nm; an identical result was obtained from HGA solution after alkalization. The absorbance values at both 406 nm and 430 nm increased in a time-dependent manner. In addition, the absorbance values at these peaks were greater in strongly alkaline samples (NaOH- KOH-added as compared with those in weakly alkaline samples (NH4OH-added. In addition, the peaks disappeared following the addition of ascorbic acid to the samples. CONCLUSIONS: We found two characteristic peaks at 406 nm and 430 nm in both alkaptonuric urine and HGA solution after alkalization. This new quick and easy method may pave the way for the development of an easy method for the

  2. Fast neutron detection with germanium detectors: computation of response functions for the 692 keV inelastic scattering peak

    International Nuclear Information System (INIS)

    Fehrenbacher, G.; Meckbach, R.; Paretzke, H.G.

    1996-01-01

    The dependence of the shape of the right-sided broadening of the inelastic scattering peak at 692 keV in the pulse-height distribution measured with a Ge detector in fast neutron fields on the energy of the incident neutrons has been analyzed. A model incorporating the process contributing to the energy deposition that engender the peak, including the partitioning of the energy deposition by the Ge recoils, was developed. With a Monte Carlo code based on this model, the detector response associated with this peak was computed and compared with results of measurements with quasi-monoenergetic neutrons for energies between 0.88 and 2.1 MeV. A set of 80 response functions for neutron energies in the range from the reaction threshold at 0.7 to 6 MeV was computed, which will serve as a starting point for methods, which aim at obtaining information on the spectral distribution of fast neutron fields for this energy range from measurements with a Ge detector. (orig.)

  3. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  4. 'Peak oil' or 'peak demand'?

    International Nuclear Information System (INIS)

    Chevallier, Bruno; Moncomble, Jean-Eudes; Sigonney, Pierre; Vially, Rolland; Bosseboeuf, Didier; Chateau, Bertrand

    2012-01-01

    This article reports a workshop which addressed several energy issues like the objectives and constraints of energy mix scenarios, the differences between the approaches in different countries, the cost of new technologies implemented for this purposes, how these technologies will be developed and marketed, which will be the environmental and societal acceptability of these technical choices. Different aspects and issues have been more precisely presented and discussed: the peak oil, development of shale gases and their cost (will non conventional hydrocarbons modify the peak oil and be socially accepted?), energy efficiency (its benefits, its reality in France and other countries, its position in front of the challenge of energy transition), and strategies in the transport sector (challenges for mobility, evolution towards a model of sustainable mobility)

  5. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data.

    Science.gov (United States)

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela; Trabucchi, Michele

    2017-05-19

    Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Gamma-Ray Loudness, Synchrotron Peak Frequency, and Parsec-scale Properties of Blazars Detected by the Fermi Large Area Telescope

    Science.gov (United States)

    Linford, J. D.; Taylor, G. B.; Schinzel, F. K.

    2012-09-01

    The parsec-scale radio properties of 232 active galactic nuclei, most of which are blazars, detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed contemporaneously by the Very Long Baseline Array (VLBA) at 5 GHz. Data from both the first 11 months (1FGL) and the first 2 years (2FGL) of the Fermi mission were used to investigate these sources' γ-ray properties. We use the ratio of the γ-ray-to-radio luminosity as a measure of γ-ray loudness. We investigate the relationship of several radio properties to γ-ray loudness and to the synchrotron peak frequency. There is a tentative correlation between γ-ray loudness and synchrotron peak frequency for BL Lac objects in both 1FGL and 2FGL, and for flat-spectrum radio quasars (FSRQs) in 2FGL. We find that the apparent opening angle tentatively correlates with γ-ray loudness for FSRQs, but only when we use the 2FGL data. We also find that the total VLBA flux density correlates with the synchrotron peak frequency for BL Lac objects and FSRQs. The core brightness temperature also correlates with synchrotron peak frequency, but only for the BL Lac objects. The low-synchrotron-peaked (LSP) BL Lac object sample shows indications of contamination by FSRQs which happen to have undetectable emission lines. There is evidence that the LSP BL Lac objects are more strongly beamed than the rest of the BL Lac object population.

  7. GAMMA-RAY LOUDNESS, SYNCHROTRON PEAK FREQUENCY, AND PARSEC-SCALE PROPERTIES OF BLAZARS DETECTED BY THE FERMI LARGE AREA TELESCOPE

    Energy Technology Data Exchange (ETDEWEB)

    Linford, J. D.; Taylor, G. B.; Schinzel, F. K., E-mail: jlinford@unm.edu [Department of Physics and Astronomy, University of New Mexico, MSC07 4220, Albuquerque, NM 87131-0001 (United States)

    2012-09-20

    The parsec-scale radio properties of 232 active galactic nuclei, most of which are blazars, detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed contemporaneously by the Very Long Baseline Array (VLBA) at 5 GHz. Data from both the first 11 months (1FGL) and the first 2 years (2FGL) of the Fermi mission were used to investigate these sources' {gamma}-ray properties. We use the ratio of the {gamma}-ray-to-radio luminosity as a measure of {gamma}-ray loudness. We investigate the relationship of several radio properties to {gamma}-ray loudness and to the synchrotron peak frequency. There is a tentative correlation between {gamma}-ray loudness and synchrotron peak frequency for BL Lac objects in both 1FGL and 2FGL, and for flat-spectrum radio quasars (FSRQs) in 2FGL. We find that the apparent opening angle tentatively correlates with {gamma}-ray loudness for FSRQs, but only when we use the 2FGL data. We also find that the total VLBA flux density correlates with the synchrotron peak frequency for BL Lac objects and FSRQs. The core brightness temperature also correlates with synchrotron peak frequency, but only for the BL Lac objects. The low-synchrotron-peaked (LSP) BL Lac object sample shows indications of contamination by FSRQs which happen to have undetectable emission lines. There is evidence that the LSP BL Lac objects are more strongly beamed than the rest of the BL Lac object population.

  8. GAMMA-RAY LOUDNESS, SYNCHROTRON PEAK FREQUENCY, AND PARSEC-SCALE PROPERTIES OF BLAZARS DETECTED BY THE FERMI LARGE AREA TELESCOPE

    International Nuclear Information System (INIS)

    Linford, J. D.; Taylor, G. B.; Schinzel, F. K.

    2012-01-01

    The parsec-scale radio properties of 232 active galactic nuclei, most of which are blazars, detected by the Large Area Telescope (LAT) on board the Fermi Gamma-ray Space Telescope have been observed contemporaneously by the Very Long Baseline Array (VLBA) at 5 GHz. Data from both the first 11 months (1FGL) and the first 2 years (2FGL) of the Fermi mission were used to investigate these sources' γ-ray properties. We use the ratio of the γ-ray-to-radio luminosity as a measure of γ-ray loudness. We investigate the relationship of several radio properties to γ-ray loudness and to the synchrotron peak frequency. There is a tentative correlation between γ-ray loudness and synchrotron peak frequency for BL Lac objects in both 1FGL and 2FGL, and for flat-spectrum radio quasars (FSRQs) in 2FGL. We find that the apparent opening angle tentatively correlates with γ-ray loudness for FSRQs, but only when we use the 2FGL data. We also find that the total VLBA flux density correlates with the synchrotron peak frequency for BL Lac objects and FSRQs. The core brightness temperature also correlates with synchrotron peak frequency, but only for the BL Lac objects. The low-synchrotron-peaked (LSP) BL Lac object sample shows indications of contamination by FSRQs which happen to have undetectable emission lines. There is evidence that the LSP BL Lac objects are more strongly beamed than the rest of the BL Lac object population.

  9. Malaria prevalence defined by microscopy, antigen detection, DNA amplification and total nucleic acid amplification in a malaria-endemic region during the peak malaria transmission season.

    Science.gov (United States)

    Waitumbi, John N; Gerlach, Jay; Afonina, Irina; Anyona, Samuel B; Koros, Joseph N; Siangla, Joram; Ankoudinova, Irina; Singhal, Mitra; Watts, Kate; Polhemus, Mark E; Vermeulen, Nicolaas M; Mahoney, Walt; Steele, Matt; Domingo, Gonzalo J

    2011-07-01

    To determine the malaria prevalence by microscopy, antigen detection and nucleic acid detection in a defined subpopulation in a Plasmodium falciparum-endemic region during the peak transmission season. Blood specimens were collected in a cross-sectional study involving children aged 5-10 years (n = 195) presenting with acute fever to two clinics in Western Kenya. All specimens underwent microscopy, HRP2 and aldolase antigen detection by enzyme immunoassay (EIA), parasite-specific DNA and total nucleic acid (RNA and DNA) by real-time PCR (qPCR) and reverse-transcriptase PCR (qRT-PCR). Microscopy detected 65/195 cases of malaria infection [95% confidence interval (CI) 52-78]. HRP2 and aldolase EIA had similar sensitivity levels detecting antigen in 65/195 (95% CI, 52-78) and 57/195 (95% CI, 45-70) cases. Discordants in antigen detection vs. microscopy occurred at Detection of total nucleic acid allowed a 3 log lower limit of detection than just DNA detection by real-time PCR in vitro. In clinical specimens, 114/195 (95% CI, 100-127) were qPCR positive (DNA), and 187/195 (95% CI, 179-191) were qRT-PCR positive (DNA plus RNA). The prevalence of submicroscopic malaria infection was significantly higher when detecting total nucleic acid than just DNA in this outpatient population during the high transmission season. Defining standards for submicroscopic infection will be important for control programmes, diagnostics development efforts and molecular epidemiology studies. © 2011 Blackwell Publishing Ltd.

  10. An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

    Science.gov (United States)

    Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

    2014-01-01

    Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances Ch

  11. Peak flow meter with a questionnaire and mini-spirometer to help detect asthma and COPD in real-life clinical practice: a cross-sectional study.

    Science.gov (United States)

    Thorat, Yogesh T; Salvi, Sundeep S; Kodgule, Rahul R

    2017-05-09

    Peak flow meter with questionnaire and mini-spirometer are considered as alternative tools to spirometry for screening of asthma and chronic obstructive pulmonary disease. However, the accuracy of these tools together, in clinical settings for disease diagnosis, has not been studied. Two hundred consecutive patients with respiratory complaints answered a short symptom questionnaire and performed peak expiratory flow measurements, standard spirometry with Koko spirometer and mini-spirometry (COPD-6). Spirometry was repeated after bronchodilation. Physician made a final diagnosis of asthma, chronic obstructive pulmonary disease and others. One eighty nine patients (78 females) with age 51 ± 17 years with asthma (115), chronic obstructive pulmonary disease (33) and others (41) completed the study. "Breathlessness > 6months" and "cough > 6months" were important symptoms to detect obstructive airways disease. "Asymptomatic period > 2 weeks" had the best sensitivity (Sn) and specificity (Sp) to differentiate asthma and chronic obstructive pulmonary disease. A peak expiratory flow of meter with few symptom questions can be effectively used in clinical practice for objective detection of asthma and chronic obstructive pulmonary disease, in the absence of good quality spirometry. Mini-spirometers are useful in detection of obstructive airways diseases but FEV 1 measured is inaccurate. DIFFERENTIATING CONDITIONS IN POORLY-EQUIPPED SETTINGS: A simple questionnaire and peak flow meter measurements can help doctors differentiate between asthma and chronic lung disease. In clinical settings where access to specialist equipment and knowledge is limited, it can be challenging for doctors to tell the difference between asthma and chronic obstructive pulmonary disease (COPD). To determine a viable alternative method for differentiating between these diseases, Rahul Kodgule and colleagues at the Chest Research Foundation in Pune, India, trialed a simplified version

  12. A Combined Syntactical and Statistical Approach for R Peak Detection in Real-Time Long-Term Heart Rate Variability Analysis

    Directory of Open Access Journals (Sweden)

    David Pang

    2018-06-01

    Full Text Available Long-term heart rate variability (HRV analysis is useful as a noninvasive technique for autonomic nervous system activity assessment. It provides a method for assessing many physiological and pathological factors that modulate the normal heartbeat. The performance of HRV analysis systems heavily depends on a reliable and accurate detection of the R peak of the QRS complex. Ectopic beats caused by misdetection or arrhythmic events can introduce bias into HRV results, resulting in significant problems in their interpretation. This study presents a novel method for long-term detection of normal R peaks (which represent the normal heartbeat in electrocardiographic signals, intended specifically for HRV analysis. The very low computational complexity of the proposed method, which combines and exploits the advantages of syntactical and statistical approaches, enables real-time applications. The approach was validated using the Massachusetts Institute of Technology–Beth Israel Hospital Normal Sinus Rhythm and the Fantasia database, and has a sensitivity, positive predictivity, detection error rate, and accuracy of 99.998, 99.999, 0.003, and 99.996%, respectively.

  13. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  14. The use of compressive sensing and peak detection in the reconstruction of microtubules length time series in the process of dynamic instability.

    Science.gov (United States)

    Mahrooghy, Majid; Yarahmadian, Shantia; Menon, Vineetha; Rezania, Vahid; Tuszynski, Jack A

    2015-10-01

    Microtubules (MTs) are intra-cellular cylindrical protein filaments. They exhibit a unique phenomenon of stochastic growth and shrinkage, called dynamic instability. In this paper, we introduce a theoretical framework for applying Compressive Sensing (CS) to the sampled data of the microtubule length in the process of dynamic instability. To reduce data density and reconstruct the original signal with relatively low sampling rates, we have applied CS to experimental MT lament length time series modeled as a Dichotomous Markov Noise (DMN). The results show that using CS along with the wavelet transform significantly reduces the recovery errors comparing in the absence of wavelet transform, especially in the low and the medium sampling rates. In a sampling rate ranging from 0.2 to 0.5, the Root-Mean-Squared Error (RMSE) decreases by approximately 3 times and between 0.5 and 1, RMSE is small. We also apply a peak detection technique to the wavelet coefficients to detect and closely approximate the growth and shrinkage of MTs for computing the essential dynamic instability parameters, i.e., transition frequencies and specially growth and shrinkage rates. The results show that using compressed sensing along with the peak detection technique and wavelet transform in sampling rates reduces the recovery errors for the parameters. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    Science.gov (United States)

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  16. Enhanced Isotopic Ratio Outlier Analysis (IROA Peak Detection and Identification with Ultra-High Resolution GC-Orbitrap/MS: Potential Application for Investigation of Model Organism Metabolomes

    Directory of Open Access Journals (Sweden)

    Yunping Qiu

    2018-01-01

    Full Text Available Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG. IROA uses two different 13C-enriched carbon sources (randomized 95% 12C and 95% 13C to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n, which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016 with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine. For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great

  17. Enhanced Isotopic Ratio Outlier Analysis (IROA) Peak Detection and Identification with Ultra-High Resolution GC-Orbitrap/MS: Potential Application for Investigation of Model Organism Metabolomes.

    Science.gov (United States)

    Qiu, Yunping; Moir, Robyn D; Willis, Ian M; Seethapathy, Suresh; Biniakewitz, Robert C; Kurland, Irwin J

    2018-01-18

    Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA) workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG). IROA uses two different 13 C-enriched carbon sources (randomized 95% 12 C and 95% 13 C) to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n), which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016) with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine). For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great potential in

  18. New approach for T-wave peak detection and T-wave end location in 12-lead paced ECG signals based on a mathematical model.

    Science.gov (United States)

    Madeiro, João P V; Nicolson, William B; Cortez, Paulo C; Marques, João A L; Vázquez-Seisdedos, Carlos R; Elangovan, Narmadha; Ng, G Andre; Schlindwein, Fernando S

    2013-08-01

    This paper presents an innovative approach for T-wave peak detection and subsequent T-wave end location in 12-lead paced ECG signals based on a mathematical model of a skewed Gaussian function. Following the stage of QRS segmentation, we establish search windows using a number of the earliest intervals between each QRS offset and subsequent QRS onset. Then, we compute a template based on a Gaussian-function, modified by a mathematical procedure to insert asymmetry, which models the T-wave. Cross-correlation and an approach based on the computation of Trapezium's area are used to locate, respectively, the peak and end point of each T-wave throughout the whole raw ECG signal. For evaluating purposes, we used a database of high resolution 12-lead paced ECG signals, recorded from patients with ischaemic cardiomyopathy (ICM) in the University Hospitals of Leicester NHS Trust, UK, and the well-known QT database. The average T-wave detection rates, sensitivity and positive predictivity, were both equal to 99.12%, for the first database, and, respectively, equal to 99.32% and 99.47%, for QT database. The average time errors computed for T-wave peak and T-wave end locations were, respectively, -0.38±7.12 ms and -3.70±15.46 ms, for the first database, and 1.40±8.99 ms and 2.83±15.27 ms, for QT database. The results demonstrate the accuracy, consistency and robustness of the proposed method for a wide variety of T-wave morphologies studied. Copyright © 2012 IPEM. Published by Elsevier Ltd. All rights reserved.

  19. Asymmetry of Peak Thicknesses between the Superior and Inferior Retinal Nerve Fiber Layers for Early Glaucoma Detection: A Simple Screening Method.

    Science.gov (United States)

    Bae, Hyoung Won; Lee, Sang Yeop; Kim, Sangah; Park, Chan Keum; Lee, Kwanghyun; Kim, Chan Yun; Seong, Gong Je

    2018-01-01

    To assess whether the asymmetry in the peripapillary retinal nerve fiber layer (pRNFL) thickness between superior and inferior hemispheres on optical coherence tomography (OCT) is useful for early detection of glaucoma. The patient population consisted of Training set (a total of 60 subjects with early glaucoma and 59 normal subjects) and Validation set (30 subjects with early glaucoma and 30 normal subjects). Two kinds of ratios were employed to measure the asymmetry between the superior and inferior pRNFL thickness using OCT. One was the ratio of the superior to inferior peak thicknesses (peak pRNFL thickness ratio; PTR), and the other was the ratio of the superior to inferior average thickness (average pRNFL thickness ratio; ATR). The diagnostic abilities of the PTR and ATR were compared to the color code classification in OCT. Using the optimal cut-off values of the PTR and ATR obtained from the Training set, the two ratios were independently validated for diagnostic capability. For the Training set, the sensitivities/specificities of the PTR, ATR, quadrants color code classification, and clock-hour color code classification were 81.7%/93.2%, 71.7%/74.6%, 75.0%/93.2%, and 75.0%/79.7%, respectively. The PTR showed a better diagnostic performance for early glaucoma detection than the ATR and the clock-hour color code classification in terms of areas under the receiver operating characteristic curves (AUCs) (0.898, 0.765, and 0.773, respectively). For the Validation set, the PTR also showed the best sensitivity and AUC. The PTR is a simple method with considerable diagnostic ability for early glaucoma detection. It can, therefore, be widely used as a new screening method for early glaucoma. © Copyright: Yonsei University College of Medicine 2018

  20. Web Server for Peak Detection, Baseline Correction, and Alignment in Two-Dimensional Gas Chromatography Mass Spectrometry-Based Metabolomics Data.

    Science.gov (United States)

    Tian, Tze-Feng; Wang, San-Yuan; Kuo, Tien-Chueh; Tan, Cheng-En; Chen, Guan-Yuan; Kuo, Ching-Hua; Chen, Chi-Hsin Sally; Chan, Chang-Chuan; Lin, Olivia A; Tseng, Y Jane

    2016-11-01

    Two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC/TOF-MS) is superior for chromatographic separation and provides great sensitivity for complex biological fluid analysis in metabolomics. However, GC×GC/TOF-MS data processing is currently limited to vendor software and typically requires several preprocessing steps. In this work, we implement a web-based platform, which we call GC 2 MS, to facilitate the application of recent advances in GC×GC/TOF-MS, especially for metabolomics studies. The core processing workflow of GC 2 MS consists of blob/peak detection, baseline correction, and blob alignment. GC 2 MS treats GC×GC/TOF-MS data as pictures and clusters the pixels as blobs according to the brightness of each pixel to generate a blob table. GC 2 MS then aligns the blobs of two GC×GC/TOF-MS data sets according to their distance and similarity. The blob distance and similarity are the Euclidean distance of the first and second retention times of two blobs and the Pearson's correlation coefficient of the two mass spectra, respectively. GC 2 MS also directly corrects the raw data baseline. The analytical performance of GC 2 MS was evaluated using GC×GC/TOF-MS data sets of Angelica sinensis compounds acquired under different experimental conditions and of human plasma samples. The results show that GC 2 MS is an easy-to-use tool for detecting peaks and correcting baselines, and GC 2 MS is able to align GC×GC/TOF-MS data sets acquired under different experimental conditions. GC 2 MS is freely accessible at http://gc2ms.web.cmdm.tw .

  1. ADAP-GC 3.0: Improved Peak Detection and Deconvolution of Co-eluting Metabolites from GC/TOF-MS Data for Metabolomics Studies.

    Science.gov (United States)

    Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei; Du, Xiuxia

    2016-09-06

    ADAP-GC is an automated computational pipeline for untargeted, GC/MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of coeluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information on compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community.

  2. ADAP-GC 3.0: Improved Peak Detection and Deconvolution of Co-eluting Metabolites from GC/TOF-MS Data for Metabolomics Studies

    Science.gov (United States)

    Ni, Yan; Su, Mingming; Qiu, Yunping; Jia, Wei

    2017-01-01

    ADAP-GC is an automated computational pipeline for untargeted, GC-MS-based metabolomics studies. It takes raw mass spectrometry data as input and carries out a sequence of data processing steps including construction of extracted ion chromatograms, detection of chromatographic peak features, deconvolution of co-eluting compounds, and alignment of compounds across samples. Despite the increased accuracy from the original version to version 2.0 in terms of extracting metabolite information for identification and quantitation, ADAP-GC 2.0 requires appropriate specification of a number of parameters and has difficulty in extracting information of compounds that are in low concentration. To overcome these two limitations, ADAP-GC 3.0 was developed to improve both the robustness and sensitivity of compound detection. In this paper, we report how these goals were achieved and compare ADAP-GC 3.0 against three other software tools including ChromaTOF, AnalyzerPro, and AMDIS that are widely used in the metabolomics community. PMID:27461032

  3. Use of placental vascularization indices and uterine artery peak systolic velocity in early detection of pregnancies complicated by gestational diabetes, chronic or gestational hypertension, and preeclampsia at risk.

    Science.gov (United States)

    Altorjay, Ábel T; Surányi, Andrea; Nyári, Tibor; Németh, Gábor

    2017-04-14

    We aimed to investigate correlations between uterine artery peak systolic velocity (AUtPSV), and placental vascularization in groups of normal blood pressure (NBP) and hypertensive disorders of pregnancy (chronic hypertension (CHT), gestational hypertension (GHT) and preeclampsia (PE)) alone or in combination with gestational diabetes mellitus (GDM), and hypothesized that AUtPSV rises when GDM complicates pregnancy hypertension. Placental 3-dimensional power Doppler indices, such as vascularization index (VI), flow index (FI), and vascularization-flow index (VFI), and uterine artery peak systolic velocity (AUtPSV) were measured in CHT (N=43), CHT+GDM (N=15), GHT (N=57), GHT+GDM (N=23) and PE (N=17) pregnancies, and compared to NBP (N=109). Correlations were analyzed between vascularization indices, AUtPSV, pregestational BMI and adverse pregnancy outcome rates. In our results VI was higher in CHT (P=0.010), while FI was lower in CHT (P=0.009), GHT and PE (P=0.001) compared to NBP. In case of VFI, significant difference was found between CHT and GHT (P=0.002), and NBP and PE (P=0.001). FI was found prognostic for umbilical pH and neonatal birth weight. Pre-gestational BMI was significantly higher in GHT+GDM compared to GHT, and in CHT+GDM compared to the CHT group. As for AUtPSV, significant difference was found between NBP and CHT (P=0.012), NBP and CHT+GDM (P=0.045), NBP and GHT+GDM (P=0.007), NBP and PE (P=0.032), and GHT and GHT+GDM (P=0.048) groups. Our study revealed that vascularization indices and AUtPSV show significant differences due to gestational pathology, and can be useful in detection of pregnancies at risk.

  4. Detection of Obstructive Coronary Artery Disease Using Peak Systolic Global Longitudinal Strain Derived by Two-Dimensional Speckle-Tracking: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Liou, Kevin; Negishi, Kazuaki; Ho, Suyen; Russell, Elizabeth A; Cranney, Greg; Ooi, Sze-Yuan

    2016-08-01

    Global longitudinal strain (GLS) is well validated and has important applications in contemporary clinical practice. The aim of this analysis was to evaluate the accuracy of resting peak GLS in the diagnosis of obstructive coronary artery disease (CAD). A systematic literature search was performed through July 2015 using four databases. Data were extracted independently by two authors and correlated before analyses. Using a random-effect model, the pooled sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, diagnostic odds ratio, and summary area under the curve for GLS were estimated with their respective 95% CIs. Screening of 1,669 articles yielded 10 studies with 1,385 patients appropriate for inclusion in the analysis. The mean age and left ventricular ejection fraction were 59.9 years and 61.1%. On the whole, 54.9% and 20.9% of the patients had hypertension and diabetes, respectively. Overall, abnormal GLS detected moderate to severe CAD with a pooled sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio of 74.4%, 72.1%, 2.9, and 0.35 respectively. The area under the curve and diagnostic odds ratio were 0.81 and 8.5. The mean values of GLS for those with and without CAD were -16.5% (95% CI, -15.8% to -17.3%) and -19.7% (95% CI, -18.8% to -20.7%), respectively. Subgroup analyses for patients with severe CAD and normal left ventricular ejection fractions yielded similar results. Current evidence supports the use of GLS in the detection of moderate to severe obstructive CAD in symptomatic patients. GLS may complement existing diagnostic algorithms and act as an early adjunctive marker of cardiac ischemia. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  5. Pulsed hybrid dual wavelength Y-branch-DFB laser-tapered amplifier system suitable for water vapor detection at 965 nm with 16 W peak power

    Science.gov (United States)

    Vu, Thi N.; Klehr, Andreas; Sumpf, Bernd; Hoffmann, Thomas; Liero, Armin; Tränkle, Günther

    2016-03-01

    A master oscillator power amplifier system emitting alternatingly at two neighbored wavelengths around 965 nm is presented. As master oscillator (MO) a Y-branch DFB-laser is used. The two branches, which can be individually controlled, deliver the two wavelengths needed for a differential absorption measurement of water vapor. Adjusting the current through the DFB sections, the wavelength can be adjusted with respect to the targeted either "on" or "off" resonance, respectively wavelength λon or wavelength λoff. The emission of this laser is amplified in a tapered amplifier (TA). The ridge waveguide section of the TA acts as optical gate to generate short pulses with duration of 8 ns at a repetition rate of 25 kHz, the flared section is used for further amplification to reach peak powers up to 16 W suitable for micro-LIDAR (Light Detection and Ranging). The necessary pulse current supply user a GaN-transistor based driver electronics placed close to the power amplifier (PA). The spectral properties of the emission of the MO are preserved by the PA. A spectral line width smaller than 10 pm and a side mode suppression ratio (SMSR) of 37 dB are measured. These values meet the demands for water vapor absorption measurements under atmospheric conditions.

  6. Could quantitative longitudinal peak systolic strain help in the detection of left ventricular wall motion abnormalities in our daily echocardiographic practice?

    Science.gov (United States)

    Benyounes, Nadia; Lang, Sylvie; Gout, Olivier; Ancédy, Yann; Etienney, Arnaud; Cohen, Ariel

    2016-10-01

    Transthoracic echocardiography is the most commonly used tool for the detection of left ventricular wall motion (LVWM) abnormalities using "naked eye evaluation". This subjective and operator-dependent technique requires a high level of clinical training and experience. Two-dimensional speckle-tracking echocardiography (2D-STE), which is less operator-dependent, has been proposed for this purpose. However, the role of on-line segmental longitudinal peak systolic strain (LPSS) values in the prediction of LVWM has not been fully evaluated. To test segmental LPSS for predicting LVWM abnormalities in routine echocardiography laboratory practice. LVWM was evaluated by an experienced cardiologist, during routine practice, in 620 patients; segmental LPSS values were then calculated. In this work, reflecting real life, 99.6% of segments were successfully tracked. Mean (95% confidence interval [CI]) segmental LPSS values for normal basal (n=3409), mid (n=3468) and apical (n=3466) segments were -16.7% (-16.9% to -16.5%), -18.2% (-18.3% to -18.0%) and -21.1% (-21.3% to -20.9%), respectively. Mean (95% CI) segmental LPSS values for hypokinetic basal (n=114), mid (n=116) and apical (n=90) segments were -7.7% (-9.0% to -6.3%), -10.1% (-11.1% to -9.0%) and -9.3% (-10.5% to -8.1%), respectively. Mean (95% CI) segmental LPSS values for akinetic basal (n=128), mid (n=95) and apical (n=91) segments were -6.6% (-8.0% to -5.1%), -6.1% (-7.7% to -4.6%) and -4.2% (-5.4% to -3.0%), respectively. LPSS allowed the differentiation between normal and abnormal segments at basal, mid and apical levels. An LPSS value≥-12% detected abnormal segmental motion with a sensitivity of 78% for basal, 70% for mid and 82% for apical segments. Segmental LPSS values may help to differentiate between normal and abnormal left ventricular segments. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  7. INTEGRAL detection of the multi-peaked emission from the Be/X-ray binary pulsar GRO J1008-57

    DEFF Research Database (Denmark)

    Fiocchi, M.; Sguera, A.; Chenevez, Jérôme

    2014-01-01

    Crab (3-10 keV) and 70.5 +/-9 mCrab (10-25 keV), during a 4.9 ks effective exposure. This is the third outburst peak observed from this source during the current X-ray activity which started in September (ATEL #6465, #6630, #6656, #6664, #6819). Multiple peaks are a complex morphology occurring in about 1...

  8. Statistical analysis of uncertainties of gamma-peak identification and area calculation in particulate air-filter environment radionuclide measurements using the results of a Comprehensive Nuclear-Test-Ban Treaty Organization (CTBTO) organized intercomparison, Part I: Assessment of reliability and uncertainties of isotope detection and energy precision using artificial spiked test spectra, Part II: Assessment of the true type I error rate and the quality of peak area estimators in relation to type II errors using large numbers of natural spectra

    International Nuclear Information System (INIS)

    Zhang, W.; Zaehringer, M.; Ungar, K.; Hoffman, I.

    2008-01-01

    In this paper, the uncertainties of gamma-ray small peak analysis have been examined. As the intensity of a gamma-ray peak approaches its detection decision limit, derived parameters such as centroid channel energy, peak area, peak area uncertainty, baseline determination, and peak significance are statistically sensitive. The intercomparison exercise organized by the CTBTO provided an excellent opportunity for this to be studied. Near background levels, the false-positive and false-negative peak identification frequencies in artificial test spectra have been compared to statistically predictable limiting values. In addition, naturally occurring radon progeny were used to compare observed variance against nominal uncertainties. The results infer that the applied fit algorithms do not always represent the best estimator. Understanding the statistically predicted peak-finding limit is important for data evaluation and analysis assessment. Furthermore, these results are useful to optimize analytical procedures to achieve the best results

  9. The additional value of first pass myocardial perfusion imaging during peak dose of dobutamine stress cardiac MRI for the detection of myocardial ischemia

    NARCIS (Netherlands)

    Lubbers, Daniel D.; Janssen, Caroline H. C.; Kuijpers, Dirkjan; Van Dijkman, Paul R. M.; Overbosch, Jelle; Willems, Tineke P.; Oudkerk, Matthijs

    Purpose of this study was to assess the additional value of first pass myocardial perfusion imaging during peak dose of dobutamine stress Cardiac-MR (CMR). Dobutamine Stress CMR was performed in 115 patients with an inconclusive diagnosis of myocardial ischemia on a 1.5 T system (Magnetom Avanto,

  10. m6aViewer: software for the detection, analysis, and visualization of N6-methyladenosine peaks from m6A-seq/ME-RIP sequencing data.

    Science.gov (United States)

    Antanaviciute, Agne; Baquero-Perez, Belinda; Watson, Christopher M; Harrison, Sally M; Lascelles, Carolina; Crinnion, Laura; Markham, Alexander F; Bonthron, David T; Whitehouse, Adrian; Carr, Ian M

    2017-10-01

    Recent methods for transcriptome-wide N 6 -methyladenosine (m 6 A) profiling have facilitated investigations into the RNA methylome and established m 6 A as a dynamic modification that has critical regulatory roles in gene expression and may play a role in human disease. However, bioinformatics resources available for the analysis of m 6 A sequencing data are still limited. Here, we describe m6aViewer-a cross-platform application for analysis and visualization of m 6 A peaks from sequencing data. m6aViewer implements a novel m 6 A peak-calling algorithm that identifies high-confidence methylated residues with more precision than previously described approaches. The application enables data analysis through a graphical user interface, and thus, in contrast to other currently available tools, does not require the user to be skilled in computer programming. m6aViewer and test data can be downloaded here: http://dna2.leeds.ac.uk/m6a. © 2017 Antanaviciute et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Performance and advantages of a soft-core based parallel architecture for energy peak detection in the calorimeter Level 0 trigger for the NA62 experiment at CERN

    International Nuclear Information System (INIS)

    Ammendola, R.; Barbanera, M.; Bizzarri, M.; Bonaiuto, V.; Ceccucci, A.; Simone, N. De; Fantechi, R.; Fucci, A.; Lupi, M.; Ryjov, V.; Checcucci, B.; Papi, A.; Piccini, M.; Federici, L.; Paoluzzi, G.; Salamon, A.; Salina, G.; Sargeni, F.; Venditti, S.

    2017-01-01

    The NA62 experiment at CERN SPS has started its data-taking. Its aim is to measure the branching ratio of the ultra-rare decay K +  → π + ν ν̅ . In this context, rejecting the background is a crucial topic. One of the main background to the measurement is represented by the K +  → π + π 0  decay. In the 1-8.5 mrad decay region this background is rejected by the calorimetric trigger processor (Cal-L0). In this work we present the performance of a soft-core based parallel architecture built on FPGAs for the energy peak reconstruction as an alternative to an implementation completely founded on VHDL language.

  12. Performance and advantages of a soft-core based parallel architecture for energy peak detection in the calorimeter Level 0 trigger for the NA62 experiment at CERN

    Science.gov (United States)

    Ammendola, R.; Barbanera, M.; Bizzarri, M.; Bonaiuto, V.; Ceccucci, A.; Checcucci, B.; De Simone, N.; Fantechi, R.; Federici, L.; Fucci, A.; Lupi, M.; Paoluzzi, G.; Papi, A.; Piccini, M.; Ryjov, V.; Salamon, A.; Salina, G.; Sargeni, F.; Venditti, S.

    2017-03-01

    The NA62 experiment at CERN SPS has started its data-taking. Its aim is to measure the branching ratio of the ultra-rare decay K+ → π+ν ν̅ . In this context, rejecting the background is a crucial topic. One of the main background to the measurement is represented by the K+ → π+π0 decay. In the 1-8.5 mrad decay region this background is rejected by the calorimetric trigger processor (Cal-L0). In this work we present the performance of a soft-core based parallel architecture built on FPGAs for the energy peak reconstruction as an alternative to an implementation completely founded on VHDL language.

  13. Doppler ultrasound for detection of renal transplant artery stenosis - Threshold peak systolic velocity needs to be higher in a low-risk or surveillance population

    International Nuclear Information System (INIS)

    Patel, U.; Khaw, K.K.; Hughes, N.C.

    2003-01-01

    AIMS: To establish the ideal threshold arterial velocity for the diagnosis of renal transplant artery stenosis in a surveillance population with a low pre-test probability of stenosis. METHODS: Retrospective review of Doppler ultrasound, angiographic and clinical outcome data of patients transplanted over a 3-year period. Data used to calculate sensitivity, specificity, positive predictive values (PPV) and negative predictive values (NPV) for various threshold peak systolic velocity values. RESULTS: Of 144 patients transplanted, full data were available in 117 cases. Five cases had renal transplant artery stenosis--incidence 4.2% [stenosis identified at a mean of 6.5 months (range 2-10 months)]. All five cases had a significant arterial pressure gradient across the narrowing and underwent angioplasty. Threshold peak systolic velocity of ≥2.5 m/s is not ideal [specificity=79% (CI 65-82%), PPV=18% (CI 6-32%), NPV=100% (CI 94-100%)], subjecting many patients to unnecessary angiography--8/117 (6%) in our population. Comparable values if the threshold is set at ≥3.0 m/s are 93% (CI 77-96%), 33% (CI 7-44%) and 99% (CI 93-100%), respectively. The clinical outcome of all patients was satisfactory, with no unexplained graft failures or loss. CONCLUSIONS: In a surveillance population with a low pre-test probability of stenosis, absolute renal artery velocity ≥2.5 m/s is a limited surrogate marker for significant renal artery stenosis. The false-positive rate is high, and ≥3.0 m/s is a better choice which will halve the number of patients enduring unnecessary angiography. Close clinical follow-up of patients in the 2.5-3.0 m/s range, with repeat Doppler ultrasound if necessary, will identify the test false-negatives

  14. Peak Experience Project

    Science.gov (United States)

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  15. A novel method for the detection of R-peaks in ECG based on K-Nearest Neighbors and Particle Swarm Optimization

    Science.gov (United States)

    He, Runnan; Wang, Kuanquan; Li, Qince; Yuan, Yongfeng; Zhao, Na; Liu, Yang; Zhang, Henggui

    2017-12-01

    Cardiovascular diseases are associated with high morbidity and mortality. However, it is still a challenge to diagnose them accurately and efficiently. Electrocardiogram (ECG), a bioelectrical signal of the heart, provides crucial information about the dynamical functions of the heart, playing an important role in cardiac diagnosis. As the QRS complex in ECG is associated with ventricular depolarization, therefore, accurate QRS detection is vital for interpreting ECG features. In this paper, we proposed a real-time, accurate, and effective algorithm for QRS detection. In the algorithm, a proposed preprocessor with a band-pass filter was first applied to remove baseline wander and power-line interference from the signal. After denoising, a method combining K-Nearest Neighbor (KNN) and Particle Swarm Optimization (PSO) was used for accurate QRS detection in ECGs with different morphologies. The proposed algorithm was tested and validated using 48 ECG records from MIT-BIH arrhythmia database (MITDB), achieved a high averaged detection accuracy, sensitivity and positive predictivity of 99.43, 99.69, and 99.72%, respectively, indicating a notable improvement to extant algorithms as reported in literatures.

  16. Simultaneous resolution of overlapping peaks in high-performance liquid chromatography and micellar electrokinetic chromatography with diode array detection using augmented iterative target transformation factor analysis

    NARCIS (Netherlands)

    van Zomeren, Paul; Metting, H.J; Coenegracht, P.M.J.; de Jong, G.J.

    2005-01-01

    In this paper, augmentation has been applied to data matrices, which originate from hyphenated methods that share the same mode of detection, but use different separation methods, HPLC-DAD and MEKC-DAD. A novel method, wavelength shift eigenstructure tracking (WET), has been proposed for the

  17. Wavelet-based peak detection and a new charge inference procedure for MS/MS implemented in ProteoWizard's msConvert.

    Science.gov (United States)

    French, William R; Zimmerman, Lisa J; Schilling, Birgit; Gibson, Bradford W; Miller, Christine A; Townsend, R Reid; Sherrod, Stacy D; Goodwin, Cody R; McLean, John A; Tabb, David L

    2015-02-06

    We report the implementation of high-quality signal processing algorithms into ProteoWizard, an efficient, open-source software package designed for analyzing proteomics tandem mass spectrometry data. Specifically, a new wavelet-based peak-picker (CantWaiT) and a precursor charge determination algorithm (Turbocharger) have been implemented. These additions into ProteoWizard provide universal tools that are independent of vendor platform for tandem mass spectrometry analyses and have particular utility for intralaboratory studies requiring the advantages of different platforms convergent on a particular workflow or for interlaboratory investigations spanning multiple platforms. We compared results from these tools to those obtained using vendor and commercial software, finding that in all cases our algorithms resulted in a comparable number of identified peptides for simple and complex samples measured on Waters, Agilent, and AB SCIEX quadrupole time-of-flight and Thermo Q-Exactive mass spectrometers. The mass accuracy of matched precursor ions also compared favorably with vendor and commercial tools. Additionally, typical analysis runtimes (∼1-100 ms per MS/MS spectrum) were short enough to enable the practical use of these high-quality signal processing tools for large clinical and research data sets.

  18. Wavelet-Based Peak Detection and a New Charge Inference Procedure for MS/MS Implemented in ProteoWizard’s msConvert

    Science.gov (United States)

    2015-01-01

    We report the implementation of high-quality signal processing algorithms into ProteoWizard, an efficient, open-source software package designed for analyzing proteomics tandem mass spectrometry data. Specifically, a new wavelet-based peak-picker (CantWaiT) and a precursor charge determination algorithm (Turbocharger) have been implemented. These additions into ProteoWizard provide universal tools that are independent of vendor platform for tandem mass spectrometry analyses and have particular utility for intralaboratory studies requiring the advantages of different platforms convergent on a particular workflow or for interlaboratory investigations spanning multiple platforms. We compared results from these tools to those obtained using vendor and commercial software, finding that in all cases our algorithms resulted in a comparable number of identified peptides for simple and complex samples measured on Waters, Agilent, and AB SCIEX quadrupole time-of-flight and Thermo Q-Exactive mass spectrometers. The mass accuracy of matched precursor ions also compared favorably with vendor and commercial tools. Additionally, typical analysis runtimes (∼1–100 ms per MS/MS spectrum) were short enough to enable the practical use of these high-quality signal processing tools for large clinical and research data sets. PMID:25411686

  19. Peak-interviewet

    DEFF Research Database (Denmark)

    Raalskov, Jesper; Warming-Rasmussen, Bent

    Peak-interviewet er en særlig effektiv metode til at gøre ubevidste menneskelige ressourcer bevidste. Fokuspersonen (den interviewede) interviewes om en selvvalgt, personlig succesoplevelse. Terapeuten/coachen (intervieweren) spørger ind til processen, som ledte hen til denne succes. Herved afdæk...... fokuspersonen ønsker at tage op (nye mål eller nye processer). Nærværende workingpaper beskriver, hvad der menes med et peak-interview, peakinterviwets teoretiske fundament samt metodikken til at foretage et tillidsfuldt og effektiv peak-interview....

  20. Validation of sleep-2-Peak: A smartphone application that can detect fatigue-related changes in reaction times during sleep deprivation.

    Science.gov (United States)

    Brunet, Jean-François; Dagenais, Dominique; Therrien, Marc; Gartenberg, Daniel; Forest, Geneviève

    2017-08-01

    Despite its high sensitivity and validity in the context of sleep loss, the Psychomotor Vigilance Test (PVT) could be improved. The aim of the present study was to validate a new smartphone PVT-type application called sleep-2-Peak (s2P) by determining its ability to assess fatigue-related changes in alertness in a context of extended wakefulness. Short 3-min versions of s2P and of the classic PVT were administered at every even hour during a 35-h total sleep deprivation protocol. In addition, subjective measures of sleepiness were collected. The outcomes on these tests were then compared using Pearson product-moment correlations, t tests, and repeated measures within-groups analyses of variance. The results showed that both tests significantly correlated on all outcome variables, that both significantly distinguished between the alert and sleepy states in the same individual, and that both varied similarly through the sleep deprivation protocol as sleep loss accumulated. All outcome variables on both tests also correlated significantly with the subjective measures of sleepiness. These results suggest that a 3-min version of s2P is a valid tool for differentiating alert from sleepy states and is as sensitive as the PVT for tracking fatigue-related changes during extended wakefulness and sleep loss. Unlike the PVT, s2P does not provide feedback to subjects on each trial. We discuss how this feature of s2P raises the possibility that the performance results measured by s2P could be less impacted by motivational confounds, giving this tool added value in particular clinical and/or research settings.

  1. Quantitative computer-aided diagnostic algorithm for automated detection of peak lesion attenuation in differentiating clear cell from papillary and chromophobe renal cell carcinoma, oncocytoma, and fat-poor angiomyolipoma on multiphasic multidetector computed tomography.

    Science.gov (United States)

    Coy, Heidi; Young, Jonathan R; Douek, Michael L; Brown, Matthew S; Sayre, James; Raman, Steven S

    2017-07-01

    To evaluate the performance of a novel, quantitative computer-aided diagnostic (CAD) algorithm on four-phase multidetector computed tomography (MDCT) to detect peak lesion attenuation to enable differentiation of clear cell renal cell carcinoma (ccRCC) from chromophobe RCC (chRCC), papillary RCC (pRCC), oncocytoma, and fat-poor angiomyolipoma (fp-AML). We queried our clinical databases to obtain a cohort of histologically proven renal masses with preoperative MDCT with four phases [unenhanced (U), corticomedullary (CM), nephrographic (NP), and excretory (E)]. A whole lesion 3D contour was obtained in all four phases. The CAD algorithm determined a region of interest (ROI) of peak lesion attenuation within the 3D lesion contour. For comparison, a manual ROI was separately placed in the most enhancing portion of the lesion by visual inspection for a reference standard, and in uninvolved renal cortex. Relative lesion attenuation for both CAD and manual methods was obtained by normalizing the CAD peak lesion attenuation ROI (and the reference standard manually placed ROI) to uninvolved renal cortex with the formula [(peak lesion attenuation ROI - cortex ROI)/cortex ROI] × 100%. ROC analysis and area under the curve (AUC) were used to assess diagnostic performance. Bland-Altman analysis was used to compare peak ROI between CAD and manual method. The study cohort comprised 200 patients with 200 unique renal masses: 106 (53%) ccRCC, 32 (16%) oncocytomas, 18 (9%) chRCCs, 34 (17%) pRCCs, and 10 (5%) fp-AMLs. In the CM phase, CAD-derived ROI enabled characterization of ccRCC from chRCC, pRCC, oncocytoma, and fp-AML with AUCs of 0.850 (95% CI 0.732-0.968), 0.959 (95% CI 0.930-0.989), 0.792 (95% CI 0.716-0.869), and 0.825 (95% CI 0.703-0.948), respectively. On Bland-Altman analysis, there was excellent agreement of CAD and manual methods with mean differences between 14 and 26 HU in each phase. A novel, quantitative CAD algorithm enabled robust peak HU lesion detection

  2. Peak power ratio generator

    Science.gov (United States)

    Moyer, R.D.

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  3. Detection and identification of serum protein peak at 6648 m/z as a novel indicator in breast cancer based on mass spectrometry.

    Science.gov (United States)

    Song, Dongjian; Yue, Lifang; Zhan, Yuxiao; Zhang, Junjie; Yan, Zechen; Fan, Yingzhong; Yang, Heying; Zhang, Da; Liu, Qiuliang; Xia, Ziqiang; Qin, Pan; Jia, Jia; Yue, Ming; Yu, Jiekai; Zheng, Shu; Yang, Fuquan; Wang, Jiaxiang

    2017-05-01

    Breast cancer (BC) is the second-leading cause of cancer mortality after lung cancer in women owing partly to a lack of specific and sensitive tests for early screening and monitoring. The detection of novel specific BC serum indicators for screening purposes is an essential clinical need. A total of 437 serum specimens from 310 BC patients that were divided into mining and testing sets were collected in this study. In contrast with the conventional BC indicators through receiver operating characteristic, survival and hazard function curves, and multivariate Cox regression analyses, we intended to hunt for stable protein indicators from serum specimens and identify their diagnostic and prognostic potential for BC. We identified a unique serum peptide located at 6648 Da originated from apoC-III with a validated correlation with BC tumorigenesis with confirmation in a substantive testing set and minimization of systematic bias by pre-analytical parameters. We found that the diagnostic efficacy of this peptide is better than the present conventional BC diagnostic indicators either alone or in combination with conventional indicators in distinguishing BC patients from control volunteers. Moreover, this peptide denotes a stronger prognostic factor for BC patients than conventional indicators. In light of these findings, we speculate that this peptide is a potential diagnostic and prognostic indicator and a supplement to conventional indicators in monitoring BC. The detection of this peptide located at 6648 Da in sera could enhance early screening and assessment of the postoperative survival opportunity for BC patients.

  4. Peak Oil, Peak Coal and Climate Change

    Science.gov (United States)

    Murray, J. W.

    2009-05-01

    Research on future climate change is driven by the family of scenarios developed for the IPCC assessment reports. These scenarios create projections of future energy demand using different story lines consisting of government policies, population projections, and economic models. None of these scenarios consider resources to be limiting. In many of these scenarios oil production is still increasing to 2100. Resource limitation (in a geological sense) is a real possibility that needs more serious consideration. The concept of 'Peak Oil' has been discussed since M. King Hubbert proposed in 1956 that US oil production would peak in 1970. His prediction was accurate. This concept is about production rate not reserves. For many oil producing countries (and all OPEC countries) reserves are closely guarded state secrets and appear to be overstated. Claims that the reserves are 'proven' cannot be independently verified. Hubbert's Linearization Model can be used to predict when half the ultimate oil will be produced and what the ultimate total cumulative production (Qt) will be. US oil production can be used as an example. This conceptual model shows that 90% of the ultimate US oil production (Qt = 225 billion barrels) will have occurred by 2011. This approach can then be used to suggest that total global production will be about 2200 billion barrels and that the half way point will be reached by about 2010. This amount is about 5 to 7 times less than assumed by the IPCC scenarios. The decline of Non-OPEC oil production appears to have started in 2004. Of the OPEC countries, only Saudi Arabia may have spare capacity, but even that is uncertain, because of lack of data transparency. The concept of 'Peak Coal' is more controversial, but even the US National Academy Report in 2007 concluded only a small fraction of previously estimated reserves in the US are actually minable reserves and that US reserves should be reassessed using modern methods. British coal production can be

  5. Application of a novel measure of EEG non-stationarity as 'Shannon- entropy of the peak frequency shifting' for detecting residual abnormalities in concussed individuals.

    Science.gov (United States)

    Cao, Cheng; Slobounov, Semyon

    2011-07-01

    The aim of this report was to propose a novel measure of non-stationarity of EEG signals, named Shannon- entropy of the peak frequency shifting (SEPFS). The feasibility of this method was documented comparing this measure with traditional time domain assessment of non-stationarity and its application to EEG data sets obtained from student-athletes before and after suffering a single episode of mild traumatic brain injury (mTBI) with age-matched normal controls. Instead of assessing the power density distribution on the time-frequency plane, like previously proposed measures of signal non-stationarity, this new measure is based on the shift of the dominant frequency of the EEG signal over time. We applied SEPFS measure to assess the properties of EEG non-stationarity in subjects before and shortly after they suffered mTBI. Student-athletes at high risk for mTBI (n=265) were tested prior to concussive episodes as a baseline. From this subject pool, 30 athletes who suffered from mTBI were retested on day 30 post-injury. Additional subjects pool (student-athletes without history of concussion, n=30) were recruited and test-re-tested within the same 30 day interval. Thirty-two channels EEG signals were acquired in sitting eyes closed condition. The results showed that the SEPFS values significantly decreased in subjects suffering from mTBI. Specifically, reduced EEG non-stationarity was observed in occipital, temporal and central brain areas, indicating the possibility of residual brain dysfunctions in concussed individuals. A similar but less statistically significant trend was observed using traditional time domain analysis of EEG non-stationarity. The proposed measure has at least two merits of interest: (1) it is less affected by the limited resolution of time-frequency representation of the EEG signal; (2) it takes into account the neural characteristics of the EEG signal that have not been considered in previously proposed measures of non-stationarity. This new

  6. Peak regulation right

    International Nuclear Information System (INIS)

    Gao, Z. |; Ren, Z.; Li, Z.; Zhu, R.

    2005-01-01

    A peak regulation right concept and corresponding transaction mechanism for an electricity market was presented. The market was based on a power pool and independent system operator (ISO) model. Peak regulation right (PRR) was defined as a downward regulation capacity purchase option which allowed PRR owners to buy certain quantities of peak regulation capacity (PRC) at a specific price during a specified period from suppliers. The PRR owner also had the right to decide whether or not they would buy PRC from suppliers. It was the power pool's responsibility to provide competitive and fair peak regulation trading markets to participants. The introduction of PRR allowed for unit capacity regulation. The PRR and PRC were rated by the supplier, and transactions proceeded through a bidding process. PRR suppliers obtained profits by selling PRR and PRC, and obtained downward regulation fees regardless of whether purchases are made. It was concluded that the peak regulation mechanism reduced the total cost of the generating system and increased the social surplus. 6 refs., 1 tab., 3 figs

  7. Make peak flow a habit

    Science.gov (United States)

    Asthma - make peak flow a habit; Reactive airway disease - peak flow; Bronchial asthma - peak flow ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  8. Dynamic workload peak detection for slack management

    NARCIS (Netherlands)

    Milutinovic, A.; Goossens, Kees; Smit, Gerardus Johannes Maria; Kuper, Jan; Kuper, J.

    2009-01-01

    In this paper an analytical study on dynamism and possibilities on slack exploitation by dynamic power management is presented. We introduce a specific workload decomposition method for work required for (streaming) application processing data tokens (e.g. video frames) with work behaviour patterns

  9. DETECTION AND QUANTIFICATION OF ASYMMETRIC PEAKS

    Science.gov (United States)

    One of the goals of a recent U.S. Environmental Protection Agency air pollution study was to relate the participants' activities to their exposures to particulate matter (PM) during their routine activities. PM concentration data were collected continuously with a real-time monit...

  10. Enhancement of evaporative light scattering detection in high-performance liquid chromatographic determination of neomycin based on highly volatile mobile phase, high-molecular-mass ion-pairing reagents and controlled peak shape.

    Science.gov (United States)

    Megoulas, Nikolaos C; Koupparis, Michael A

    2004-11-19

    In the frame of the development of a novel HPLC-ELSD (evaporative light scattering detection) method for the determination of the aminoglycoside antibiotic neomycin sulfate, the influence of mobile phase composition and peak broadening on ELSD response was evaluated. ELSD response was enhanced by: (a) increase of mobile phase volatility (solvents examined: water, acetonitrile, methanol and acetone), (b) increase of molecular mass of ion-pairing species [acidic reagents tested: formic, acetic, trifluoroacetic, trichloroacetic and heptafluorobutyric acid (HFBA)], and (c) decrease of peak width and asymmetry obtained by controlling the concentration of the ion-pairing acidic reagent (HFBA). Utilizing a Waters ODS-2 C18 Spherisorb column, evaporation temperature of 45 degrees C and nitrogen pressure of 3.5 bar, the optimized mobile phase was water-acetone (50:50), containing 11.6 mM HFBA, in an isocratic mode at a rate of 1.0 ml/min. Neomycin was eluted at 4.9 min, with asymmetry factor 1.3. Logarithmic calibration curve was obtained from 2 to 50 microg/ml (r > 0.9997). Limit of detection (LOD) was 0.6 microg/ml and R.S.D. = 1.7% (n = 3, 3.3 microg/ml). In raw materials, the simultaneous determination of sulfate (LOD = 3 microg/ml, R.S.D. = 1.7%, r> 0.9998) and of minor impurities was feasible. The developed method was also applied for the determination of neomycin in pharmaceutical formulations (powder, aerosol and cream) without any interference from excipients (recovery from spiked samples ranged from 99 to 102%) and a %R.S.D. of <2.1 (n = 3). The HPLC-ELSD method was also found applicable in the determination of neomycin in animal feeds (LOQ=0.2%) without any interference from the feed matrices.

  11. Peak reading detector circuit

    International Nuclear Information System (INIS)

    Courtin, E.; Grund, K.; Traub, S.; Zeeb, H.

    1975-01-01

    The peak reading detector circuit serves for picking up the instants during which peaks of a given polarity occur in sequences of signals in which the extreme values, their time intervals, and the curve shape of the signals vary. The signal sequences appear in measuring the foetal heart beat frequence from amplitude-modulated ultrasonic, electrocardiagram, and blood pressure signals. In order to prevent undesired emission of output signals from, e. g., disturbing intermediate extreme values, the circuit consists of the series connections of a circuit to simulate an ideal diode, a strong unit, a discriminator for the direction of charging current, a time-delay circuit, and an electronic switch lying in the decharging circuit of the storage unit. The time-delay circuit thereby causes storing of a preliminary maximum value being used only after a certain time delay for the emission of the output signal. If a larger extreme value occurs during the delay time the preliminary maximum value is cleared and the delay time starts running anew. (DG/PB) [de

  12. Resting multilayer 2D speckle-tracking TTE for detection of ischemic segments confirmed by invasive FFR part-2, using post-systolic-strain-index and time from aortic-valve-closure to regional peak longitudinal-strain.

    Science.gov (United States)

    Ozawa, Koya; Funabashi, Nobusada; Nishi, Takeshi; Takahara, Masayuki; Fujimoto, Yoshihide; Kamata, Tomoko; Kobayashi, Yoshio

    2016-08-15

    This study evaluated the post-systolic strain index (PSI), and the time interval between aortic valve closure (AVC) and regional peak longitudinal strain (PLS), measured by transthoracic echocardiography (TTE), for detection of left ventricular (LV) myocardial ischemic segments confirmed by invasive fractional flow reserve (FFR). 39 stable patients (32 males; 65.8±11.9years) with 46 coronary arteries at ≥50% stenosis on invasive coronary angiography underwent 2D speckle tracking TTE (Vivid E9, GE Healthcare) and invasive FFR measurements. PSI, AVC and regional PLS in each LV segment were calculated. FFR ≤0.80 was detected in 27 LV segments. There were no significant differences between segments supplied by FFR ≤0.80 and FFR >0.80 vessels in either PSI or the time interval between AVC and regional PLS. To identify LV segments±FFR ≤0.80, the receiver operator characteristic (ROC) curves for PSI, and the time interval between AVC and regional PLS had areas under the curve (AUC) values of 0.58 and 0.57, respectively, with best cut-off points of 12% (sensitivity 70.4%, specificity 57.9%) and 88ms (sensitivity 70.4%, specificity 52.6%), respectively, but the AUCs were not statistically significant. In stable coronary artery disease patients with ≥50% coronary artery stenosis, measurement of PSI, and the time interval between AVC and regional PLS, on resting TTE, enabled the identification of LV segments with FFR ≤0.80 using each appropriate threshold for PSI, and the time interval between AVC and regional PLS, with reasonable diagnostic accuracy. However, the AUC values were not statistically significant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Avoiding the False Peaks in Correlation Discrimination

    International Nuclear Information System (INIS)

    Awwal, A.S.

    2009-01-01

    Fiducials imprinted on laser beams are used to perform video image based alignment of the 192 laser beams in the National Ignition Facility (NIF) of Lawrence Livermore National Laboratory. In many video images, matched filtering is used to detect the location of these fiducials. Generally, the highest correlation peak is used to determine the position of the fiducials. However, when the signal to-be-detected is very weak compared to the noise, this approach totally breaks down. The highest peaks act as traps for false detection. The active target images used for automatic alignment in the National Ignition Facility are examples of such images. In these images, the fiducials of interest exhibit extremely low intensity and contrast, surrounded by high intensity reflection from metallic objects. Consequently, the highest correlation peaks are caused by these bright objects. In this work, we show how the shape of the correlation is exploited to isolate the valid matches from hundreds of invalid correlation peaks, and therefore identify extremely faint fiducials under very challenging imaging conditions

  14. Upper limit of peak area

    International Nuclear Information System (INIS)

    Helene, O.A.M.

    1982-08-01

    The determination of the upper limit of peak area in a multi-channel spectra, with a known significance level is discussed. This problem is specially important when the peak area is masked by the background statistical fluctuations. The problem is exactly solved and, thus, the results are valid in experiments with small number of events. The results are submitted to a Monte Carlo test and applied to the 92 Nb beta decay. (Author) [pt

  15. Peak Oil and other threatening peaks-Chimeras without substance

    International Nuclear Information System (INIS)

    Radetzki, Marian

    2010-01-01

    The Peak Oil movement has widely spread its message about an impending peak in global oil production, caused by an inadequate resource base. On closer scrutiny, the underlying analysis is inconsistent, void of a theoretical foundation and without support in empirical observations. Global oil resources are huge and expanding, and pose no threat to continuing output growth within an extended time horizon. In contrast, temporary or prolonged supply crunches are indeed plausible, even likely, on account of growing resource nationalism denying access to efficient exploitation of the existing resource wealth.

  16. Electricity Portfolio Management: Optimal Peak / Off-Peak Allocations

    OpenAIRE

    Huisman, Ronald; Mahieu, Ronald; Schlichter, Felix

    2007-01-01

    textabstractElectricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to allocate optimal positions in peak and off-peak forward contracts. It is shown that the optimal allocations are based on the difference in risk premiums per unit of day-ahead risk as a measure of relati...

  17. Ultrasonic Transducer Peak-to-Peak Optical Measurement

    Directory of Open Access Journals (Sweden)

    Pavel Skarvada

    2012-01-01

    Full Text Available Possible optical setups for measurement of the peak-to-peak value of an ultrasonic transducer are described in this work. The Michelson interferometer with the calibrated nanopositioner in reference path and laser Doppler vibrometer were used for the basic measurement of vibration displacement. Langevin type of ultrasonic transducer is used for the purposes of Electro-Ultrasonic Nonlinear Spectroscopy (EUNS. Parameters of produced mechanical vibration have to been well known for EUNS. Moreover, a monitoring of mechanical vibration frequency shift with a mass load and sample-transducer coupling is important for EUNS measurement.

  18. Online junction temperature measurement using peak gate current

    DEFF Research Database (Denmark)

    Baker, Nick; Munk-Nielsen, Stig; Iannuzzo, Francesco

    2015-01-01

    A new method for junction temperature measurement of MOS-gated power semiconductor switches is presented. The measurement method involves detecting the peak voltage over the external gate resistor of an IGBT or MOSFET during turn-on. This voltage is directly proportional to the peak gate current...

  19. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  20. How to use your peak flow meter

    Science.gov (United States)

    ... meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  1. Peak effect in twinned superconductors

    International Nuclear Information System (INIS)

    Larkin, A.I.; Marchetti, M.C.; Vinokur, V.M.

    1995-01-01

    A sharp maximum in the critical current J c as a function of temperature just below the melting point of the Abrikosov flux lattice has recently been observed in both low- and high-temperature superconductors. This peak effect is strongest in twinned crystals for fields aligned with the twin planes. We propose that this peak signals the breakdown of the collective pinning regime and the crossover to strong pinning of single vortices on the twin boundaries. This crossover is very sharp and can account for the steep drop of the differential resistivity observed in experiments. copyright 1995 The American Physical Society

  2. Hubbert's Peak -- A Physicist's View

    Science.gov (United States)

    McDonald, Richard

    2011-04-01

    Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.

  3. SPANISH PEAKS PRIMITIVE AREA, MONTANA.

    Science.gov (United States)

    Calkins, James A.; Pattee, Eldon C.

    1984-01-01

    A mineral survey of the Spanish Peaks Primitive Area, Montana, disclosed a small low-grade deposit of demonstrated chromite and asbestos resources. The chances for discovery of additional chrome resources are uncertain and the area has little promise for the occurrence of other mineral or energy resources. A reevaluation, sampling at depth, and testing for possible extensions of the Table Mountain asbestos and chromium deposit should be undertaken in the light of recent interpretations regarding its geologic setting.

  4. Neurofeedback training for peak performance

    OpenAIRE

    Marek Graczyk; Maria Pąchalska; Artur Ziółkowski; Grzegorz Mańko; Beata Łukaszewska; Kazimierz Kochanowicz; Andrzej Mirski; Iurii D. Kropotov

    2014-01-01

    [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneou...

  5. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  6. Evaluation of concurrent peak responses

    International Nuclear Information System (INIS)

    Wang, P.C.; Curreri, J.; Reich, M.

    1983-01-01

    This report deals with the problem of combining two or more concurrent responses which are induced by dynamic loads acting on nuclear power plant structures. Specifically, the acceptability of using the square root of the sum of the squares (SRSS) value of peak values as the combined response is investigated. Emphasis is placed on the establishment of a simplified criterion that is convenient and relatively easy to use by design engineers

  7. Finding two-dimensional peaks

    International Nuclear Information System (INIS)

    Silagadze, Z.K.

    2007-01-01

    Two-dimensional generalization of the original peak finding algorithm suggested earlier is given. The ideology of the algorithm emerged from the well-known quantum mechanical tunneling property which enables small bodies to penetrate through narrow potential barriers. We merge this 'quantum' ideology with the philosophy of Particle Swarm Optimization to get the global optimization algorithm which can be called Quantum Swarm Optimization. The functionality of the newborn algorithm is tested on some benchmark optimization problems

  8. Drivers of peak sales for pharmaceutical brands

    NARCIS (Netherlands)

    Fischer, Marc; Leeflang, Peter S. H.; Verhoef, Peter C.

    2010-01-01

    Peak sales are an important metric in the pharmaceutical industry. Specifically, managers are focused on the height-of-peak-sales and the time required achieving peak sales. We analyze how order of entry and quality affect the level of peak sales and the time-to-peak-sales of pharmaceutical brands.

  9. Spatial peak-load pricing

    International Nuclear Information System (INIS)

    Arellano, M. Soledad; Serra, Pablo

    2007-01-01

    This article extends the traditional electricity peak-load pricing model to include transmission costs. In the context of a two-node, two-technology electric power system, where suppliers face inelastic demand, we show that when the marginal plant is located at the energy-importing center, generators located away from that center should pay the marginal capacity transmission cost; otherwise, consumers should bear this cost through capacity payments. Since electric power transmission is a natural monopoly, marginal-cost pricing does not fully cover costs. We propose distributing the revenue deficit among users in proportion to the surplus they derive from the service priced at marginal cost. (Author)

  10. Economic effects of peak oil

    International Nuclear Information System (INIS)

    Lutz, Christian; Lehr, Ulrike; Wiebe, Kirsten S.

    2012-01-01

    Assuming that global oil production peaked, this paper uses scenario analysis to show the economic effects of a possible supply shortage and corresponding rise in oil prices in the next decade on different sectors in Germany and other major economies such as the US, Japan, China, the OPEC or Russia. Due to the price-inelasticity of oil demand the supply shortage leads to a sharp increase in oil prices in the second scenario, with high effects on GDP comparable to the magnitude of the global financial crises in 2008/09. Oil exporting countries benefit from high oil prices, whereas oil importing countries are negatively affected. Generally, the effects in the third scenario are significantly smaller than in the second, showing that energy efficiency measures and the switch to renewable energy sources decreases the countries' dependence on oil imports and hence reduces their vulnerability to oil price shocks on the world market. - Highlights: ► National and sectoral economic effects of peak oil until 2020 are modelled. ► The price elasticity of oil demand is low resulting in high price fluctuations. ► Oil shortage strongly affects transport and indirectly all other sectors. ► Global macroeconomic effects are comparable to the 2008/2009 crisis. ► Country effects depend on oil imports and productivity, and economic structures.

  11. Generation of narrow peaks in spectroscopy of charged particles

    Energy Technology Data Exchange (ETDEWEB)

    Dubbers, Dirk, E-mail: dubbers@physi.uni-heidelberg.de; Schmidt, Ulrich, E-mail: ulrich.schmidt@physi.uni-heidelberg.de

    2016-11-21

    In spectroscopy of charged particles, narrow peaks may appear in continuous spectra if magnetic transport of the particles is involved. These artefacts, which so far have escaped the attention of investigators, can develop whenever geometric detection efficiency is less than 100%. As such peaks may be misinterpreted as new physics, their generation is investigated, both analytically and experimentally, for various detector configurations, including those used in searches for the spontaneous decay of the vacuum in heavy-ion collisions.

  12. Separation of α-tocotrienol oxidation products and eight tocochromanols by HPLC with DAD and fluorescence detection and identification of unknown peaks by DAD, PBI-EIMS, FTIR, and NMR.

    Science.gov (United States)

    Büsing, Anne; Ternes, Waldemar

    2011-11-01

    Tocotrienols, like tocopherols, are members of the vitamin E family. While tocopherols (T) have been studied intensively, only recently have tocotrienols (T3) received increased attention due to their special health benefits. However, these positive attributes of T3 are probably lost as a result of degradation during food storage and processing, and there is little information about their oxidation products. Of particular interest are the oxidation products of α-tocotrienol (α-T3) as this is the least thermostable T3 isomer with the highest rate of degradation. The objective of this study was therefore to develop a reliable method for the determination of the most important oxidation products of α-T3 along with other tocochromanol isomers. We developed a high-performance liquid chromatography method with diode array detection, fluorescence detection, and a particle beam interface electron impact mass spectroscopy in order to separate the most important oxidation products of α-T3 (α-T3 spirodimers/spirotrimers, α-tocotrienoldihydroxy dimer, 7-formyl-β-tocotrienol (7-FβT3), 5-formyl-γ-tocotrienol (5-FγT3), α-tocotrienolquinone (α-T3Q), and α-T3Q dimers and α-tocotrienolquinone epoxides (α-T3QE)) from eight tocochromanol isomers. Furthermore, we sought to identify the as yet unknown oxidation products 5-FγT3, 7-FβT3, α-T3Q-dimer, and α-T3QE. Of these, 5-FγT3 was fully characterized by Fourier transform infrared spectroscopy and (1)H and (13)C nuclear magnetic resonance spectroscopy.

  13. Establishment of peak bone mass.

    Science.gov (United States)

    Mora, Stefano; Gilsanz, Vicente

    2003-03-01

    Among the main areas of progress in osteoporosis research during the last decade or so are the general recognition that this condition, which is the cause of so much pain in the elderly population, has its antecedents in childhood and the identification of the structural basis accounting for much of the differences in bone strength among humans. Nevertheless, current understanding of the bone mineral accrual process is far from complete. The search for genes that regulate bone mass acquisition is ongoing, and current results are not sufficient to identify subjects at risk. However, there is solid evidence that BMD measurements can be helpful for the selection of subjects that presumably would benefit from preventive interventions. The questions regarding the type of preventive interventions, their magnitude, and duration remain unanswered. Carefully designed controlled trials are needed. Nevertheless, previous experience indicates that weight-bearing activity and possibly calcium supplements are beneficial if they are begun during childhood and preferably before the onset of puberty. Modification of unhealthy lifestyles and increments in exercise or calcium assumption are logical interventions that should be implemented to improve bone mass gains in all children and adolescents who are at risk of failing to achieve an optimal peak bone mass.

  14. Neurofeedback training for peak performance

    Directory of Open Access Journals (Sweden)

    Marek Graczyk

    2014-11-01

    Full Text Available [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs. [b]case study[/b]. The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. [b]conclusion[/b]. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  15. Reactor power peaking information display

    International Nuclear Information System (INIS)

    Book, T.L.; Kochendarfer, R.A.

    1986-01-01

    This patent describes a system for monitoring operating conditions within a nuclear reactor. The system consists of a method for measuring the operating parameters within the nuclear reactor, including the position of axial power shaping rods and regulating control rod. It also includes a method for determining from the operating parameters the operating limits before a power peaking condition exists within the nuclear reactor, and a method for displaying the operating limits which consists of a visual display permitting the continuous monitoring of the operating conditions within the nuclear reactor as a graph of the shaping rod position vs the regulating rod position having a permissible area and a restricted area. The permissible area is further divided into a recommended operating area for steady state operation and a cursor located on the graph to indicate the present operating condition of the nuclear reactor to allow an operator to view any need for corrective action based on the movement of the cursor out of the recommended operating area and to take any corrective transient action within the permissible area

  16. Neurofeedback training for peak performance.

    Science.gov (United States)

    Graczyk, Marek; Pąchalska, Maria; Ziółkowski, Artur; Mańko, Grzegorz; Łukaszewska, Beata; Kochanowicz, Kazimierz; Mirski, Andrzej; Kropotov, Iurii D

    2014-01-01

    One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs). The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  17. The Peak Pairs algorithm for strain mapping from HRTEM images

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, Pedro L. [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)], E-mail: pedro.galindo@uca.es; Kret, Slawomir [Institute of Physics, PAS, AL. Lotnikow 32/46, 02-668 Warsaw (Poland); Sanchez, Ana M. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Laval, Jean-Yves [Laboratoire de Physique du Solide, UPR5 CNRS-ESPCI, Paris (France); Yanez, Andres; Pizarro, Joaquin; Guerrero, Elisa [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Ben, Teresa; Molina, Sergio I. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)

    2007-11-15

    Strain mapping is defined as a numerical image-processing technique that measures the local shifts of image details around a crystal defect with respect to the ideal, defect-free, positions in the bulk. Algorithms to map elastic strains from high-resolution transmission electron microscopy (HRTEM) images may be classified into two categories: those based on the detection of peaks of intensity in real space and the Geometric Phase approach, calculated in Fourier space. In this paper, we discuss both categories and propose an alternative real space algorithm (Peak Pairs) based on the detection of pairs of intensity maxima in an affine transformed space dependent on the reference area. In spite of the fact that it is a real space approach, the Peak Pairs algorithm exhibits good behaviour at heavily distorted defect cores, e.g. interfaces and dislocations. Quantitative results are reported from experiments to determine local strain in different types of semiconductor heterostructures.

  18. Improving EEG signal peak detection using feature weight learning ...

    Indian Academy of Sciences (India)

    Therefore, we aimed to develop a general procedure for eye event-related applications based on feature weight learning (FWL), through the use of a neural network with random weights (NNRW) as the classifier. The FWL is performed using a particle swarm optimization algorithm, applied to the well-studied Dumpala, Acir, ...

  19. Passive radio frequency peak power multiplier

    Science.gov (United States)

    Farkas, Zoltan D.; Wilson, Perry B.

    1977-01-01

    Peak power multiplication of a radio frequency source by simultaneous charging of two high-Q resonant microwave cavities by applying the source output through a directional coupler to the cavities and then reversing the phase of the source power to the coupler, thereby permitting the power in the cavities to simultaneously discharge through the coupler to the load in combination with power from the source to apply a peak power to the load that is a multiplication of the source peak power.

  20. Practical load management - Peak shaving using photovoltaics

    International Nuclear Information System (INIS)

    Berger, W.

    2009-01-01

    This article takes a look at how photovoltaic (PV) power generation can be used in a practical way to meet peak demands for electricity. Advice is provided on how photovoltaics can provide peak load 'shaving' through the correlation between its production and the peak loads encountered during the day. The situation regarding feed-in tariffs in Italy is discussed, as are further examples of installations in Germany and Austria. Further, an initiative of the American Southern California Edison utility is discussed which foresees the installation of large PV plant on the roofs of commercial premises to provide local generation of peak energy and thus relieve demands on their power transportation network.

  1. The geomorphic structure of the runoff peak

    Directory of Open Access Journals (Sweden)

    R. Rigon

    2011-06-01

    Full Text Available This paper develops a theoretical framework to investigate the core dependence of peak flows on the geomorphic properties of river basins. Based on the theory of transport by travel times, and simple hydrodynamic characterization of floods, this new framework invokes the linearity and invariance of the hydrologic response to provide analytical and semi-analytical expressions for peak flow, time to peak, and area contributing to the peak runoff. These results are obtained for the case of constant-intensity hyetograph using the Intensity-Duration-Frequency (IDF curves to estimate extreme flow values as a function of the rainfall return period. Results show that, with constant-intensity hyetographs, the time-to-peak is greater than rainfall duration and usually shorter than the basin concentration time. Moreover, the critical storm duration is shown to be independent of rainfall return period as well as the area contributing to the flow peak. The same results are found when the effects of hydrodynamic dispersion are accounted for. Further, it is shown that, when the effects of hydrodynamic dispersion are negligible, the basin area contributing to the peak discharge does not depend on the channel velocity, but is a geomorphic propriety of the basin. As an example this framework is applied to three watersheds. In particular, the runoff peak, the critical rainfall durations and the time to peak are calculated for all links within a network to assess how they increase with basin area.

  2. [A peak recognition algorithm designed for chromatographic peaks of transformer oil].

    Science.gov (United States)

    Ou, Linjun; Cao, Jian

    2014-09-01

    In the field of the chromatographic peak identification of the transformer oil, the traditional first-order derivative requires slope threshold to achieve peak identification. In terms of its shortcomings of low automation and easy distortion, the first-order derivative method was improved by applying the moving average iterative method and the normalized analysis techniques to identify the peaks. Accurate identification of the chromatographic peaks was realized through using multiple iterations of the moving average of signal curves and square wave curves to determine the optimal value of the normalized peak identification parameters, combined with the absolute peak retention times and peak window. The experimental results show that this algorithm can accurately identify the peaks and is not sensitive to the noise, the chromatographic peak width or the peak shape changes. It has strong adaptability to meet the on-site requirements of online monitoring devices of dissolved gases in transformer oil.

  3. Simultaneous collection method of on-peak window image and off-peak window image in Tl-201 imaging

    International Nuclear Information System (INIS)

    Murakami, Tomonori; Noguchi, Yasushi; Kojima, Akihiro; Takagi, Akihiro; Matsumoto, Masanori

    2007-01-01

    Tl-201 imaging detects the photopeak (71 keV, in on-peak window) of characteristic X-rays of Hg-201 formed from Tl-201 decay. The peak is derived from 4 rays of different energy and emission intensity and does not follow in Gaussian distribution. In the present study, authors made an idea for the method in the title to attain the more effective single imaging, which was examined for its accuracy and reliability with phantoms and applied clinically to Tl-201 scintigraphy in a patient. The authors applied the triple energy window method for data acquisition: the energy window setting was made on Hg-201 X-rays photopeak in three of the lower (3%, L), main (72 keV, M) and upper (14%, U) windows with the gamma camera with 2-gated detector (Toshiba E. CAM/ICON). L, M and U images obtained simultaneously were then constructed to images of on-peak (L+M, Mock on-peak) and off-peak (M+U) window settings for evaluation. Phantoms for line source with Tl-201-containing swab and for multi-defect with acrylic plate containing Tl-201 solution were imaged in water. The female patient with thyroid cancer was subjected to preoperative scintigraphy under the defined conditions. Mock on-, off-peak images were found to be equivalent to the true (ordinary, clinical) on-, off-peak ones, and the present method was thought usable for evaluation of usefulness of off-peak window data. (R.T.)

  4. On dealing with multiple correlation peaks in PIV

    Science.gov (United States)

    Masullo, A.; Theunissen, R.

    2018-05-01

    A novel algorithm to analyse PIV images in the presence of strong in-plane displacement gradients and reduce sub-grid filtering is proposed in this paper. Interrogation windows subjected to strong in-plane displacement gradients often produce correlation maps presenting multiple peaks. Standard multi-grid procedures discard such ambiguous correlation windows using a signal to noise (SNR) filter. The proposed algorithm improves the standard multi-grid algorithm allowing the detection of splintered peaks in a correlation map through an automatic threshold, producing multiple displacement vectors for each correlation area. Vector locations are chosen by translating images according to the peak displacements and by selecting the areas with the strongest match. The method is assessed on synthetic images of a boundary layer of varying intensity and a sinusoidal displacement field of changing wavelength. An experimental case of a flow exhibiting strong velocity gradients is also provided to show the improvements brought by this technique.

  5. Employer Attitudes towards Peak Hour Avoidance

    NARCIS (Netherlands)

    Vonk Noordegraaf, D.M.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  6. Employer attitudes towards peak hour avoidance

    NARCIS (Netherlands)

    Noordegraaf, D.M.V.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  7. Peak load pricing lowers generation costs

    International Nuclear Information System (INIS)

    Lande, R.H.

    1980-01-01

    Before a utility implements peak load pricing for different classes of consumers, the costs and the benefits should be compared. The methodology described enables a utility to determine whether peak load pricing should be introduced for specific users. Cost-benefit analyses for domestic consumers and commercial/industrial consumers, showing break-even points are presented. (author)

  8. Peak Shaving Considering Streamflow Uncertainties | Iwuagwu ...

    African Journals Online (AJOL)

    The main thrust of this paper is peak shaving with a Stochastic hydro model. In peak sharing, the amount of hydro energy scheduled may be a minimum but it serves to replace less efficient thermal units. The sample system is die Kainji hydro plant and the thermal units of the National Electric Power Authority. The random ...

  9. The peak in neutron powder diffraction

    International Nuclear Information System (INIS)

    Laar, B. van; Yelon, W.B.

    1984-01-01

    For the application of Rietveld profile analysis to neutron powder diffraction data a precise knowledge of the peak profile, in both shape and position, is required. The method now in use employs a Gaussian shaped profile with a semi-empirical asymmetry correction for low-angle peaks. The integrated intensity is taken to be proportional to the classical Lorentz factor calculated for the X-ray case. In this paper an exact expression is given for the peak profile based upon the geometrical dimensions of the diffractometer. It is shown that the asymmetry of observed peaks is well reproduced by this expression. The angular displacement of the experimental profile with respect to the nominal Bragg angle value is larger than expected. Values for the correction to the classical Lorentz factor for the integrated intensity are given. The exact peak profile expression has been incorporated into a Rietveld profile analysis refinement program. (Auth.)

  10. Study on the man-operator characteristics in the peak identification problem in line spectra

    International Nuclear Information System (INIS)

    Gopych, P.M.; Sorokin, V.I.; Sotnikov, V.V.

    1992-01-01

    ATOS program complex (automatical test spectra processing) realizing all stages of investigation necessary to obtain qualitative characteristics of the man-operator in the peak identification problem is developed. Qualitative characteristics of identitication ion quality of peaks by operators searching for peaks in line spectra are determined due to simulation experiment. It is shown, that for trained operators reference possibility of false detection of peaks is equal to F=0.012±0.004, while for untrained ones - F≅0.3. Comparison of results with analogous data on on-line programs for identification of peaks in γ-spectra is conducted

  11. Comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry peak sorting algorithm.

    Science.gov (United States)

    Oh, Cheolhwan; Huang, Xiaodong; Regnier, Fred E; Buck, Charles; Zhang, Xiang

    2008-02-01

    We report a novel peak sorting method for the two-dimensional gas chromatography/time-of-flight mass spectrometry (GC x GC/TOF-MS) system. The objective of peak sorting is to recognize peaks from the same metabolite occurring in different samples from thousands of peaks detected in the analytical procedure. The developed algorithm is based on the fact that the chromatographic peaks for a given analyte have similar retention times in all of the chromatograms. Raw instrument data are first processed by ChromaTOF (Leco) software to provide the peak tables. Our algorithm achieves peak sorting by utilizing the first- and second-dimension retention times in the peak tables and the mass spectra generated during the process of electron impact ionization. The algorithm searches the peak tables for the peaks generated by the same type of metabolite using several search criteria. Our software also includes options to eliminate non-target peaks from the sorting results, e.g., peaks of contaminants. The developed software package has been tested using a mixture of standard metabolites and another mixture of standard metabolites spiked into human serum. Manual validation demonstrates high accuracy of peak sorting with this algorithm.

  12. The need for standardisation of peak flow charts

    OpenAIRE

    Reddel, H; Vincent, S; Civitico, J

    2005-01-01

    Peak expiratory flow (PEF) monitoring is recommended in asthma guidelines as a tool for assessing severity, monitoring response to treatment, detecting exacerbations, identifying triggers, and providing objective justification for treatment to the patient, but some clinicians have expressed concerns about its relevance in the management of asthma. We have identified a sevenfold variation in the scale of existing PEF charts, with resulting wide variation in the appearance of the same PEF date ...

  13. Isotope resolution of the iron peak

    International Nuclear Information System (INIS)

    Henke, R.P.; Benton, E.V.

    1977-01-01

    A stack of Lexan detectors from the Apollo 17 mission has been analyzed to obtain Z measurements of sufficient accuracy to resolve the iron peak into its isotopic components. Within this distribution several peaks are present. With the centrally located, most populated peak assumed to be 56 Fe, the measurements imply that the abundances of 54 Fe and 58 Fe are appreciable fractions of the 56 Fe abundance. This result is in agreement with those of Webber et al. and Siegman et al. but in disagreement with the predictions of Tsao et al. (Auth.)

  14. Peak load arrangements : Assessment of Nordel guidelines

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    Two Nordic countries, Sweden and Finland, have legislation that empowers the TSO to acquire designated peak load resources to mitigate the risk for shortage situations during the winter. In Denmark, the system operator procures resources to maintain a satisfactory level of security of supply. In Norway the TSO has set up a Regulation Power Option Market (RKOM) to secure a satisfactory level of operational reserves at all times, also in winter with high load demand. Only the arrangements in Finland and Sweden fall under the heading of Peak Load Arrangements defined in Nordel Guidelines. NordREG has been invited by the Electricity Market Group (EMG) to evaluate Nordel's proposal for 'Guidelines for transitional Peak Load Arrangements'. The EMG has also financed a study made by EC Group to support NordREG in the evaluation of the proposal. The study has been taken into account in NordREG's evaluation. In parallel to the EMG task, the Swedish regulator, the Energy Markets Inspectorate, has been given the task by the Swedish government to investigate a long term solution of the peak load issue. The Swedish and Finnish TSOs have together with Nord Pool Spot worked on finding a harmonized solution for activation of the peak load reserves in the market. An agreement accepted by the relevant authorities was reached in early January 2009, and the arrangement has been implemented since 19th January 2009. NordREG views that the proposed Nordel guidelines have served as a starting point for the presently agreed procedure. However, NordREG does not see any need to further develop the Nordel guidelines for peak load arrangements. NordREG agrees with Nordel that the market should be designed to solve peak load problems through proper incentives to market players. NordREG presumes that the relevant authorities in each country will take decisions on the need for any peak load arrangement to ensure security of supply. NordREG proposes that such decisions should be

  15. Automated Peak Picking and Peak Integration in Macromolecular NMR Spectra Using AUTOPSY

    Science.gov (United States)

    Koradi, Reto; Billeter, Martin; Engeli, Max; Güntert, Peter; Wüthrich, Kurt

    1998-12-01

    A new approach for automated peak picking of multidimensional protein NMR spectra with strong overlap is introduced, which makes use of the program AUTOPSY (automatedpeak picking for NMRspectroscopy). The main elements of this program are a novel function for local noise level calculation, the use of symmetry considerations, and the use of lineshapes extracted from well-separated peaks for resolving groups of strongly overlapping peaks. The algorithm generates peak lists with precise chemical shift and integral intensities, and a reliability measure for the recognition of each peak. The results of automated peak picking of NOESY spectra with AUTOPSY were tested in combination with the combined automated NOESY cross peak assignment and structure calculation routine NOAH implemented in the program DYANA. The quality of the resulting structures was found to be comparable with those from corresponding data obtained with manual peak picking.

  16. Bayesian Peak Picking for NMR Spectra

    KAUST Repository

    Cheng, Yichen

    2014-02-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein–DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method.

  17. Peak-Seeking Control for Trim Optimization

    Data.gov (United States)

    National Aeronautics and Space Administration — Innovators have developed a peak-seeking algorithm that can reduce drag and improve performance and fuel efficiency by optimizing aircraft trim in real time. The...

  18. Instream flow needs below peaking hydroelectric projects

    International Nuclear Information System (INIS)

    Milhous, R.T.

    1991-01-01

    This paper reports on a method developed to assist in the determination of instream flow needs below hydroelectric projects operated in a peaking mode. Peaking hydroelectric projects significantly change streamflow over a short period of time; consequently, any instream flow methodology must consider the dual flows associated with peaking projects. The dual flows are the lowest flow and the maximum generation flow of a peaking cycle. The methodology is based on elements of the Physical Habitat Simulation System of the U.S. Fish and Wildlife Service and uses habitat, rather than fish numbers or biomas, as at basic response variable. All aquatic animals are subject to the rapid changes in streamflow which cause rapid swings in habitat quality. Some aquatic organisms are relatively fixed in location in the stream while others can move when flows change. The habitat available from a project operated in peaking mode is considered to be the minimum habitat occurring during a cycle of habitat change. The methodology takes in to consideration that some aquatic animals can move and others cannot move during a peaking cycle

  19. Limitation of peak fitting and peak shape methods for determination of activation energy of thermoluminescence glow peaks

    CERN Document Server

    Sunta, C M; Piters, T M; Watanabe, S

    1999-01-01

    This paper shows the limitation of general order peak fitting and peak shape methods for determining the activation energy of the thermoluminescence glow peaks in the cases in which retrapping probability is much higher than the recombination probability and the traps are filled up to near saturation level. Right values can be obtained when the trap occupancy is reduced by using small doses or by post-irradiation partial bleaching. This limitation in the application of these methods has not been indicated earlier. In view of the unknown nature of kinetics in the experimental samples, it is recommended that these methods of activation energy determination should be applied only at doses well below the saturation dose.

  20. Statistics of peaks of Gaussian random fields

    International Nuclear Information System (INIS)

    Bardeen, J.M.; Bond, J.R.; Kaiser, N.; Szalay, A.S.; Stanford Univ., CA; California Univ., Berkeley; Cambridge Univ., England; Fermi National Accelerator Lab., Batavia, IL)

    1986-01-01

    A set of new mathematical results on the theory of Gaussian random fields is presented, and the application of such calculations in cosmology to treat questions of structure formation from small-amplitude initial density fluctuations is addressed. The point process equation is discussed, giving the general formula for the average number density of peaks. The problem of the proper conditional probability constraints appropriate to maxima are examined using a one-dimensional illustration. The average density of maxima of a general three-dimensional Gaussian field is calculated as a function of heights of the maxima, and the average density of upcrossing points on density contour surfaces is computed. The number density of peaks subject to the constraint that the large-scale density field be fixed is determined and used to discuss the segregation of high peaks from the underlying mass distribution. The machinery to calculate n-point peak-peak correlation functions is determined, as are the shapes of the profiles about maxima. 67 references

  1. Peak Oil, threat or energy worlds' phantasm?

    International Nuclear Information System (INIS)

    Favennec, Jean-Pierre

    2011-01-01

    The concept of Peak Oil is based on the work of King Hubbert, a petroleum geologist who worked for Shell in the USA in the 1960's. Based on the fact that discoveries in America reached a maximum in the 1930's, he announced that American production would reach a maximum in 1969, which did actually occur. Geologists members of the Association for the Study of Peak Oil have extrapolated this result to a worldwide scale and, since oil discoveries reached a peak in the 1960's, argued that production will peak in the very near future. It is clear that hydrocarbon reserves are finite and therefore exhaustible. But little is known regarding the level of ultimate (i.e. total existing) reserves. There are probably very large reserves of non conventional oil in addition to the reserves of conventional oil. An increasing number of specialists put maximum production at less than 100 Mb/d more for geopolitical than physical reasons. Attainable peak production will probably vary from year to year and will depend on how crude oil prices develop

  2. Electric peak power forecasting by year 2025

    International Nuclear Information System (INIS)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A.

    2005-01-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs

  3. Electric peak power forecasting by year 2025

    Energy Technology Data Exchange (ETDEWEB)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A. [Kuwait Inst. for Scientific Research, Kuwait City (Kuwait). Div. of Environment and Urban Development

    2005-07-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs.

  4. Subband Energy Detection in Passive Array Processing

    National Research Council Canada - National Science Library

    Bono, Michael

    2000-01-01

    ...), which includes both Subband Peak Energy Detection (SPED) and Subband Extrema Energy Detection (SEED). It will be shown that SED has several performance advantages over Conventional Energy Detection...

  5. 110 C thermoluminescence glow peak of quartz – A brief review

    Indian Academy of Sciences (India)

    sitization property. Various aspects of the peak, like its nature, defect centres involved, ... sensitivity, reliability, versatility and compatibility with the detection system. Its ...... [24] H M Rendell, P D Townsend, R A Wood and B J Luff, Radiat. Meas.

  6. High-precision analogue peak detector for X-ray imaging applications

    OpenAIRE

    Dlugosz, Rafal Tomasz; Iniewski, Kris

    2007-01-01

    A new analogue high-precision peak detector is presented. Owing to its very low power consumption the circuit is particularly well suited for photon energy detection in multichannel receiver integrated circuits used in nuclear medicine.

  7. SPANISH PEAKS WILDERNESS STUDY AREA, COLORADO.

    Science.gov (United States)

    Budding, Karin E.; Kluender, Steven E.

    1984-01-01

    A geologic and geochemical investigation and a survey of mines and prospects were conducted to evaluate the mineral-resource potential of the Spanish Peaks Wilderness Study Area, Huerfano and Las Animas Counties, in south-central Colorado. Anomalous gold, silver, copper, lead, and zinc concentrations in rocks and in stream sediments from drainage basins in the vicinity of the old mines and prospects on West Spanish Peak indicate a substantiated mineral-resource potential for base and precious metals in the area surrounding this peak; however, the mineralized veins are sparse, small in size, and generally low in grade. There is a possibility that coal may underlie the study area, but it would be at great depth and it is unlikely that it would have survived the intense igneous activity in the area. There is little likelihood for the occurrence of oil and gas because of the lack of structural traps and the igneous activity.

  8. Analysis of fuel end-temperature peaking

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Z.; Jiang, Q.; Lai, L.; Shams, M. [CANDU Energy Inc., Fuel Engineering Dept., Mississauga, Ontario (Canada)

    2013-07-01

    During normal operation and refuelling of CANDU® fuel, fuel temperatures near bundle ends will increase due to a phenomenon called end flux peaking. Similar phenomenon would also be expected to occur during a postulated large break LOCA event. The end flux peaking in a CANDU fuel element is due to the fact that neutron flux is higher near a bundle end, in contact with a neighbouring bundle or close to heavy water coolant, than in the bundle mid-plane, because of less absorption of thermal neutrons by Zircaloy or heavy water than by the UO{sub 2} material. This paper describes Candu Energy experience in analysing behaviour of bundle due to end flux peaking using fuel codes FEAT, ELESTRES and ELOCA. (author)

  9. Power peak in vicinity of WWER-440 control rod

    International Nuclear Information System (INIS)

    Mikus, J.

    2003-01-01

    The measurements of axial power (fission density) distribution have been performed by means of gamma activity determination (gamma scanning method) of the irradiated fuel pins detecting gamma quanta in the La peak area - 1596.5 keV of their selected parts having 20 mm length in the axial coordinates range 50-950 mm with a 10 mm step using a rectangular collimator (dimensions 20x10 mm). Two NaI(Tl) scintillation crystals (one as a monitor) with diameter of 40 mm were used, each of them in Pb shielding (thickness 150 mm). The obtained results enlarge the available 'power peaking database' and enable validation of the codes also in important case of zero-boron concentration that corresponds to the end of WWER-440 fuel cycle. This validation can improve the reliability of the calculation results of the power distribution in WWER-440 cores, re-loading schemes etc

  10. Peak-locking reduction for particle image velocimetry

    International Nuclear Information System (INIS)

    Michaelis, Dirk; Wieneke, Bernhard; Neal, Douglas R

    2016-01-01

    A parametric study of the factors contributing to peak-locking, a known bias error source in particle image velocimetry (PIV), is conducted using synthetic data that are processed with a state-of-the-art PIV algorithm. The investigated parameters include: particle image diameter, image interpolation techniques, the effect of asymmetric versus symmetric window deformation, number of passes and the interrogation window size. Some of these parameters are found to have a profound effect on the magnitude of the peak-locking error. The effects for specific PIV cameras are also studied experimentally using a precision turntable to generate a known rotating velocity field. Image time series recorded using this experiment show a linear range of pixel and sub-pixel shifts ranging from 0 to  ±4 pixels. Deviations in the constant vorticity field (ω z ) reveal how peak-locking can be affected systematically both by varying parameters of the detection system such as the focal distance and f -number, and also by varying the settings of the PIV analysis. A new a priori technique for reducing the bias errors associated with peak-locking in PIV is introduced using an optical diffuser to avoid undersampled particle images during the recording of the raw images. This technique is evaluated against other a priori approaches using experimental data and is shown to perform favorably. Finally, a new a posteriori anti peak-locking filter (APLF) is developed and investigated, which shows promising results for both synthetic data and real measurements for very small particle image sizes. (paper)

  11. Characterizing the Peak in the Cosmic Microwave Background Angular Power Spectrum

    Science.gov (United States)

    Knox, Lloyd; Page, Lyman

    2000-08-01

    A peak has been unambiguously detected in the cosmic microwave background angular spectrum. Here we characterize its properties with fits to phenomenological models. We find that the TOCO and BOOM/NA data determine the peak location to be in the range 175-243 and 151-259, respectively (at 95% confidence) and determine the peak amplitude to be between ~70 and 90 μK. The peak shape is consistent with inflation-inspired flat, cold dark matter plus cosmological constant models of structure formation with adiabatic, nearly scale invariant initial conditions. It is inconsistent with open models and presents a great challenge to defect models.

  12. Osteoporosis: Peak Bone Mass in Women

    Science.gov (United States)

    ... bone density are seen even during childhood and adolescence. Hormonal factors. The hormone estrogen has an effect on peak bone mass. For example, women who had their first menstrual cycle at an early age and those who use oral contraceptives, which contain estrogen, often have high bone mineral ...

  13. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  14. Robust Peak Recognition in Intracranial Pressure Signals

    Directory of Open Access Journals (Sweden)

    Bergsneider Marvin

    2010-10-01

    Full Text Available Abstract Background The waveform morphology of intracranial pressure pulses (ICP is an essential indicator for monitoring, and forecasting critical intracranial and cerebrovascular pathophysiological variations. While current ICP pulse analysis frameworks offer satisfying results on most of the pulses, we observed that the performance of several of them deteriorates significantly on abnormal, or simply more challenging pulses. Methods This paper provides two contributions to this problem. First, it introduces MOCAIP++, a generic ICP pulse processing framework that generalizes MOCAIP (Morphological Clustering and Analysis of ICP Pulse. Its strength is to integrate several peak recognition methods to describe ICP morphology, and to exploit different ICP features to improve peak recognition. Second, it investigates the effect of incorporating, automatically identified, challenging pulses into the training set of peak recognition models. Results Experiments on a large dataset of ICP signals, as well as on a representative collection of sampled challenging ICP pulses, demonstrate that both contributions are complementary and significantly improve peak recognition performance in clinical conditions. Conclusion The proposed framework allows to extract more reliable statistics about the ICP waveform morphology on challenging pulses to investigate the predictive power of these pulses on the condition of the patient.

  15. Liquid waste processing at Comanche Peak

    International Nuclear Information System (INIS)

    Hughes-Edwards, L.M.; Edwards, J.M.

    1996-01-01

    This article describes the radioactive waste processing at Comanche Peak Steam Electric Station. Topics covered are the following: Reduction of liquid radioactive discharges (system leakage, outage planning); reduction of waste resin generation (waste stream segregation, processing methodology); reduction of activity released and off-site dose. 8 figs., 2 tabs

  16. Hubbert's Peak: the Impending World oil Shortage

    Science.gov (United States)

    Deffeyes, K. S.

    2004-12-01

    Global oil production will probably reach a peak sometime during this decade. After the peak, the world's production of crude oil will fall, never to rise again. The world will not run out of energy, but developing alternative energy sources on a large scale will take at least 10 years. The slowdown in oil production may already be beginning; the current price fluctuations for crude oil and natural gas may be the preamble to a major crisis. In 1956, the geologist M. King Hubbert predicted that U.S. oil production would peak in the early 1970s.1 Almost everyone, inside and outside the oil industry, rejected Hubbert's analysis. The controversy raged until 1970, when the U.S. production of crude oil started to fall. Hubbert was right. Around 1995, several analysts began applying Hubbert's method to world oil production, and most of them estimate that the peak year for world oil will be between 2004 and 2008. These analyses were reported in some of the most widely circulated sources: Nature, Science, and Scientific American.2 None of our political leaders seem to be paying attention. If the predictions are correct, there will be enormous effects on the world economy. Even the poorest nations need fuel to run irrigation pumps. The industrialized nations will be bidding against one another for the dwindling oil supply. The good news is that we will put less carbon dioxide into the atmosphere. The bad news is that my pickup truck has a 25-gallon tank.

  17. Prediction of peak overlap in NMR spectra

    International Nuclear Information System (INIS)

    Hefke, Frederik; Schmucki, Roland; Güntert, Peter

    2013-01-01

    Peak overlap is one of the major factors complicating the analysis of biomolecular NMR spectra. We present a general method for predicting the extent of peak overlap in multidimensional NMR spectra and its validation using both, experimental data sets and Monte Carlo simulation. The method is based on knowledge of the magnetization transfer pathways of the NMR experiments and chemical shift statistics from the Biological Magnetic Resonance Data Bank. Assuming a normal distribution with characteristic mean value and standard deviation for the chemical shift of each observable atom, an analytic expression was derived for the expected overlap probability of the cross peaks. The analytical approach was verified to agree with the average peak overlap in a large number of individual peak lists simulated using the same chemical shift statistics. The method was applied to eight proteins, including an intrinsically disordered one, for which the prediction results could be compared with the actual overlap based on the experimentally measured chemical shifts. The extent of overlap predicted using only statistical chemical shift information was in good agreement with the overlap that was observed when the measured shifts were used in the virtual spectrum, except for the intrinsically disordered protein. Since the spectral complexity of a protein NMR spectrum is a crucial factor for protein structure determination, analytical overlap prediction can be used to identify potentially difficult proteins before conducting NMR experiments. Overlap predictions can be tailored to particular classes of proteins by preparing statistics from corresponding protein databases. The method is also suitable for optimizing recording parameters and labeling schemes for NMR experiments and improving the reliability of automated spectra analysis and protein structure determination.

  18. The peak in anomalous magnetic viscosity

    International Nuclear Information System (INIS)

    Collocott, S.J.; Watterson, P.A.; Tan, X.H.; Xu, H.

    2014-01-01

    Anomalous magnetic viscosity, where the magnetization as a function of time exhibits non-monotonic behaviour, being seen to increase, reach a peak, and then decrease, is observed on recoil lines in bulk amorphous ferromagnets, for certain magnetic prehistories. A simple geometrical approach based on the motion of the state line on the Preisach plane gives a theoretical framework for interpreting non-monotonic behaviour and explains the origin of the peak. This approach gives an expression for the time taken to reach the peak as a function of the applied (or holding) field. The theory is applied to experimental data for bulk amorphous ferromagnet alloys of composition Nd 60−x Fe 30 Al 10 Dy x , x = 0, 1, 2, 3 and 4, and it gives a reasonable description of the observed behaviour. The role played by other key magnetic parameters, such as the intrinsic coercivity and fluctuation field, is also discussed. When the non-monotonic behaviour of the magnetization of a number of alloys is viewed in the context of the model, features of universal behaviour emerge, that are independent of alloy composition. - Highlights: • Development of a simple geometrical model based on the Preisach model which gives a complete explanation of the peak in the magnetic viscosity. • Geometrical approach is extended by considering equations that govern the motion of the state line. • The model is used to deduce the relationship between the holding field and the time it takes to reach the peak. • The model is tested with experimental results for a range of Nd–Fe–Al–Dy bulk amorphous ferromagnets. • There is good agreement between the model and the experimental data

  19. The spatial resolution of epidemic peaks.

    Directory of Open Access Journals (Sweden)

    Harriet L Mills

    2014-04-01

    Full Text Available The emergence of novel respiratory pathogens can challenge the capacity of key health care resources, such as intensive care units, that are constrained to serve only specific geographical populations. An ability to predict the magnitude and timing of peak incidence at the scale of a single large population would help to accurately assess the value of interventions designed to reduce that peak. However, current disease-dynamic theory does not provide a clear understanding of the relationship between: epidemic trajectories at the scale of interest (e.g. city; population mobility; and higher resolution spatial effects (e.g. transmission within small neighbourhoods. Here, we used a spatially-explicit stochastic meta-population model of arbitrary spatial resolution to determine the effect of resolution on model-derived epidemic trajectories. We simulated an influenza-like pathogen spreading across theoretical and actual population densities and varied our assumptions about mobility using Latin-Hypercube sampling. Even though, by design, cumulative attack rates were the same for all resolutions and mobilities, peak incidences were different. Clear thresholds existed for all tested populations, such that models with resolutions lower than the threshold substantially overestimated population-wide peak incidence. The effect of resolution was most important in populations which were of lower density and lower mobility. With the expectation of accurate spatial incidence datasets in the near future, our objective was to provide a framework for how to use these data correctly in a spatial meta-population model. Our results suggest that there is a fundamental spatial resolution for any pathogen-population pair. If underlying interactions between pathogens and spatially heterogeneous populations are represented at this resolution or higher, accurate predictions of peak incidence for city-scale epidemics are feasible.

  20. Comparison of the two relaxation peaks in the Ti50Ni48Fe2 alloy

    International Nuclear Information System (INIS)

    Fan Genlian; Zhou Yumei; Otsuka, Kazuhiro; Ren Xiaobing; Suzuki, Tetsuro; Yin Fuxing

    2009-01-01

    The internal friction (tan δ) and storage modulus of Ti 50 Ni 48 Fe 2 alloy were studied by dynamic mechanical analysis (DMA). On cooling, a broad relaxation peak with tan δ value as high as 0.2 was detected in R-phase. On heating, another relaxation peak with tan δ value of 0.06 was found in B19' martensite. Both relaxation peaks disappeared when the alloy was dehydrogenated in a dynamic vacuum furnace. Thus, the origin of both relaxation peaks was attributed to the interaction between twin boundaries and hydrogen atoms, as recently proved in Ti-Ni-Cu alloy. The direct comparison of these two relaxation peaks in the same sample indicates that the height of relaxation peaks increases with the decreasing of twinning shear.

  1. WaVPeak: Picking NMR peaks through wavelet-based smoothing and volume-based filtering

    KAUST Repository

    Liu, Zhi

    2012-02-10

    Motivation: Nuclear magnetic resonance (NMR) has been widely used as a powerful tool to determine the 3D structures of proteins in vivo. However, the post-spectra processing stage of NMR structure determination usually involves a tremendous amount of time and expert knowledge, which includes peak picking, chemical shift assignment and structure calculation steps. Detecting accurate peaks from the NMR spectra is a prerequisite for all following steps, and thus remains a key problem in automatic NMR structure determination. Results: We introduce WaVPeak, a fully automatic peak detection method. WaVPeak first smoothes the given NMR spectrum by wavelets. The peaks are then identified as the local maxima. The false positive peaks are filtered out efficiently by considering the volume of the peaks. WaVPeak has two major advantages over the state-of-the-art peak-picking methods. First, through wavelet-based smoothing, WaVPeak does not eliminate any data point in the spectra. Therefore, WaVPeak is able to detect weak peaks that are embedded in the noise level. NMR spectroscopists need the most help isolating these weak peaks. Second, WaVPeak estimates the volume of the peaks to filter the false positives. This is more reliable than intensity-based filters that are widely used in existing methods. We evaluate the performance of WaVPeak on the benchmark set proposed by PICKY (Alipanahi et al., 2009), one of the most accurate methods in the literature. The dataset comprises 32 2D and 3D spectra from eight different proteins. Experimental results demonstrate that WaVPeak achieves an average of 96%, 91%, 88%, 76% and 85% recall on 15N-HSQC, HNCO, HNCA, HNCACB and CBCA(CO)NH, respectively. When the same number of peaks are considered, WaVPeak significantly outperforms PICKY. The Author(s) 2012. Published by Oxford University Press.

  2. The GRB variability/peak luminosity correlation: new results

    International Nuclear Information System (INIS)

    Guidorzi, C.; Rossi, F.; Hurley, K.; Mundell, C.G.

    2005-01-01

    We test the correlation between time variability and isotropic-equivalent peak luminosity found by Reichart et al. (ApJ, 552 (2001) 57) using a set of 26 Gamma-Ray Bursts (GRBs) with known redshift. We confirm the correlation, thought with a larger spread around the best-fit power-law obtained by Reichart et al. which in turn does not provide an acceptable description any longer. In addiction, we find no evidence for correlation between variability and beaming-corrected peak luminosity for a subset of 14 GRBs whose beaming angles have been taken from Ghirlanda et al. (ApJ, 616 (2004) 331). Finally, we investigate the possible connection for some GRBs between the location in the variability/peak luminosity space and some afterglow properties, such as the detectability in the optical band, by adding some GRBs whose redshifts, unknown from direct measurements, have been derived assuming the Amati at al. (AeA, 390 (2002) 81) relationship

  3. Stereotactic Bragg peak proton radiosurgery method

    International Nuclear Information System (INIS)

    Kjellberg, R.N.

    1979-01-01

    A brief description of the technical aspects of a stereotactic Bragg peak proton radiosurgical method for the head is presented. The preparatory radiographic studies are outlined and the stereotactic instrument and positioning of the patient are described. The instrument is so calibrated that after corrections for soft tissue and bone thickness, the Bragg peak superimposes upon the intracranial target. The head is rotated at specific intervals to allow predetermined portals of access for the beam path, all of which converge on the intracranial target. Normally, portals are arranged to oppose and overlap from both sides of the head. Using a number of beams (in sequence) on both sides of the head, the target dose is far greater than the path dose. The procedure normally takes 3/2-2 hours, following which the patient can walk away. (Auth./C.F.)

  4. Central peaking of magnetized gas discharges

    International Nuclear Information System (INIS)

    Chen, Francis F.; Curreli, Davide

    2013-01-01

    Partially ionized gas discharges used in industry are often driven by radiofrequency (rf) power applied at the periphery of a cylinder. It is found that the plasma density n is usually flat or peaked on axis even if the skin depth of the rf field is thin compared with the chamber radius a. Previous attempts at explaining this did not account for the finite length of the discharge and the boundary conditions at the endplates. A simple 1D model is used to focus on the basic mechanism: the short-circuit effect. It is found that a strong electric field (E-field) scaled to electron temperature T e , drives the ions inward. The resulting density profile is peaked on axis and has a shape independent of pressure or discharge radius. This “universal” profile is not affected by a dc magnetic field (B-field) as long as the ion Larmor radius is larger than a

  5. Peak Oil, Food Systems, and Public Health

    Science.gov (United States)

    Parker, Cindy L.; Kirschenmann, Frederick L.; Tinch, Jennifer; Lawrence, Robert S.

    2011-01-01

    Peak oil is the phenomenon whereby global oil supplies will peak, then decline, with extraction growing increasingly costly. Today's globalized industrial food system depends on oil for fueling farm machinery, producing pesticides, and transporting goods. Biofuels production links oil prices to food prices. We examined food system vulnerability to rising oil prices and the public health consequences. In the short term, high food prices harm food security and equity. Over time, high prices will force the entire food system to adapt. Strong preparation and advance investment may mitigate the extent of dislocation and hunger. Certain social and policy changes could smooth adaptation; public health has an essential role in promoting a proactive, smart, and equitable transition that increases resilience and enables adequate food for all. PMID:21778492

  6. Hanford Site peak gust wind speeds

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1998-01-01

    Peak gust wind data collected at the Hanford Site since 1945 are analyzed to estimate maximum wind speeds for use in structural design. The results are compared with design wind speeds proposed for the Hanford Site. These comparisons indicate that design wind speeds contained in a January 1998 advisory changing DOE-STD-1020-94 are excessive for the Hanford Site and that the design wind speeds in effect prior to the changes are still appropriate for the Hanford Site

  7. Commodity hydrogen from off-peak electricity

    Energy Technology Data Exchange (ETDEWEB)

    Darrow, K.; Biederman, N.; Konopka, A.

    1977-01-01

    This paper considers the use of off-peak electrical power as an energy source for the electrolytic production of hydrogen. The present industrial uses for hydrogen are examined to determine if hydrogen produced in this fashion would be competitive with the industry's onsite production or existing hydrogen prices. The paper presents a technical and economic feasibility analysis of the various components required and of the operation of the system as a whole including production, transmission, storage, and markets.

  8. Some practical aspects of peak kilovoltage measurements

    International Nuclear Information System (INIS)

    Irfan, A.Y.; Pugh, V.I.; Jeffery, C.D.

    1985-01-01

    The peak kilovoltage (kVsub(p)) across the X-ray tube electrodes in diagnostic X-ray machines is a most important parameter, affecting both radiation output and beam quality. Four commercially available non-invasive devices used for kVsub(p) measurement were tested using a selection of generator waveforms. The majority of the devices provided satisfactory measurements of the kVsub(p) to within approximately +- kV provided certain operating conditions are observed. (U.K.)

  9. METing SUSY on the Z peak

    Energy Technology Data Exchange (ETDEWEB)

    Barenboim, G.; Bernabeu, J.; Vives, O. [Universitat de Valencia, Departament de Fisica Teorica, Burjassot (Spain); Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain); Mitsou, V.A.; Romero, E. [Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain)

    2016-02-15

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E{sub T}{sup miss} > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m{sub g} or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  10. Acquisition of peak responding: what is learned?

    Science.gov (United States)

    Balci, Fuat; Gallistel, Charles R; Allen, Brian D; Frank, Krystal M; Gibson, Jacqueline M; Brunner, Daniela

    2009-01-01

    We investigated how the common measures of timing performance behaved in the course of training on the peak procedure in C3H mice. Following fixed interval (FI) pre-training, mice received 16 days of training in the peak procedure. The peak time and spread were derived from the average response rates while the start and stop times and their relative variability were derived from a single-trial analysis. Temporal precision (response spread) appeared to improve in the course of training. This apparent improvement in precision was, however, an averaging artifact; it was mediated by the staggered appearance of timed stops, rather than by the delayed occurrence of start times. Trial-by-trial analysis of the stop times for individual subjects revealed that stops appeared abruptly after three to five sessions and their timing did not change as training was prolonged. Start times and the precision of start and stop times were generally stable throughout training. Our results show that subjects do not gradually learn to time their start or stop of responding. Instead, they learn the duration of the FI, with robust temporal control over the start of the response; the control over the stop of response appears abruptly later.

  11. METing SUSY on the Z peak

    International Nuclear Information System (INIS)

    Barenboim, G.; Bernabeu, J.; Vives, O.; Mitsou, V.A.; Romero, E.

    2016-01-01

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E T miss > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m g or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  12. Monitoring device for local power peaking coefficients

    International Nuclear Information System (INIS)

    Mihashi, Ishi

    1987-01-01

    Purpose: To determine and monitor the local power peaking coefficients by a method not depending on the combination of fuel types. Constitution: Representative values for the local power distribution can be obtained by determining corresponding burn-up degrees based on the burn-up degree of each of fuel assembly segments obtained in a power distribution monitor and by the interpolation and extrapolation of void coefficients. The typical values are multiplied with compensation coefficients for the control rod effect and coefficients for compensating the effect of adjacent fuel assemblies in a calculation device to obtain typical values for the present local power distribution compensated with all of the effects. Further, the calculation device compares them with typical values of the present local power distribution to obtain an aimed local power peaking coefficient as the maximum value thereof. According to the present invention, since the local power peaking coefficients can be determined not depending on the combination of the kind of fuels, if the combination of fuel assemblies is increased upon fuel change, the amount of operation therefor is not increased. (Kamimura, M.)

  13. Ionoacoustic characterization of the proton Bragg peak with submillimeter accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Assmann, W., E-mail: walter.assmann@lmu.de; Reinhardt, S.; Lehrack, S.; Edlich, A.; Thirolf, P. G.; Parodi, K. [Department for Medical Physics, Ludwig-Maximilians-Universität München, Am Coulombwall 1, Garching 85748 (Germany); Kellnberger, S.; Omar, M.; Ntziachristos, V. [Institute for Biological and Medical Imaging, Technische Universität München and Helmholtz Zentrum München, Ingolstädter Landstrasse 1, Neuherberg 85764 (Germany); Moser, M.; Dollinger, G. [Institute for Applied Physics and Measurement Technology, Universität der Bundeswehr, Werner-Heisenberg-Weg 39, Neubiberg 85577 (Germany)

    2015-02-15

    Purpose: Range verification in ion beam therapy relies to date on nuclear imaging techniques which require complex and costly detector systems. A different approach is the detection of thermoacoustic signals that are generated due to localized energy loss of ion beams in tissue (ionoacoustics). Aim of this work was to study experimentally the achievable position resolution of ionoacoustics under idealized conditions using high frequency ultrasonic transducers and a specifically selected probing beam. Methods: A water phantom was irradiated by a pulsed 20 MeV proton beam with varying pulse intensity and length. The acoustic signal of single proton pulses was measured by different PZT-based ultrasound detectors (3.5 and 10 MHz central frequencies). The proton dose distribution in water was calculated by Geant4 and used as input for simulation of the generated acoustic wave by the matlab toolbox k-WAVE. Results: In measurements from this study, a clear signal of the Bragg peak was observed for an energy deposition as low as 10{sup 12} eV. The signal amplitude showed a linear increase with particle number per pulse and thus, dose. Bragg peak position measurements were reproducible within ±30 μm and agreed with Geant4 simulations to better than 100 μm. The ionoacoustic signal pattern allowed for a detailed analysis of the Bragg peak and could be well reproduced by k-WAVE simulations. Conclusions: The authors have studied the ionoacoustic signal of the Bragg peak in experiments using a 20 MeV proton beam with its correspondingly localized energy deposition, demonstrating submillimeter position resolution and providing a deep insight in the correlation between the acoustic signal and Bragg peak shape. These results, together with earlier experiments and new simulations (including the results in this study) at higher energies, suggest ionoacoustics as a technique for range verification in particle therapy at locations, where the tumor can be localized by ultrasound

  14. Chinese emissions peak: Not when, but how

    International Nuclear Information System (INIS)

    Spencer, Thomas; Colombier, Michel; Wang, Xin; Sartor, Oliver; Waisman, Henri

    2016-07-01

    It seems highly likely that China will overachieve its 2020 and 2030 targets, and peak its emissions before 2030 and possibly at a lower level than often assumed. This paper argues that the debate on the timing of the peak is misplaced: what matters is not when by why. For the peak to be seen as a harbinger of deep transformation, it needs to be based on significant macro-economic reform and restructuring, with attendant improvement in energy intensity. The Chinese economic model has been extraordinarily investment and resource intensive, and has driven the growth in GHG emissions. That model is no longer economically or environmentally sustainable. Therefore Chinese policy-makers are faced with a trade-off between slower short-term growth and economic reform, versus supporting short-term growth but slowing economic reform. The outcome will be crucial for the transition to a low-carbon economy. Overall, the 13. FYP (2016-2020) gives the impression of a cautious reflection of the new normal paradigm on the economic front, and a somewhat conservative translation of this shift into the energy and climate targets. Nonetheless, the 13. FYP targets set China well on the way to overachieving its 2020 pledge undertaken at COP15 in Copenhagen, and to potentially overachieving its INDC. It thus seems likely that China will achieve its emissions peak before 2030. However, the crucial question is not when China peaks, but whether the underlying transformation of the Chinese economy and energy system lays the basis for deep decarbonization thereafter. Thorough assessments of the implications of the 'new normal' for Chinese emissions and energy system trajectories, taking into account the link with the Chinese macro-economy, are needed. Scenarios provide a useful framework and should focus on a number of short-term uncertainties. Most energy system and emissions scenarios published today assume a continuity of trends between 2010-2015 and 2015-2020, which is at odds with clear

  15. Interpretation of the peak areas in gamma-ray spectra that have a large relative uncertainty

    International Nuclear Information System (INIS)

    Korun, M.; Maver Modec, P.; Vodenik, B.

    2012-01-01

    Empirical evidence is provided that the areas of peaks having a relative uncertainty in excess of 30% are overestimated. This systematic influence is of a statistical nature and originates in way the peak-analyzing routine recognizes the small peaks. It is not easy to detect this influence since it is smaller than the peak-area uncertainty. However, the systematic influence can be revealed in repeated measurements under the same experimental conditions, e.g., in background measurements. To evaluate the systematic influence, background measurements were analyzed with the peak-analyzing procedure described by Korun et al. (2008). The magnitude of the influence depends on the relative uncertainty of the peak area and may amount, in the conditions used in the peak analysis, to a factor of 5 at relative uncertainties exceeding 60%. From the measurements, the probability for type-II errors, as a function of the relative uncertainty of the peak area, was extracted. This probability is near zero below an uncertainty of 30% and rises to 90% at uncertainties exceeding 50%. - Highlights: ► A systematic influence affecting small peak areas in gamma-ray spectra is described. ► The influence originates in the peak locating procedure, using a pre-determined sensitivity. ► The predetermined sensitivity makes peak areas with large uncertainties to be overestimated. ► The influence depends on the relative uncertainty of the number of counts in the peak. ► Corrections exceeding a factor of 3 are attained at peak area uncertainties exceeding 60%.

  16. Concentration of elements on impregnated paper followed by their determination by peak chromatography

    International Nuclear Information System (INIS)

    Aleskovskaya, V.N.; Aleskovskij, V.B.; Bogdanova, Eh.G.

    1977-01-01

    To increase the limits of detection of ions Au, Ru and others in paper peak chromatography, their concentration is suggested on this very paper due to an increase of the analysed solution volume introduced on the paper. It is shown that deviation from the linear dependence of the peak heights on the determined ion concentration on the primary chromatograph near the limit of detection is explained by sorption of the ion with its precipitate. The concentration by two orders of magnitude enlargeds the concentration ranges of 1 - and Ru(3). The concentration is possible for small amounts of ions for which a nonlinear dependence occurs near the limit of detection

  17. Particle creation by peak electric field

    Energy Technology Data Exchange (ETDEWEB)

    Adorno, T.C. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Gavrilov, S.P. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Herzen State Pedagogical University of Russia, Department of General and Experimental Physics, St. Petersburg (Russian Federation); Gitman, D.M. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); P. N. Lebedev Physical Institute, Moscow (Russian Federation); University of Sao Paulo, Institute of Physics, CP 66318, Sao Paulo, SP (Brazil)

    2016-08-15

    The particle creation by the so-called peak electric field is considered. The latter field is a combination of two exponential parts, one exponentially increasing and another exponentially decreasing. We find exact solutions of the Dirac equation with the field under consideration with appropriate asymptotic conditions and calculate all the characteristics of particle creation effect, in particular, differential mean numbers of created particle, total number of created particles, and the probability for a vacuum to remain a vacuum. Characteristic asymptotic regimes are discussed in detail and a comparison with the pure asymptotically decaying field is considered. (orig.)

  18. Octant vectorcardiography - the evaluation by peaks.

    Science.gov (United States)

    Laufberger, V

    1982-01-01

    From the Frank lead potentials a computer prints out an elementary table. Therein, the electrical space of left ventricle depolarization is divided into eight spatial parts labelled by numbers 1-8 and called octants. Within these octants six peaks are determined labelled with letters ALPR-IS. Their localization is described by six-digit topograms characteristic for each patient. From 300 cases of patients after myocardial infarction, three data bases were compiled enabling every case to be classified into classes, subclasses and types. The follow up of patients according to these principles gives an objective and detailed image about the progress of coronary artery disease.

  19. Energy peaks: A high energy physics outlook

    Science.gov (United States)

    Franceschini, Roberto

    2017-12-01

    Energy distributions of decay products carry information on the kinematics of the decay in ways that are at the same time straightforward and quite hidden. I will review these properties and discuss their early historical applications, as well as more recent ones in the context of (i) methods for the measurement of masses of new physics particle with semi-invisible decays, (ii) the characterization of Dark Matter particles produced at colliders, (iii) precision mass measurements of Standard Model particles, in particular of the top quark. Finally, I will give an outlook of further developments and applications of energy peak method for high energy physics at colliders and beyond.

  20. Computation of peak discharge at culverts

    Science.gov (United States)

    Carter, Rolland William

    1957-01-01

    Methods for computing peak flood flow through culverts on the basis of a field survey of highwater marks and culvert geometry are presented. These methods are derived from investigations of culvert flow as reported in the literature and on extensive laboratory studies of culvert flow. For convenience in computation, culvert flow has been classified into six types, according to the location of the control section and the relative heights of the head-water and tail-water levels. The type of flow which occurred at any site can be determined from the field data and the criteria given in this report. A discharge equation has been developed for each flow type by combining the energy and continuity equations for the distance between an approach section upstream from the culvert and a terminal section within the culvert barrel. The discharge coefficient applicable to each flow type is listed for the more common entrance geometries. Procedures for computing peak discharge through culverts are outlined in detail for each of the six flow types.

  1. Comparison of five portable peak flow meters.

    Science.gov (United States)

    Takara, Glaucia Nency; Ruas, Gualberto; Pessoa, Bruna Varanda; Jamami, Luciana Kawakami; Di Lorenzo, Valéria Amorim Pires; Jamami, Mauricio

    2010-05-01

    To compare the measurements of spirometric peak expiratory flow (PEF) from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone, Assess, Galemed, Personal Best and Vitalograph peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (pmeters were 428 (263-688 L/min), 450 (350-800 L/min), 420 (310-720 L/min), 380 (300-735 L/min), 400 (310-685 L/min) and 415 (335-610 L/min), respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone(R) (pmeters. There was no agreement between the spirometric values and the five PEF meters. The results suggest that the values recorded from Galemed meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  2. Monitoring device for local power peaking coefficient

    International Nuclear Information System (INIS)

    Mitsuhashi, Ishi

    1987-01-01

    Purpose: To monitor the local power peaking coefficients obtained by the method not depending on the combination of fuel types. Method: A plurality of representative values for the local power distribution determined by the nuclear constant calculation for one fuel assembly are memorized regarding each of the burn-up degree and the void coefficient on every positions and fuel types in fuel rod assemblies. While on the other hand, the representative values for the local power distribution as described above are compensated by a compensation coefficient considering the effect of adjacent segments and a control rod compensation coefficient considering the effect due to the control rod insertion relative to the just-mentioned compensation coefficient. Then, the maximum value among them is selected to determine the local power peaking coefficient at each of the times and each of the segments, which is monitored. According to this system, the calculation and the working required for the fitting work depending on the combination of fuel types are no more required at all to facilitate the maintenance as well. (Horiuchi, T.)

  3. Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.

    Science.gov (United States)

    Foley, Joe P; Blackney, Donna M; Ennis, Erin J

    2017-11-10

    The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum

  4. A beam-synchronous gated peak-detector for the LHC beam observation system

    CERN Document Server

    Levens, T E; Wehrle, U

    2013-01-01

    Measurements of the bunch peak amplitude using the longitudinal wideband wall-current monitor are a vital tool used in the Large Hadron Collider (LHC) beam observation system. These peak-detected measurements can be used to diagnose bunch shape oscillations, for example coherent quadrupole oscillations, that occur at injection and during beam manipulations. Peak-detected Schottky diagnostics can also be used to obtain the synchrotron frequency distribution and other parameters from a bunched beam under stable conditions. For the LHC a beam-synchronous gated peak detector has been developed to allow individual bunches to be monitored without the influence of other bunches circulating in the machine. The requirement for the observation of both low intensity pilot bunches and high intensity bunches for physics requires a detector front-end with a high bandwidth and a large dynamic range while the usage for Schottky measurements requires low noise electronics. This paper will present the design of this detector s...

  5. Peak Wind Tool for General Forecasting

    Science.gov (United States)

    Barrett, Joe H., III

    2010-01-01

    The expected peak wind speed of the day is an important forecast element in the 45th Weather Squadron's (45 WS) daily 24-Hour and Weekly Planning Forecasts. The forecasts are used for ground and space launch operations at the Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS). The 45 WS also issues wind advisories for KSC/CCAFS when they expect wind gusts to meet or exceed 25 kt, 35 kt and 50 kt thresholds at any level from the surface to 300 ft. The 45 WS forecasters have indicated peak wind speeds are challenging to forecast, particularly in the cool season months of October - April. In Phase I of this task, the Applied Meteorology Unit (AMU) developed a tool to help the 45 WS forecast non-convective winds at KSC/CCAFS for the 24-hour period of 0800 to 0800 local time. The tool was delivered as a Microsoft Excel graphical user interface (GUI). The GUI displayed the forecast of peak wind speed, 5-minute average wind speed at the time of the peak wind, timing of the peak wind and probability the peak speed would meet or exceed 25 kt, 35 kt and 50 kt. For the current task (Phase II ), the 45 WS requested additional observations be used for the creation of the forecast equations by expanding the period of record (POR). Additional parameters were evaluated as predictors, including wind speeds between 500 ft and 3000 ft, static stability classification, Bulk Richardson Number, mixing depth, vertical wind shear, temperature inversion strength and depth and wind direction. Using a verification data set, the AMU compared the performance of the Phase I and II prediction methods. Just as in Phase I, the tool was delivered as a Microsoft Excel GUI. The 45 WS requested the tool also be available in the Meteorological Interactive Data Display System (MIDDS). The AMU first expanded the POR by two years by adding tower observations, surface observations and CCAFS (XMR) soundings for the cool season months of March 2007 to April 2009. The POR was expanded

  6. Emissions Scenarios and Fossil-fuel Peaking

    Science.gov (United States)

    Brecha, R.

    2008-12-01

    Intergovernmental Panel on Climate Change (IPCC) emissions scenarios are based on detailed energy system models in which demographics, technology and economics are used to generate projections of future world energy consumption, and therefore, of greenhouse gas emissions. Built into the assumptions for these scenarios are estimates for ultimately recoverable resources of various fossil fuels. There is a growing chorus of critics who believe that the true extent of recoverable fossil resources is much smaller than the amounts taken as a baseline for the IPCC scenarios. In a climate optimist camp are those who contend that "peak oil" will lead to a switch to renewable energy sources, while others point out that high prices for oil caused by supply limitations could very well lead to a transition to liquid fuels that actually increase total carbon emissions. We examine a third scenario in which high energy prices, which are correlated with increasing infrastructure, exploration and development costs, conspire to limit the potential for making a switch to coal or natural gas for liquid fuels. In addition, the same increasing costs limit the potential for expansion of tar sand and shale oil recovery. In our qualitative model of the energy system, backed by data from short- and medium-term trends, we have a useful way to gain a sense of potential carbon emission bounds. A bound for 21st century emissions is investigated based on two assumptions: first, that extractable fossil-fuel resources follow the trends assumed by "peak oil" adherents, and second, that little is done in the way of climate mitigation policies. If resources, and perhaps more importantly, extraction rates, of fossil fuels are limited compared to assumptions in the emissions scenarios, a situation can arise in which emissions are supply-driven. However, we show that even in this "peak fossil-fuel" limit, carbon emissions are high enough to surpass 550 ppm or 2°C climate protection guardrails. Some

  7. Simulation of the peak efficiency for a stacked NaI(Tl) spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, H; Murohka, H; Anami, K; Nohtomi, A; Uozumi, Y; Sakae, T; Matoba, M [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering; Koori, N; Maki, T

    1996-07-01

    A stacked NaI(Tl) spectrometer has been developed to measure proton spectra in wide energy range. In the measurement of charged particles with intermediate energy, the detecting efficiency of the spectrometer decreases considerably due to nuclear reactions or out-scattering in the detector material. A Monte Carlo simulation code has been developed to estimate the peak efficiency (peak-to-total ratio) of the spectrometer. The calculated efficiency for intermediate energy is in good agreement with the experimental one. (author)

  8. MEASURING PRIMORDIAL NON-GAUSSIANITY THROUGH WEAK-LENSING PEAK COUNTS

    International Nuclear Information System (INIS)

    Marian, Laura; Hilbert, Stefan; Smith, Robert E.; Schneider, Peter; Desjacques, Vincent

    2011-01-01

    We explore the possibility of detecting primordial non-Gaussianity of the local type using weak-lensing peak counts. We measure the peak abundance in sets of simulated weak-lensing maps corresponding to three models f NL = 0, - 100, and 100. Using survey specifications similar to those of EUCLID and without assuming any knowledge of the lens and source redshifts, we find the peak functions of the non-Gaussian models with f NL = ±100 to differ by up to 15% from the Gaussian peak function at the high-mass end. For the assumed survey parameters, the probability of fitting an f NL = 0 peak function to the f NL = ±100 peak functions is less than 0.1%. Assuming the other cosmological parameters are known, f NL can be measured with an error Δf NL ∼ 13. It is therefore possible that future weak-lensing surveys like EUCLID and LSST may detect primordial non-Gaussianity from the abundance of peak counts, and provide information complementary to that obtained from the cosmic microwave background.

  9. Peak Electric Load Relief in Northern Manhattan

    Directory of Open Access Journals (Sweden)

    Hildegaard D. Link

    2014-08-01

    Full Text Available The aphorism “Think globally, act locally,” attributed to René Dubos, reflects the vision that the solution to global environmental problems must begin with efforts within our communities. PlaNYC 2030, the New York City sustainability plan, is the starting point for this study. Results include (a a case study based on the City College of New York (CCNY energy audit, in which we model the impacts of green roofs on campus energy demand and (b a case study of energy use at the neighborhood scale. We find that reducing the urban heat island effect can reduce building cooling requirements, peak electricity loads stress on the local electricity grid and improve urban livability.

  10. Tim Peake and Britain's road to space

    CERN Document Server

    Seedhouse, Erik

    2017-01-01

    This book puts the reader in the flight suit of Britain’s first male astronaut, Tim Peake. It chronicles his life, along with the Principia mission and the down-to-the-last-bolt descriptions of life aboard the ISS, by way of the hurdles placed by the British government and the rigors of training at Russia’s Star City military base. In addition, this book discusses the learning curves required in astronaut and mission training and the complexity of the technologies required to launch an astronaut and keep them alive for months on end. This book underscores the fact that technology and training, unlike space, do not exist in a vacuum; complex technical systems, like the ISS, interact with the variables of human personality, and the cultural background of the astronauts. .

  11. Complex behavior of elevators in peak traffic

    Science.gov (United States)

    Nagatani, Takashi

    2003-08-01

    We study the dynamical behavior of elevators in the morning peak traffic. We present a stochastic model of the elevators to take into account the interactions between elevators through passengers. The dynamics of the elevators is expressed in terms of a coupled nonlinear map with noises. The number of passengers carried by an elevator and the time-headway between elevators exhibit the complex behavior with varying elevator trips. It is found that the behavior of elevators exhibits a deterministic chaos even if there are no noises. The chaotic motion depends on the loading parameter, the maximum capacity of an elevator, and the number of elevators. When the loading parameter is superior to the threshold, each elevator carries a full load of passengers throughout its trip. The dependence of the threshold (transition point) on the elevator capacity is clarified.

  12. Equivalence principle and the baryon acoustic peak

    Science.gov (United States)

    Baldauf, Tobias; Mirbabayi, Mehrdad; Simonović, Marko; Zaldarriaga, Matias

    2015-08-01

    We study the dominant effect of a long wavelength density perturbation δ (λL) on short distance physics. In the nonrelativistic limit, the result is a uniform acceleration, fixed by the equivalence principle, and typically has no effect on statistical averages due to translational invariance. This same reasoning has been formalized to obtain a "consistency condition" on the cosmological correlation functions. In the presence of a feature, such as the acoustic peak at ℓBAO, this naive expectation breaks down for λLexplicitly applied to the one-loop calculation of the power spectrum. Finally, the success of baryon acoustic oscillation reconstruction schemes is argued to be another empirical evidence for the validity of the results.

  13. Comparison of five portable peak flow meters

    Directory of Open Access Journals (Sweden)

    Glaucia Nency Takara

    2010-01-01

    Full Text Available OBJECTIVE: To compare the measurements of spirometric peak expiratory flow (PEF from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. METHODS: Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (p<0.05, Spearman's correlation test and Bland-Altman's agreement test. RESULTS: The median and interquartile ranges for the spirometric values and the Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® meters were 428 (263-688 L/min, 450 (350-800 L/min, 420 (310-720 L/min, 380 (300-735 L/min, 400 (310-685 L/min and 415 (335-610 L/min, respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone® (p<0.001 and Galemed ® (p<0.01 meters. There was no agreement between the spirometric values and the five PEF meters. CONCLUSIONS: The results suggest that the values recorded from Galemed® meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone® meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  14. Norwegian hydropower a valuable peak power source

    Energy Technology Data Exchange (ETDEWEB)

    Brekke, Hermod

    2010-07-01

    given on a possible increase of the Norwegian hydropower peak power production to meet the growing the European demand for peak power caused by the growing non stationary production from wind mills and ocean energy from waves and sea current. Also building of reversible pump turbine power plants will be discussed even if approximately 10% power will be consumed by loss in the pumping phase compared to direct use of the water from reservoirs. (Author)

  15. Can You Hear That Peak? Utilization of Auditory and Visual Feedback at Peak Limb Velocity

    Science.gov (United States)

    Loria, Tristan; de Grosbois, John; Tremblay, Luc

    2016-01-01

    Purpose: At rest, the central nervous system combines and integrates multisensory cues to yield an optimal percept. When engaging in action, the relative weighing of sensory modalities has been shown to be altered. Because the timing of peak velocity is the critical moment in some goal-directed movements (e.g., overarm throwing), the current study…

  16. OccuPeak: ChIP-Seq peak calling based on internal background modelling

    NARCIS (Netherlands)

    de Boer, Bouke A.; van Duijvenboden, Karel; van den Boogaard, Malou; Christoffels, Vincent M.; Barnett, Phil; Ruijter, Jan M.

    2014-01-01

    ChIP-seq has become a major tool for the genome-wide identification of transcription factor binding or histone modification sites. Most peak-calling algorithms require input control datasets to model the occurrence of background reads to account for local sequencing and GC bias. However, the

  17. Prediction of iodine activity peak during refuelling

    International Nuclear Information System (INIS)

    Hozer, Z.; Vajda, N.

    2001-01-01

    The increase of fission product activities in the primary circuit of a nuclear power plant indicates the existence of defects in some fuel rods. The power change leads to the cooling down of the fuel and results in the fragmentation of the UO 2 pellets, which facilitates the release of fission products from the intergranular regions. Furthermore the injection of boric acid after shutdown will increase the primary activity, due to the solution of deposited fission products from the surface of the core components. The calculation of these phenomena usually is based on the evaluation of activity measurements and power plant data. The estimation of iodine spiking peak during reactor transients is based on correlation with operating parameters, such as reactor power and primary pressure. The approach used in the present method was applied for CANDU reactors. The VVER-440 specific correlations were determined using the activity measurements of the Paks NPP and the data provided by the Russian fuel supplier. The present method is used for the evaluation of the iodine isotopes, as well as the noble gases. A numerical model has been developed for iodine spiking simulation and has been validated against several shutdown transients, measured at Paks NPP. (R.P.)

  18. Relationships among peak power output, peak bar velocity, and mechanomyographic amplitude during the free-weight bench press exercise.

    Science.gov (United States)

    Stock, Matt S; Beck, Travis W; Defreitas, Jason M; Dillon, Michael A

    2010-10-01

    The purpose of this study was to examine the relationships among mechanomyographic (MMG) amplitude, power output, and bar velocity during the free-weight bench press exercise. Twenty-one resistance-trained men [one-repetition maximum (1-RM) bench press = 125.4+18.4 kg] performed bench press muscle actions as explosively as possible from 10% to 90% of the 1-RM while peak power output and peak bar velocity were assessed with a TENDO Weightlifting Analyzer. During each muscle action, surface MMG signals were detected from the right and left pectoralis major and triceps brachii, and the concentric portion of the range of motion was selected for analysis. Results indicated that power output increased from 10% to 50% 1-RM, followed by decreases from 50% to 90% 1-RM, but MMG amplitude for each of the muscles increased from 10 to 80% 1-RM. The results of this study indicate that during the free-weight bench press exercise, MMG amplitude was not related to power output, but was inversely related to bar velocity and directly related to the external load being lifted. In future research, coaches and sport scientists may be able to estimate force/torque production from individual muscles during multi-joint, dynamic constant external resistance muscle actions.

  19. Research Opportunities at Storm Peak Laboratory

    Science.gov (United States)

    Hallar, A. G.; McCubbin, I. B.

    2006-12-01

    The Desert Research Institute (DRI) operates a high elevation facility, Storm Peak Laboratory (SPL), located on the west summit of Mt. Werner in the Park Range near Steamboat Springs, Colorado at an elevation of 3210 m MSL (Borys and Wetzel, 1997). SPL provides an ideal location for long-term research on the interactions of atmospheric aerosol and gas- phase chemistry with cloud and natural radiation environments. The ridge-top location produces almost daily transition from free tropospheric to boundary layer air which occurs near midday in both summer and winter seasons. Long-term observations at SPL document the role of orographically induced mixing and convection on vertical pollutant transport and dispersion. During winter, SPL is above cloud base 25% of the time, providing a unique capability for studying aerosol-cloud interactions (Borys and Wetzel, 1997). A comprehensive set of continuous aerosol measurements was initiated at SPL in 2002. SPL includes an office-type laboratory room for computer and instrumentation setup with outside air ports and cable access to the roof deck, a cold room for precipitation and cloud rime ice sample handling and ice crystal microphotography, a 150 m2 roof deck area for outside sampling equipment, a full kitchen and two bunk rooms with sleeping space for nine persons. The laboratory is currently well equipped for aerosol and cloud measurements. Particles are sampled from an insulated, 15 cm diameter manifold within approximately 1 m of its horizontal entry point through an outside wall. The 4 m high vertical section outside the building is capped with an inverted can to exclude large particles.

  20. Peak MSC—Are We There Yet?

    Directory of Open Access Journals (Sweden)

    Timothy R. Olsen

    2018-06-01

    Full Text Available Human mesenchymal stem cells (hMSCs are a critical raw material for many regenerative medicine products, including cell-based therapies, engineered tissues, or combination products, and are on the brink of radically changing how the world of medicine operates. Their unique characteristics, potential to treat many indications, and established safety profile in more than 800 clinical trials have contributed to their current consumption and will only fuel future demand. Given the large target patient populations with typical dose sizes of 10's to 100's of millions of cells per patient, and engineered tissues being constructed with 100's of millions to billions of cells, an unprecedented demand has been created for hMSCs. The fulfillment of this demand faces an uphill challenge in the limited availability of large quantities of pharmaceutical grade hMSCs for the industry—fueling the need for parallel rapid advancements in the biomanufacturing of this living critical raw material. Simply put, hMSCs are no different than technologies like transistors, as they are a highly technical and modular product that requires stringent control over manufacturing that can allow for high quality and consistent performance. As hMSC manufacturing processes are optimized, it predicts a future time of abundance for hMSCs, where scientists and researchers around the world will have access to a consistent and readily available supply of high quality, standardized, and economical pharmaceutical grade product to buy off the shelf for their applications and drive product development—this is “Peak MSC.”

  1. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak......-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show...... four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate...

  2. Large abnormal peak on capillary zone electrophoresis due to contrast agent.

    Science.gov (United States)

    Wheeler, Rachel D; Zhang, Liqun; Sheldon, Joanna

    2017-01-01

    Background Some iodinated radio-contrast media absorb ultraviolet light and can therefore be detected by capillary zone electrophoresis. If seen, these peaks are typically small with 'quantifications' of below 5 g/L. Here, we describe the detection of a large peak on capillary zone electrophoresis that was due to the radio-contrast agent, Omnipaque™. Methods Serum from a patient was analysed by capillary zone electrophoresis, and the IgG, IgA, IgM and total protein concentrations were measured. The serum sample was further analysed by gel electrophoresis and immunofixation. Results Capillary zone electrophoresis results for the serum sample showed a large peak with a concentration high enough to warrant urgent investigation. However, careful interpretation alongside the serum immunoglobulin concentrations and total protein concentration showed that the abnormal peak was a pseudoparaprotein rather than a monoclonal immunoglobulin. This was confirmed by analysis with gel electrophoresis and also serum immunofixation. The patient had had a CT angiogram with the radio-contrast agent Omnipaque™; addition of Omnipaque™ to a normal serum sample gave a peak with comparable mobility to the pseudoparaprotein in the patient's serum. Conclusions Pseudoparaproteins can appear as a large band on capillary zone electrophoresis. This case highlights the importance of a laboratory process that detects significant electrophoretic abnormalities promptly and interprets them in the context of the immunoglobulin concentrations. This should avoid incorrect reporting of pseudoparaproteins which could result in the patient having unnecessary investigations.

  3. Characterizing the Peak in the Cosmic Microwave Background Angular Power Spectrum

    International Nuclear Information System (INIS)

    Knox, Lloyd; Page, Lyman

    2000-01-01

    A peak has been unambiguously detected in the cosmic microwave background angular spectrum. Here we characterize its properties with fits to phenomenological models. We find that the TOCO and BOOM/NA data determine the peak location to be in the range 175-243 and 151-259, respectively (at 95% confidence) and determine the peak amplitude to be between ≅70 and 90 μK . The peak shape is consistent with inflation-inspired flat, cold dark matter plus cosmological constant models of structure formation with adiabatic, nearly scale invariant initial conditions. It is inconsistent with open models and presents a great challenge to defect models. (c) 2000 The American Physical Society

  4. Optimization of a Compton-suppression system by escape-peak ratio

    International Nuclear Information System (INIS)

    Niu, H.; Chao, J.H.; Wu, S.-C.

    1996-01-01

    A Compton-suppression system consisting of an HPGe central detector surrounded by eight BGO scintillators in an annular geometry was assembled. This system is dedicated to in-beam γ-ray measurements. The ratios of full-energy to single-escape peak and full-energy of double-escape peak, at γ-rays of 2754, 4443 and 6130 keV, were used to derive associated suppression factors in order to optimize detection conditions of the system. The suppression factors derived both from the escape peak ratios and the corresponding peak-to-Compton ratios of the γ-ray spectra are compared and discussed. This optimization technique may be of great significance for analyzing complicated spectra, where high-energy γ-rays are considered for analytical use. (Author)

  5. Sharp Absorption Peaks in THz Spectra Valuable for Crystal Quality Evaluation of Middle Molecular Weight Pharmaceuticals

    Science.gov (United States)

    Sasaki, Tetsuo; Sakamoto, Tomoaki; Otsuka, Makoto

    2018-05-01

    Middle molecular weight (MMW) pharmaceuticals (MW 400 4000) are attracting attention for their possible use in new medications. Sharp absorption peaks were observed in MMW pharmaceuticals at low temperatures by measuring with a high-resolution terahertz (THz) spectrometer. As examples, high-resolution THz spectra for amoxicillin trihydrate, atorvastatin calcium trihydrate, probucol, and α,β,γ,δ-tetrakis(1-methylpyridinium-4-yl)porphyrin p-toluenesulfonate (TMPyP) were obtained at 10 K. Typically observed as peaks with full width at half-height (FWHM) values as low as 5.639 GHz at 0.96492 THz in amoxicillin trihydrate and 8.857 GHz at 1.07974 THz for probucol, many sharp peaks of MMW pharmaceuticals could be observed. Such narrow absorption peaks enable evaluation of the crystal quality of MMW pharmaceuticals and afford sensitive detection of impurities.

  6. "Peak-tracking chip" (PTC) for bulk refractive index sensing and bioarray sensing

    KAUST Repository

    Bougot-Robin, Kristelle; Austin, H. Robert; Benisty, Henri; Hsing, I-Ming; Kodzius, Rimantas; Li, Shunbo; Wen, Weijia; Zhang, Yinghua

    2013-01-01

    Resonant techniques are of wide interest to detect variation of effective refractive index at a chip surface. Both Surface Plasmon Resonance (SPR) and dielectric resonant waveguide (RWGs) can be exploited. Through their design, RWGs allow more flexibility (size of the biomolecule to detect, detection angle…). Using specially designed RWG “Peak-tracking chip”, we propose to use spatial information from a simple monochromatic picture as a new label-free bioarray technique. We discuss robustness, sensitivity, multiplex detection, fluidic integration of the technique and illustrate it through bulk refractive index sensing as well as specific recognition of DNA fragment from gyrase A.

  7. "Peak-tracking chip" (PTC) for bulk refractive index sensing and bioarray sensing

    KAUST Repository

    Bougot-Robin, Kristelle

    2013-10-20

    Resonant techniques are of wide interest to detect variation of effective refractive index at a chip surface. Both Surface Plasmon Resonance (SPR) and dielectric resonant waveguide (RWGs) can be exploited. Through their design, RWGs allow more flexibility (size of the biomolecule to detect, detection angle…). Using specially designed RWG “Peak-tracking chip”, we propose to use spatial information from a simple monochromatic picture as a new label-free bioarray technique. We discuss robustness, sensitivity, multiplex detection, fluidic integration of the technique and illustrate it through bulk refractive index sensing as well as specific recognition of DNA fragment from gyrase A.

  8. Characteristic of 120 degree C thermoluminescence peak of iceland spar

    International Nuclear Information System (INIS)

    Lu Xinwei; Han Jia

    2006-01-01

    The basic characteristic of 120 degree C thermoluminescence peak of iceland spar was studied. The experimental result indicates the longevity of 120 degree C thermoluminescence peak of iceland spar is about 2 h under 30 degree C. The thermoluminescence peak moves to the high temperature when the heating speed increasing. The intensity of 120 degree C thermoluminescence peak of iceland spar is directly proportional to radiation dose under 15 Gy. (authors)

  9. Deciphering lead and cadmium stripping peaks for porous antimony deposited electrodes

    Directory of Open Access Journals (Sweden)

    Taimoor Aqeel Ahmad

    2016-06-01

    Full Text Available Cadmium and lead are generally taken as model heavy metal ions in water to scale the detection limit of various electrode sensors, using electrochemical sensing techniques. These ions interact with the electrochemically deposited antimony electrodes depending on the diffusion limitations. The phenomenon acts differently for the in-situ and ex-situ deposition as well as for porous and non-porous electrodes. A method has been adopted in this study to discourage the stripping and deposition of the working ions (antimony to understand the principle of heavy metal ion detection. X-ray photoelectron spectroscopy (XPS technique was used to establish the interaction between the working and dissolved ions. In addition to the distinct peaks for each analyte, researchers also observed a shoulder peak. A possible reason for the presence of this peak was provided. Different electrochemical tests were performed to ascertain the theory on the basis of the experimental observations.

  10. Assessing peak aerobic capacity in Dutch law enforcement officers

    NARCIS (Netherlands)

    Wittink, Harriet; Takken, Tim; de Groot, Janke; Reneman, Michiel; Peters, Roelof; Vanhees, Luc

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  11. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1990-03-01

    This paper reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertanties in the background and in the expected position of the peak. (author) [pt

  12. PEAK TRACKING WITH A NEURAL NETWORK FOR SPECTRAL RECOGNITION

    NARCIS (Netherlands)

    COENEGRACHT, PMJ; METTING, HJ; VANLOO, EM; SNOEIJER, GJ; DOORNBOS, DA

    1993-01-01

    A peak tracking method based on a simulated feed-forward neural network with back-propagation is presented. The network uses the normalized UV spectra and peak areas measured in one chromatogram for peak recognition. It suffices to train the network with only one set of spectra recorded in one

  13. Assessing peak aerobic capacity in Dutch law enforcement officers.

    NARCIS (Netherlands)

    Wittink, H.; Takken, T.; Groot, J.F. de; Reneman, M.; Peters, R.; Vanhees, L.

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  14. 7 CFR 457.163 - Nursery peak inventory endorsement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Nursery peak inventory endorsement. 457.163 Section... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.163 Nursery peak inventory endorsement. Nursery Crop Insurance Peak Inventory Endorsement This endorsement is not continuous and must be...

  15. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1991-01-01

    This article reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertainties both in the background and in the expected position of the peak. (orig.)

  16. Extrasolar Planet Transits Observed at Kitt Peak National Observatory

    Science.gov (United States)

    Sada, Pedro V.; Jennings, Donald E.; Deming, Drake; Jennings, Donald E.; Jackson, Brian; Hamilton, Catrina M.; Fraine, Jonathan; Peterson, Steven W.; Haase, Flynn; Bays, Kevin; hide

    2012-01-01

    We obtained J-, H-, and JH-band photometry of known extrasolar planet transiting systems at the 2.1 m Kitt Peak National Observatory Telescope using the FLAMINGOS infrared camera between 2008 October and 2011 October. From the derived light curves we have extracted the midtransit times, transit depths and transit durations for these events. The precise midtransit times obtained help improve the orbital periods and also constrain transit-time variations of the systems. For most cases the published system parameters successfully accounted for our observed light curves, but in some instances we derive improved planetary radii and orbital periods. We complemented our 2.1 m infrared observations using CCD z0-band and B-band photometry (plus two H(alpha) filter observations) obtained with the Kitt Peak Visitor Center Telescope, and with four H-band transits observed in 2007 October with the NSO's 1.6 m McMath-Pierce Solar Telescope. The principal highlights of our results are (1) Our ensemble of J-band planetary radii agree with optical radii, with the best-fit relation being RpRJ0:0017 0:979RpRvis. (2) We observe starspot crossings during the transit of WASP-11HAT-P-10. (3) We detect starspot crossings by HAT-P-11b (Kepler-3b), thus confirming that the magnetic evolution of the stellar active regions can be monitored even after the Kepler mission has ended. (4) We confirm a grazing transit for HAT-P-27WASP-40. In total, we present 57 individual transits of 32 known exoplanet systems.

  17. THE LATE PEAKING AFTERGLOW OF GRB 100418A

    International Nuclear Information System (INIS)

    Marshall, F. E.; Holland, S. T.; Sakamoto, T.; Antonelli, L. A.; Burrows, D. N.; Siegel, M. H.; Covino, S.; Fugazza, D.; De Pasquale, M.; Oates, S. R.; Evans, P. A.; O'Brien, P. T.; Osborne, J. P.; Pagani, C.; Liang, E. W.; Wu, X. F.; Zhang, B.

    2011-01-01

    GRB 100418A is a long gamma-ray burst (GRB) at redshift z = 0.6235 discovered with the Swift Gamma-ray Burst Explorer with unusual optical and X-ray light curves. After an initial short-lived, rapid decline in X-rays, the optical and X-ray light curves observed with Swift are approximately flat or rising slightly out to at least ∼7 x 10 3 s after the trigger, peak at ∼5 x 10 4 s, and then follow an approximately power-law decay. Such a long optical plateau and late peaking is rarely seen in GRB afterglows. Observations with Rapid Eye Mount during a gap in the Swift coverage indicate a bright optical flare at ∼2.5 x 10 4 s. The long plateau phase of the afterglow is interpreted using either a model with continuous injection of energy into the forward shock of the burst or a model in which the jet of the burst is viewed off-axis. In both models the isotropic kinetic energy in the late afterglow after the plateau phase is ≥10 2 times the 10 51 erg of the prompt isotropic gamma-ray energy release. The energy injection model is favored because the off-axis jet model would require the intrinsic T 90 for the GRB jet viewed on-axis to be very short, ∼10 ms, and the intrinsic isotropic gamma-ray energy release and the true jet energy to be much higher than the typical values of known short GRBs. The non-detection of a jet break up to t ∼ 2 x 10 6 s indicates a jet half-opening angle of at least ∼14 0 , and a relatively high-collimation-corrected jet energy of E jet ≥ 10 52 erg.

  18. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    International Nuclear Information System (INIS)

    Cutshall, N.H.; Larsen, I.L.

    1980-01-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented. (orig.)

  19. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    Energy Technology Data Exchange (ETDEWEB)

    Cutshall, N H; Larsen, I L [Oak Ridge National Lab., TN (USA)

    1980-12-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented.

  20. The U.S. Geological Survey Peak-Flow File Data Verification Project, 2008–16

    Science.gov (United States)

    Ryberg, Karen R.; Goree, Burl B.; Williams-Sether, Tara; Mason, Robert R.

    2017-11-21

    Annual peak streamflow (peak flow) at a streamgage is defined as the maximum instantaneous flow in a water year. A water year begins on October 1 and continues through September 30 of the following year; for example, water year 2015 extends from October 1, 2014, through September 30, 2015. The accuracy, characterization, and completeness of the peak streamflow data are critical in determining flood-frequency estimates that are used daily to design water and transportation infrastructure, delineate flood-plain boundaries, and regulate development and utilization of lands throughout the United States and are essential to understanding the implications of climate and land-use change on flooding and high-flow conditions.As of November 14, 2016, peak-flow data existed for 27,240 unique streamgages in the United States and its territories. The data, collectively referred to as the “peak-flow file,” are available as part of the U.S. Geological Survey (USGS) public web interface, the National Water Information System, at https://nwis.waterdata.usgs.gov/usa/nwis/peak. Although the data have been routinely subjected to periodic review by the USGS Office of Surface Water and screening at the USGS Water Science Center level, these data were not reviewed in a national, systematic manner until 2008 when automated scripts were developed and applied to detect potential errors in peak-flow values and their associated dates, gage heights, and peak-flow qualification codes, as well as qualification codes associated with the gage heights. USGS scientists and hydrographers studied the resulting output, accessed basic records and field notes, and corrected observed errors or, more commonly, confirmed existing data as correct.This report summarizes the changes in peak-flow file data at a national level, illustrates their nature and causation, and identifies the streamgages affected by these changes. Specifically, the peak-flow data were compared for streamgages with peak flow

  1. Study on the influence of lipid peak to the results of MR spectroscopy in the central gland of prostate

    International Nuclear Information System (INIS)

    Dong Yanjun; Wang Xiaoying; Li Feiyu; Jiang Xuexiang

    2007-01-01

    Objective: To study the influence of lipid peak to MRS in central gland of prostate gland. Methods: Seventeen patients performed transurethral resection of prostate (TURP) for benign prostate hyperplasia (BPH) were enrolled in this study. Three groups were divided according to the pathological findings: glandular-BPH (GBPH) (7 cases), stromal-BPH (SBPH) (6 cases), and incidentally detected prostate carcinoma (IDPC) (4 cases). The voxel with lipid peak in the field of volume was counted. Compared with pathology, the following studies were performed: (1) The location of the voxels that more frequently presented lipid peak in the central gland. (2) Whether the appearance of the lipid peak would obscure the identification of the peaks of the endogenous metabolites. Results: The ratio of voxels with lipid peak in central gland was about 22.8% (834/3567). There were 1477 (397 voxels with lipid peak), 1434(396 voxels with lipid peak), and 656(41 voxels with lipid peak) voxels in CBPH, SBPH, and IDPC groups, respectively. The percentage in GBPH, SBPH, and IDPC groups was 23.6%, 27.2%, and 6.4%, respectively. The percentage of voxels with lipid peak at the edge of the central gland (79.6%, 68.6% and 72.4%, respectively) was higher than that in other regions. The lipid peak in most of the voxels didn't influence the identification of the citrate and choline peak (82.8%, 98.0%, and 96.4%, respectively). Conclusion: The lipid peak in the central gland may result from the lipid tissues near the gland, and most lipid peak had no influence on the identification of endogenous metabolites. (authors)

  2. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed; Kong, Xin-Bing; Liu, Zhi; Jing, Bing-Yi; Gao, Xin

    2013-01-01

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  3. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed

    2013-01-07

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  4. Gamma-Ray Peak Integration: Accuracy and Precision

    International Nuclear Information System (INIS)

    Richard M. Lindstrom

    2000-01-01

    The accuracy of singlet gamma-ray peak areas obtained by a peak analysis program is immaterial. If the same algorithm is used for sample measurement as for calibration and if the peak shapes are similar, then biases in the integration method cancel. Reproducibility is the only important issue. Even the uncertainty of the areas computed by the program is trivial because the true standard uncertainty can be experimentally assessed by repeated measurements of the same source. Reproducible peak integration was important in a recent standard reference material certification task. The primary tool used for spectrum analysis was SUM, a National Institute of Standards and Technology interactive program to sum peaks and subtract a linear background, using the same channels to integrate all 20 spectra. For comparison, this work examines other peak integration programs. Unlike some published comparisons of peak performance in which synthetic spectra were used, this experiment used spectra collected for a real (though exacting) analytical project, analyzed by conventional software used in routine ways. Because both components of the 559- to 564-keV doublet are from 76 As, they were integrated together with SUM. The other programs, however, deconvoluted the peaks. A sensitive test of the fitting algorithm is the ratio of reported peak areas. In almost all the cases, this ratio was much more variable than expected from the reported uncertainties reported by the program. Other comparisons to be reported indicate that peak integration is still an imperfect tool in the analysis of gamma-ray spectra

  5. Relationships between electroencephalographic spectral peaks across frequency bands

    Directory of Open Access Journals (Sweden)

    Sacha Jennifer Van Albada

    2013-03-01

    Full Text Available The degree to which electroenencephalographic (EEG spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification.

  6. Relationships between Electroencephalographic Spectral Peaks Across Frequency Bands

    Science.gov (United States)

    van Albada, S. J.; Robinson, P. A.

    2013-01-01

    The degree to which electroencephalographic spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification. PMID:23483663

  7. Particle in cell simulation of peaking switch for breakdown evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Umbarkar, Sachin B.; Bindu, S.; Mangalvedekar, H.A.; Saxena, A.; Singh, N.M., E-mail: sachin.b.umbarkar@gmail.com [Department of Electric Engineering, Veermata Jijabai Technological Institute, Mumbai (India); Sharma, Archana; Saroj, P.C.; Mittal, K.C. [Accelerator Pulse Power Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-07-01

    Marx generator connected to peaking capacitor and peaking switch can generate Ultra-Wideband (UWB) radiation. A new peaking switch is designed for converting the existing nanosecond Marx generator to a UWB source. The paper explains the particle in cell (PIC) simulation for this peaking switch, using MAGIC 3D software. This peaking switch electrode is made up of copper tungsten material and is fixed inside the hermitically sealed derlin material. The switch can withstand a gas pressure up to 13.5 kg/cm{sup 2}. The lower electrode of the switch is connected to the last stage of the Marx generator. Initially Marx generator (without peaking stage) in air; gives the output pulse with peak amplitude of 113.75 kV and pulse rise time of 25 ns. Thus, we design a new peaking switch to improve the rise time of output pulse and to pressurize this peaking switch separately (i.e. Marx and peaking switch is at different pressure). The PIC simulation gives the particle charge density, current density, E counter plot, emitted electron current, and particle energy along the axis of gap between electrodes. The charge injection and electric field dependence on ionic dissociation phenomenon are briefly analyzed using this simulation. The model is simulated with different gases (N{sub 2}, H{sub 2}, and Air) under different pressure (2 kg/cm{sup 2}, 5 kg/cm{sup 2}, 10 kg/cm{sup 2}). (author)

  8. Computation of distribution of minimum resolution for log-normal distribution of chromatographic peak heights.

    Science.gov (United States)

    Davis, Joe M

    2011-10-28

    General equations are derived for the distribution of minimum resolution between two chromatographic peaks, when peak heights in a multi-component chromatogram follow a continuous statistical distribution. The derivation draws on published theory by relating the area under the distribution of minimum resolution to the area under the distribution of the ratio of peak heights, which in turn is derived from the peak-height distribution. Two procedures are proposed for the equations' numerical solution. The procedures are applied to the log-normal distribution, which recently was reported to describe the distribution of component concentrations in three complex natural mixtures. For published statistical parameters of these mixtures, the distribution of minimum resolution is similar to that for the commonly assumed exponential distribution of peak heights used in statistical-overlap theory. However, these two distributions of minimum resolution can differ markedly, depending on the scale parameter of the log-normal distribution. Theory for the computation of the distribution of minimum resolution is extended to other cases of interest. With the log-normal distribution of peak heights as an example, the distribution of minimum resolution is computed when small peaks are lost due to noise or detection limits, and when the height of at least one peak is less than an upper limit. The distribution of minimum resolution shifts slightly to lower resolution values in the first case and to markedly larger resolution values in the second one. The theory and numerical procedure are confirmed by Monte Carlo simulation. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Quantifying the cepstral peak prominence, a measure of dysphonia.

    Science.gov (United States)

    Heman-Ackah, Yolanda D; Sataloff, Robert T; Laureyns, Griet; Lurie, Deborah; Michael, Deirdre D; Heuer, Reinhardt; Rubin, Adam; Eller, Robert; Chandran, Swapna; Abaza, Mona; Lyons, Karen; Divi, Venu; Lott, Joanna; Johnson, Jennifer; Hillenbrand, James

    2014-11-01

    The purpose of this study is to establish normative values for the smoothed cepstral peak prominence (CPPS) and its sensitivity and specificity as a measure of dysphonia. Prospective cohort study. Voice samples of running speech were obtained from 835 patients and 50 volunteers. Eight laryngologists and four speech-language pathologists performed perceptual ratings of the voice samples on the degree of dysphonia/normality using an analog scale. The mean of their perceptual ratings was used as the gold standard for the detection of the presence or absence of dysphonia. CPPS was measured using the CPPS algorithm of Hillenbrand, and the cut-off value for positivity that has the highest sensitivity and specificity for discriminating between normal and severely dysphonia voices was determined based on ROC-curve analysis. The cut-off value for normal for CPPS was set at 4.0 or higher, which gave a sensitivity of 92.4%, a specificity of 79%, a positive predictive value of 82.5%, and a negative predictive value of 90.8%. The area under the receiver operating characteristic (ROC) curve was 0.937 (P dysphonia, with the normal value of CPPS (Hillenbrand algorithm) of a running speech sample being defined as a value of 4.0 or higher. Copyright © 2014 The Voice Foundation. All rights reserved.

  10. Gigahertz-peaked spectra pulsars in Pulsar Wind Nebulae

    Science.gov (United States)

    Basu, R.; RoŻko, K.; Kijak, J.; Lewandowski, W.

    2018-04-01

    We have carried out a detailed study of the spectral nature of six pulsars surrounded by pulsar wind nebulae (PWNe). The pulsar flux density was estimated using the interferometric imaging technique of the Giant Metrewave Radio Telescope at three frequencies 325, 610, and 1280 MHz. The spectra showed a turnover around gigahertz frequency in four out of six pulsars. It has been suggested that the gigahertz-peaked spectrum (GPS) in pulsars arises due to thermal absorption of the pulsar emission in surrounding medium like PWNe, H II regions, supernova remnants, etc. The relatively high incidence of GPS behaviour in pulsars surrounded by PWNe imparts further credence to this view. The pulsar J1747-2958 associated with the well-known Mouse nebula was also observed in our sample and exhibited GPS behaviour. The pulsar was detected as a point source in the high-resolution images. However, the pulsed emission was not seen in the phased-array mode. It is possible that the pulsed emission was affected by extreme scattering causing considerable smearing of the emission at low radio frequencies. The GPS spectra were modelled using the thermal free-free absorption and the estimated absorber properties were largely consistent with PWNe. The spatial resolution of the images made it unlikely that the point source associated with J1747-2958 was the compact head of the PWNe, but the synchrotron self-absorption seen in such sources was a better fit to the estimated spectral shape.

  11. Estimation of the peak factor based on watershed characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Gauthier, Jean; Nolin, Simon; Ruest, Benoit [BPR Inc., Quebec, (Canada)

    2010-07-01

    Hydraulic modeling and dam structure design require the river flood flow as a primary input. For a given flood event, the ratio of peak flow over mean daily flow defines the peak factor. The peak factor value is dependent on the watershed and location along the river. The main goal of this study consisted in finding a relationship between watershed characteristics and this peak factor. Regression analyses were carried out on 53 natural watersheds located in the southern part of the province of Quebec using data from the Centre d'expertise hydrique du Quebec (CEHQ). The watershed characteristics included in the analyses were the watershed area, the maximum flow length, the mean slope, the lake proportion and the mean elevation. The results showed that watershed area and length are the major parameters influencing the peak factor. Nine natural watersheds were also used to test the use of a multivariable model in order to determine the peak factor for ungauged watersheds.

  12. Evaluation of peak power prediction equations in male basketball players.

    Science.gov (United States)

    Duncan, Michael J; Lyons, Mark; Nevill, Alan M

    2008-07-01

    This study compared peak power estimated using 4 commonly used regression equations with actual peak power derived from force platform data in a group of adolescent basketball players. Twenty-five elite junior male basketball players (age, 16.5 +/- 0.5 years; mass, 74.2 +/- 11.8 kg; height, 181.8 +/- 8.1 cm) volunteered to participate in the study. Actual peak power was determined using a countermovement vertical jump on a force platform. Estimated peak power was determined using countermovement jump height and body mass. All 4 prediction equations were significantly related to actual peak power (all p jump prediction equations, 12% for the Canavan and Vescovi equation, and 6% for the Sayers countermovement jump equation. In all cases peak power was underestimated.

  13. Peak experiences of psilocybin users and non-users.

    Science.gov (United States)

    Cummins, Christina; Lyke, Jennifer

    2013-01-01

    Maslow (1970) defined peak experiences as the most wonderful experiences of a person's life, which may include a sense of awe, well-being, or transcendence. Furthermore, recent research has suggested that psilocybin can produce experiences subjectively rated as uniquely meaningful and significant (Griffiths et al. 2006). It is therefore possible that psilocybin may facilitate or change the nature of peak experiences in users compared to non-users. This study was designed to compare the peak experiences of psilocybin users and non-users, to evaluate the frequency of peak experiences while under the influence of psilocybin, and to assess the perceived degree of alteration of consciousness during these experiences. Participants were recruited through convenience and snowball sampling from undergraduate classes and at a musical event. Participants were divided into three groups, those who reported a peak experience while under the influence of psilocybin (psilocybin peak experience: PPE), participants who had used psilocybin but reported their peak experiences did not occur while they were under the influence of psilocybin (non-psilocybin peak experience: NPPE), and participants who had never used psilocybin (non-user: NU). A total of 101 participants were asked to think about their peak experiences and complete a measure evaluating the degree of alteration of consciousness during that experience. Results indicated that 47% of psilocybin users reported their peak experience occurred while using psilocybin. In addition, there were significant differences among the three groups on all dimensions of alteration of consciousness. Future research is necessary to identify factors that influence the peak experiences of psilocybin users in naturalistic settings and contribute to the different characteristics of peak experiences of psilocybin users and non-users.

  14. Extragalactic Peaked-spectrum Radio Sources at Low Frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.; Lenc, E. [Sydney Institute for Astronomy (SIfA), School of Physics, The University of Sydney, NSW 2006 (Australia); Ekers, R. D.; Bell, M. E. [CSIRO Astronomy and Space Science (CASS), Marsfield, NSW 2122 (Australia); Line, J. L. B.; Hancock, P. J.; Kapińska, A. D.; McKinley, B.; Procopio, P. [ARC Centre of Excellence for All-Sky Astrophysics (CAASTRO) (Australia); Hurley-Walker, N.; Tingay, S. J.; Franzen, T. M. O.; Morgan, J. [International Centre for Radio Astronomy Research (ICRAR), Curtin University, Bentley, WA 6102 (Australia); Dwarakanath, K. S. [Raman Research Institute (RRI), Bangalore 560080 (India); For, B.-Q. [International Centre for Radio Astronomy Research (ICRAR), The University of Western Australia, Crawley, WA 6009 (Australia); Hindson, L.; Johnston-Hollitt, M. [School of Chemical and Physical Sciences, Victoria University of Wellington, Wellington 6140 (New Zealand); Offringa, A. R., E-mail: joseph.callingham@sydney.edu.au [Netherlands Institute for Radio Astronomy (ASTRON), Dwingeloo (Netherlands); and others

    2017-02-20

    We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak. We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.

  15. The sharp peak-flat trough pattern and critical speculation

    OpenAIRE

    Roehner, B. M.; Sornette, D.

    1998-01-01

    We find empirically a characteristic sharp peak-flat trough pattern in a large set of commodity prices. We argue that the sharp peak structure reflects an endogenous inter-market organization, and that peaks may be seen as local ``singularities'' resulting from imitation and herding. These findings impose a novel stringent constraint on the construction of models. Intermittent amplification is not sufficient and nonlinear effects seem necessary to account for the observations.

  16. Gamma-ray peak shapes from cadmium zinc telluride detectors

    Energy Technology Data Exchange (ETDEWEB)

    Namboodiri, M.N.; Lavietes, A.D.; McQuaid, J.H.

    1996-09-01

    We report the results of a study of the peak shapes in the gamma spectra measured using several 5 x 5 x 5 mm{sup 3} cadmium zinc telluride (CZT) detectors. A simple parameterization involving a Gaussian and an exponential low energy tail describes the peak shapes sell. We present the variation of the parameters with gamma energy. This type of information is very useful in the analysis of complex gamma spectra consisting of many peaks.

  17. Statistics of peaks in cosmological nonlinear density fields

    International Nuclear Information System (INIS)

    Suginohara, Tatsushi; Suto, Yasushi.

    1990-06-01

    Distribution of the high-density peaks in the universe is examined using N-body simulations. Nonlinear evolution of the underlying density field significantly changes the statistical properties of the peaks, compared with the analytic results valid for the random Gaussian field. In particular, the abundances and correlations of the initial density peaks are discussed in the context of biased galaxy formation theory. (author)

  18. Environmental impacts of public transport. Why peak-period travellers cause a greater environmental burden than off-peak travellers

    International Nuclear Information System (INIS)

    Rietveld, P.

    2002-01-01

    Given the difference between peak and off-peak occupancy rates in public transport, emissions per traveller kilometre are lower in the peak than in the off-peak period, whereas the opposite pattern is observed for cars. It is argued that it is much more fruitful to analyse environmental effects in marginal terms. This calls for a careful analysis of capacity management policies of public transport suppliers that are facing increased demand during both peak and off-peak periods. A detailed analysis of capacity management by the Netherlands Railways (NS) revealed that off-peak capacity supply is mainly dictated by the demand levels during the peak period. The analysis included the effects of increased frequency and increased vehicle size on environmental impacts, while environmental economies of vehicle size were also taken into account. The main conclusion is that the marginal environmental burden during the peak hours is much higher than is usually thought, whereas it is almost zero during the off-peak period. This implies a pattern that is the precise opposite of the average environmental burden. Thus, an analysis of environmental effects of public transport based on average performance would yield misleading conclusions [nl

  19. The dislocation-internal friction peak γ in tantalum

    International Nuclear Information System (INIS)

    Baur, J.; Benoit, W.; Schultz, H.

    1989-01-01

    Torsion-pendulum measurements were carried out on high-purity single crystal specimens of tantalum, having extremely low oxygen contents ( 2 peak, which appears close to γ is small traces of oxygen are presents. The γ 2 peak was formerly explained as a ''dislocation-enhanced Snoek peak''. The γ peak recovers at the peak temperature, whereas the γ 2 peak is more stable. On the basis of their results, and making use of earlier investigations of Rodrian and Schultz, the authors suggest that γ 2 is modified γ relaxation, related to screw-dislocation segments, stabilized by oxygen-decorated kinks. The stability of the γ 2 peak allows an accurate determination of the activation energy, found to be 1.00 +- 0.03 eV. This value is distinctly lower than the activation energy of the oxygen Snoek effect (1.10 eV) and is related here to the mechanism of ''kink-pair formation'' in screw dislocations, as the original γ peak. The numerical value is compatible with recent values derived from flow-stress measurements. The peak γ 2 shows increasing stability with increasing oxygen content. This is explained by single- and multi-decorated kinks

  20. Evaluation of peak-fitting software for gamma spectrum analysis

    International Nuclear Information System (INIS)

    Zahn, Guilherme S.; Genezini, Frederico A.; Moralles, Mauricio

    2009-01-01

    In all applications of gamma-ray spectroscopy, one of the most important and delicate parts of the data analysis is the fitting of the gamma-ray spectra, where information as the number of counts, the position of the centroid and the width, for instance, are associated with each peak of each spectrum. There's a huge choice of computer programs that perform this type of analysis, and the most commonly used in routine work are the ones that automatically locate and fit the peaks; this fit can be made in several different ways - the most common ways are to fit a Gaussian function to each peak or simply to integrate the area under the peak, but some software go far beyond and include several small corrections to the simple Gaussian peak function, in order to compensate for secondary effects. In this work several gamma-ray spectroscopy software are compared in the task of finding and fitting the gamma-ray peaks in spectra taken with standard sources of 137 Cs, 60 Co, 133 Ba and 152 Eu. The results show that all of the automatic software can be properly used in the task of finding and fitting peaks, with the exception of GammaVision; also, it was possible to verify that the automatic peak-fitting software did perform as well as - and sometimes even better than - a manual peak-fitting software. (author)

  1. Individual vision and peak distribution in collective actions

    Science.gov (United States)

    Lu, Peng

    2017-06-01

    People make decisions on whether they should participate as participants or not as free riders in collective actions with heterogeneous visions. Besides of the utility heterogeneity and cost heterogeneity, this work includes and investigates the effect of vision heterogeneity by constructing a decision model, i.e. the revised peak model of participants. In this model, potential participants make decisions under the joint influence of utility, cost, and vision heterogeneities. The outcomes of simulations indicate that vision heterogeneity reduces the values of peaks, and the relative variance of peaks is stable. Under normal distributions of vision heterogeneity and other factors, the peaks of participants are normally distributed as well. Therefore, it is necessary to predict distribution traits of peaks based on distribution traits of related factors such as vision heterogeneity and so on. We predict the distribution of peaks with parameters of both mean and standard deviation, which provides the confident intervals and robust predictions of peaks. Besides, we validate the peak model of via the Yuyuan Incident, a real case in China (2014), and the model works well in explaining the dynamics and predicting the peak of real case.

  2. Neuroscience imaging enabled by new highly tunable and high peak power femtosecond lasers

    Science.gov (United States)

    Hakulinen, T.; Klein, J.

    2017-02-01

    Neuroscience applications benefit from recent developments in industrial femtosecond laser technology. New laser sources provide several megawatts of peak power at wavelength of 1040 nm, which enables simultaneous optogenetics photoactivation of tens or even hundreds of neurons using red shifted opsins. Another recent imaging trend is to move towards longer wavelengths, which would enable access to deeper layers of tissue due to lower scattering and lower absorption in the tissue. Femtosecond lasers pumping a non-collinear optical parametric amplifier (NOPA) enable the access to longer wavelengths with high peak powers. High peak powers of >10 MW at 1300 nm and 1700 nm allow effective 3-photon excitation of green and red shifted calcium indicators respectively and access to deeper, sub-cortex layers of the brain. Early results include in vivo detection of spontaneous activity in hippocampus within an intact mouse brain, where neurons express GCaMP6 activated in a 3-photon process at 1320 nm.

  3. Determination of Proper Peaking Time for Ultra Lege detector at Medium Energies

    International Nuclear Information System (INIS)

    Karabidak, S. M.

    2008-01-01

    Reducing count losses and pile-up pulse effects in quantitative and qualitative analysis is necessary for accuracy of analysis. Therefore, the optimum peaking time for particular detector systems is important. For this purpose, pure Se and Zn elements were excited by 59.5 keV γ-rays from a 50 mCi 241 A m annular radioactive source in this study. The characteristic x-rays emitted from pure Se and Zn elements were detected by using an ultra low energy Ge (Ultra-LEGe) detector connecting Tennelec TC 244 spectroscopy amplifier at different peaking time modes. Overall pulse widths were determined by HM 203-7 oscilloscope connecting amplifier. The proper peaking time for ultra low energy germanium detector (Ultra-LEGe) is determined about 4 μs

  4. Analysis of neutron diffraction peak broadening caused by internal stresses in composite materials

    International Nuclear Information System (INIS)

    Todd, R.I.; Borsa, C.; Derby, B.

    1994-01-01

    Neutron diffraction is an essential tool in the study of internal stresses in composite materials. In most work only the peak shifts caused by the related elastic strains are considered, but other valuable information exists in the form of peak shape changes. The conditions under which the pure diffraction profile of the composite (i.e. the profile when all sources of broadening not caused by the residual stresses are removed) represents the probability distribution of the peak shifts corresponding to the strains are examined. It is shown that in these conditions, the pure diffraction profile has no attributes of particle size broadening (and vice versa), thereby providing a test for the validity of results interpreted in this way. The experimental derivation of measured strain distributions in Al 2 O 3 /SiCp composites using neutron diffraction is described. No apparent particle size broadening was detected, demonstrating the validity of the results, which also satisfied other tests for consistency

  5. Measuring saccade peak velocity using a low-frequency sampling rate of 50 Hz.

    Science.gov (United States)

    Wierts, Roel; Janssen, Maurice J A; Kingma, Herman

    2008-12-01

    During the last decades, small head-mounted video eye trackers have been developed in order to record eye movements. Real-time systems-with a low sampling frequency of 50/60 Hz-are used for clinical vestibular practice, but are generally considered not to be suited for measuring fast eye movements. In this paper, it is shown that saccadic eye movements, having an amplitude of at least 5 degrees, can, in good approximation, be considered to be bandwidth limited up to a frequency of 25-30 Hz. Using the Nyquist theorem to reconstruct saccadic eye movement signals at higher temporal resolutions, it is shown that accurate values for saccade peak velocities, recorded at 50 Hz, can be obtained, but saccade peak accelerations and decelerations cannot. In conclusion, video eye trackers sampling at 50/60 Hz are appropriate for detecting the clinical relevant saccade peak velocities in contrast to what has been stated up till now.

  6. Free-space optical communications with peak and average constraints: High SNR capacity approximation

    KAUST Repository

    Chaaban, Anas

    2015-09-07

    The capacity of the intensity-modulation direct-detection (IM-DD) free-space optical channel with both average and peak intensity constraints is studied. A new capacity lower bound is derived by using a truncated-Gaussian input distribution. Numerical evaluation shows that this capacity lower bound is nearly tight at high signal-to-noise ratio (SNR), while it is shown analytically that the gap to capacity upper bounds is a small constant at high SNR. In particular, the gap to the high-SNR asymptotic capacity of the channel under either a peak or an average constraint is small. This leads to a simple approximation of the high SNR capacity. Additionally, a new capacity upper bound is derived using sphere-packing arguments. This bound is tight at high SNR for a channel with a dominant peak constraint.

  7. Use of an iterative convolution approach for qualitative and quantitative peak analysis in low resolution gamma-ray spectra

    International Nuclear Information System (INIS)

    Gardner, Robin P.; Ai Xianyun; Peeples, Cody R.; Wang, Jiaxin; Lee, Kyoung; Peeples, Johanna L.; Calderon, Adan

    2011-01-01

    In many applications, low resolution gamma-ray spectrometers, such as sodium iodide scintillation detectors, are widely used primarily due to their relatively low cost and high detection efficiency. There is widespread interest in improved methods for analyzing spectral data acquired with such devices, using inverse analysis. Peak means and peak areas in gamma- and X-ray spectra are needed for both qualitative and quantitative analysis. This paper introduces the PEAKSI code package that was developed at the Center for Engineering Applications of Radioisotopes (CEAR). The basic approach described here is to use accurate forward models and iterative convolution instead of direct deconvolution. Rather than smoothing and differentiation a combination of linear regression and non-linear searching is used to minimize the reduced chi-square, since this approach retains the capability of establishing uncertainties in the estimated peak parameters. The PEAKSI package uses a Levenberg-Marquardt (LM) non-linear search method combined with multiple linear regression (MLR) to minimize the reduced chi-square value for fitting single or multiple overlapping peaks to determine peak parameters, including peak means, peak standard deviations or full width at half maximum (FWHM), net peak counts, and background counts of peaks in experimental gamma-ray spectra. This approach maintains the natural error structure so that parameter uncertainties can be estimated. The plan is to release this code to the public in the near future.

  8. Assessing peak aerobic capacity in Dutch law enforcement officers

    Directory of Open Access Journals (Sweden)

    Harriet Wittink

    2015-06-01

    Full Text Available Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report normative absolute and relative VO2peak values of a sample of law enforcement officers in the Netherlands. Material and Methods: The peak rate of oxygen consumption (ml×kg–1×min–1 was measured using a maximal incremental bicycle test in 1530 subjects, including 1068 male and 461 female police officers. Validity of the prediction equations for groups was assessed by comparing predicted VO2peak with measured VO2peak using paired t-tests. For individual differences limits of agreement (LoA were calculated. Equations were considered valid for individuals when the difference between measured and predicted VO2peak did not exceed ±1 metabolic equivalent (MET in 95% of individuals. Results: None of the equations met the validity criterion of 95% of individuals having ±1 MET difference or less than the measured value. Limits of agreement (LoAs were large in all predictions. At the individual level, none of the equations were valid predictors of VO2peak (ml×kg–1×min–1. Normative values for Dutch law enforcement officers were presented. Conclusions: Substantial differences between measured and predicted VO2peak (ml×kg–1×min–1 were found. Most tested equations were invalid predictors of VO2peak at group level and all were invalid at individual levels.

  9. Asymmetry of characteristic X-ray peaks obtained by a Si(Li) detector

    Energy Technology Data Exchange (ETDEWEB)

    Visnovezky, Claudia [Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Ciudad Universitaria, 5000, Cordoba (Argentina)], E-mail: cavy3@hotmail.com; Limandri, Silvina [Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Ciudad Universitaria, 5000, Cordoba (Argentina)], E-mail: silvilimandri@hotmail.com; Canafoglia, Maria Elena [Centro de Investigacion y Desarrollo en Ciencias Aplicadas Dr. Jorge Ronco, Calle 47 No 257, 1900 La Plata, Argentina, Facultad de Ciencias Exactas y Facultad de Ingenieria de la UNLP, La Plata (Argentina); Bonetto, Rita [Centro de Investigacion y Desarrollo en Ciencias Aplicadas Dr. Jorge Ronco, Calle 47 No 257, 1900 La Plata, Argentina, Facultad de Ciencias Exactas y Facultad de Ingenieria de la UNLP, La Plata (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas de la Republica Argentina (Argentina)], E-mail: bonetto@quimica.unlp.edu.ar; Trincavelli, Jorge [Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Ciudad Universitaria, 5000, Cordoba (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas de la Republica Argentina (Argentina)], E-mail: jorge@quechua.fis.uncor.edu

    2007-05-15

    The asymmetry of the characteristic X-ray peaks obtained using a Si(Li) detector is mainly due to incomplete charge collection. Impurities and defects in the crystalline structure of Si can act as 'traps' for holes and electrons in their trip toward the detector electrodes. Therefore, the collected charge, and consequently the detected energy, is smaller than the expected one. The global effect is that peaks may present a 'tail' toward the low energy side. This phenomenon is more important for low energies (lower than 2.3 keV, in the case of the detector characterized). In this work, the parameters related to peak asymmetry were studied, allowing a better understanding of the trapping process mentioned above. For this purpose, spectra from mono- and multi-element samples were collected for elements with atomic number between 7 and 20. In order to describe the shape of the characteristic K peaks as a function of its energy, an asymmetric correction to a Gaussian function was proposed. Spectra were obtained by electron probe microanalysis for incidence energies between 5 and 25 keV using an energy dispersive spectrometer equipped with an ultra-thin window Si(Li) detector. It was observed that the area corresponding to the asymmetric correction exhibits an energy dependence similar to that of the mass absorption coefficient of the detector material. In addition, other two spectrometers were used to investigate the dependence of tailing on the detection system. When two spectrometers with the same kind of detector and different pulse processors were compared, peaks were more asymmetric for lower peaking time values. When two different detectors were used, differences were even more important.

  10. Constraining the shape of the CMB: A peak-by-peak analysis

    International Nuclear Information System (INIS)

    Oedman, Carolina J.; Hobson, Michael P.; Lasenby, Anthony N.; Melchiorri, Alessandro

    2003-01-01

    The recent measurements of the power spectrum of cosmic microwave background anisotropies are consistent with the simplest inflationary scenario and big bang nucleosynthesis constraints. However, these results rely on the assumption of a class of models based on primordial adiabatic perturbations, cold dark matter and a cosmological constant. In this paper we investigate the need for deviations from the Λ-CDM scenario by first characterizing the spectrum using a phenomenological function in a 15 dimensional parameter space. Using a Monte Carlo Markov chain approach to Bayesian inference and a low curvature model template we then check for the presence of new physics and/or systematics in the CMB data. We find an almost perfect consistency between the phenomenological fits and the standard Λ-CDM models. The curvature of the secondary peaks is weakly constrained by the present data, but they are well located. The improved spectral resolution expected from future satellite experiments is warranted for a definitive test of the scenario

  11. Limitations of middle cerebral artery peak systolic velocity in the ...

    African Journals Online (AJOL)

    We present a case of a mother with severe pre-eclampsia at 32 weeks' gestation and non-immune fetal hydrops without obvious cause. Since the. MCA peak systolic velocity (PSV) was ... Limitations of middle cerebral artery peak systolic velocity .... [7] found MCA PSV of value in 9 women with chronic abruption, but in 5.

  12. Daily Nigerian peak load forecasting using artificial neural network ...

    African Journals Online (AJOL)

    A daily peak load forecasting technique that uses artificial neural network with seasonal indices is presented in this paper. A neural network of relatively smaller size than the main prediction network is used to predict the daily peak load for a period of one year over which the actual daily load data are available using one ...

  13. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  14. Quality Assurance in the Determination of Overlapping Peak Areas

    DEFF Research Database (Denmark)

    Christensen, L.H.; Heydorn, K.

    1987-01-01

    The ability of different computer programs to yield accurate peak areas in statistical control in the case of partially overlapping photopeaks has been tested by the Analysis of Precision. A modified Covell method, two commercially available peak-fitting programs from Nuclear Data and Ortec, and ...

  15. Peak effect in surface resistance at microwave frequencies in Dy ...

    Indian Academy of Sciences (India)

    In the measurements at both frequencies the induced microwave current was always less than the critical current of the films. The reason for observation of this peak effect in these films has been explained in our earlier publication [5]. Comparing figures 1 and 2, it is observed that the peaks in sample S1 are broader and.

  16. Peak heart rate decreases with increasing severity of acute hypoxia

    DEFF Research Database (Denmark)

    Lundby, C; Araoz, M; Van Hall, Gerrit

    2001-01-01

    , 459, and 404 mmHg) in a hypobaric chamber and while breathing 9% O(2) in N(2). These conditions were equivalent to altitudes of 3300, 4300, 5300, and 6300 m above sea level, respectively. At 4300 m, maximal exercise was also repeated after 4 and 8 h. Peak heart rate (HR) decreased from 191 (182......-202) (mean and range) at sea level to 189 (179-200), 182 (172-189), 175 (166-183), and 165 (162-169) in the acute hypoxic conditions. Peak HR did not decrease further after 4 and 8 h at 4300 m compared to the acute exposure at this altitude. Between barometric pressures of 518 and 355 mmHg (approximately...... 3300 and 6300 m), peak HR decreased linearly: peak HR(hypobaria) = peak HR(sea level) - 0.135 x [hypobaria(3100) - hypobaria (mmHg)]; or peak HR(altitude) = peak HR(sea level) - 0.15 x (altitude - 3100 m). This corresponds to approximately 1-beat x min(-1) reduction in peak HR for every 7-mmHg decrease...

  17. Determination of gaussian peaks in gamma spectra by iterative regression

    International Nuclear Information System (INIS)

    Nordemann, D.J.R.

    1987-05-01

    The parameters of the peaks in gamma-ray spectra are determined by a simple iterative regression method. For each peak, the parameters are associated with a gaussian curve (3 parameters) located above a linear continuum (2 parameters). This method may produces the complete result of the calculation of statistical uncertainties and an accuracy higher than others methods. (author) [pt

  18. Peak Expiratory Flow Rate In Cigarette Smokers | Ukoli | Highland ...

    African Journals Online (AJOL)

    Objective: To compare lung function between smokers and non-smokers using Peak Expiratory Flow Rate (PEFR). Methods: This study examines the peak expiratory flow rate (PEFR) of three hundred and forty cigarette smokers, age and sex-matched with PEFR of equal number of non-smokers. Results: The mean PEFR of ...

  19. Psychological Preparation for Peak Performance in Sports Competition

    Science.gov (United States)

    Ohuruogu, Ben; Jonathan, Ugwuanyi I.; Ikechukwu, Ugwu Jude

    2016-01-01

    This paper attempts to make an overview of various techniques, sport psychologist adopt in psychological preparation of athletes for peak performance. To attain peak performance in sports competitions, coaches and athletes should not base their prospect on physical training on sport skills alone rather should integrate both the mental and physical…

  20. Identification of peaks in multidimensional coincidence {gamma}-ray spectra

    Energy Technology Data Exchange (ETDEWEB)

    Morhac, Miroslav E-mail: fyzimiro@savba.sk; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-03-21

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector {gamma}-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges.

  1. Identification of peaks in multidimensional coincidence γ-ray spectra

    International Nuclear Information System (INIS)

    Morhac, Miroslav; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-01-01

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector γ-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges

  2. A new automatic fixed peak technology of microcontroller

    International Nuclear Information System (INIS)

    Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng

    1999-01-01

    The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources

  3. Impact of Smart Grid Technologies on Peak Load to 2050

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    The IEA's Smart Grids Technology Roadmap identified five global trends that could be effectively addressed by deploying smart grids. These are: increasing peak load (the maximum power that the grid delivers during peak hours), rising electricity consumption, electrification of transport, deployment of variable generation technologies (e.g. wind and solar PV) and ageing infrastructure. Along with this roadmap, a new working paper -- Impact of Smart Grid Technologies on Peak Load to 2050 -- develops a methodology to estimate the evolution of peak load until 2050. It also analyses the impact of smart grid technologies in reducing peak load for four key regions; OECD North America, OECD Europe, OECD Pacific and China. This working paper is a first IEA effort in an evolving modelling process of smart grids that is considering demand response in residential and commercial sectors as well as the integration of electric vehicles.

  4. Decomposition and correction overlapping peaks of LIBS using an error compensation method combined with curve fitting.

    Science.gov (United States)

    Tan, Bing; Huang, Min; Zhu, Qibing; Guo, Ya; Qin, Jianwei

    2017-09-01

    The laser induced breakdown spectroscopy (LIBS) technique is an effective method to detect material composition by obtaining the plasma emission spectrum. The overlapping peaks in the spectrum are a fundamental problem in the qualitative and quantitative analysis of LIBS. Based on a curve fitting method, this paper studies an error compensation method to achieve the decomposition and correction of overlapping peaks. The vital step is that the fitting residual is fed back to the overlapping peaks and performs multiple curve fitting processes to obtain a lower residual result. For the quantitative experiments of Cu, the Cu-Fe overlapping peaks in the range of 321-327 nm obtained from the LIBS spectrum of five different concentrations of CuSO 4 ·5H 2 O solution were decomposed and corrected using curve fitting and error compensation methods. Compared with the curve fitting method, the error compensation reduced the fitting residual about 18.12-32.64% and improved the correlation about 0.86-1.82%. Then, the calibration curve between the intensity and concentration of the Cu was established. It can be seen that the error compensation method exhibits a higher linear correlation between the intensity and concentration of Cu, which can be applied to the decomposition and correction of overlapping peaks in the LIBS spectrum.

  5. On Some Statistical Properties of GRBs with Measured Redshifts Having Peaks in Optical Light Curves

    Directory of Open Access Journals (Sweden)

    Grigorii Beskin

    2013-01-01

    Full Text Available We studied the subset of optical light curves of gamma-ray bursts with measured redshifts and well-sampled R band data that have clearly detected peaks. Among 43 such events, 11 are promptoptical peaks (P, coincident with gamma-ray activity, 22 are purely afterglows (A, and 10 more carrythe signatures of an underlying activity (A(U. We studied pair correlations of their gamma-ray andoptical parameters, e.g. total energetics, peak optical luminosities, and durations. The main outcomeof our study is the detection of source frame correlations between both optical peak luminosity and total energy and the redshift for classes A and A(U, and the absence of such a correlation for class Pevents. This result seems to provide evidence of the cosmological evolution of a medium around the burst defining class A and A(U energetics, and the absence of cosmological evolution of the internal properties of GRB engines. We also discuss some other prominent correlations.

  6. Quantification of Protein Biomarker Using SERS Nano-Stress Sensing with Peak Intensity Ratiometry

    Science.gov (United States)

    Goh, Douglas; Kong, Kien Voon; Jayakumar, Perumal; Gong, Tianxun; Dinish, U. S.; Olivo, Malini

    We report a surface enhanced Raman spectroscopy (SERS) ratiometry method based on peak intensity coupled in a nano-stress sensing platform to detect and quantify biological molecules. Herein, we employed an antibody-conjugated p-aminothiophenol (ATP) functionalized on a bimetallic-film-over-nanosphere (BMFON) substrate as a sensitive SERS platform to detect human haptoglobin (Hp) protein, which is an acute phase protein and a biomarker for various cancers. Correlation between change in the ATP spectral characteristics and concentration of Hp protein was established by examining the peak intensity ratio at 1572cm-1 and 1592cm-1 that reflects the degree of stress experienced by the aromatic ring of ATP during Hp protein-antibody interaction. Development of this platform shows the potential in developing a low-cost and sensitive SERS sensor for the pre-screening of various biomarkers.

  7. Peak broadening in paper chromatography and related techniques : III. Peak broadening in thin-layer chromatography on cellulose powder

    NARCIS (Netherlands)

    Ligny, C.L. de; Remijnse, A.G.

    1968-01-01

    The mechanism of peak broadening in thin-layer chromatography on cellulose powder was investigated by comparing the peak widths obtained in chromatography with those caused only by diffusion in the cellulose powder, for a set of amino acids of widely differing RF values and six kinds of cellulose

  8. On the stationarity of annual flood peaks in the continental United States during the 20th century

    Science.gov (United States)

    Villarini, Gabriele; Serinaldi, Francesco; Smith, James A.; Krajewski, Witold F.

    2009-08-01

    Annual peak discharge records from 50 stations in the continental United States with at least 100 years of record are used to investigate stationarity of flood peaks during the 20th century. We examine temporal trends in flood peaks and abrupt changes in the mean and/or variance of flood peak distributions. Change point analysis for detecting abrupt changes in flood distributions is performed using the nonparametric Pettitt test. Two nonparametric (Mann-Kendall and Spearman) tests and one parametric (Pearson) test are used to detect the presence of temporal trends. Generalized additive models for location, scale, and shape (GAMLSS) are also used to parametrically model the annual peak data, exploiting their flexibility to account for abrupt changes and temporal trends in the parameters of the distribution functions. Additionally, the presence of long-term persistence is investigated through estimation of the Hurst exponent, and an alternative interpretation of the results in terms of long-term persistence is provided. Many of the drainage basins represented in this study have been affected by regulation through systems of reservoirs, and all of the drainage basins have experienced significant land use changes during the 20th century. Despite the profound changes that have occurred to drainage basins throughout the continental United States and the recognition that elements of the hydrologic cycle are being altered by human-induced climate change, it is easier to proclaim the demise of stationarity of flood peaks than to prove it through analyses of annual flood peak data.

  9. System dynamics model of Hubbert Peak for China's oil

    International Nuclear Information System (INIS)

    Tao Zaipu; Li Mingyu

    2007-01-01

    American geophysicist M. King Hubbert in 1956 first introduced a logistic equation to estimate the peak and lifetime production for oil of USA. Since then, a fierce debate ensued on the so-called Hubbert Peak, including also its methodology. This paper proposes to use the generic STELLA model to simulate Hubbert Peak, particularly for the Chinese oil production. This model is demonstrated as being robust. We used three scenarios to estimate the Chinese oil peak: according to scenario 1 of this model, the Hubbert Peak for China's crude oil production appears to be in 2019 with a value of 199.5 million tonnes, which is about 1.1 times the 2005 output. Before the peak comes, Chinese oil output will grow by about 1-2% annually, after the peak, however, the output will fall. By 2040, the annual production of Chinese crude oil would be equivalent to the level of 1990. During the coming 20 years, the crude oil demand of China will probably grow at the rate of 2-3% annually, and the gap between domestic supply and total demand may be more than half of this demand

  10. Core fueling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1994-06-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. We show that with radially ''hollow'' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles which are peaked off-axis. The fueling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fueling does not require MeV particle energy. Even with beam voltages of ∼200 keV, however, exceptionally good particle confinement, τ p much-gt τ E is required to achieve net electrical power generation. In system with no power production requirement (e.g., neutron sources) neutral beam fueling should be capable of producing peaked density profiles in devices as large as ITER. Fueling systems with low energy cost per particle (such as cryogenic pellet injection) must be used in power producing tokamaks when τ p ∼ τ E . Simulations with pellet injection speeds of 7 km/sec show the peaking factor, n eo /left-angle n e right-angle, approaching 2

  11. Core fuelling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1995-01-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. It is shown that with radially 'hollow' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles that are peaked off-axis. The fuelling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fuelling does not require Megavolt particle energies. Even with beam voltages of ∼ 200 keV, however, exceptionally good particle confinement is needed to achieve net electrical power generation. The required ratio of particle to thermal diffusivities is an order of magnitude outside the range reported for tokamaks. In a system with no power production requirement (e.g., neutron sources) neutral beam fuelling should be capable of producing peaked density profiles in devices as large as ITER. Fuelling systems with low energy cost per particle - such as cryogenic pellet injection - must be used in power producing tokamaks when τ P ∼ τ E . Simulations with pellet injection speeds of 7 km/s show that the peaking factor, n e0 / e >, approaches 2. (author). 65 refs, 8 figs

  12. Peak loads and network investments in sustainable energy transitions

    Energy Technology Data Exchange (ETDEWEB)

    Blokhuis, Erik, E-mail: e.g.j.blokhuis@tue.nl [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Brouwers, Bart [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Putten, Eric van der [Endinet, Gas and Electricity Network Operations, P.O. Box 2005, 5600CA Eindhoven (Netherlands); Schaefer, Wim [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands)

    2011-10-15

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: > Sustainable energy transitions can result in major electricity peak load increases. > Introduction of heat pumps and electrical vehicles requires network expansion. > Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. > The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. > Future policy choices should be made from the viewpoint of the integral energy system.

  13. Peak loads and network investments in sustainable energy transitions

    International Nuclear Information System (INIS)

    Blokhuis, Erik; Brouwers, Bart; Putten, Eric van der; Schaefer, Wim

    2011-01-01

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: → Sustainable energy transitions can result in major electricity peak load increases. → Introduction of heat pumps and electrical vehicles requires network expansion. → Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. → The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. → Future policy choices should be made from the viewpoint of the integral energy system.

  14. Relaxation peak near 200 K in NiTi alloy

    Science.gov (United States)

    Zhu, J. S.; Schaller, R.; Benoit, W.

    1989-10-01

    Internal friction (IF), frequency ( f), electrical resistance ( R) and zero point movement of the torsion pendulum (ɛ) have been measured in near equi-atomic NiTi alloy in order to clarify the mechanism for the relaxation peak near 200 K. The height of the relaxation peak decreases successively with thermal cycling and settles down to a lower stable value in running 15 cycles. However, the electrical resistance of the sample shows a variation in contrast with the internal friction. Both of them will return to the initial state after a single annealing at 773 K for 1 h. The probable mechanism of this relaxation peak was discussed.

  15. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of the three volume report is a final report appendix with information on the National Energy Peak Leveling Program (NEPLP).

  16. The environmental impacts of peaking at hydropower plants

    International Nuclear Information System (INIS)

    Halleraker, Jo Halvard

    2001-01-01

    A recent energy act in Norway allows hydropower plants to be operated so that hydro peaking is permitted. However, it is uncertain how fish react to the variations in discharge and depth that follow hydro peaking. SINTEF Energy Research is cooperating with other research institutions to investigate the consequences of these variations on the biota. Among the research tools is an aqua channel which is an indoor laboratory flume where fish behaviour can be studied in detail. It has been constructed to provide the hydropower industry and public authorities with means of better determining the effects of hydro peaking. (author)

  17. Peak center and area estimation in gamma-ray energy spectra using a Mexican-hat wavelet

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Zhang-jian; Chen, Chuan; Luo, Jun-song; Xie, Xing-hong; Ge, Liang-quan [School of Information Science & Technology, Chengdu University of Technology, Chengdu (China); Wu, Qi-fan [Department of Engineering Physics, Tsinghua University, Beijing (China)

    2017-06-21

    Wavelet analysis is commonly used to detect and localize peaks within a signal, such as in Gamma-ray energy spectra. This paper presents a peak area estimation method based on a new wavelet analysis. Another Mexican Hat Wavelet Signal (MHWS) named after the new MHWS is obtained with the convolution of a Gaussian signal and a MHWS. During the transform, the overlapping background on the Gaussian signal caused by Compton scattering can be subtracted because the impulse response function MHWS is a second-order smooth function, and the amplitude of the maximum within the new MHWS is the net height corresponding to the Gaussian signal height, which can be used to estimate the Gaussian peak area. Moreover, the zero-crossing points within the new MHWS contain the information of the Gaussian variance whose valve should be obtained when the Gaussian peak area is estimated. Further, the new MHWS center is also the Gaussian peak center. With that distinguishing feature, the channel address of a characteristic peak center can be accurately obtained which is very useful in the stabilization of airborne Gamma energy spectra. In particular, a method for determining the correction coefficient k is given, where the peak area is calculated inaccurately because the value of the scale factor in wavelet transform is too small. The simulation and practical applications show the feasibility of the proposed peak center and area estimation method.

  18. The peak of oil production-Timings and market recognition

    International Nuclear Information System (INIS)

    Almeida, Pedro de; Silva, Pedro D.

    2009-01-01

    Energy is essential for present societies. In particular, transportation systems depend on petroleum-based fuels. That world oil production is set to pass a peak is now a reasonably accepted concept, although its date is far from consensual. In this work, we analyze the true expectations of the oil market participants about the future availability of this fundamental energy source. We study the evolution through time of the curves of crude oil futures prices, and we conclude that the market participants, among them the crude oil producers, already expect a near-term peak of oil production. This agrees with many technical predictions for the date of peak production, including our own, that point to peak dates around the end of the present decade. If this scenario is confirmed, it can cause serious social and economical problems because societies will have little time to perform the necessary adjustments

  19. Reducing Electricity Demand Peaks by Scheduling Home Appliances Usage

    DEFF Research Database (Denmark)

    Rossello Busquet, Ana; Kardaras, Georgios; Iversen, Villy Bæk

    2011-01-01

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users’ appliances...... should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power...... consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions...

  20. Advancements of ultra-high peak power laser diode arrays

    Science.gov (United States)

    Crawford, D.; Thiagarajan, P.; Goings, J.; Caliva, B.; Smith, S.; Walker, R.

    2018-02-01

    Enhancements of laser diode epitaxy in conjunction with process and packaging improvements have led to the availability of 1cm bars capable of over 500W peak power at near-infrared wavelengths (770nm to 1100nm). Advances in cooler design allow for multi-bar stacks with bar-to-bar pitches as low as 350μm and a scalable package architecture enabled a single diode assembly with total peak powers of over 1MegaWatt of peak power. With the addition of micro-optics, overall array brightness greater than 10kW/cm2 was achieved. Performance metrics of barbased diode lasers specifically engineered for high peak power and high brightness at wavelengths and pulse conditions commonly used to pump a variety of fiber and solid-state materials are presented.

  1. Energy and public health: the challenge of peak petroleum.

    Science.gov (United States)

    Frumkin, Howard; Hess, Jeremy; Vindigni, Stephen

    2009-01-01

    Petroleum is a unique and essential energy source, used as the principal fuel for transportation, in producing many chemicals, and for numerous other purposes. Global petroleum production is expected to reach a maximum in the near future and to decline thereafter, a phenomenon known as "peak petroleum." This article reviews petroleum geology and uses, describes the phenomenon of peak petroleum, and reviews the scientific literature on the timing of this transition. It then discusses how peak petroleum may affect public health and health care, by reference to four areas: medical supplies and equipment, transportation, energy generation, and food production. Finally, it suggests strategies for anticipating and preparing for peak petroleum, both general public health preparedness strategies and actions specific to the four expected health system impacts.

  2. OECD : Euroopa peaks laenuraha odava hoidma / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2002-01-01

    USA majanduse kiire toibumine võib varsti tuua laenuintresside tõusu, Euroopa Keskpank peaks vähemalt aasta lõpuni ootama ja laskma kasvul juurduda. Diagramm: OECD tõstis majanduskasvu prognoosi. Maksukoormus

  3. Hubbert's Oil Peak Revisited by a Simulation Model

    International Nuclear Information System (INIS)

    Giraud, P.N.; Sutter, A.; Denis, T.; Leonard, C.

    2010-01-01

    As conventional oil reserves are declining, the debate on the oil production peak has become a burning issue. An increasing number of papers refer to Hubbert's peak oil theory to forecast the date of the production peak, both at regional and world levels. However, in our views, this theory lacks micro-economic foundations. Notably, it does not assume that exploration and production decisions in the oil industry depend on market prices. In an attempt to overcome these shortcomings, we have built an adaptative model, accounting for the behavior of one agent, standing for the competitive exploration-production industry, subjected to incomplete but improving information on the remaining reserves. Our work yields challenging results on the reasons for an Hubbert type peak oil, lying mainly 'above the ground', both at regional and world levels, and on the shape of the production and marginal cost trajectories. (authors)

  4. Peak globalization. Climate change, oil depletion and global trade

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Fred [Department of Economics, Drew University, Madison, NJ 07940 (United States)

    2009-12-15

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  5. Peak thrust operation of linear induction machines from parameter identification

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.; Eastham, T.R.; Dawson, G.E. [Queen`s Univ., Kingston, Ontario (Canada). Dept. of Electrical and Computer Engineering

    1995-12-31

    Various control strategies are being used to achieve high performance operation of linear drives. To maintain minimum volume and weight of the power supply unit on board the transportation vehicle, peak thrust per unit current operation is a desirable objective. True peak thrust per unit current through slip control is difficult to achieve because the parameters of linear induction machines vary during normal operation. This paper first develops a peak thrust per unit current control law based on the per-phase equivalent circuit for linear induction machines. The algorithm for identification of the variable parameters in induction machines is then presented. Application to an operational linear induction machine (LIM) demonstrates the utility of this algorithm. The control strategy is then simulated, based on an operational transit LIM, to show the capability of achieving true peak thrust operation for linear induction machines.

  6. Brian Eno Hollandi Festivali peakülaliseks

    Index Scriptorium Estoniae

    1999-01-01

    Inglise helilooja, videokunstnik ja muusikaprodutsent Brian Eno on 5.-26. juunini Amsterdamis toimuva avangardse Hollandi Festivali peakülaline, kelle videoinstallatsioon seatakse üles Stedelijki Muuseumis. Festivali programmist

  7. FHWA operations support : port peak pricing program evaluation

    Science.gov (United States)

    2009-01-01

    This report evaluates the applicability, Federal policy implications, and possible public and private sector roles related to peak pricing strategies at ports and intermodal facilities in the U.S. A number of ports and intermodal terminals are consid...

  8. Peak globalization. Climate change, oil depletion and global trade

    International Nuclear Information System (INIS)

    Curtis, Fred

    2009-01-01

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  9. The simple method of determination peaks areas in multiplets

    International Nuclear Information System (INIS)

    Loska, L.; Ptasinski, J.

    1991-01-01

    Semiconductor germanium detectors used in γ-spectrometry give spectra with well-separated peaks. However, in some cases, energies of γ-lines are too near, to produce resolved and undisturbed peaks. Then, there is a necessity to perform a mathematical separation. The method proposed here is based on the assumption, that areas of peaks composing the analysed multiplet are proportional to their heights. The method can be applied for any number of interfering peaks, providing, that the function of the background under the multiplet is accurately determined. The results of testing calculations performed on a simulated spectrum are given. The method works successfully in a computer program used for neutron activation analysis data processing. (author). 9 refs, 1 fig, 1 tab

  10. Heavy Ion Testing at the Galactic Cosmic Ray Energy Peak

    Science.gov (United States)

    Pellish, Jonathan A.; Xapsos, M. A.; LaBel, K. A.; Marshall, P. W.; Heidel, D. F.; Rodbell, K. P.; Hakey, M. C.; Dodd, P. E.; Shaneyfelt, M. R.; Schwank, J. R.; hide

    2009-01-01

    A 1 GeV/u Fe-56 Ion beam allows for true 90 deg. tilt irradiations of various microelectronic components and reveals relevant upset trends for an abundant element at the galactic cosmic ray (GCR) flux-energy peak.

  11. Bedrock Geologic Map of the Jay Peak, VT Quadrangle

    Data.gov (United States)

    Vermont Center for Geographic Information — Digital data from VG99-1 Compilation bedrock geologic map of the Jay Peak quadrangle, Compiled by B. Doolan, 1999: VGS Open-File Report VG99-1, 1 plate, scale...

  12. Neutron-induced peaks in Ge detectors from evaporation neutrons

    International Nuclear Information System (INIS)

    Gete, E.; Measday, D.F.; Moftah, B.A.; Saliba, M.A.; Stocki, T.J.

    1997-01-01

    We have studied the peak shapes at 596 and 691 keV resulting from fast neutron interactions inside germanium detectors. We have used neutrons from a 252 Cf source, as well as from the 28 Si(μ - , nν), and 209 Bi(π - , xn) reactions to compare the peaks and to check for a dependence of peak shape on the incoming neutron energy. In our investigation, no difference between these three measurements has been observed. In a comparison of these peak shapes with other studies, we found similar results to ours except for those measurements using monoenergetic neutrons in which a significant variation with neutron energy has been observed. (orig.)

  13. Desert Peak East Enhanced Geothermal Systems (EGS) Project

    Energy Technology Data Exchange (ETDEWEB)

    Zemach, Ezra [Ormat Technologies Inc., Reno, NV (United States); Drakos, Peter [Ormat Technologies Inc., Reno, NV (United States); Spielman, Paul [Ormat Technologies Inc., Reno, NV (United States); Akerley, John [Ormat Technologies Inc., Reno, NV (United States)

    2013-09-30

    This manuscript is a draft to replaced with a final version at a later date TBD. A summary of activities pertaining to the Desert Peak EGS project including the planning and resulting stimulation activities.

  14. Effects of equipment and technique on peak flow measurements

    Directory of Open Access Journals (Sweden)

    O'Driscoll B Ronan

    2006-06-01

    Full Text Available Abstract Background Different lung function equipment and different respiratory manoeuvres may produce different Peak Expiratory Flow (PEF results. Although the PEF is the most common lung function test, there have been few studies of these effects and no previous study has evaluated both factors in a single group of patients. Methods We studied 36 subjects (PEF range 80–570 l/min. All patients recorded PEF measurements using a short rapid expiration following maximal inspiration (PEF technique or a forced maximal expiration to residual volume (FVC technique. Measurements were made using a Wright's peak flow meter, a turbine spirometer and a Fleisch pneumotachograph spirometer. Results The mean PEF was 8.7% higher when the PEF technique was used (compared with FVC technique, p Conclusion Peak flow measurements are affected by the instruction given and by the device and Peak Flow scale used. Patient management decisions should not be based on PEF measurement made on different instruments.

  15. Periodic transmission peak splitting in one dimensional disordered photonic structures

    Science.gov (United States)

    Kriegel, Ilka; Scotognella, Francesco

    2016-08-01

    In the present paper we present ways to modulate the periodic transmission peaks arising in disordered one dimensional photonic structures with hundreds of layers. Disordered structures in which the optical length nd (n is the refractive index and d the layer thickness) is the same for each layer show regular peaks in their transmission spectra. A proper variation of the optical length of the layers leads to a splitting of the transmission peaks. Notably, the variation of the occurrence of high and low refractive index layers, gives a tool to tune also the width of the peaks. These results are of highest interest for optical application, such as light filtering, where the manifold of parameters allows a precise design of the spectral transmission ranges.

  16. Effects of peatland drainage management on peak flows

    OpenAIRE

    C. E. Ballard; N. McIntyre; H. S. Wheater

    2011-01-01

    Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrologica...

  17. Peak-load management, the security of supply warranty

    International Nuclear Information System (INIS)

    2010-01-01

    Even if France owns an efficient power generation park, largely exporting and clean (90% with no CO 2 emission), it encounters some difficulties during peak-load periods. The successive peak power demand records which are recorded each year represent as many alerts about a possible collapse of the power system. In order to warrant the electricity supply, the present day regulatory framework must be changed to allow the industrial players to carry out the necessary investments

  18. Improvements to science operations at Kitt Peak National Observatory

    Science.gov (United States)

    Bohannan, Bruce

    1998-07-01

    In recent years Kitt Peak National Observatory has undertaken a number of innovative projects to optimize science operations with the suite of telescopes we operate on Kitt Peak, Arizona. Changing scientific requirements and expectations of our users, evolving technology and declining budgets have motivated the changes. The operations improvements have included telescope performance enhancements--with the focus on the Mayall 4-m--modes of observing and scheduling, telescope control and observing systems, planning and communication, and data archiving.

  19. Several peaks of total current in Trichel pulse

    International Nuclear Information System (INIS)

    Bolotov, O.; Golota, V.; Kadolin, B.; Mankovskyi, S.; Ostroushko, V.; Pashchenko, I.; Taran, G.; Zavada, L.

    2015-01-01

    The numerical simulations of negative corona at constant voltage in Trichel pulse mode are carried out in assumptions of presence and absence of photoemission from cathode. In absence of photoemission two peaks of total current or the step before the main peak were obtained for very small values of ion-electron emission coefficient. In presence of photoemission there were observed several maximums, connected with instability development of the process based on radiation of photons, photoemission, and avalanche multiplication

  20. Converter for Measurement of non-sinusoidal current peak value

    DEFF Research Database (Denmark)

    Butvin, P.; Nielsen, Otto V; Brauer, Peter

    1997-01-01

    A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current.......A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current....

  1. Modeling the probability distribution of peak discharge for infiltrating hillslopes

    Science.gov (United States)

    Baiamonte, Giorgio; Singh, Vijay P.

    2017-07-01

    Hillslope response plays a fundamental role in the prediction of peak discharge at the basin outlet. The peak discharge for the critical duration of rainfall and its probability distribution are needed for designing urban infrastructure facilities. This study derives the probability distribution, denoted as GABS model, by coupling three models: (1) the Green-Ampt model for computing infiltration, (2) the kinematic wave model for computing discharge hydrograph from the hillslope, and (3) the intensity-duration-frequency (IDF) model for computing design rainfall intensity. The Hortonian mechanism for runoff generation is employed for computing the surface runoff hydrograph. Since the antecedent soil moisture condition (ASMC) significantly affects the rate of infiltration, its effect on the probability distribution of peak discharge is investigated. Application to a watershed in Sicily, Italy, shows that with the increase of probability, the expected effect of ASMC to increase the maximum discharge diminishes. Only for low values of probability, the critical duration of rainfall is influenced by ASMC, whereas its effect on the peak discharge seems to be less for any probability. For a set of parameters, the derived probability distribution of peak discharge seems to be fitted by the gamma distribution well. Finally, an application to a small watershed, with the aim to test the possibility to arrange in advance the rational runoff coefficient tables to be used for the rational method, and a comparison between peak discharges obtained by the GABS model with those measured in an experimental flume for a loamy-sand soil were carried out.

  2. Peak oil: The four stages of a new idea

    Energy Technology Data Exchange (ETDEWEB)

    Bardi, Ugo [Dipartimento di Chimica, Universita di Firenze, Association for the Study of Peak Oil and Gas (ASPO), Polo Scientifico di Sesto Fiorentino, Via della Lastruccia 3, 50019 Sesto Fiorentino (Fi) (Italy)

    2009-03-15

    The present paper reviews the reactions and the path of acceptance of the theory known as ''peak oil''. The theory was proposed for the first time by M.K. Hubbert in the 1950s as a way to describe the production pattern of crude oil. According to Hubbert, the production curve is ''bell shaped'' and approximately symmetric. Hubbert's theory was verified with good approximation for the case of oil production in the United States that peaked in 1971, and is now being applied to the worldwide oil production. It is generally believed that the global peak of oil production (''peak oil'') will take place during the first decade of the 21st century, and some analysts believe that it has already occurred in 2005 or 2006. The theory and its consequences have unpleasant social and economical implications. The present paper is not aimed at assessing the peak date but offers a discussion on the factors that affect the acceptance and the diffusion of the concept of ''peak oil'' with experts and with the general public. The discussion is based on a subdivision of ''four stages of acceptance'', loosely patterned after a sentence by Thomas Huxley. (author)

  3. Peaking of world oil production: Impacts, mitigation, & risk management

    Energy Technology Data Exchange (ETDEWEB)

    Hirsch, R.L. (SAIC); Bezdek, Roger (MISI); Wendling, Robert (MISI)

    2005-02-01

    The peaking of world oil production presents the U.S. and the world with an unprecedented risk management problem. As peaking is approached, liquid fuel prices and price volatility will increase dramatically, and, without timely mitigation, the economic, social, and political costs will be unprecedented. Viable mitigation options exist on both the supply and demand sides, but to have substantial impact, they must be initiated more than a decade in advance of peaking.... The purpose of this analysis was to identify the critical issues surrounding the occurrence and mitigation of world oil production peaking. We simplified many of the complexities in an effort to provide a transparent analysis. Nevertheless, our study is neither simple nor brief. We recognize that when oil prices escalate dramatically, there will be demand and economic impacts that will alter our simplified assumptions. Consideration of those feedbacks will be a daunting task but one that should be undertaken. Our aim in this study is to-- • Summarize the difficulties of oil production forecasting; • Identify the fundamentals that show why world oil production peaking is such a unique challenge; • Show why mitigation will take a decade or more of intense effort; • Examine the potential economic effects of oil peaking; • Describe what might be accomplished under three example mitigation scenarios. • Stimulate serious discussion of the problem, suggest more definitive studies, and engender interest in timely action to mitigate its impacts.

  4. Peak energy consumption and CO2 emissions in China

    International Nuclear Information System (INIS)

    Yuan, Jiahai; Xu, Yan; Hu, Zheng; Zhao, Changhong; Xiong, Minpeng; Guo, Jingsheng

    2014-01-01

    China is in the processes of rapid industrialization and urbanization. Based on the Kaya identity, this paper proposes an analytical framework for various energy scenarios that explicitly simulates China's economic development, with a prospective consideration on the impacts of urbanization and income distribution. With the framework, China's 2050 energy consumption and associated CO 2 reduction scenarios are constructed. Main findings are: (1) energy consumption will peak at 5200–5400 million tons coal equivalent (Mtce) in 2035–2040; (2) CO 2 emissions will peak at 9200–9400 million tons (Mt) in 2030–2035, whilst it can be potentially reduced by 200–300 Mt; (3) China's per capita energy consumption and per capita CO 2 emission are projected to peak at 4 tce and 6.8 t respectively in 2020–2030, soon after China steps into the high income group. - Highlights: • A framework for modeling China's energy and CO 2 emissions is proposed. • Scenarios are constructed based on various assumptions on the driving forces. • Energy consumption will peak in 2035–2040 at 5200–5400 Mtce. • CO 2 emissions will peak in 2030–2035 at about 9300 Mt and be cut by 300 Mt in a cleaner energy path. • Energy consumption and CO 2 emissions per capita will peak soon after China steps into the high income group

  5. Remote Sensing of Black Lakes and Using 810 nm Reflectance Peak for Retrieving Water Quality Parameters of Optically Complex Waters

    Directory of Open Access Journals (Sweden)

    Tiit Kutser

    2016-06-01

    Full Text Available Many lakes in boreal and arctic regions have high concentrations of CDOM (coloured dissolved organic matter. Remote sensing of such lakes is complicated due to very low water leaving signals. There are extreme (black lakes where the water reflectance values are negligible in almost entire visible part of spectrum (400–700 nm due to the absorption by CDOM. In these lakes, the only water-leaving signal detectable by remote sensing sensors occurs as two peaks—near 710 nm and 810 nm. The first peak has been widely used in remote sensing of eutrophic waters for more than two decades. We show on the example of field radiometry data collected in Estonian and Swedish lakes that the height of the 810 nm peak can also be used in retrieving water constituents from remote sensing data. This is important especially in black lakes where the height of the 710 nm peak is still affected by CDOM. We have shown that the 810 nm peak can be used also in remote sensing of a wide variety of lakes. The 810 nm peak is caused by combined effect of slight decrease in absorption by water molecules and backscattering from particulate material in the water. Phytoplankton was the dominant particulate material in most of the studied lakes. Therefore, the height of the 810 peak was in good correlation with all proxies of phytoplankton biomass—chlorophyll-a (R2 = 0.77, total suspended matter (R2 = 0.70, and suspended particulate organic matter (R2 = 0.68. There was no correlation between the peak height and the suspended particulate inorganic matter. Satellite sensors with sufficient spatial and radiometric resolution for mapping lake water quality (Landsat 8 OLI and Sentinel-2 MSI were launched recently. In order to test whether these satellites can capture the 810 nm peak we simulated the spectral performance of these two satellites from field radiometry data. Actual satellite imagery from a black lake was also used to study whether these sensors can detect the peak

  6. Automatic fitting of Gaussian peaks using abductive machine learning

    Science.gov (United States)

    Abdel-Aal, R. E.

    1998-02-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 5.8%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum.

  7. The duration of pubertal growth peak among three skeletal classes

    Directory of Open Access Journals (Sweden)

    Waqar Jeelani

    Full Text Available ABSTRACT Introduction: Pubertal growth peak is closely associated with a rapid increase in mandibular length and offers a wide range of therapeutic modifiability. Objective: The aim of the present study was to determine and compare the mean ages of onset and duration of pubertal growth peak among three skeletal classes. Methods: A retrospective cross-sectional study was conducted using lateral cephalograms of 230 subjects with growth potential (110 males, 120 females. Subjects were categorized into three classes (Class I = 81, Class II = 82, Class III = 67, according to the sagittal relationship established between the maxilla and the mandible. The cervical vertebral maturation stage was recorded by means of Baccetti's method. The mean ages at CS3 and CS4 and the CS3-CS4 age interval were compared between boys and girls and among three skeletal classes. Results: Pubertal growth peak occurred on average four months earlier in girls than boys (p = 0.050. The average duration of pubertal growth peak was 11 months in Class I, seven months in Class II and 17 months in Class III subjects. Interclass differences were highly significant (Cohen's d > 0.08. However, no significant difference was found in the timing of pubertal growth peak onset among three skeletal classes (p = 0.126 in boys, p = 0.262 in girls. Conclusions: Girls enter pubertal growth peak on average four months earlier than boys. Moreover, the duration of pubertal growth peak is on average four months shorter in Class II and six months longer in Class III subjects as compared to Class I subjects.

  8. Peak Operation of Cascaded Hydropower Plants Serving Multiple Provinces

    Directory of Open Access Journals (Sweden)

    Jianjian Shen

    2015-10-01

    Full Text Available The bulk hydropower transmission via trans-provincial and trans-regional power networks in China provides great operational flexibility to dispatch power resources between multiple power grids. This is very beneficial to alleviate the tremendous peak load pressure of most provincial power grids. This study places the focus on peak operations of cascaded hydropower plants serving multiple provinces under a regional connected AC/DC network. The objective is to respond to peak loads of multiple provincial power grids simultaneously. A two-stage search method is developed for this problem. In the first stage, a load reconstruction strategy is proposed to combine multiple load curves of power grids into a total load curve. The purpose is to deal with different load features in load magnitudes, peaks and valleys. A mutative-scale optimization method is then used to determine the generation schedules of hydropower plants. In the second stage, an exterior point search method is established to allocate the generation among multiple receiving power grids. This method produces an initial solution using the load shedding algorithm, and further improves it by iteratively coordinating the generation among different power grids. The proposed method was implemented to the operations of cascaded hydropower plants on Xin-Fu River and another on Hongshui River. The optimization results in two cases satisfied the peak demands of receiving provincial power grids. Moreover, the maximum load difference between peak and valley decreased 12.67% and 11.32% in Shanghai Power Grid (SHPG and Zhejiang Power Grid (ZJPG, exceeding by 4.85% and 6.72% those of the current operational method, respectively. The advantage of the proposed method in alleviating peak-shaving pressure is demonstrated.

  9. Superoxide dismutase levels and peak expiratory flow in asthmatic children

    Directory of Open Access Journals (Sweden)

    Arie Kurniasih

    2016-11-01

    Full Text Available Background Asthma is a chronic inflammatory process which involve variety of cells such as inflammatory mediators, reactive oxygen species (ROS, and cytokines. The inflammatory process would be exacerbated in the presence of oxidative stress. Superoxide dismutase (SOD is the first important enzyme to protect the respiratory tract against oxidative stress. The decreased of SOD has a correlation with increased of airway obstruction and bronchospasm. Objective To assess for a correlation between superoxide dismutase (SOD levels and peak expiratory flow, as well as to determine the impact of SOD levels for predicting asthma attacks. Methods We conducted a prospective cohort study at Dr. Sardjito Hospital, Yogyakarta, between February and April 2011 involving asthmatic children aged 5-18 years. Subjects’ serum SOD levels and peak expiratory flow were measured at the same time point. We then performed a prospective study following up on the same subjects to find out if they had a recurrent asthma attack within one month of the tests. We also reassessed their peak expiratory flow one month after blood specimens were obtained. Results Thirty-nine patients were enrolled in this study. There was no significant correlation between SOD level and peak expiratory flow [r=0.289; 95%CI -0.025 to 0.47; P=0.074]. However, older age was significantly associated with higher peak expiratory flow (=0.5; 95%CI 3.10 to 11.57; P=0.01. Lower levels of SOD increased the risk of asthma attacks in a month following the initial measurements (RR=5.5; 95%CI 1.6 to 18.9; P=0.009. Conclusion Superoxide dismutase (SOD level is not significantly associated with peak expiratory flow. However, we find a relationship between older age and higher peak expiratory flow and a relationship between lower SOD levels and risk of asthma attacks within one month following the tests.

  10. Managing peak loads in energy grids: Comparative economic analysis

    International Nuclear Information System (INIS)

    Zhuk, A.; Zeigarnik, Yu.; Buzoverov, E.; Sheindlin, A.

    2016-01-01

    One of the key issues in modern energy technology is managing the imbalance between the generated power and the load, particularly during times of peak demand. The increasing use of renewable energy sources makes this problem even more acute. Various existing technologies, including stationary battery energy storage systems (BESS), can be employed to provide additional power during peak demand times. In the future, integration of on-board batteries of the growing fleet of electric vehicles (EV) and plug-in hybrid electric vehicles (PHEV) into the grid can provide power during peak demand hours (vehicle-to-grid, or V2G technology). This work provides cost estimates of managing peak energy demands using traditional technologies, such as maneuverable power plants, conventional hydroelectric, pumped storage plants and peaker generators, as well as BESS and V2G technologies. The derived estimates provide both per kWh and kW year of energy supplied to the grid. The analysis demonstrates that the use of battery storage is economically justified for short peak demand periods of <1 h. For longer durations, the most suitable technology remains the use of maneuverable steam gas power plants, gas turbine,reciprocating gas engine peaker generators, conventional hydroelectric, pumped storage plants. - Highlights: • Cost of managing peak energy demand employing different technologies are estimated. • Traditional technologies, stationary battery storage and V2G are compared. • Battery storage is economically justified for peak demand periods of <1 h. • V2G appears to have better efficiency than stationary battery storage in low voltage power grids.

  11. Automatic fitting of Gaussian peaks using abductive machine learning

    International Nuclear Information System (INIS)

    Abdel-Aal, R.E.

    1998-01-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1,000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 98%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum

  12. flowPeaks: a fast unsupervised clustering for flow cytometry data via K-means and density peak finding.

    Science.gov (United States)

    Ge, Yongchao; Sealfon, Stuart C

    2012-08-01

    For flow cytometry data, there are two common approaches to the unsupervised clustering problem: one is based on the finite mixture model and the other on spatial exploration of the histograms. The former is computationally slow and has difficulty to identify clusters of irregular shapes. The latter approach cannot be applied directly to high-dimensional data as the computational time and memory become unmanageable and the estimated histogram is unreliable. An algorithm without these two problems would be very useful. In this article, we combine ideas from the finite mixture model and histogram spatial exploration. This new algorithm, which we call flowPeaks, can be applied directly to high-dimensional data and identify irregular shape clusters. The algorithm first uses K-means algorithm with a large K to partition the cell population into many small clusters. These partitioned data allow the generation of a smoothed density function using the finite mixture model. All local peaks are exhaustively searched by exploring the density function and the cells are clustered by the associated local peak. The algorithm flowPeaks is automatic, fast and reliable and robust to cluster shape and outliers. This algorithm has been applied to flow cytometry data and it has been compared with state of the art algorithms, including Misty Mountain, FLOCK, flowMeans, flowMerge and FLAME. The R package flowPeaks is available at https://github.com/yongchao/flowPeaks. yongchao.ge@mssm.edu Supplementary data are available at Bioinformatics online.

  13. Analysis of Peak-to-Peak Current Ripple Amplitude in Seven-Phase PWM Voltage Source Inverters

    Directory of Open Access Journals (Sweden)

    Gabriele Grandi

    2013-08-01

    Full Text Available Multiphase systems are nowadays considered for various industrial applications. Numerous pulse width modulation (PWM schemes for multiphase voltage source inverters with sinusoidal outputs have been developed, but no detailed analysis of the impact of these modulation schemes on the output peak-to-peak current ripple amplitude has been reported. Determination of current ripple in multiphase PWM voltage source inverters is important for both design and control purposes. This paper gives the complete analysis of the peak-to-peak current ripple distribution over a fundamental period for multiphase inverters, with particular reference to seven-phase VSIs. In particular, peak-to-peak current ripple amplitude is analytically determined as a function of the modulation index, and a simplified expression to get its maximum value is carried out. Although reference is made to the centered symmetrical PWM, being the most simple and effective solution to maximize the DC bus utilization, leading to a nearly-optimal modulation to minimize the RMS of the current ripple, the analysis can be readily extended to either discontinuous or asymmetrical modulations, both carrier-based and space vector PWM. A similar approach can be usefully applied to any phase number. The analytical developments for all different sub-cases are verified by numerical simulations.

  14. Activity measurement by using γ-ray sum peak method considering intake radioactivity and its application

    International Nuclear Information System (INIS)

    Miyahara, Hiroshi; Narita, Norihiko; Tomita, Kenichi; Katoh, Yoshichika; Mori, Chizuo; Momose, Takumaro; Shinohara, Kunihiko

    2000-01-01

    It is important to measure external and internal exposure dose in the case of accident. The external exposure can be measured by various dosimeters, but the internal exposure is usually calculated from estimated amounts of intake radioactivity because of difficulty of direct measurement. Detection efficiency of human counter used in direct measurement is necessary, but there is no effective method to determine it for non-uniform distribution. The γ-ray sum peak method is tried for the cascade γ-ray emitter under the consideration of small diffusion such as just after intake. After disintegration rates of sources of 46 Sc and 60 Co were determined by 4πβ-γ coincidence method, γ-ray spectra were measured at various positions. Calculated disintegration rates by sum peak method agreed with those by coincidence method within 10%. The similar results were obtained for distributed plural sources in restricted condition. It is also investigated as application for the case that the other nuclide is contained in it. Using peak-to-total ratios measured in advance, the disintegration rates were determined only from the peak intensities. In this case the results had systematic uncertainty of about 20%. (author)

  15. Explanation of the surface peak in charge integrated LEIS spectra

    CERN Document Server

    Draxler, M; Taglauer, E; Schmid, K; Gruber, R; Ermolov, S N; Bauer, P

    2003-01-01

    Low energy ion scattering is very surface sensitive if scattered ions are analyzed. By time-of-flight (TOF) techniques, also neutral and charge integrated spectra (ions plus neutrals) can be obtained, which yield information about deeper layers. In the literature, the observation of a more or less pronounced surface peak was reported for charge integrated spectra, the intensity of the surface peak being higher at low energies and for heavy projectiles. Aiming at a more profound physical understanding of this surface peak, we performed TOF-experiments and computer simulations for He projectiles and a copper target. Experiments were done in the range 1-9 keV for a scattering angle of 129 deg. . The simulation was performed using the MARLOWE code for the given experimental parameters and a polycrystalline target. At low energies, a pronounced surface peak was observed, which fades away at higher energies. This peak is quantitatively reproduced by the simulation, and corresponds to scattering from approx 2 atomic...

  16. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  17. Pediatric Exercise Testing: Value and Implications of Peak Oxygen Uptake

    Directory of Open Access Journals (Sweden)

    Paolo T. Pianosi

    2017-01-01

    Full Text Available Peak oxygen uptake (peak V ˙ O 2 measured by clinical exercise testing is the benchmark for aerobic fitness. Aerobic fitness, estimated from maximal treadmill exercise, is a predictor of mortality in adults. Peak V ˙ O 2 was shown to predict longevity in patients aged 7–35 years with cystic fibrosis over 25 years ago. A surge of exercise studies in young adults with congenital heart disease over the past decade has revealed significant prognostic information. Three years ago, the first clinical trial in children with pulmonary arterial hypertension used peak V ˙ O 2 as an endpoint that likewise delivered clinically relevant data. Cardiopulmonary exercise testing provides clinicians with biomarkers and clinical outcomes, and researchers with novel insights into fundamental biological mechanisms reflecting an integrated physiological response hidden at rest. Momentum from these pioneering observations in multiple disease states should impel clinicians to employ similar methods in other patient populations; e.g., sickle cell disease. Advances in pediatric exercise science will elucidate new pathways that may identify novel biomarkers. Our initial aim of this essay is to highlight the clinical relevance of exercise testing to determine peak V ˙ O 2 , and thereby convince clinicians of its merit, stimulating future clinical investigators to broaden the application of exercise testing in pediatrics.

  18. Effects of peatland drainage management on peak flows

    Directory of Open Access Journals (Sweden)

    C. E. Ballard

    2012-07-01

    Full Text Available Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrological regime associated with the drainage of blanket peat and the subsequent blocking of drains is poorly understood, therefore a new physics-based model has been developed that allows the exploration of the associated hydrological processes. A series of simulations is used to explore the response of intact, drained and blocked drain sites at field scales. While drainage is generally found to increase peak flows, the effect of drain blocking appears to be dependent on local conditions, sometimes decreasing and sometimes increasing peak flows. Based on insights from these simulations we identify steep smooth drains as those that would experience the greatest reduction in field-scale peak flows if blocked and recommend that future targeted field studies should be focused on examining surface runoff characteristics.

  19. Group Elevator Peak Scheduling Based on Robust Optimization Model

    Directory of Open Access Journals (Sweden)

    ZHANG, J.

    2013-08-01

    Full Text Available Scheduling of Elevator Group Control System (EGCS is a typical combinatorial optimization problem. Uncertain group scheduling under peak traffic flows has become a research focus and difficulty recently. RO (Robust Optimization method is a novel and effective way to deal with uncertain scheduling problem. In this paper, a peak scheduling method based on RO model for multi-elevator system is proposed. The method is immune to the uncertainty of peak traffic flows, optimal scheduling is realized without getting exact numbers of each calling floor's waiting passengers. Specifically, energy-saving oriented multi-objective scheduling price is proposed, RO uncertain peak scheduling model is built to minimize the price. Because RO uncertain model could not be solved directly, RO uncertain model is transformed to RO certain model by elevator scheduling robust counterparts. Because solution space of elevator scheduling is enormous, to solve RO certain model in short time, ant colony solving algorithm for elevator scheduling is proposed. Based on the algorithm, optimal scheduling solutions are found quickly, and group elevators are scheduled according to the solutions. Simulation results show the method could improve scheduling performances effectively in peak pattern. Group elevators' efficient operation is realized by the RO scheduling method.

  20. Energy Saving by Chopping off Peak Demand Using Day Light

    Directory of Open Access Journals (Sweden)

    Ashok Kumar Maitra

    2011-08-01

    Full Text Available An artificial intelligent technique has been implemented in this research using real time datas to calculate how much energy can be chopped from peak load demand. The results are based on real time data that are taken from power delivering centers. These datas do reflect the present condition of power and a solution to those critical conditions during the peak period. These are done in such a way such that helps in judicious scheduling of load. The time based load scheduling has been done so as to understand the basic criteria for solving power crisis during morning peak and early evening peak. The sunray availability and percentage of load that will use day light saving (DLS technique has been taken into account in this work. The results shows that about 0.5% to 1% of load can be shedded off from the peak load period which otherwise is reduction of power. Thus it otherwise also means that an equivalent amount of energy is saved which amounts to a large saving of national money. This result is obtained on monthly and even daily basis. Thus this paper justifies DLS gives a new renewable technique to save energy.

  1. Enhanced vegetation growth peak and its key mechanisms

    Science.gov (United States)

    Huang, K.; Xia, J.; Wang, Y.; Ahlström, A.; Schwalm, C.; Huntzinger, D. N.; Chen, J.; Cook, R. B.; Fang, Y.; Fisher, J. B.; Jacobson, A. R.; Michalak, A.; Schaefer, K. M.; Wei, Y.; Yan, L.; Luo, Y.

    2017-12-01

    It remains unclear that whether and how the vegetation growth peak has been shifted globally during the past three decades. Here we used two global datasets of gross primary productivity (GPP) and a satellite-derived Normalized Difference Vegetation Index (NDVI) to characterize recent changes in seasonal peak vegetation growth. The attribution of changes in peak growth to their driving factors was examined with several datasets. We demonstrated that the growth peak of global vegetation has been linearly increasing during the past three decades. About 65% of this trend is evenly explained by the expanding croplands (21%), rising atmospheric [CO2] (22%), and intensifying nitrogen deposition (22%). The contribution of expanding croplands to the peak growth trend was substantiated by measurements from eddy-flux towers, sun-induced chlorophyll fluorescence and a global database of plant traits, all of which demonstrated that croplands have a higher photosynthetic capacity than other vegetation types. The contribution of rising atmospheric [CO2] and nitrogen deposition are consistent with the positive response of leaf growth to elevated [CO2] (25%) and nitrogen addition (8%) from 346 manipulated experiments. The positive effect of rising atmospheric [CO2] was also well captured by 15 terrestrial biosphere models. However, most models underestimated the contributions of land-cover change and nitrogen deposition, but overestimated the positive effect of climate change.

  2. Non-Gaussian bias: insights from discrete density peaks

    CERN Document Server

    Desjacques, Vincent; Riotto, Antonio

    2013-01-01

    Corrections induced by primordial non-Gaussianity to the linear halo bias can be computed from a peak-background split or the widespread local bias model. However, numerical simulations clearly support the prediction of the former, in which the non-Gaussian amplitude is proportional to the linear halo bias. To understand better the reasons behind the failure of standard Lagrangian local bias, in which the halo overdensity is a function of the local mass overdensity only, we explore the effect of a primordial bispectrum on the 2-point correlation of discrete density peaks. We show that the effective local bias expansion to peak clustering vastly simplifies the calculation. We generalize this approach to excursion set peaks and demonstrate that the resulting non-Gaussian amplitude, which is a weighted sum of quadratic bias factors, precisely agrees with the peak-background split expectation, which is a logarithmic derivative of the halo mass function with respect to the normalisation amplitude. We point out tha...

  3. Rotational and peak torque stiffness of rugby shoes.

    Science.gov (United States)

    Ballal, Moez S; Usuelli, Federico Giuseppe; Montrasio, Umberto Alfieri; Molloy, Andy; La Barbera, Luigi; Villa, Tomaso; Banfi, Giuseppe

    2014-09-01

    Sports people always strive to avoid injury. Sports shoe designs in many sports have been shown to affect traction and injury rates. The aim of this study is to demonstrate the differing stiffness and torque in rugby boots that are designed for the same effect. Five different types of rugby shoes commonly worn by scrum forwards were laboratory tested for rotational stiffness and peak torque on a natural playing surface generating force patterns that would be consistent with a rugby scrum. The overall internal rotation peak torque was 57.75±6.26 Nm while that of external rotation was 56.55±4.36 Nm. The Peak internal and external rotational stiffness were 0.696±0.1 and 0.708±0.06 Nm/deg respectively. Our results, when compared to rotational stiffness and peak torques of football shoes published in the literature, show that shoes worn by rugby players exert higher rotational and peak torque stiffness compared to football shoes when tested on the same natural surfaces. There was significant difference between the tested rugby shoes brands. In our opinion, to maximize potential performance and lower the potential of non-contact injury, care should be taken in choosing boots with stiffness appropriate to the players main playing role. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Accuracy of portable devices in measuring peak cough flow

    International Nuclear Information System (INIS)

    Kulnik, Stefan Tino; Kalra, Lalit; MacBean, Victoria; Birring, Surinder Singh; Moxham, John; Rafferty, Gerrard Francis

    2015-01-01

    Peak cough flow (PCF) measurements can be used as indicators of cough effectiveness. Portable peak flow meters and spirometers have been used to measure PCF, but little is known about their accuracy compared to pneumotachograph systems. The aim of this study was to compare the accuracy of four portable devices (Mini–Wright and Assess peak flow meters, SpiroUSB and Microlab spirometers) in measuring PCF with a calibrated laboratory based pneumotachograph system. Twenty healthy volunteers (mean (SD) age 45 (16) years) coughed through a pneumotachograph connected in series with each portable device in turn, and the differences in PCF readings were analysed. In addition, mechanically generated flow waves of constant peak flow were delivered through each device both independently and when connected in series with the pneumotachograph. Agreement between PCF readings obtained with the pneumotachograph and the portable devices was poor. Peak flow readings were on average lower by approximately 50 L min −1 when measured using the portable devices; 95% limits of agreement spanned approximately 150 L min −1 . The findings highlight the potential for inaccuracy when using portable devices for the measurement of PCF. Depending on the measurement instrument used, absolute values of PCF reported in the literature may not be directly comparable. (paper)

  5. Detectability in a derivative Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Yoshimura, Takeaki; Miyamoto, Masashi; Wakabayashi, Nobuo

    1978-01-01

    In Moessbauer spectrometry, a criterion for detecting a faint peak under the condition that the peak is superimposed onto a tail of a large and broad peak is discussed. By adopting a derivative method, it is found that the criterion is improved in comparison with a usual method, and that the condition for determining the modulation amplitude W/2 is 1.5 GAMMA 1 1 where GAMMA 1 is the spectral linewidth of the faint peak. (auth.)

  6. Statistical analysis of the low-temperature dislocation peak of internal friction (Bordoni peak) in nanostructured copper

    International Nuclear Information System (INIS)

    Vatazhuk, E.N.; Natsik, V.D.

    2011-01-01

    The temperature-frequency dependence of internal friction in the nanostructured samples of Cu and fibred composite C-32 vol.%Nb with the sizes of structure fragments approx 200 nm is analyzed. Experiments are used as initial information for such analysis. The characteristic for the heavily deformed copper Bordoni peak, located nearby a temperature 90 K, was recorded on temperature dependence of vibration decrement (frequencies 73-350 kHz) in previous experiments. The peak is due to the resonance interaction of sound with the system of thermal activated relaxators, and its width considerably greater in comparison with the width of standard internal friction peak with the single relaxation time. Statistical analysis of the peak is made in terms of assumption that the reason of broadening is random activation energy dispersion of relaxators as a result of intense distortion of copper crystal structure. Good agreement of experimental data and Seeger theory considers thermal activated paired kinks at linear segments of dislocation lines, placed in potential Peierls relief valley, as relaxators of Bordoni peak, was established. It is shown that the registered peak height in experiment correspond to presence at the average one dislocation segment in the interior of crystalline grain with size of 200 nm. Empirical estimates for the critical Peierls stress σp ∼ 2x10 7 Pa and integrated density of the interior grain dislocations ρ d ∼ 10 13 m -2 are made. Nb fibers in the composite Cu-Nb facilitate to formation of nanostructured copper, but do not influence evidently on the Bordoni peak.

  7. An internal friction peak caused by hydrogen in maraging steel

    International Nuclear Information System (INIS)

    Usui, Makoto; Asano, Shigeru

    1996-01-01

    Internal friction in hydrogen-charged iron and steel has so far been studied by a large number of investigators. For pure iron, a well-defined peak of internal friction has been observed under the cold-worked and hydrogen-charged conditions. This is called the hydrogen cold-work peak, or the Snoek-Koester relaxation, which originates from the hydrogen-dislocation interaction. In the present study, a high-strength maraging steel (Fe-18Ni-9Co-5Mo) was chosen as another high-alloy steel which is known to be very susceptible to hydrogen embrittlement. The purpose of this paper is to show a new internal friction peak caused by hydrogen in the maraging steel and to compare it with those found in stainless steels which have so far been studied as typical engineering high-alloy materials

  8. Electron-electron Thomas peak in fast transfer ionization

    International Nuclear Information System (INIS)

    Tolmanov, S. G.; McGuire, J. H.

    2000-01-01

    ''Thomas process'' is a name used for a family of singular two-step processes that can lead to electron transfer. The Thomas process of the ''second kind,'' occurring in reactions with both transfer and ionization, utilizes the e-e scattering in the second step, so this Thomas process requires the dynamics of the electron-electron interaction. We calculate numerically the second order element of an S matrix and corresponding cross sections for the transfer ionization process. We find that the position and shape of the Thomas peak depend on both electron-electron and the electron-nucleus interaction. Also the direct and exchange amplitudes are equal at the peak position. We test the peaking approximation used for transfer ionization. Our results can be compared to experimental results for p + +He→H+He 2+ +e - . (c) 2000 The American Physical Society

  9. Distribution network planning method considering distributed generation for peak cutting

    International Nuclear Information System (INIS)

    Ouyang Wu; Cheng Haozhong; Zhang Xiubin; Yao Liangzhong

    2010-01-01

    Conventional distribution planning method based on peak load brings about large investment, high risk and low utilization efficiency. A distribution network planning method considering distributed generation (DG) for peak cutting is proposed in this paper. The new integrated distribution network planning method with DG implementation aims to minimize the sum of feeder investments, DG investments, energy loss cost and the additional cost of DG for peak cutting. Using the solution techniques combining genetic algorithm (GA) with the heuristic approach, the proposed model determines the optimal planning scheme including the feeder network and the siting and sizing of DG. The strategy for the site and size of DG, which is based on the radial structure characteristics of distribution network, reduces the complexity degree of solving the optimization model and eases the computational burden substantially. Furthermore, the operation schedule of DG at the different load level is also provided.

  10. Correlation Filter Learning Toward Peak Strength for Visual Tracking.

    Science.gov (United States)

    Sui, Yao; Wang, Guanghui; Zhang, Li

    2018-04-01

    This paper presents a novel visual tracking approach to correlation filter learning toward peak strength of correlation response. Previous methods leverage all features of the target and the immediate background to learn a correlation filter. Some features, however, may be distractive to tracking, like those from occlusion and local deformation, resulting in unstable tracking performance. This paper aims at solving this issue and proposes a novel algorithm to learn the correlation filter. The proposed approach, by imposing an elastic net constraint on the filter, can adaptively eliminate those distractive features in the correlation filtering. A new peak strength metric is proposed to measure the discriminative capability of the learned correlation filter. It is demonstrated that the proposed approach effectively strengthens the peak of the correlation response, leading to more discriminative performance than previous methods. Extensive experiments on a challenging visual tracking benchmark demonstrate that the proposed tracker outperforms most state-of-the-art methods.

  11. Gnevyshev peaks in solar radio emissions at different frequencies

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2009-04-01

    Full Text Available Sunspots have a major 11-year cycle, but the years near the sunspot maximum show two or more peaks called GP (Gnevyshev Peaks. In this communication, it was examined whether these peaks in sunspots are reflected in other parameters such as Lyman-α (the chromospheric emission 121.6 nm, radio emissions 242–15 400 MHz emanating from altitude levels 2000–12 000 km, the low latitude (+45° to −45° solar open magnetic flux and the coronal green line emission (Fe XIV, 530.3 nm. In the different solar cycles 20–23, the similarity extended at least upto the level of 609 MHz, but in cycle 22, the highest level was of 242 MHz. The extension to the higher level in cycle 22 does not seem to be related to the cycle strength Rz(max, or to the cycle length.

  12. Order Tracking Based on Robust Peak Search Instantaneous Frequency Estimation

    International Nuclear Information System (INIS)

    Gao, Y; Guo, Y; Chi, Y L; Qin, S R

    2006-01-01

    Order tracking plays an important role in non-stationary vibration analysis of rotating machinery, especially to run-up or coast down. An instantaneous frequency estimation (IFE) based order tracking of rotating machinery is introduced. In which, a peak search algorithms of spectrogram of time-frequency analysis is employed to obtain IFE of vibrations. An improvement to peak search is proposed, which can avoid strong non-order components or noises disturbing to the peak search work. Compared with traditional methods of order tracking, IFE based order tracking is simplified in application and only software depended. Testing testify the validity of the method. This method is an effective supplement to traditional methods, and the application in condition monitoring and diagnosis of rotating machinery is imaginable

  13. Households' hourly electricity consumption and peak demand in Denmark

    DEFF Research Database (Denmark)

    Møller Andersen, Frits; Baldini, Mattia; Hansen, Lars Gårn

    2017-01-01

    consumption, we analyse the contribution of appliances and new services, such as individual heat pumps and electric vehicles, to peak consumption and the need for demand response incentives to reduce the peak.Initially, the paper presents a new model that represents the hourly electricity consumption profile...... of households in Denmark. The model considers hourly consumption profiles for different household appliances and their contribution to annual household electricity consumption. When applying the model to an official scenario for annual electricity consumption, assuming non-flexible consumption due...... to a considerable introduction of electric vehicles and individual heat pumps, household consumption is expected to increase considerably, especially peak hour consumption is expected to increase.Next the paper presents results from a new experiment where household customers are given economic and/or environmental...

  14. Discovery and characterization of the first low-peaked and intermediate-peaked BL Lacertae objects in the very high energy {gamma}-ray regime

    Energy Technology Data Exchange (ETDEWEB)

    Berger, Karsten

    2009-12-19

    20 years after the discovery of the Crab Nebula as a source of very high energy {gamma}-rays, the number of sources newly discovered above 100 GeV using ground-based Cherenkov telescopes has considerably grown, at the time of writing of this thesis to a total of 81. The sources are of different types, including galactic sources such as supernova remnants, pulsars, binary systems, or so-far unidentified accelerators and extragalactic sources such as blazars and radio galaxies. The goal of this thesis work was to search for {gamma}-ray emission from a particular type of blazars previously undetected at very high {gamma}-ray energies, by using the MAGIC telescope. Those blazars previously detected were all of the same type, the so-called high-peaked BL Lacertae objects. The sources emit purely non-thermal emission, and exhibit a peak in their radio-to-X-ray spectral energy distribution at X-ray energies. The entire blazar population extends from these rare, low-luminosity BL Lacertae objects with peaks at X-ray energies to the much more numerous, high-luminosity infrared-peaked radio quasars. Indeed, the low-peaked sources dominate the source counts obtained from space-borne observations at {gamma}-ray energies up to 10 GeV. Their spectra observed at lower {gamma}-ray energies show power-law extensions to higher energies, although theoretical models suggest them to turn over at energies below 100 GeV. This opened the quest for MAGIC as the Cherenkov telescope with the currently lowest energy threshold. In the framework of this thesis, the search was focused on the prominent sources BL Lac, W Comae and S5 0716+714, respectively. Two of the sources were unambiguously discovered at very high energy {gamma}-rays with the MAGIC telescope, based on the analysis of a total of about 150 hours worth of data collected between 2005 and 2008. The analysis of this very large data set required novel techniques for treating the effects of twilight conditions on the data quality

  15. Discovery and characterization of the first low-peaked and intermediate-peaked BL Lacertae objects in the very high energy γ-ray regime

    International Nuclear Information System (INIS)

    Berger, Karsten

    2009-01-01

    20 years after the discovery of the Crab Nebula as a source of very high energy γ-rays, the number of sources newly discovered above 100 GeV using ground-based Cherenkov telescopes has considerably grown, at the time of writing of this thesis to a total of 81. The sources are of different types, including galactic sources such as supernova remnants, pulsars, binary systems, or so-far unidentified accelerators and extragalactic sources such as blazars and radio galaxies. The goal of this thesis work was to search for γ-ray emission from a particular type of blazars previously undetected at very high γ-ray energies, by using the MAGIC telescope. Those blazars previously detected were all of the same type, the so-called high-peaked BL Lacertae objects. The sources emit purely non-thermal emission, and exhibit a peak in their radio-to-X-ray spectral energy distribution at X-ray energies. The entire blazar population extends from these rare, low-luminosity BL Lacertae objects with peaks at X-ray energies to the much more numerous, high-luminosity infrared-peaked radio quasars. Indeed, the low-peaked sources dominate the source counts obtained from space-borne observations at γ-ray energies up to 10 GeV. Their spectra observed at lower γ-ray energies show power-law extensions to higher energies, although theoretical models suggest them to turn over at energies below 100 GeV. This opened the quest for MAGIC as the Cherenkov telescope with the currently lowest energy threshold. In the framework of this thesis, the search was focused on the prominent sources BL Lac, W Comae and S5 0716+714, respectively. Two of the sources were unambiguously discovered at very high energy γ-rays with the MAGIC telescope, based on the analysis of a total of about 150 hours worth of data collected between 2005 and 2008. The analysis of this very large data set required novel techniques for treating the effects of twilight conditions on the data quality. This was successfully achieved

  16. Study of peak broadening effect in floor time histories

    International Nuclear Information System (INIS)

    Soni, R.S.; Kushwaha, H.S.; Mahajan, S.C.; Kakodkar, A.

    1996-01-01

    Seismic design of secondary systems such components and piping is usually carried out by using the floor motions at their support points. These floor motions can be in the form of Floor Response Spectra (FRS) or the Floor Time Histories (FTH). In order to account for the various uncertainties in generating these floor motions, these motions should be peak broadened and smoothened as per the regulatory codes. Presented here in this paper is the methodology to account for such peak broadening effect in the FTH. Results of this study have been compared with the FRS approach and various important conclusions have been arrived at based on the study

  17. CO2 emissions: a peak level in 2010

    International Nuclear Information System (INIS)

    Anon.

    2011-01-01

    After a reduction of CO 2 emissions in 2009 due to the financial crisis, these emissions have again reached a peak in 2010: 30.6 Gt, it means an increase by 5% compared to the previous peak. According to IEA (International Energy Agency): 44% of the emissions come from coal, 36% from oil and 20% from natural gas, and OECD countries are responsible of 40% of the CO 2 global emissions but only of 25% of their increase since 2009. For China and India the emissions of CO 2 have increased sharply due to their strong economic growth. (A.C.)

  18. Peak Oil and the Everyday Complexity of Human Progress Narratives

    Directory of Open Access Journals (Sweden)

    John C. Pruit

    2012-11-01

    Full Text Available The “big” story of human progress has polarizing tendencies featuring the binary options of progress or decline. I consider human progress narratives in the context of everyday life. Analysis of the “little” stories from two narrative environments focusing on peak oil offers a more complex picture of the meaning and contours of the narrative. I consider the impact of differential blog site commitments to peak oil perspectives and identify five narrative types culled from two narrative dimensions. I argue that the lived experience complicates human progress narratives, which is no longer an either/or proposition.

  19. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This multisectioned three-Volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of volume III contains appendixes of information on load shedding determination, analysis, socio-economic study, contractual cross references, and definitions.

  20. Prediction of a Photon Peak in Heavy Ion Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Casalderrey-Solana, Jorge; Mateos, David

    2008-07-01

    We show that if a flavour-less vector meson remains bound after deconfinement, and if its limiting velocity in the quark-gluon plasma is subluminal, then this meson produces a distinct peak in the spectrum of thermal photons emitted by the plasma. We also demonstrate that this effect is a universal property of all strongly coupled, large-Nc plasmas with a gravity dual. For the J/psi the corresponding peak lies between 3 and 5 GeV and could be observed at LHC.

  1. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program for computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. The report consists of the following three volumes: Volume I: management overview; Volume II: methodology and technology; and Volume III; appendices.

  2. High-Average, High-Peak Current Injector Design

    CERN Document Server

    Biedron, S G; Virgo, M

    2005-01-01

    There is increasing interest in high-average-power (>100 kW), um-range FELs. These machines require high peak current (~1 kA), modest transverse emittance, and beam energies of ~100 MeV. High average currents (~1 A) place additional constraints on the design of the injector. We present a design for an injector intended to produce the required peak currents at the injector, eliminating the need for magnetic compression within the linac. This reduces the potential for beam quality degradation due to CSR and space charge effects within magnetic chicanes.

  3. Demand Side Management: An approach to peak load smoothing

    Science.gov (United States)

    Gupta, Prachi

    A preliminary national-level analysis was conducted to determine whether Demand Side Management (DSM) programs introduced by electric utilities since 1992 have made any progress towards their stated goal of reducing peak load demand. Estimates implied that DSM has a very small effect on peak load reduction and there is substantial regional and end-user variability. A limited scholarly literature on DSM also provides evidence in support of a positive effect of demand response programs. Yet, none of these studies examine the question of how DSM affects peak load at the micro-level by influencing end-users' response to prices. After nearly three decades of experience with DSM, controversy remains over how effective these programs have been. This dissertation considers regional analyses that explore both demand-side solutions and supply-side interventions. On the demand side, models are estimated to provide in-depth evidence of end-user consumption patterns for each North American Electric Reliability Corporation (NERC) region, helping to identify sectors in regions that have made a substantial contribution to peak load reduction. The empirical evidence supports the initial hypothesis that there is substantial regional and end-user variability of reductions in peak demand. These results are quite robust in rapidly-urbanizing regions, where air conditioning and lighting load is substantially higher, and regions where the summer peak is more pronounced than the winter peak. It is also evident from the regional experiences that active government involvement, as shaped by state regulations in the last few years, has been successful in promoting DSM programs, and perhaps for the same reason we witness an uptick in peak load reductions in the years 2008 and 2009. On the supply side, we estimate the effectiveness of DSM programs by analyzing the growth of capacity margin with the introduction of DSM programs. The results indicate that DSM has been successful in offsetting the

  4. Universal parametric correlations of conductance peaks in quantum dots

    International Nuclear Information System (INIS)

    Alhassid, Y.; Attias, H.

    1996-01-01

    We compute the parametric correlation function of the conductance peaks in chaotic and weakly disordered quantum dots in the Coulomb blockade regime and demonstrate its universality upon an appropriate scaling of the parameter. For a symmetric dot we show that this correlation function is affected by breaking time-reversal symmetry but is independent of the details of the channels in the external leads. We derive a new scaling which depends on the eigenfunctions alone and can be extracted directly from the conductance peak heights. Our results are in excellent agreement with model simulations of a disordered quantum dot. copyright 1996 The American Physical Society

  5. Direct observation of the hydrogen peak in the energy distribution of electrons backscattered elastically from polyethylene

    International Nuclear Information System (INIS)

    Varga, D.; Toekesi, K.; Berenyi, Z.; Toth, J.; Koever, L.

    2004-01-01

    Complete text of publication follows. Observation of the hydrogen peak is either challenging or impossible task for the conventional electron spectroscopy. Hydrogen was observed earlier in electron scattering experiments using transmission geometry and formvar film. In this work we show an alternative way for the detection of hydrogen peak analyzing the spectra of elastically backscattered electrons from polyethylene ((CH 2 ) n ). We take advantage of the fact that the elastic peak from polyethylene split into carbon and hydrogen components. The energy of the elastically scattered electrons is shifted from the nominal values due to the energy transfer between the primary electron and the target atoms (recoil effect). Due to the motion of the scattering atoms, a broadering of the energy width of the spectra takes place. We performed Monte Carlo simulation for 2 keV electrons penetrated and elastically backscattered from polyethylene sample. In our calculations both the elastic and inelastic scattering events were taken into account. We further assume that the thermal motion of the target atoms follows the Maxwell-Boltzmann energy distribution. After each elastic scattering the recoil energy was calculated according to ref Fig. 1 shows the geometric configuration used in the calculation. The initial angle of incident beam (θ) was 50 deg. Fig. 2 shows the gray scale plot of the intensity of electrons backscattered elastically from polyethylene. The separation between the carbon and hydrogen peaks is clearly seen. Our results show that the multiple electron scattering causes only minor changes in the energy shifts and broadenings of elastic peaks. Moreover, our simulations are in good agreement with our experimental observations. (author)

  6. Main flood peaks in the medieval Carpathian Basin (1000-1500): Annual and decadal overview

    Science.gov (United States)

    Kiss, Andrea

    2013-04-01

    The analysis of over 140 reported floods is mainly based on contemporary legal evidence (charters), partly on other types of contemporary documentary evidence. Majority of sources contains data on individual flood events (i.e. occurrence, seasonality, magnitude). Concerning main flood peaks, evidence on annual and multi-annual (decadal, multi-decadal) level is also available. Despite data increase in the 13th century, only in the 14th-15th centuries documentation is representative enough to draw further conclusions. Apart from secondary flood peaks (probably in the mid-13th century and the turn of the 13th-14th centuries), three main periods with high flood frequencies are detected: 1330s-1350s, 1390s-1430s, and the late 1480s-1490s (continuing in the early 16th century). The first major flood peak was primarily reported in the eastern Carpathian Basin (the Tisa catchment), and can be characterised by a number of high-intensity flood events (with 1342-1343 in centre). During the second major, prolonged flood peak of 1390s-1430s, and that of the third, late 15th century one the importance of floods occurred on the Danube and in the Danube catchment area has to be as well highlighted. Moreover, in the first half of the 15th century long-term hydrological problems (prolonged high water-level and high flood frequency problems) can be identified. In some cases high flood-frequency periods were accompanied by documented hydromorphological impacts and some impacts on society can be also detected. Results show good agreement with the decadal precipitation reconstruction based on speleothem investigations carried out in North-Hungary.

  7. Low-complexity R-peak detection for ambulatory fetal monitoring

    NARCIS (Netherlands)

    Rooijakkers, M.J.; Rabotti, C.; Oei, S.G.; Mischi, M.

    2012-01-01

    Non-invasive fetal health monitoring during pregnancy is becoming increasingly important because of the increasing number of high-risk pregnancies. Despite recent advances in signal-processing technology, which have enabled fetal monitoring during pregnancy using abdominal electrocardiogram (ECG)

  8. Low-complexity R-peak detection as a first step in ambulatory fetal monitoring

    NARCIS (Netherlands)

    Rooijakkers, M.J.; Rabotti, C.; Mischi, M.

    2012-01-01

    Fetal Heart Rate (fHR) monitoring and derivation of the fetal electrocardiogram (fECG) are important in assessing fetal distress during pregnancy and delivery. Currently used methods of obtaining the fECG using an invasive scalp electrode are however not suited for long term observation throughout

  9. Performance of barcode scanner using peak detection with interference from LED lamps

    NARCIS (Netherlands)

    Deng, X.; Zijlstra, P.; Zhang, J.; Wu, Y.; Zhou, G.; Linnartz, J.-P.

    2015-01-01

    This paper presents a new model for barcode scanners that suffer from the interference of LED lamps, to quantify the system performance in terms of Timing Signal-to-Interference Ratio (TSIR), particularly as a function of modulation depth and frequency of the flicker in the LED lighting. Physical

  10. Storing of Extracts in Polypropylene Microcentrifuge Tubes Yields Contaminant Peak During Ultra-flow Liquid Chromatographic Analysis.

    Science.gov (United States)

    Kshirsagar, Parthraj R; Hegde, Harsha; Pai, Sandeep R

    2016-05-01

    This study was designed to understand the effect of storage in polypropylene microcentrifuge tubes and glass vials during ultra-flow liquid chromatographic (UFLC) analysis. One ml of methanol was placed in polypropylene microcentrifuge tubes (PP material, Autoclavable) and glass vials (Borosilicate) separately for 1, 2, 4, 8, 10, 20, 40, and 80 days intervals stored at -4°C. Contaminant peak was detected in methanol stored in polypropylene microcentrifuge tubes using UFLC analysis. The contaminant peak detected was prominent, sharp detectable at 9.176 ± 0.138 min on a Waters 250-4.6 mm, 4 μ, Nova-Pak C18 column with mobile phase consisting of methanol:water (70:30). It was evident from the study that long-term storage of biological samples prepared using methanol in polypropylene microcentrifuge tubes produce contaminant peak. Further, this may mislead in future reporting an unnatural compound by researchers. Long-term storage of biological samples prepared using methanol in polypropylene microcentrifuge tubes produce contaminant peakContamination peak with higher area under the curve (609993) was obtained in ultra-flow liquid chromatographic run for methanol stored in PP microcentrifuge tubesContamination peak was detected at retention time 9.113 min with a lambda max of 220.38 nm and 300 mAU intensity on the given chromatographic conditionsGlass vials serve better option over PP microcentrifuge tubes for storing biological samples. Abbreviations used: UFLC: Ultra Flow Liquid Chromatography; LC: Liquid Chromatography; MS: Mass spectrometry; AUC: Area Under Curve.

  11. Supernovae with two peaks in the optical light curve and the signature of progenitors with low-mass extended envelopes

    Energy Technology Data Exchange (ETDEWEB)

    Nakar, Ehud [Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Piro, Anthony L. [Theoretical Astrophysics, California Institute of Technology, 1200 East California Boulevard, M/C 350-17, Pasadena, CA 91125 (United States)

    2014-06-20

    Early observations of supernova light curves are powerful tools for shedding light on the pre-explosion structures of their progenitors and their mass-loss histories just prior to explosion. Some core-collapse supernovae that are detected during the first days after the explosion prominently show two peaks in the optical bands, including the R and I bands, where the first peak appears to be powered by the cooling of shocked surface material and the second peak is clearly powered by radioactive decay. Such light curves have been explored in detail theoretically for SN 1993J and 2011dh, where it was found that they may be explained by progenitors with extended, low-mass envelopes. Here, we generalize these results. We first explore whether any double-peaked light curve of this type can be generated by a progenitor with a 'standard' density profile, such as a red supergiant or a Wolf-Rayet star. We show that a standard progenitor (1) cannot produce a double-peaked light curve in the R and I bands and (2) cannot exhibit a fast drop in the bolometric luminosity as is seen after the first peak. We then explore the signature of a progenitor with a compact core surrounded by extended, low-mass material. This may be a hydrostatic low-mass envelope or material ejected just prior to the explosion. We show that it naturally produces both of these features. We use this result to provide simple formulae to estimate (1) the mass of the extended material from the time of the first peak, (2) the extended material radius from the luminosity of the first peak, and (3) an upper limit on the core radius from the luminosity minimum between the two peaks.

  12. American video peak store gives fuel a better image

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    A new American image enhancement system using a video peak frame store aims to overcome the common problems of viewing serial numbers on irradiated fuel assemblies within the reactor core whilst reducing operator exposure at the same time. Other nuclear plant inspection applications are envisaged. (author)

  13. High precision 16K, 16 channel peak sensing CAMAC ADC

    International Nuclear Information System (INIS)

    Jain, Mamta; Subramaniam, E.T

    2013-01-01

    A high density, peak sensing, analog to digital converter (ADC) double width module with CAMAC back plane has been developed for nuclear physics experiments with a large number of detectors. This module has sixteen independent channels in plug-in daughter card mother board mode

  14. Standardization of I-125. Sum-Peak Coincidence Counting

    International Nuclear Information System (INIS)

    Grau Carles, A.; Grau Malonda, A.

    2011-01-01

    I-125 is a nuclide which presents difficulties for standardization. The sum-peak method is one of the procedures used to standardize this radionuclide. Initially NaI (Tl)detectors and then the semiconductor detectors with higher resolution have been used.This paper describes the different methods based on the sum-peak procedure and the different expressions used to calculate the activity are deduced. We describe a general procedure for obtaining all of the above equations and many more. We analyze the influence of uncertainties in the used parameters in the uncertainty of the activity. We give a complete example of the transmission of uncertainty and the effects of correlations in the uncertainty of the activity of the sample. High-resolution spectra show an unresolved doublet of 62.0 keV and 62.8 keV. The paper presents two approaches to solve this problem. One is based on the calculation of area ratio and the sum of peak areas obtained from atomic and nuclear data, in the other we modify the equations so that the sum of the peak areas doublet, rather than its components, is present. (Author) 19 refs.

  15. Focal F0 peak shape and sentence mode in Swedish

    DEFF Research Database (Denmark)

    Ambrazaitis, Gilbert; Buanzur, Tuarik C.; Niebuhr, Oliver

    2015-01-01

    Shape characteristics of rising-falling accentual F0 peaks of Stockholm Swedish Accent I words in narrow focus are studied in a corpus of 287 read sentences. The corpus includes statements and three types of polar questions. Results reveal a clear effect of sentence mode on the shape of the accen...

  16. factors influencing peak expiratory flow in teenage boys

    African Journals Online (AJOL)

    smoked. Regression analysis suggested peak flow differenct.s ... Medical Research Council Centre for Molecular and Cellular Biology, Department ... J leasure of lung function and a tool for asthma management.'.2 ... by the subjects were assigned a numerical value based on how .... Our data differ marginally from data.

  17. Size-independent peak shift between normal and upconversion ...

    Indian Academy of Sciences (India)

    2014-02-12

    Feb 12, 2014 ... In this article, we report size-dependent measurement of the shift in peak of upconversion photoluminescence spectra compared to that of normal photoluminescence using a 800 nm femtosecond laser and its second harmonic. It has been shown that the upconversion photoluminescence is always ...

  18. Scheduling Non-Preemptible Jobs to Minimize Peak Demand

    Directory of Open Access Journals (Sweden)

    Sean Yaw

    2017-10-01

    Full Text Available This paper examines an important problem in smart grid energy scheduling; peaks in power demand are proportionally more expensive to generate and provision for. The issue is exacerbated in local microgrids that do not benefit from the aggregate smoothing experienced by large grids. Demand-side scheduling can reduce these peaks by taking advantage of the fact that there is often flexibility in job start times. We focus attention on the case where the jobs are non-preemptible, meaning once started, they run to completion. The associated optimization problem is called the peak demand minimization problem, and has been previously shown to be NP-hard. Our results include an optimal fixed-parameter tractable algorithm, a polynomial-time approximation algorithm, as well as an effective heuristic that can also be used in an online setting of the problem. Simulation results show that these methods can reduce peak demand by up to 50% versus on-demand scheduling for household power jobs.

  19. Bragg peak and relative biological efficiency of different ions

    Czech Academy of Sciences Publication Activity Database

    Lokajíček st., Miloš; Judas, Libor; Kundrát, Pavel

    2002-01-01

    Roč. 64, Suppl. 1 (2002), S309-S309 ISSN 0167-8140 R&D Projects: GA AV ČR(CZ) KSK4055109 Keywords : Bragg peak * relative biological efficisncy * radiological mechanism Subject RIV: CC - Organic Chemistry Impact factor: 2.838, year: 2002

  20. Measurement of peak temperature along an optical fiber

    International Nuclear Information System (INIS)

    Fox, R.J.

    1983-01-01

    A multimode silica-clad optical fiber with a liquid silicone core was used as a distributed-line peak-temperature sensor over a temperature range from ambient to 190 0 C. The maximum error was 2 0 C and was essentially independent of the length or position of the hot zone

  1. Biomechanical aspects of peak performance in human swimming

    NARCIS (Netherlands)

    Toussaint, H.M.; Truijens, M.J.

    2005-01-01

    Peak performances in sport require the full deployment of all the powers an athlete possesses. How factors such as mechanical power output, technique and drag, each individually, but also in concert, determine swimming performance is the subject of this enquiry. This overview of swimming

  2. T(peak)T(end) interval in long QT syndrome

    DEFF Research Database (Denmark)

    Kanters, Jørgen Kim; Haarmark, Christian; Vedel-Larsen, Esben

    2008-01-01

    BACKGROUND: The T(peak)T(end) (T(p)T(e)) interval is believed to reflect the transmural dispersion of repolarization. Accordingly, it should be a risk factor in long QT syndrome (LQTS). The aim of the study was to determine the effect of genotype on T(p)T(e) interval and test whether it was relat...

  3. Peak Communication Experiences: Concept, Structure, and Sex Differences.

    Science.gov (United States)

    Gordon, Ron; Dulaney, Earl

    A study was conducted to test a "peak communication experience" (PCE) scale developed from Abraham Maslow's theory of PCE's, a model of one's highest interpersonal communication moments in terms of perceived mutual understanding, happiness, and personal fulfillment. Nineteen items, extrapolated from Maslow's model but rendered more…

  4. Analysis of multibeam-hydrosweep echo peaks for seabed characterisation

    Digital Repository Service at National Institute of Oceanography (India)

    Chakraborty, B.; Schenke, H.W.; Kodagali, V.N.; Hagen, R.

    , in general, Gaussian in nature except in the case of the Kainan Maru seamount summit (area D). The outer beams of the Enderby abyssal plain (area C) echo-peak PDF statistics reveal the highest possible large-scale feature dominance. Interestingly, Extremal...

  5. Characteristics of peaks of inhalation exposure to organic solvents

    NARCIS (Netherlands)

    Preller, L.; Burstyn, I.; Pater, N. de; Kromhout, H.

    2004-01-01

    Objectives: To determine which exposure metrics are sufficient to characterize 'peak' inhalation exposure to organic solvents (OS) during spraying operations. Methods: Personal exposure measurements (n = 27; duration 5-159 min) were collected during application of paints, primers, resins and glues

  6. A new sample of faint Gigahertz Peaked Spectrum radio sources

    NARCIS (Netherlands)

    Snellen, IAG; Schilizzi, RT; de Bruyn, AG; Miley, GK; Rengelink, RB; Rottgering, HJ

    The Westerbork Northern Sky Survey (WENSS) has been used to select a sample of Gigahertz Peaked Spectrum (GPS) radio sources at flux densities one to two orders of magnitude lower than bright GPS sources investigated in earlier studies. Sources with inverted spectra at frequencies above 325 MHz have

  7. Efficient protection of mercury peaks; Effizienter Schutz vor Quecksilberspitzen

    Energy Technology Data Exchange (ETDEWEB)

    Esser-Schmittmann, Wolfgang; Schmitz, Simone [Carbon Service und Consulting GmbH und Co. KG, Vettweiss (Germany)

    2010-07-15

    Exhaust gases from the combustion of wastes and substitute fuels temporarily exhibit again and again emission peaks of mercury which in individual cases cannot be caught by the exhaust after-treatment system designed for the stationary plant operation. The problem can be solved inexpensively by dosage of small quantities of chemisorptive powder activated charcoal.

  8. predicted peak expiratory flow in human and the clinical implication ...

    African Journals Online (AJOL)

    DR. AMINU

    predicted PEF varied widely across formulae and choice of a particular formula may alter guideline- base care. This work has therefore accepted a recently published population-base equation proposed as the reference standard for future asthma guidelines. Keywords: Peak expiratory flow, Asthma, Practice guidelines, ...

  9. Analytical construction of peaked solutions for the nonlinear ...

    African Journals Online (AJOL)

    These results demonstrate the existence of peaked pulses propagating through a pair plasma. The algebraic decay rate of the pulses are determined analytically, as well. The method discussed here can be applied to approximate solutions to similar nonlinear partial differential equations of nonlinear Schrödinger type.

  10. A 62GHz inductor-peaked rectifier with 7% efficiency

    NARCIS (Netherlands)

    Gao, H.; Matters - Kammerer, M.; Milosevic, D.; Roermund, van A.H.M.; Baltus, P.G.M.

    2013-01-01

    This paper presents the first 62 GHz fully onchip RF-DC rectifier in 65nm CMOS technology. The rectifier is the bottleneck in realizing on-chip wireless power receivers. In this paper, efficiency problems of the mm-wave rectifier are discussed and the inductor-peaked rectifier structure is proposed

  11. Peak metamorphic temperatures from cation diffusion zoning in garnet

    DEFF Research Database (Denmark)

    Smit, Matthijs Arjen; Scherer, Erik; Mezger, Klaus

    2013-01-01

    ) to develop a tool that uses the diffusion zoning of these cations in garnet to constrain peak temperature conditions for garnet-bearing rocks. The thermometric approach was externally tested by applying it to garnet crystals from various metamorphic terranes worldwide and comparing the results to published...

  12. Measurement of peak discharge at dams by indirect methods

    Science.gov (United States)

    Hulsing, Harry

    1967-01-01

    This chapter describes procedures for measuring peak discharges using dams, weirs, and embankments. Field and office procedures limited to this method are described. Discharge coefficients and formulas are given for three general classes of weirs-sharp-crested, broad-crested, and round-crested-and for highway embankments and weirs of unusual shape. The effects of submergence are defined for most forms.

  13. Comparative LC-MS: A landscape of Peaks and Valleys

    NARCIS (Netherlands)

    America, A.H.P.; Cordewener, J.H.G.

    2008-01-01

    Quantitative proteomics approaches using stable isotopes are well-known and used in many labs nowadays. More recently, high resolution quantitative approaches are reported that rely on LC-MS quantitation of peptide concentrations by comparing peak intensities between multiple runs obtained by

  14. Robust peak-shaving for a neighborhood with electric vehicles

    NARCIS (Netherlands)

    Gerards, Marco Egbertus Theodorus; Hurink, Johann L.

    2016-01-01

    Demand Side Management (DSM) is a popular approach for grid-aware peak-shaving. The most commonly used DSM methods either have no look ahead feature and risk deploying flexibility too early, or they plan ahead using predictions, which are in general not very reliable. To counter this, a DSM approach

  15. Climate Change Impacts on Peak Electricity Consumption: US vs. Europe.

    Science.gov (United States)

    Auffhammer, M.

    2016-12-01

    It has been suggested that climate change impacts on the electric sector will account for the majority of global economic damages by the end of the current century and beyond. This finding is at odds with the relatively modest increase in climate driven impacts on consumption. Comprehensive high frequency load balancing authority level data have not been used previously to parameterize the relationship between electric demand and temperature for any major economy. Using statistical models we analyze multi-year data from load balancing authorities in the United States of America and the European Union, which are responsible for more than 90% of the electricity delivered to residential, industrial, commercial and agricultural customers. We couple the estimated response functions between total daily consumption and daily peak load with an ensemble of downscaled GCMs from the CMIP5 archive to simulate climate change driven impacts on both outcomes. We show moderate and highly spatially heterogeneous changes in consumption. The results of our peak load simulations, however, suggest significant changes in the intensity and frequency of peak events throughout the United States and Europe. As the electricity grid is built to endure maximum load, which usually occurs on the hottest day of the year, our findings have significant implications for the construction of costly peak generating and transmission capacity.

  16. Knowledge, attitude and practice of nurses toward peak expiratory ...

    African Journals Online (AJOL)

    Background: Peak expiratory flow meter (PEFM) is an easy to use, relatively cheap device that can be used for guiding management of bronchial asthma by the patients at home according to a preset plan by health care workers. Objective: The aim of the study is to reveal the extent of knowledge and perception of nurses ...

  17. Knowledge, attitude and practice of physicians toward peak ...

    African Journals Online (AJOL)

    Background: Peak expiratory flow meter (PEFM) may reduce diagnostic delay and improve decision-making in asthma by providing an objective assessment of their flow and hence identify air flow variability that is essential for management of air way diseases. Objectives: This study was designed to reveal extent of ...

  18. Family practitioners perception of, knowledge about and use of peak ...

    African Journals Online (AJOL)

    Background The purpose of this paper was to determine the availability of peak flow meters, perceptions about their usefulness and the perceptions of clinical indications for their use. Methods A questionnaire was administered to private and public sector practitioners (n=72) working in three urban areas of greater ...

  19. Knowledge of spacer device, peak flow meter and inhaler technique ...

    African Journals Online (AJOL)

    Background: Metered dose inhalers are cornerstone in effective management of bronchial asthma when correctly used. Most studies hitherto have focused on assessing patient's knowledge of inhaler technique. We sought to assess the knowledge of inhaler technique, spacer device and peak flow meter among doctors and ...

  20. quasi hyperrigidity and weak peak points for non-commutative ...

    Indian Academy of Sciences (India)

    7

    Abstract. In this article, we introduce the notions of weak boundary repre- sentation, quasi hyperrigidity and weak peak points in the non-commutative setting for operator systems in C∗-algebras. An analogue of Saskin's theorem relating quasi hyperrigidity and weak Choquet boundary for particular classes of C∗-algebras is ...

  1. Simple area determination of strongly overlapping ion mobility peaks

    Czech Academy of Sciences Publication Activity Database

    Borovcová, L.; Hermannová, M.; Pauk, V.; Šimek, M.; Havlíček, Vladimír; Lemr, Karel

    2017-01-01

    Roč. 981, AUG 15 (2017), s. 71-79 ISSN 0003-2670 Grant - others:GA MŠk(CZ) LO1305 Institutional support: RVO:61388971 Keywords : Ion mobility-mass spectrometry * Fitting of mobility peaks * Analysis of isomers Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 4.950, year: 2016

  2. Standardization of I-125. Sum-Peak Coincidence Counting

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A.; Grau Malonda, A.

    2011-07-01

    I-125 is a nuclide which presents difficulties for standardization. The sum-peak method is one of the procedures used to standardize this radionuclide. Initially NaI (Tl)detectors and then the semiconductor detectors with higher resolution have been used.This paper describes the different methods based on the sum-peak procedure and the different expressions used to calculate the activity are deduced. We describe a general procedure for obtaining all of the above equations and many more. We analyze the influence of uncertainties in the used parameters in the uncertainty of the activity. We give a complete example of the transmission of uncertainty and the effects of correlations in the uncertainty of the activity of the sample. High-resolution spectra show an unresolved doublet of 62.0 keV and 62.8 keV. The paper presents two approaches to solve this problem. One is based on the calculation of area ratio and the sum of peak areas obtained from atomic and nuclear data, in the other we modify the equations so that the sum of the peak areas doublet, rather than its components, is present. (Author) 19 refs.

  3. Factors influencing peak expiratory flow in teenage boys | van ...

    African Journals Online (AJOL)

    Background. Peak expiratory flow (PEF) is a useful measure of pulmonary health status and is frequently utilised in asthm, management. Reduction in PEF is usually indicative of onset (of asthma symptoms. However, use can be made of PEF values only if normal values are known. The definition of normal range is always ...

  4. Automatic Locking of Laser Frequency to an Absorption Peak

    Science.gov (United States)

    Koch, Grady J.

    2006-01-01

    An electronic system adjusts the frequency of a tunable laser, eventually locking the frequency to a peak in the optical absorption spectrum of a gas (or of a Fabry-Perot cavity that has an absorption peak like that of a gas). This system was developed to enable precise locking of the frequency of a laser used in differential absorption LIDAR measurements of trace atmospheric gases. This system also has great commercial potential as a prototype of means for precise control of frequencies of lasers in future dense wavelength-division-multiplexing optical communications systems. The operation of this system is completely automatic: Unlike in the operation of some prior laser-frequency-locking systems, there is ordinarily no need for a human operator to adjust the frequency manually to an initial value close enough to the peak to enable automatic locking to take over. Instead, this system also automatically performs the initial adjustment. The system (see Figure 1) is based on a concept of (1) initially modulating the laser frequency to sweep it through a spectral range that includes the desired absorption peak, (2) determining the derivative of the absorption peak with respect to the laser frequency for use as an error signal, (3) identifying the desired frequency [at the very top (which is also the middle) of the peak] as the frequency where the derivative goes to zero, and (4) thereafter keeping the frequency within a locking range and adjusting the frequency as needed to keep the derivative (the error signal) as close as possible to zero. More specifically, the system utilizes the fact that in addition to a zero crossing at the top of the absorption peak, the error signal also closely approximates a straight line in the vicinity of the zero crossing (see Figure 2). This vicinity is the locking range because the linearity of the error signal in this range makes it useful as a source of feedback for a proportional + integral + derivative control scheme that

  5. Reducing electricity demand peaks by scheduling home appliances usage

    Energy Technology Data Exchange (ETDEWEB)

    Rossello-Busquet, A.; Kardaras, G.; Baek Iversen, V.; Soler, J.; Dittmann, L.

    2011-05-15

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users' appliances should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions. On the contrary, the low priority devices have to pause their operation, when the algorithm dictates it, and resume it in the future. This can become beneficial for both energy companies and users. The electricity suppliers companies will be capable of regulating power generation during demand peaks periods. Moreover, users can be granted lower electricity bill rates for accepting delaying the operation of some of their appliances. In order to analyze this scenario, teletraffic engineering theory, which is used in evaluating the performance of telecommunication networks, is used. A reversible fair scheduling (RFS) algorithm, which was originally developed for telecommunication networks, is applied. The purpose is to analyze how a power consumption limit and priorities for home appliances will affect the demand peak and the users' everyday life. Verification of the effectiveness of the RFS algorithm is done by means of simulation and by using real data for power consumption and operation hours. The defined maximum power limit of 750 and 1000 Watt was not exceeded during

  6. Peak Dose Assessment for Proposed DOE-PPPO Authorized Limits

    International Nuclear Information System (INIS)

    Maldonado, Delis

    2012-01-01

    The Oak Ridge Institute for Science and Education (ORISE), a U.S. Department of Energy (DOE) prime contractor, was contracted by the DOE Portsmouth/Paducah Project Office (DOE-PPPO) to conduct a peak dose assessment in support of the Authorized Limits Request for Solid Waste Disposal at Landfill C-746-U at the Paducah Gaseous Diffusion Plant (DOE-PPPO 2011a). The peak doses were calculated based on the DOE-PPPO Proposed Single Radionuclides Soil Guidelines and the DOE-PPPO Proposed Authorized Limits (AL) Volumetric Concentrations available in DOE-PPPO 2011a. This work is provided as an appendix to the Dose Modeling Evaluations and Technical Support Document for the Authorized Limits Request for the C-746-U Landfill at the Paducah Gaseous Diffusion Plant, Paducah, Kentucky (ORISE 2012). The receptors evaluated in ORISE 2012 were selected by the DOE-PPPO for the additional peak dose evaluations. These receptors included a Landfill Worker, Trespasser, Resident Farmer (onsite), Resident Gardener, Recreational User, Outdoor Worker and an Offsite Resident Farmer. The RESRAD (Version 6.5) and RESRAD-OFFSITE (Version 2.5) computer codes were used for the peak dose assessments. Deterministic peak dose assessments were performed for all the receptors and a probabilistic dose assessment was performed only for the Offsite Resident Farmer at the request of the DOE-PPPO. In a deterministic analysis, a single input value results in a single output value. In other words, a deterministic analysis uses single parameter values for every variable in the code. By contrast, a probabilistic approach assigns parameter ranges to certain variables, and the code randomly selects the values for each variable from the parameter range each time it calculates the dose (NRC 2006). The receptor scenarios, computer codes and parameter input files were previously used in ORISE 2012. A few modifications were made to the parameter input files as appropriate for this effort. Some of these changes

  7. Forecasting Strategies for Predicting Peak Electric Load Days

    Science.gov (United States)

    Saxena, Harshit

    Academic institutions spend thousands of dollars every month on their electric power consumption. Some of these institutions follow a demand charges pricing structure; here the amount a customer pays to the utility is decided based on the total energy consumed during the month, with an additional charge based on the highest average power load required by the customer over a moving window of time as decided by the utility. Therefore, it is crucial for these institutions to minimize the time periods where a high amount of electric load is demanded over a short duration of time. In order to reduce the peak loads and have more uniform energy consumption, it is imperative to predict when these peaks occur, so that appropriate mitigation strategies can be developed. The research work presented in this thesis has been conducted for Rochester Institute of Technology (RIT), where the demand charges are decided based on a 15 minute sliding window panned over the entire month. This case study makes use of different statistical and machine learning algorithms to develop a forecasting strategy for predicting the peak electric load days of the month. The proposed strategy was tested for a whole year starting May 2015 to April 2016 during which a total of 57 peak days were observed. The model predicted a total of 74 peak days during this period, 40 of these cases were true positives, hence achieving an accuracy level of 70 percent. The results obtained with the proposed forecasting strategy are promising and demonstrate an annual savings potential worth about $80,000 for a single submeter of RIT.

  8. Peak Running Intensity of International Rugby: Implications for Training Prescription.

    Science.gov (United States)

    Delaney, Jace A; Thornton, Heidi R; Pryor, John F; Stewart, Andrew M; Dascombe, Ben J; Duthie, Grant M

    2017-09-01

    To quantify the duration and position-specific peak running intensities of international rugby union for the prescription and monitoring of specific training methodologies. Global positioning systems (GPS) were used to assess the activity profile of 67 elite-level rugby union players from 2 nations across 33 international matches. A moving-average approach was used to identify the peak relative distance (m/min), average acceleration/deceleration (AveAcc; m/s 2 ), and average metabolic power (P met ) for a range of durations (1-10 min). Differences between positions and durations were described using a magnitude-based network. Peak running intensity increased as the length of the moving average decreased. There were likely small to moderate increases in relative distance and AveAcc for outside backs, halfbacks, and loose forwards compared with the tight 5 group across all moving-average durations (effect size [ES] = 0.27-1.00). P met demands were at least likely greater for outside backs and halfbacks than for the tight 5 (ES = 0.86-0.99). Halfbacks demonstrated the greatest relative distance and P met outputs but were similar to outside backs and loose forwards in AveAcc demands. The current study has presented a framework to describe the peak running intensities achieved during international rugby competition by position, which are considerably higher than previously reported whole-period averages. These data provide further knowledge of the peak activity profiles of international rugby competition, and this information can be used to assist coaches and practitioners in adequately preparing athletes for the most demanding periods of play.

  9. Revisiting the Correlations of Peak Luminosity with Spectral Lag and Peak Energy of the Observed Gamma-ray Bursts

    Directory of Open Access Journals (Sweden)

    Yun-A Jo

    2016-12-01

    Full Text Available An analysis of light curves and spectra of observed gamma-ray bursts in gamma-ray ranges is frequently demanded because the prompt emission contains immediate details regarding the central engine of gamma-ray bursts (GRBs. We have revisited the relationship between the collimation-corrected peak luminosity and the spectral lag, investigating the lag-luminosity relationships in great detail by focusing on spectral lags resulting from all possible combinations of channels. Firstly, we compiled the opening angle data and demonstrated that the distribution of opening angles of 205 long GRBs is represented by a double Gaussian function having maxima at ~ 0.1 and ~ 0.3 radians. We confirmed that the peak luminosity and the spectral lag are anti-correlated, both in the observer frame and in the source frame. We found that, in agreement with our previous conclusion, the correlation coefficient improves significantly in the source frame. It should be noted that spectral lags involving channel 2 (25-50 keV yield high correlation coefficients, where Swift/Burst Alert Telescope (BAT has four energy channels (channel 1: 15-25 keV, channel 2: 25-50 keV, channel 3: 50-100 keV, channel 4: 100-200 keV. We also found that peak luminosity is positively correlated with peak energy.

  10. Hurricane Mitch: Peak Discharge for Selected River Reachesin Honduras

    Science.gov (United States)

    Smith, Mark E.; Phillips, Jeffrey V.; Spahr, Norman E.

    2002-01-01

    Hurricane Mitch began as a tropical depression in the Caribbean Sea on 22 October 1998. By 26 October, Mitch had strengthened to a Category 5 storm as defined by the Saffir-Simpson Hurricane Scale (National Climate Data Center, 1999a), and on 27 October was threatening the northern coast of Honduras (fig. 1). After making landfall 2 days later (29 October), the storm drifted south and west across Honduras, wreaking destruction throughout the country before reaching the Guatemalan border on 31 October. According to the National Climate Data Center of the National Oceanic and Atmospheric Administration (National Climate Data Center, 1999b), Hurricane Mitch ranks among the five strongest storms on record in the Atlantic Basin in terms of its sustained winds, barometric pressure, and duration. Hurricane Mitch also was one of the worst Atlantic storms in terms of loss of life and property. The regionwide death toll was estimated to be more than 9,000; thousands of people were reported missing. Economic losses in the region were more than $7.5 billion (U.S. Agency for International Development, 1999). Honduras suffered the most widespread devastation during the storm. More than 5,000 deaths, and economic losses of more than $4 billion, were reported by the Government of Honduras. Honduran officials estimated that Hurricane Mitch destroyed 50 years of economic development. In addition to the human and economic losses, intense flooding and landslides scarred the Honduran landscape - hydrologic and geomorphologic processes throughout the country likely will be affected for many years. As part of the U.S. Government's response to the disaster, the U.S. Geological Survey (USGS) conducted post-flood measurements of peak discharge at 16 river sites throughout Honduras (fig. 2). Such measurements, termed 'indirect' measurements, are used to determine peak flows when direct measurements (using current meters or dye studies, for example) cannot be made. Indirect measurements of

  11. Determination of the diagnostic x-ray tube practical peak voltage (PPV) from average or average peak voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Hourdakis, C J, E-mail: khour@gaec.gr [Ionizing Radiation Calibration Laboratory-Greek Atomic Energy Commission, PO Box 60092, 15310 Agia Paraskevi, Athens, Attiki (Greece)

    2011-04-07

    The practical peak voltage (PPV) has been adopted as the reference measuring quantity for the x-ray tube voltage. However, the majority of commercial kV-meter models measure the average peak, U-bar{sub P}, the average, U-bar, the effective, U{sub eff} or the maximum peak, U{sub P} tube voltage. This work proposed a method for determination of the PPV from measurements with a kV-meter that measures the average U-bar or the average peak, U-bar{sub p} voltage. The kV-meter reading can be converted to the PPV by applying appropriate calibration coefficients and conversion factors. The average peak k{sub PPV,kVp} and the average k{sub PPV,Uav} conversion factors were calculated from virtual voltage waveforms for conventional diagnostic radiology (50-150 kV) and mammography (22-35 kV) tube voltages and for voltage ripples from 0% to 100%. Regression equation and coefficients provide the appropriate conversion factors at any given tube voltage and ripple. The influence of voltage waveform irregularities, like 'spikes' and pulse amplitude variations, on the conversion factors was investigated and discussed. The proposed method and the conversion factors were tested using six commercial kV-meters at several x-ray units. The deviations between the reference and the calculated - according to the proposed method - PPV values were less than 2%. Practical aspects on the voltage ripple measurement were addressed and discussed. The proposed method provides a rigorous base to determine the PPV with kV-meters from U-bar{sub p} and U-bar measurement. Users can benefit, since all kV-meters, irrespective of their measuring quantity, can be used to determine the PPV, complying with the IEC standard requirements.

  12. Theoretical Derivation of Simplified Evaluation Models for the First Peak of a Criticality Accident in Nuclear Fuel Solution

    International Nuclear Information System (INIS)

    Nomura, Yasushi

    2000-01-01

    In a reprocessing facility where nuclear fuel solutions are processed, one could observe a series of power peaks, with the highest peak right after a criticality accident. The criticality alarm system (CAS) is designed to detect the first power peak and warn workers near the reacting material by sounding alarms immediately. Consequently, exposure of the workers would be minimized by an immediate and effective evacuation. Therefore, in the design and installation of a CAS, it is necessary to estimate the magnitude of the first power peak and to set up the threshold point where the CAS initiates the alarm. Furthermore, it is necessary to estimate the level of potential exposure of workers in the case of accidents so as to decide the appropriateness of installing a CAS for a given compartment.A simplified evaluation model to estimate the minimum scale of the first power peak during a criticality accident is derived by theoretical considerations only for use in the design of a CAS to set up the threshold point triggering the alarm signal. Another simplified evaluation model is derived in the same way to estimate the maximum scale of the first power peak for use in judging the appropriateness for installing a CAS. Both models are shown to have adequate margin in predicting the minimum and maximum scale of criticality accidents by comparing their results with French CRiticality occurring ACcidentally (CRAC) experimental data

  13. Relationship between SEP Peak intensity and CME Acceleration, Speed and Width

    Science.gov (United States)

    Xie, H.; St Cyr, O. C.; Makela, P. A.; Gopalswamy, N.

    2017-12-01

    We study the large solar energetic particle (SEP) events that were detected by GOES in the >10 MeV energy channel during December 2006 to January 2016. Data used in this study includes the Solar Electron Proton Telescope (SEPT) and High Energy Telescopes (HET) on STEREO A and B, the Electron, Proton, and Alpha Monitor (EPAM) on ACE, and the Energetic and Relativistic Nuclei and Electron instrument (ERNE) on SOHO. By choosing the smallest connection angles between SEP solar locations and magnetic foot-points of each spacecraft, we divide SEP events as SOHO SEPs or STEREO SEPs. We then compute the SEP peak intensity I0 at the center of the Gausssian using the Gausssian expression from Richardson et al. (2014) and study the relationship between SEP electron and proton peak intensity and CME acceleration, speed and width. By using I0 derived from multi-spacecraft observations we found that the correlations between SEP peak intensity and CME acceleration and speed improved. We also found that this correlation can be further improved by taking into account the effects of CME width and its solar source latitude. The implication for the SEP forecast of our obtained results will be discussed.

  14. How does economic theory explain the Hubbert peak oil model?

    International Nuclear Information System (INIS)

    Reynes, F.; Okullo, S.; Hofkes, M.

    2010-01-01

    The aim of this paper is to provide an economic foundation for bell shaped oil extraction trajectories, consistent with Hubbert's peak oil model. There are several reasons why it is important to get insight into the economic foundations of peak oil. As production decisions are expected to depend on economic factors, a better comprehension of the economic foundations of oil extraction behaviour is fundamental to predict production and price over the coming years. The investigation made in this paper helps us to get a better understanding of the different mechanisms that may be at work in the case of OPEC and non-OPEC producers. We show that profitability is the main driver behind production plans. Changes in profitability due to divergent trajectories between costs and oil price may give rise to a Hubbert production curve. For this result we do not need to introduce a demand or an exploration effect as is generally assumed in the literature.

  15. Kinematic evidence for downdip movement on the Mormon Peak detachment

    Science.gov (United States)

    Walker, Christopher D.; Anders, Mark H.; Christie-Blick, Nicholas

    2007-03-01

    The Mormon Peak detachment is considered to be one of the best examples of a rooted upper crustal detachment fault that propagated through the brittle crust at a low angle. The hanging wall of the detachment today consists of a number of isolated blocks that have been interpreted as remnants of a once-contiguous extensional allochthon. Here we present the results of a new study of directional indicators from the basal surfaces beneath these blocks. These measurements do not agree with the long-standing interpretation of a S75°W movement direction for the detachment hanging wall. Instead, the most recent movement on each section of the detachment took place approximately parallel to the present downdip direction. We conclude that the Mormon Peak detachment is best explained as the basal surfaces to a series of rootless gravity slides.

  16. Evaluation of peaking factors uncertainty for CASMO-3

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kang Suk; Song, Jae Seung; Kim, Yong Rae; Ji, Seong Kyun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1996-02-01

    This document evaluates the pin-to-box factor uncertainty based on using the CASMO-3 with 40-group J-library. Five CE criticals performed by Westinghouse, two by B and W and four RPI criticals were analyzed, using cross sections by CASMO-3. DOT was used for the core calculation. THis is one hof series of efforts to verify ADONIS procedure which is a new core design package under development by KAERI. The expected outcome of this analysis is CASMO-3 pin peak uncertainty applicable to CE type fuel assembly design. The evaluated uncertainty of peaking factors for CASMO-3 was 1.863%. 21 tabs., 23 figs., 12 refs. (Author) .new.

  17. What is the peak stress in ceramic bar impacts?

    International Nuclear Information System (INIS)

    Simha, C. Hari Manoj; Bless, S.J.; Bedford, A.

    2000-01-01

    The bar impact experiment has been extensively used to characterize the high strain rate properties of high strength ceramics. In particular, alumina AD-99.5 has been widely studied; both stress gauge and VISAR bar impact data are available for this material. We have performed plate-on-bar impact experiments using this material in some novel configurations. An interface was introduced in the target bar (by cutting it) in the zone where the material fails by axial splitting. Such experiments resulted in a dramatic drop in the peak stress measured in the experiment, when compared to experiments with no interface. We show that the damage kinetics in tension influence these measurements. Since the peak stress is dependent on the damage kinetics we conclude that the measurement cannot be correlated to some intrinsic strength of the ceramic

  18. Maximizing utilization of sport halls during peak hours

    DEFF Research Database (Denmark)

    Iversen, Evald Bundgård; Forsberg, Peter

    the number of participants 7.5 persons higher pr. activity compared to club activities. This implies that clubs during peak hours could include more participants. Another possibility to increase utilization is if the management of sport facilities forced sport clubs and other organisers to adapt...... their activities to a smaller amount of floor space, which would make it possible to have more than one activity on the floor at the same time. Hence, to achieve better utilization during prime time, further analysis and research could focus on how activities in sport halls can be adapted to include more......BACKGROUNDDuring peak hours (4.30pm-8pm) demand for timeslots in sport halls in Denmark are high and there are few timeslots available. Further, focus on how public resources are spent most efficient is increasing (Iversen, 2013). This makes it interesting to analyse how utilization could...

  19. In vivo dissolution measurement with indium-111 summation peak ratios

    International Nuclear Information System (INIS)

    Jay, M.; Woodward, M.A.; Brouwer, K.R.

    1985-01-01

    Dissolution of [ 111 In]labeled tablets was measured in vivo in a totally noninvasive manner by using a modification of the perturbed angular correlation technique known as the summation peak ratio method. This method, which requires the incorporation of only 10-12 microCi into the dosage form, provided reliable dissolution data after oral administration of [ 111 In]lactose tablets. These results were supported by in vitro experiments which demonstrated that the dissolution rate as measured by the summation peak ratio method was in close agreement with the dissolution rate of salicylic acid in a [ 111 In]salicylic acid tablet. The method has the advantages of using only one detector, thereby avoiding the need for complex coincidence counting systems, requiring less radioactivity, and being potentially applicable to a gamma camera imaging system

  20. China's "Exported Carbon" Peak: Patterns, Drivers, and Implications

    Science.gov (United States)

    Mi, Zhifu; Meng, Jing; Green, Fergus; Coffman, D'Maris; Guan, Dabo

    2018-05-01

    Over the past decade, China has entered a "new normal" phase in economic development, with its role in global trade flows changing significantly. This study estimates the driving forces of Chinese export-embodied carbon emissions in the new normal phase, based on environmentally extended multiregional input-output modeling and structural decomposition analysis. We find that Chinese export-embodied CO2 emissions peaked in 2008 at a level of 1,657 million tones. The subsequent decline in CO2 emissions was mainly due to the changing structure of Chinese production. The peak in Chinese export-embodied emissions is encouraging from the perspective of global climate change mitigation, as it implies downward pressure on global CO2 emissions. However, more attention should focus on ensuring that countries that may partly replace China as major production bases increase their exports using low-carbon inputs.