Characterising the disintegration properties of tablets in opaque media using texture analysis.
Scheuerle, Rebekah L; Gerrard, Stephen E; Kendall, Richard A; Tuleu, Catherine; Slater, Nigel K H; Mahbubani, Krishnaa T
2015-01-01
Tablet disintegration characterisation is used in pharmaceutical research, development, and quality control. Standard methods used to characterise tablet disintegration are often dependent on visual observation in measurement of disintegration times. This presents a challenge for disintegration studies of tablets in opaque, physiologically relevant media that could be useful for tablet formulation optimisation. This study has explored an application of texture analysis disintegration testing, a non-visual, quantitative means of determining tablet disintegration end point, by analysing the disintegration behaviour of two tablet formulations in opaque media. In this study, the disintegration behaviour of one tablet formulation manufactured in-house, and Sybedia Flashtab placebo tablets in water, bovine, and human milk were characterised. A novel method is presented to characterise the disintegration process and to quantify the disintegration end points of the tablets in various media using load data generated by a texture analyser probe. The disintegration times in the different media were found to be statistically different (Pdisintegration times from each other in human versus bovine milk (adjusted P value 0.1685). Copyright © 2015 Elsevier B.V. All rights reserved.
Characterisation of the human NMDA receptor subunit NR3A glycine binding site
DEFF Research Database (Denmark)
Nilsson, A; Duan, J; Mo-Boquist, L-L
2007-01-01
In this study, we characterise the binding site of the human N-methyl-d-aspartate (NMDA) receptor subunit NR3A. Saturation radioligand binding of the NMDA receptor agonists [(3)H]-glycine and [(3)H]-glutamate showed that only glycine binds to human NR3A (hNR3A) with high affinity (K(d)=535nM (277...
Characterising the disintegration properties of tablets in opaque media using texture analysis
Scheuerle, Rebekah L.; Gerrard, Stephen E.; Kendall, Richard A.; Tuleu, Catherine; Slater, Nigel K.H.; Mahbubani, Krishnaa T.
2015-01-01
Tablet disintegration characterisation is used in pharmaceutical research, development, and quality control. Standard methods used to characterise tablet disintegration are often dependent on visual observation in measurement of disintegration times. This presents a challenge for disintegration studies of tablets in opaque, physiologically relevant media that could be useful for tablet formulation optimisation. In this study is explored an application of texture analysis disintegration testin...
Magnetic characterisation of longitudinal thin film media
International Nuclear Information System (INIS)
Dova, P.
1998-09-01
Magnetic characterisation techniques, as applied to longitudinal thin film media, have been investigated. These included the study of the differentials of the remanence curves, the delta-M plot and the examination of the critical volumes. Several thin film structures, which are currently used or are being considered for future media applications, have been examined using these techniques. Most of the films were Co-alloys with the exception of a set of Barium ferrite films. Both monolayer and multilayer structures were studied. It was found that the study of activation volumes provides a better insight into the reversal mechanisms of magnetic media, especially in the case of complex structures such as multilayer films and films with bicrystal microstructure. Furthermore, an evaluation study of different methods of determining critical volumes showed that the method using time dependence measurements and the micromagnetic approach is the most appropriate. The magnetic characteristics of the thin film media under investigation were correlated with their microstructure and, where possible, with their noise performance. Magnetic force microscopy was also used for acquiring quasi-domain images in the ac-demagnetised state. It was found that in all Co-alloy films the dominant intergranular coupling is magnetising in nature, the level of which is governed by the Cr content in the magnetic layer. In the case of laminated media it was found that when non-magnetic spacers are used, the nature of the interlayer coupling depends on the spacer thickness. In double layer structures with no spacer, the top layer replicates the crystallographic texture of the bottom layer, and the overall film properties are a combination of the two layers. In bicrystal films the coupling is determined by the Cr segregation in the grain boundaries. Furthermore, the presence of stacking faults in bicrystal films deteriorates their thermal stability, but can be prevented by improving the epitaxial
Novel analytical methods for characterising binding media and protective coatings in artworks
International Nuclear Information System (INIS)
Domenech-Carbo, Maria Teresa
2008-01-01
Since the first reported analytical studies and technical examinations of art and archaeological objects conducted in the late 18th century, analytical techniques and methods applied to the study of artworks have constantly grown. Among the materials composing the art object, organic compounds used as binding media or protective coatings have attracted the attention of the conservation profession given their noticeable ability for undergoing morphological and chemical changes on ageing. Thus, the aim of this paper is to review the most recent advances in the identification and determination of organic compounds present in art and art conservation materials. Immunofluorescence techniques have been proposed in recent decades as an alternative to the classical and simpler microchemical tests. Besides, a variety of instrumental techniques have also been improved in an attempt to enhance the sensitivity, repeatability and accuracy of the analytical results. Spectroscopic techniques, such as UV-vis, FTIR and Raman spectroscopy, have been coupled with light microscopes for these purposes. Synchrotron radiation FTIR microspectroscopy has also been successfully applied to the analysis of artworks. Mass spectrometry has also been increasingly used as a detector system coupled with a chromatographic device. Chromatographic methods have also improved in recent years. Paper and thin layer chromatographic techniques have been progressively replaced with gas chromatography (GC), pyrolysis-GC, high performance liquid chromatography and capillary electrophoresis. More complex proteomics hyphenated techniques, such as nano-liquid chromatography-nano-electrospray ionisation/collision quadrupole time-of-flight tandem mass spectrometry, have been recently applied to the identification and determination of proteinaceous binders. Microbeam analytical techniques have also been incorporated into the list of advanced instrumental techniques for art conservation purposes. Finally, a number
Novel analytical methods for characterising binding media and protective coatings in artworks
Energy Technology Data Exchange (ETDEWEB)
Domenech-Carbo, Maria Teresa [Institut de Restauracio del Patrimoni, Universitat Politecnica de Valencia, Cami de Vera s/n, 46022 Valencia (Spain)], E-mail: tdomenec@crbc.upv.es
2008-07-28
Since the first reported analytical studies and technical examinations of art and archaeological objects conducted in the late 18th century, analytical techniques and methods applied to the study of artworks have constantly grown. Among the materials composing the art object, organic compounds used as binding media or protective coatings have attracted the attention of the conservation profession given their noticeable ability for undergoing morphological and chemical changes on ageing. Thus, the aim of this paper is to review the most recent advances in the identification and determination of organic compounds present in art and art conservation materials. Immunofluorescence techniques have been proposed in recent decades as an alternative to the classical and simpler microchemical tests. Besides, a variety of instrumental techniques have also been improved in an attempt to enhance the sensitivity, repeatability and accuracy of the analytical results. Spectroscopic techniques, such as UV-vis, FTIR and Raman spectroscopy, have been coupled with light microscopes for these purposes. Synchrotron radiation FTIR microspectroscopy has also been successfully applied to the analysis of artworks. Mass spectrometry has also been increasingly used as a detector system coupled with a chromatographic device. Chromatographic methods have also improved in recent years. Paper and thin layer chromatographic techniques have been progressively replaced with gas chromatography (GC), pyrolysis-GC, high performance liquid chromatography and capillary electrophoresis. More complex proteomics hyphenated techniques, such as nano-liquid chromatography-nano-electrospray ionisation/collision quadrupole time-of-flight tandem mass spectrometry, have been recently applied to the identification and determination of proteinaceous binders. Microbeam analytical techniques have also been incorporated into the list of advanced instrumental techniques for art conservation purposes. Finally, a number
Watts, Kristen; Lagalante, Anthony
2018-06-06
Art conservation science is in need of a relatively nondestructive way of rapidly identifying the binding media within a painting cross-section and isolating binding media to specific layers within the cross-section. Knowledge of the stratigraphy of cross-sections can be helpful for removing possible unoriginal paint layers on the artistic work. Desorption electrospray ionization-mass spectrometry (DESI-MS) was used in ambient mode to study cross-sections from mock-up layered paint samples and samples from a 17th century baroque painting. The DESI spray was raster scanned perpendicular to the cross-section layers to maximize lateral resolution then analyzed with a triple quadrupole mass analyzer in linear ion trap mode. From these scans, isobaric mass maps were created to map the locations of masses indicative of particular binding media onto the cross-sections. Line paint-outs of pigments in different binding media showed specific and unique ions to distinguish between the modern acrylic media and the lipid containing binding media. This included: OP (EO) 9 surfactant in positive ESI for acrylic (m/z 621), and oleic (m/z 281), stearic (m/z 283), and azelaic (m/z 187) acids in negative ESI for oil and egg tempera. DESI-MS maps of mock-up cross-sections of layered pigmented binding media showed correlation between these ions and the layers with a spatial resolution of 100 μm. DESI-MS is effective in monitoring binding media within an intact painting cross-section via mass spectrometric methods. This includes distinguishing between lipid-containing and modern binding materials present in a known mockup cross section matrix as well as identifying lipid binding media in a 17th century baroque era painting. This article is protected by copyright. All rights reserved.
International Nuclear Information System (INIS)
Davies, A.R.L.; Wolstenholme, A.J.; Wonnacott, S.; Hardick, D.J.; Blagbrough, I.S.; Potter, B.V.L.
1999-01-01
Methyllycaconitine (MLA), a norditerpenoid alkaloid isolated from Delphinium seeds, is one of the most potent non-proteinacious ligands that is selective for αbungarotoxin-sensitive neuronal nicotinic acetylcholine receptors (nAChR). [ 3 H]MLA bound to rat brain membranes with high affinity (K d =1.86±0.31 nM) with a good ratio of specific to non-specific binding. The binding of [ 3 H]MLA was characterised by rapid association (t 1/2 =2.3 min) and dissociation (t 1/2 =12.6 min) kinetics. The radioligand binding displayed nicotinic pharmacology, consistent with an interaction with αbungarotoxin-sensitive nAChR. The snake α-toxins, αbungarotoxin and αcobratoxin, displaced [ 3 H]MLA with high affinity (K i =1.8±0.5 and 5.5±0.9 nM, respectively), whereas nicotine was less potent (K i =6.1±1.1 μM). The distribution of [ 3 H]MLA binding sites in crudely dissected rat brain regions was identical to that of [ 125 I]αbungarotoxin binding sites, with a high binding site density in hippocampus and hypothalamus, but low density in striatum and cerebellum. [ 3 H]MLA also labelled a sub-population of binding sites which are not sensitive to the snake αtoxins, but which did not differ significantly from the major population with respect to their other pharmacological properties or regional distribution. [ 3 H]MLA, therefore, is a novel radiolabel for characterising α7-type nAChR. A good signal to noise ratio and rapid binding kinetics provide advantages over the use of radiolabelled αbungarotoxin for rapid and accurate equilibrium binding assays. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Energy Technology Data Exchange (ETDEWEB)
Davies, A.R.L.; Wolstenholme, A.J.; Wonnacott, S. [Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY (United Kingdom); Hardick, D.J.; Blagbrough, I.S.; Potter, B.V.L. [Department of Pharmacy and Pharmacology, University of Bath, Bath BA2 7AY (United Kingdom)
1999-05-15
Methyllycaconitine (MLA), a norditerpenoid alkaloid isolated from Delphinium seeds, is one of the most potent non-proteinacious ligands that is selective for {alpha}bungarotoxin-sensitive neuronal nicotinic acetylcholine receptors (nAChR). [{sup 3}H]MLA bound to rat brain membranes with high affinity (K{sub d}=1.86{+-}0.31 nM) with a good ratio of specific to non-specific binding. The binding of [{sup 3}H]MLA was characterised by rapid association (t{sub 1/2}=2.3 min) and dissociation (t{sub 1/2}=12.6 min) kinetics. The radioligand binding displayed nicotinic pharmacology, consistent with an interaction with {alpha}bungarotoxin-sensitive nAChR. The snake {alpha}-toxins, {alpha}bungarotoxin and {alpha}cobratoxin, displaced [{sup 3}H]MLA with high affinity (K{sub i}=1.8{+-}0.5 and 5.5{+-}0.9 nM, respectively), whereas nicotine was less potent (K{sub i}=6.1{+-}1.1 {mu}M). The distribution of [{sup 3}H]MLA binding sites in crudely dissected rat brain regions was identical to that of [{sup 125}I]{alpha}bungarotoxin binding sites, with a high binding site density in hippocampus and hypothalamus, but low density in striatum and cerebellum. [{sup 3}H]MLA also labelled a sub-population of binding sites which are not sensitive to the snake {alpha}toxins, but which did not differ significantly from the major population with respect to their other pharmacological properties or regional distribution. [{sup 3}H]MLA, therefore, is a novel radiolabel for characterising {alpha}7-type nAChR. A good signal to noise ratio and rapid binding kinetics provide advantages over the use of radiolabelled {alpha}bungarotoxin for rapid and accurate equilibrium binding assays. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Using chemical shift perturbation to characterise ligand binding.
Williamson, Mike P
2013-08-01
Chemical shift perturbation (CSP, chemical shift mapping or complexation-induced changes in chemical shift, CIS) follows changes in the chemical shifts of a protein when a ligand is added, and uses these to determine the location of the binding site, the affinity of the ligand, and/or possibly the structure of the complex. A key factor in determining the appearance of spectra during a titration is the exchange rate between free and bound, or more specifically the off-rate koff. When koff is greater than the chemical shift difference between free and bound, which typically equates to an affinity Kd weaker than about 3μM, then exchange is fast on the chemical shift timescale. Under these circumstances, the observed shift is the population-weighted average of free and bound, which allows Kd to be determined from measurement of peak positions, provided the measurements are made appropriately. (1)H shifts are influenced to a large extent by through-space interactions, whereas (13)Cα and (13)Cβ shifts are influenced more by through-bond effects. (15)N and (13)C' shifts are influenced both by through-bond and by through-space (hydrogen bonding) interactions. For determining the location of a bound ligand on the basis of shift change, the most appropriate method is therefore usually to measure (15)N HSQC spectra, calculate the geometrical distance moved by the peak, weighting (15)N shifts by a factor of about 0.14 compared to (1)H shifts, and select those residues for which the weighted shift change is larger than the standard deviation of the shift for all residues. Other methods are discussed, in particular the measurement of (13)CH3 signals. Slow to intermediate exchange rates lead to line broadening, and make Kd values very difficult to obtain. There is no good way to distinguish changes in chemical shift due to direct binding of the ligand from changes in chemical shift due to allosteric change. Ligand binding at multiple sites can often be characterised, by
Directory of Open Access Journals (Sweden)
David A MacIntyre
Full Text Available BACKGROUND: Cell culture media conditioned by human foreskin fibroblasts (HFFs provide a complex supplement of protein and metabolic factors that support in vitro proliferation of human embryonic stem cells (hESCs. However, the conditioning process is variable with different media batches often exhibiting differing capacities to maintain hESCs in culture. While recent studies have examined the protein complement of conditioned culture media, detailed information regarding the metabolic component of this media is lacking. METHODOLOGY/PRINCIPAL FINDINGS: Using a (1H-Nuclear Magnetic Resonance ((1H-NMR metabonomics approach, 32 metabolites and small compounds were identified and quantified in media conditioned by passage 11 HFFs (CMp11. A number of metabolites were secreted by HFFs with significantly higher concentration of lactate, alanine, and formate detected in CMp11 compared to non-conditioned media. In contrast, levels of tryptophan, folate and niacinamide were depleted in CMp11 indicating the utilisation of these metabolites by HFFs. Multivariate statistical analysis of the (1H-NMR data revealed marked age-related differences in the metabolic profile of CMp11 collected from HFFs every 24 h over 72 h. Additionally, the metabolic profile of CMp11 was altered following freezing at -20°C for 2 weeks. CM derived from passage 18 HFFs (CMp18 was found to be ineffective at supporting hESCs in an undifferentiated state beyond 5 days culture. Multivariate statistical comparison of CMp11 and CMp18 metabolic profiles enabled rapid and clear discrimination between the two media with CMp18 containing lower concentrations of lactate and alanine as well as higher concentrations of glucose and glutamine. CONCLUSIONS/SIGNIFICANCE: (1H-NMR-based metabonomics offers a rapid and accurate method of characterising hESC conditioning media and is a valuable tool for monitoring, controlling and optimising hESC culture media preparation.
Characterisation of mental health conditions in social media using Informed Deep Learning
Gkotsis, George; Oellrich, Anika; Velupillai, Sumithra; Liakata, Maria; Hubbard, Tim J. P.; Dobson, Richard J. B.; Dutta, Rina
2017-03-01
The number of people affected by mental illness is on the increase and with it the burden on health and social care use, as well as the loss of both productivity and quality-adjusted life-years. Natural language processing of electronic health records is increasingly used to study mental health conditions and risk behaviours on a large scale. However, narrative notes written by clinicians do not capture first-hand the patients’ own experiences, and only record cross-sectional, professional impressions at the point of care. Social media platforms have become a source of ‘in the moment’ daily exchange, with topics including well-being and mental health. In this study, we analysed posts from the social media platform Reddit and developed classifiers to recognise and classify posts related to mental illness according to 11 disorder themes. Using a neural network and deep learning approach, we could automatically recognise mental illness-related posts in our balenced dataset with an accuracy of 91.08% and select the correct theme with a weighted average accuracy of 71.37%. We believe that these results are a first step in developing methods to characterise large amounts of user-generated content that could support content curation and targeted interventions.
International Nuclear Information System (INIS)
Anglos, D.; Nevin, A.
2006-01-01
Laser-induced fluorescence (LIF) spectroscopy can provide nondestructive, qualitative analysis of protein-based binding media found in artworks. Fluorescence emissions from proteins in egg yolk and egg white are due to auto fluorescent aromatic amino acids as well as other native and age-related fluorophores, but the potential of fluorescence spectroscopy for the differentiation between binding media is dependent on the choice of a suitable excitation wavelength and limited by problems in interpretation. However, a better understanding of emission spectra associated with LIF can be achieved following comparisons with total emission fluorescence spectra where a series of consecutive emission spectra are recorded over a specific range. Results using nanosecond UV laser sources for LIF of egg-based binding media are presented which are rationalised following comparisons with total emission spectra. Specifically, fluorescence is assigned to tryptophan and oxidation products of amino acids; in the case of egg yolk, fatty-acid polymerisation and age-related degradation products account for the formation of fluorophores.
Energy Technology Data Exchange (ETDEWEB)
Haugan, Are
1998-12-01
Existing oil reservoirs might be more fully exploited if the properties of the flow of oil and water in porous media were better known. In laboratory experiments it is important to collect as much information as possible to make a descriptive model of the system, including position imaging and chemical binding information. This thesis develops nuclear methods for obtaining position image and chemical binding information from flow experiments of porous media. A combined positron emission tomography and single photon emission computed tomography system to obtain position images, and a time-differential perturbed angular correlation system to obtain chemical binding information, have been built and thoroughly tested. 68 refs., 123 figs., 14 tabs.
Directory of Open Access Journals (Sweden)
Claude Nogues
Full Text Available BACKGROUND: Non-specific binding to biosensor surfaces is a major obstacle to quantitative analysis of selective retention of analytes at immobilized target molecules. Although a range of chemical antifouling monolayers has been developed to address this problem, many macromolecular interactions still remain refractory to analysis due to the prevalent high degree of non-specific binding. We describe how we use the dynamic process of the formation of self assembling monolayers and optimise physical and chemical properties thus reducing considerably non-specific binding and allowing analysis of specific binding of analytes to immobilized target molecules. METHODOLOGY/PRINCIPAL FINDINGS: We illustrate this approach by the production of specific protein arrays for the analysis of interactions between the 65kDa isoform of human glutamate decarboxylase (GAD65 and a human monoclonal antibody. Our data illustrate that we have effectively eliminated non-specific interactions with the surface containing the immobilised GAD65 molecules. The findings have several implications. First, this approach obviates the dubious process of background subtraction and gives access to more accurate kinetic and equilibrium values that are no longer contaminated by multiphase non-specific binding. Second, an enhanced signal to noise ratio increases not only the sensitivity but also confidence in the use of SPR to generate kinetic constants that may then be inserted into van't Hoff type analyses to provide comparative DeltaG, DeltaS and DeltaH values, making this an efficient, rapid and competitive alternative to ITC measurements used in drug and macromolecular-interaction mechanistic studies. Third, the accuracy of the measurements allows the application of more intricate interaction models than simple Langmuir monophasic binding. CONCLUSIONS: The detection and measurement of antibody binding by the type 1 diabetes autoantigen GAD65 represents an example of an antibody
Directory of Open Access Journals (Sweden)
Waqasuddin Khan
Full Text Available Disordered regions of proteins often bind to structured domains, mediating interactions within and between proteins. However, it is difficult to identify a priori the short disordered regions involved in binding. We set out to determine if docking such peptide regions to peptide binding domains would assist in these predictions.We assembled a redundancy reduced dataset of SLiM (Short Linear Motif containing proteins from the ELM database. We selected 84 sequences which had an associated PDB structures showing the SLiM bound to a protein receptor, where the SLiM was found within a 50 residue region of the protein sequence which was predicted to be disordered. First, we investigated the Vina docking scores of overlapping tripeptides from the 50 residue SLiM containing disordered regions of the protein sequence to the corresponding PDB domain. We found only weak discrimination of docking scores between peptides involved in binding and adjacent non-binding peptides in this context (AUC 0.58.Next, we trained a bidirectional recurrent neural network (BRNN using as input the protein sequence, predicted secondary structure, Vina docking score and predicted disorder score. The results were very promising (AUC 0.72 showing that multiple sources of information can be combined to produce results which are clearly superior to any single source.We conclude that the Vina docking score alone has only modest power to define the location of a peptide within a larger protein region known to contain it. However, combining this information with other knowledge (using machine learning methods clearly improves the identification of peptide binding regions within a protein sequence. This approach combining docking with machine learning is primarily a predictor of binding to peptide-binding sites, and is not intended as a predictor of specificity of binding to particular receptors.
International Nuclear Information System (INIS)
Vela, A.; Elorza, F.J.; Florez, F.; Paredes, C.; Mazadiego, L.; Llamas, J.F.; Perez, E.; Vives, L.; Carrera, J.; Munoz, A.; De Vicente, G.; Casquet, C.
1999-01-01
Safety analysis of radioactive waste storage systems require fractured rock studies. The performance assessment studies of this type of problems include the development of radionuclide flow and transport models to predict the evolution of possible contaminants released from the repository to the biosphere. The methodology developed in the HIDROBAP project and some results obtained with its application in El Berrocal granite batholith are presented. It integrates modern tools belonging to different disciplines. A Discrete Fracture Network model (DFT) was selected to simulate the fractured medium and a 3D finite element flow and transport model that includes the inverse problem techniques has been coupled to the DFT model to simulate the water movement trough the fracture network system. Preliminary results show that this integrated methodology can be very useful for the hydrogeological characterisation of rock fractured media. (author)
Intermediality and media change
2012-01-01
This book is about intermediality as an approach to analysing and understanding media change. Intermediality and Media Change is critical of technological determinism that characterises 'new media discourse' about the ongoing digitalization, framed as a revolution and creating sharp contrasts between old and new media. Intermediality instead emphasises paying attention to continuities between media of all types and privileges a comparative perspective on technological changes in media over ti...
International Nuclear Information System (INIS)
Musgrave, I.F.; Kotsopoulos, D.; Hughes, R.A.
1998-01-01
Full text: The structure of I 1 -imidazoline binding sites is still unknown and we have proposed that they represent ion channels (i). In these experiments we characterised the effects of the known ion channel modulators methyltriphenylphosphonium (MTPP), 4-aminopyridine (4-AP) and tetraethyl ammonium (TEA) on [ 3 H] clonidine binding in bovine adrenal medullary membranes as these membranes have a relatively well defined I 1 -imidazoline binding site (Molderings et al, 1993). Membranes from bovine adrenal medulla's were prepared by a minor modification of the method of Rapier et al. [ 3 H] Clonidine binding was performed by the method of Ernsberger et al (3), with [ 3 H] clonidine (62 Ci/mmol) used at a final concentration of 5 nM. [ 3 H] Clonidine binding was displaced from bovine adrenal medullary membranes by adrenergic drugs with the order of potency being oxymetazoline > clonidine > moxonidine = idazoxan >> yonimbine. This order of potency is consistent with previous studies of I 1 -imidazoline binding sites (4). Non-linear curve fitting to this data was consistent with a single site model. Both TEA and 4-AP displaced [ H] clonidine with similar potency to its effect on ion channels, TEA having a EC>> of 54 ± 0.3 μM (n=3). The displacement of [ 3 H] clonidine produced by both TEA and 4-AP also fitted to a single site model. Displacement of [ 3 H] clonidine by MTPP fitted a two site model (p 1 -imidazoline binding sites defined with [ 3 H] clonidine may represent ion channels. We have used this data to perform molecular modelling and have determined a common conformation of I 1 -prefering ligands which will aid in the development of I 1 -selective ligands in the future. Copyright (1998) Australian Neuroscience Society
Public Deliberation on Government-managed Social Media
DEFF Research Database (Denmark)
Medaglia, Rony; Zhu, Demi
2017-01-01
– characterised by exposure to different opinions, mutual understanding, and reasonableness – or hinder them, resulting in increased homophily and polarisation. Using the theoretical lens of public deliberation, this study investigates attitudinal and cognitive aspects of user conversations on government......-managed social media accounts. Drawing on a survey of 417 users of the Chinese social media platform Weibo, our findings show that interactions on social media are mostly non-dialogical and non-creative in nature, and characterised by homophily and polarisation, even though users perceive their interactions...
Poltronieri, P; Cappello, M S; Dohmae, N; Conti, A; Fortunato, D; Pastorello, E A; Ortolani, C; Zacheo, G
2002-06-01
Almond proteins can cause severe anaphylactic reactions in susceptible individuals. The aim of this study was the identification of IgE-binding proteins in almonds and the characterisation of these proteins by N-terminal sequencing. Five sera were selected from individuals with a positive reaction to food challenge. Sodium dodecylsulphate-polyacrylamide gel electrophoresis and immunoblotting were performed on almond seed proteins. Purified IgE-binding proteins were tested for immunoblot inhibition with sera pre-incubated with extracts of hazelnut and walnut. N-terminal sequences of the 12-, 30- and 45-kD proteins were obtained. The 45- and 30-kD proteins shared the same N terminus, with 60% homology to the conglutin gamma heavy chain from lupine seed (Lupinus albus) and to basic 7S globulin from soybean (Glycine max). The sequences of the N-terminal 12-kD protein and of an internal peptide obtained by endoproteinase digestion showed good homology to 2S albumin from English walnut (Jug r 1). Immunoblot inhibition experiments were performed and IgE binding to almond 2S albumin and conglutin gamma was detected in the presence of cross-reacting walnut or hazelnut antigens. Two IgE-binding almond proteins were N-terminally sequenced and identified as almond 2S albumin and conglutin gamma. Localisation and conservation of IgE binding in a 6-kD peptide obtained by endoproteinase digestion of 2S albumin was shown. Copyright 2002 S. Karger AG, Basel
Directory of Open Access Journals (Sweden)
Jiufang Duan
2015-01-01
Full Text Available A novel cellulose-chitosan gel was successfully prepared in three steps: (1 ferrocene- (Fc- cellulose with degrees of substitution (DS of 0.5 wt% was synthesised by ferrocenecarboxylic acid and cellulose within dimethylacetamide/lithium chloride (DMAc/LiCl; (2 the β-cyclodextrin (β-CD groups were introduced onto the chitosan chains by reacting chitosan with epichlorohydrin in dimethyl sulphoxide and a DS of 0.35 wt%; (3 thus, the cellulose-chitosan gel was obtained via an intermolecular inclusion interaction of Fc-cellulose and β-CD-chitosan in DMA/LiCl, that is, by an intermolecular inclusion interaction, between the Fc groups of cellulose and the β-CD groups on the chitosan backbone at room temperature. The successful synthesis of Fc-cellulose and β-CD-chitosan was characterised by 13C-NMR spectroscopy. The gel based on β-CD-chitosan and Fc-cellulose was formed under mild conditions which can engender autonomous healing between cut surfaces after 24 hours: the gel cannot self-heal while the cut surfaces were coated with a solution of a competitive guest (adamantane acid. The cellulose-chitosan complex made by this method underwent self-healing. Therefore, this study provided a novel method of expanding the application of chitosan by binding it with another polymer.
Erb-Eigner, Katharina; Taupitz, Matthias; Asbach, Patrick
2016-01-01
The purpose of this study was to compare contrast and image quality of whole-body equilibrium-phase high-spatial-resolution MR angiography using a non-protein-binding unspecific extracellular gadolinium-based contrast medium with that of two contrast media with different protein-binding properties. 45 patients were examined using either 15 mL of gadobutrol (non-protein-binding, n = 15), 32 mL of gadobenate dimeglumine (weakly protein binding, n = 15) or 11 mL gadofosveset trisodium (protein binding, n = 15) followed by equilibrium-phase high-spatial-resolution MR-angiography of four consecutive anatomic regions. The time elapsed between the contrast injection and the beginning of the equilibrium-phase image acquisition in the respective region was measured and was up to 21 min. Signal intensity was measured in two vessels per region and in muscle tissue. Relative contrast (RC) values were calculated. Vessel contrast, artifacts and image quality were rated by two radiologists in consensus on a five-point scale. Compared with gadobutrol, gadofosveset trisodium revealed significantly higher RC values only when acquired later than 15 min after bolus injection. Otherwise, no significant differences between the three contrast media were found regarding vascular contrast and image quality. Equilibrium-phase high-spatial-resolution MR-angiography using a weakly protein-binding or even non-protein-binding contrast medium is equivalent to using a stronger protein-binding contrast medium when image acquisition is within the first 15 min after contrast injection, and allows depiction of the vasculature with high contrast and image quality. The protein-binding contrast medium was superior for imaging only later than 15 min after contrast medium injection. Copyright © 2015 John Wiley & Sons, Ltd.
Nweke, Mauryn C; McCartney, R Graham; Bracewell, Daniel G
2017-12-29
Mechanical characterisation of agarose-based resins is an important factor in ensuring robust chromatographic performance in the manufacture of biopharmaceuticals. Pressure-flow profiles are most commonly used to characterise these properties. There are a number of drawbacks with this method, including the potential need for several re-packs to achieve the desired packing quality, the impact of wall effects on experimental set up and the quantities of chromatography media and buffers required. To address these issues, we have developed a dynamic mechanical analysis (DMA) technique that characterises the mechanical properties of resins based on the viscoelasticity of a 1ml sample of slurry. This technique was conducted on seven resins with varying degrees of mechanical robustness and the results were compared to pressure-flow test results on the same resins. Results show a strong correlation between the two techniques. The most mechanically robust resin (Capto Q) had a critical velocity 3.3 times higher than the weakest (Sepharose CL-4B), whilst the DMA technique showed Capto Q to have a slurry deformation rate 8.3 times lower than Sepharose CL-4B. To ascertain whether polymer structure is indicative of mechanical strength, scanning electron microscopy images were also used to study the structural properties of each resin. Results indicate that DMA can be used as a small volume, complementary technique for the mechanical characterisation of chromatography media. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
The RNA-binding protein repertoire of Arabidopsis thaliana
Marondedze, Claudius; Thomas, Ludivine; Serano, Natalia Lorena Gorron; Lilley, Kathryn S.; Gehring, Christoph A
2016-01-01
RNA-binding proteins (RBPs) have essential roles in determining the fate of RNA from synthesis to decay and have been studied on a protein-by-protein basis, or computationally based on a number of well-characterised RNA-binding domains. Recently
Energy Technology Data Exchange (ETDEWEB)
Brunsting, S.; Pol, M.; Paukovic, M. [ECN Policy Studies, Energy research Centre of the Netherlands ECN, Amsterdam (Netherlands); Kaiser, M.; Zimmer, R. [Unabhaengiges Institut fuer Umweltfragen UfU, Berlin (Germany); Shackley, S.; Mabon, L. [Scottish Carbon Capture and Storage SCCS, Edinburg, Scotland (United Kingdom); Hepplewhite, F.; Loveridge, R. [Energy Markets Unit, Scottish Government, Edinburg, Scotland (United Kingdom); Mazurowski, M.; Polak-Osiniak, D. [Polish Oil and Gas Company PGNiG, Warszawa (Poland); Rybicki, C. [AGH University of Science and Technology, Krakow (Poland)
2012-10-15
At local level, public support has proven crucial to the implementation of CO2 capture and storage (CCS) demonstration projects. Whereas no method exists to guarantee public acceptability of any project, a constructive stakeholder engagement process does increase the likelihood thereof. Social site characterisation can be used as an instrument to explore, plan and evaluate a process of active and constructive local stakeholder engagement in a prospective CCS project as a parallel activity to technical site characterisation. It roughly consists of a formative research phase to get acquainted with the area followed by a series of public information and engagement activities. This deliverable presents results from the first phase for the social site characterisations of a prospective CCS site in Poland (onshore) and the UK (offshore), using qualitative as well as quantitative research methods, as a first step to planning of local public engagement activities and evaluation of these activities that will be undertaken by this consortium at both sites in the near future. Although the term social site characterisation actually refers to the entire process of formative research and subsequent public outreach, and hence to the complete package of awareness work undertaken as part of SiteChar, in the present deliverable the term only refers to the formative research activities as undertaken up to now and as described in this deliverable. The qualitative part of the social site characterisation consisted of (1) a description of relevant social site characteristics such as local history; (2) interviews with relevant local stakeholders; (3) a media analysis of local newspapers. The quantitative part of the social site characterisation consisted of surveys using representative samples to characterise the local population in terms of awareness, knowledge and perceptions of CCS, felt involvement in decision making, extent of local activism, level of trust in representatives and
User-Generated Social Media Events in Tourism
Mariné Roig, Estela; Martín Fuentes, Eva; Daries Ramón, Natalia
2017-01-01
Social media and mobile technologies have revolutionised communication and particular attention has been given to user-generated content (UGC) and the formation of online communities; however, little attention has been given to tourist events entirely generated by users through social media. This paper aims to define and characterise the phenomenon of tourism user-generated events (UGEs) through social media around the user's new empowered role and to assess user-generated social media events...
Ferrite nanoparticles: Synthesis, characterisation and applications in electronic device
Energy Technology Data Exchange (ETDEWEB)
Kefeni, Kebede K., E-mail: kkefeni@gmail.com; Msagati, Titus A.M.; Mamba, Bhekie B.
2017-01-15
Highlights: • Available synthesis methods of ferrite nanoparticles (FNPs) are briefly reviewed. • Summary of the advantage and limitation of FNPs synthesis techniques are presented. • The existing most common FNPs characterisation techniques are briefly reviewed. • Major application areas of FNPs in electronic materials are reviewed. - Abstract: Ferrite nanoparticles (FNPs) have attracted a great interest due to their wide applications in several areas such as biomedical, wastewater treatment, catalyst and electronic device. This review focuses on the synthesis, characterisation and application of FNPs in electronic device with more emphasis on the recently published works. The most commonly used synthesis techniques along with their advantages and limitations are discussed. The available characterisation techniques and their application in electronic materials such as sensors and biosensors, energy storage, microwave device, electromagnetic interference shielding and high-density recording media are briefly reviewed.
Directory of Open Access Journals (Sweden)
Hong GUO
2011-06-01
Full Text Available The archaeological discoveries of Tang tomb murals in Xi’an, China brought to light unprecedented data for the study of the art of the Tang Dynasty (618-907 AD. The spectacular murals with their particular contents provided first-hand material for the study of Chinese history and the techniques of wall paintings during the Tang Dynasty. In order to gain a better understanding of the materials used and to preserve those paintings, pyrolysis-gas chromatography-mass spectrometry (Py-GC/MS and gas chromatography-mass spectrometry (GC/MS were applied for the characterization of the binding media in the paintings. The combination of these analytical techniques is an ideal methodology to identify binding media in unknown samples.
Hughes, C S; Longo, E; Phillips-Jones, M K; Hussain, R
2017-08-01
A-type resistance towards "last-line" glycopeptide antibiotic vancomycin in the leading hospital acquired infectious agent, the enterococci, is the most common in the UK. Resistance is regulated by the VanR A S A two-component system, comprising the histidine sensor kinase VanS A and the partner response regulator VanR A . The nature of the activating ligand for VanS A has not been identified, therefore this work sought to identify and characterise ligand(s) for VanS A . In vitro approaches were used to screen the structural and activity effects of a range of potential ligands with purified VanS A protein. Of the screened ligands (glycopeptide antibiotics vancomycin and teicoplanin, and peptidoglycan components N-acetylmuramic acid, D-Ala-D-Ala and Ala-D-y-Glu-Lys-D-Ala-D-Ala) only glycopeptide antibiotics vancomycin and teicoplanin were found to bind VanS A with different affinities (vancomycin 70μM; teicoplanin 30 and 170μM), and were proposed to bind via exposed aromatic residues tryptophan and tyrosine. Furthermore, binding of the antibiotics induced quicker, longer-lived phosphorylation states for VanS A , proposing them as activators of type A vancomycin resistance in the enterococci. Copyright © 2017 Diamond Light Source Ltd. Published by Elsevier B.V. All rights reserved.
Acknowledging the dilemmas of intrusive media
DEFF Research Database (Denmark)
Mathieu, David; Finger, Juliane; Dias, Patrcia
2017-01-01
Part of the stakeholder consultation addressed strategies that media audiences are developing to cope with pressures and intrusions in a changing media environment, characterised by digitalisation and interactive possibilities. We interviewed ten stakeholders representing interests such as content...... production, media literacy, media regulation, and activism. Consulting with these stakeholders left the impression that pressures and intrusions from media lack widespread acknowledgement, and that little is known about audiences’ strategies to cope with media. Even when intrusions are acknowledged, we find...... no consensual motivation, nor any clear avenue for action. Therefore, we have analysed different discursive positions that prevent acknowledging or taking action upon the pressures and intrusions that we presented to these stakeholders. The discursive positions are outlined below....
Impedimetric method for physiologically characterisation of fungi
DEFF Research Database (Denmark)
Nielsen, Per Væggemose; Petersen, Karina
1998-01-01
Fungi are playing an important role in the food and pharmaceutical industry today, both as starter cultures, fermentation organisms, and as contaminants. Characterisation of fungal growth is normally time consuming as it includes measurements and study on a wide range of media at different...... temperatures, pH, water activity and atmosphere composition. Nevertheless is it important information in ecophysiological studies, where the growth potential by fungi are related to composition and storage of food. It is therefore of great interest to device a rapid method for characterisation of fungi.......The objective was to determine the growth phases of various fungi using an impedimetric method and compare this with traditional methods using agar plates, in order to determine if this rapid method can replace the traditional method.The method is based on impedimetric assessment of growth on the Bactometer 128...
The binding cavity of mouse major urinary protein is optimised for a variety of ligand binding modes
Energy Technology Data Exchange (ETDEWEB)
Pertinhez, Thelma A.; Ferrari, Elena; Casali, Emanuela [Department of Experimental Medicine, University of Parma, Via Volturno, 39, 43100 Parma (Italy); Patel, Jital A. [Department of Chemistry, University of Oxford, Inorganic Chemistry Laboratory, South Parks Road, Oxford OX1 3QR (United Kingdom); Spisni, Alberto, E-mail: alberto.spisni@unipr.it [Department of Experimental Medicine, University of Parma, Via Volturno, 39, 43100 Parma (Italy); Smith, Lorna J., E-mail: lorna.smith@chem.ox.ac.uk [Department of Chemistry, University of Oxford, Inorganic Chemistry Laboratory, South Parks Road, Oxford OX1 3QR (United Kingdom)
2009-12-25
{sup 15}N and {sup 1}HN chemical shift data and {sup 15}N relaxation studies have been used to characterise the binding of N-phenyl-naphthylamine (NPN) to mouse major urinary protein (MUP). NPN binds in the {beta}-barrel cavity of MUP, hydrogen bonding to Tyr120 and making extensive non-bonded contacts with hydrophobic side chains. In contrast to the natural pheromone 2-sec-butyl-4,5-dihydrothiazole, NPN binding gives no change to the overall mobility of the protein backbone of MUP. Comparison with 11 different ligands that bind to MUP shows a range of binding modes involving 16 different residues in the {beta}-barrel cavity. These finding justify why MUP is able to adapt to allow for many successful binding partners.
Otitis media with effusion:diagnosis and treatment
Directory of Open Access Journals (Sweden)
Ozgur Surmelioglu
2013-04-01
Full Text Available Otitis media with effusion (serous otitis media is characterised by an accumulation of fluid in the middle ear behind an intact tympanic membrane, without the symptoms or signs of acute infection. Serous otitis media is the most common cause of hearing loss in children in the developed world. Hearing loss may be affected speech, cognitive, and psychological development of the childeren. In addition, otitis media with effusion is not only seen in children, this sign may present with signs of nasopharyngeal diseases. For this reason, especially in childhood otitis media with effusion should be treated by early diagnosis. [Archives Medical Review Journal 2013; 22(2.000: 194-208
Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K
1999-01-01
The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...
Advice on the management of reactions to intravenous contrast media
International Nuclear Information System (INIS)
1996-01-01
The College has previously issued guidelines for the management of adverse reactions to intravenous ionic and non-ionic contrast media. The following updated guidelines are applicable to both children and adults. The reported adverse reaction rate to conventional ionic contrast media is about 5%, the vast majority of reactions being of a minor nature, and to the newer non-ionic contrast media, approximately 1%. The rare serious reaction, with an estimated incidence of 0.05% with ionic contrast media and substantially less with non-ionic media, must be treated quickly and appropriately. Identification and symptomatic characterisation of the reaction are the key first steps and should be followed by ad hoc management based on general principles. (author)
Antibiotics for otitis media with effusion in children
Venekamp, R.P.; Burton, M.J.; van Dongen, T.M.A.; van der Heijden, G.J.; van Zon, A.; Schilder, A.G.M.
2016-01-01
Background Otitis media with effusion (OME) is characterised by an accumulation of fluid in the middle ear behind an intact tympanic membrane, without the symptoms or signs of acute infection. Since most cases of OME will resolve spontaneously, only children with persistent middle ear effusion and
Cryo-STEM-EDX spectroscopy for the characterisation of nanoparticles in cell culture media
Ilett, M.; Bamiduro, F.; Matar, O.; Brown, A.; Brydson, R.; Hondow, N.
2017-09-01
We present a study of barium titanate nanoparticles dispersed in cell culture media. Scanning transmission electron microscopy combined with energy dispersive X-ray spectroscopy was undertaken on samples prepared using both conventional drop casting and also plunge freezing and examination under cryogenic conditions. This showed that drying artefacts occurred during conventional sample preparation, whereby some salt components of the cell culture media accumulated around the barium titanate nanoparticles; these were removed using the cryogenic route. Importantly, the formation of a calcium and phosphorus rich coating around the barium titanate nanoparticles was retained under cryo-conditions, highlighting that significant interactions do occur between nanomaterials and biological media.
Otitis media: viruses, bacteria, biofilms and vaccines.
Massa, Helen M; Cripps, Allan W; Lehmann, Deborah
2009-11-02
Otitis media typically presents as either acute otitis media (AOM), with symptoms including fever, otalgia, otorrhoea or irritability and short duration; or as otitis media with effusion (OME), which is often asymptomatic and characterised by accumulation of fluid in the middle ear. Diagnostic certainty of otitis media is challenging, given the young age of patients and variability of symptoms. Otitis media predominantly occurs as coincident to viral upper respiratory tract infections and/or bacterial infections. Common viruses that cause upper respiratory tract infection are frequently associated with AOM and new-onset OME. These include respiratory syncytial virus, rhinovirus, adenovirus, parainfluenza and coronavirus. Predominant bacteria that cause otitis media are Streptococcus pneumoniae, Moraxella catarrhalis, and non-typeable Haemophilus influenzae. Antibiotic therapy does not significantly benefit most patients with AOM, but long-term prophylactic antibiotic therapy can reduce the risk of otitis media recurrence among children at high risk. In Australia, 84% of AOM is treated with antibiotic therapy, which contributes to development of antibiotic resistance. Vaccine development is a key future direction for reducing the world burden of otitis media, but requires polymicrobial formulation and ongoing monitoring and modification to ensure sustained reduction in disease burden.
Fernandez, P.E.; Portiansky, E.L.; Barbeito, C.G.; Gimeno, E.J.
1998-01-01
This paper describes an approach to study the cells present in the subinvolution of placental sites (SIPS), a pathological post partum condition of the bitch that causes persistent hemorrhage of the genital tract. The expression of intermediate filament proteins was examined to determine the fetal or maternal origin of the cytotrophoblastic-like cells found in this entity. Lectin binding on tissue sections were also studied to characterise cellular glycoconjuga...
Conformational control of the binding of diatomic gases to cytochrome c'.
Manole, Andreea; Kekilli, Demet; Svistunenko, Dimitri A; Wilson, Michael T; Dobbin, Paul S; Hough, Michael A
2015-06-01
The cytochromes c' (CYTcp) are found in denitrifying, methanotrophic and photosynthetic bacteria. These proteins are able to form stable adducts with CO and NO but not with O2. The binding of NO to CYTcp currently provides the best structural model for the NO activation mechanism of soluble guanylate cyclase. Ligand binding in CYTcps has been shown to be highly dependent on residues in both the proximal and distal heme pockets. Group 1 CYTcps typically have a phenylalanine residue positioned close to the distal face of heme, while for group 2, this residue is typically leucine. We have structurally, spectroscopically and kinetically characterised the CYTcp from Shewanella frigidimarina (SFCP), a protein that has a distal phenylalanine residue and a lysine in the proximal pocket in place of the more common arginine. Each monomer of the SFCP dimer folds as a 4-alpha-helical bundle in a similar manner to CYTcps previously characterised. SFCP exhibits biphasic binding kinetics for both NO and CO as a result of the high level of steric hindrance from the aromatic side chain of residue Phe 16. The binding of distal ligands is thus controlled by the conformation of the phenylalanine ring. Only a proximal 5-coordinate NO adduct, confirmed by structural data, is observed with no detectable hexacoordinate distal NO adduct.
International Nuclear Information System (INIS)
Kouloumpi, E.; Lawson, G.; Pavlidis, B.
2006-01-01
Post-Byzantine is called the period after the invasion of the Ottomans in Constantinople, the capital of Byzantium in 1453, which lasted until the establishment of the first Greek State in 1836. The Post - Byzantine era is one of the most important artistic periods of the Neo-Hellenic Pictorial Art, since, through cultural exchanges with Western Europe, it sets the fundaments for oil painting. The thematology changes from religious to civil, the technique changes from egg yolk to egg-oil emulsion in order to end up to pure oil painting and finally, it opens 'the gates' for the modern artistic movements of the world. The current research is focused on the study of the effects of western influences on the technique and pictorial characteristics of the post-Byzantine icons by the study of any changes in the pigment's binding media through scientific analyses (SEM-EDX, micro-FTIR and GC), as well as of any changes in the painting style of the icons through comparison with both Byzantine and western painting standards. Research never ends and the results of this work give rise to further analysis, in order to throw some light to this transitional period of art. (Author)
International Nuclear Information System (INIS)
Fouchard, Sebastien
2000-01-01
Americium exhibits a high solubility form in basic media under oxidant conditions, unlike the other Transplutonium elements (TPE). This property can be used in the frame of High Level Liquid Waste (HLLW) treatment in order to extract preferentially the americium element, the main responsible of the long term radiotoxicity of the nuclear waste. This soluble compound can be obtained by addition of a concentrated basic solution of Fe(CN) 6 3- ions on Am(OH) 3 precipitates. This technique enables a rapid extraction of Am by the synthesis of this soluble form in alkaline solutions. Under these conditions, the other TPE remain in the solid state as trivalent hydroxide solids, strongly insoluble. In the case of dissolutions involving large amounts of Am(OH) 3 , the formation of the soluble complex is concomitant with the appearance of a reddish precipitate in the basic solution. Dissolution experiments which were carried out on this solid in NaOH/Fe(CN) 6 3- have demonstrated the dependency of the solubility equilibria with the media. Spectroscopic studies (UV Visible, XAS) on the precipitate have enabled the determination of the chemical structure and the oxidation state of the americium in the solid: Na 2 Am(V)O 2 (OH) 3 ,nH 2 O. Electrochemical studies on the americium solution have confirmed that the oxidation of Am(OH) 3 by the Fe(CN) 6 3- ions in basic media could only lead to the pentavalent form. A stoichiometric study carries out between a AmO 2 + ion and one Fe(CN) 6 3- ion and the spectroscopic characterisation of this reaction have demonstrated that the Fe(CN) 6 3- ion didn't remain as an un-complexed form in solution after the alkaline mixing. These results tend to prove that this dissolution of Am(OH) 3 is much more complex than a simple oxidation by the Fe(CN) 6 3- ions. The existence of molecular interactions between AmO 2 + and Fe(CN) 6 3- has been postulated and a mechanistic scheme has been proposed in order to explain the appearance of the soluble
Directory of Open Access Journals (Sweden)
Jody A. Winter
2012-01-01
Full Text Available Halophilic archaea maintain intracellular salt concentrations close to saturation to survive in high-salt environments and their cellular processes have adapted to function under these conditions. Little is known regarding halophilic adaptation of the DNA processing machinery, particularly intriguing since protein-DNA interactions are classically salt sensitive. To investigate such adaptation, we characterised the DNA-binding capabilities of recombinant RPA3 from Haloferax volcanii (HvRPA3. Under physiological salt conditions (3 M KCl, HvRPA3 is monomeric, binding 18 nucleotide ssDNA with nanomolar affinity, demonstrating that RPAs containing the single OB-fold/zinc finger architecture bind with broadly comparable affinity to two OB-fold/zinc finger RPAs. Reducing the salt concentration to 1 M KCl induces dimerisation of the protein, which retains its ability to bind DNA. On circular ssDNA, two concentration-dependent binding modes are observed. Conventionally, increased salt concentration adversely affects DNA binding but HvRPA3 does not bind DNA in 0.2 M KCl, although multimerisation may occlude the binding site. The single N-terminal OB-fold is competent to bind DNA in the absence of the C-terminal zinc finger, albeit with reduced affinity. This study represents the first quantitative characterisation of DNA binding in a halophilic protein in extreme salt concentrations.
Characterisation of bulk solids
Energy Technology Data Exchange (ETDEWEB)
D. McGlinchey [Glasgow Caledonian University, Glasgow (United Kingdom). Centre for Industrial Bulk Solids Handling
2005-07-01
Handling of powders and bulk solids is a critical industrial technology across a broad spectrum of industries, including minerals processing. With contributions from leading authors in their respective fields, this book provides the reader with a sound understanding of the techniques, importance and application of particulate materials characterisation. It covers the fundamental characteristics of individual particles and bulk particulate materials, and includes discussion of a wide range of measurement techniques, and the use of material characteristics in design and industrial practice. Contents: Characterising particle properties; Powder mechanics and rheology; Characterisation for hopper and stockpile design; Fluidization behaviour; Characterisation for pneumatic conveyor design; Explosiblility; 'Designer' particle characteristics; Current industrial practice; and Future trends. 130 ills.
Porting Social Media Contributions with SIOC
Bojars, Uldis; Breslin, John G.; Decker, Stefan
Social media sites, including social networking sites, have captured the attention of millions of users as well as billions of dollars in investment and acquisition. To better enable a user's access to multiple sites, portability between social media sites is required in terms of both (1) the personal profiles and friend networks and (2) a user's content objects expressed on each site. This requires representation mechanisms to interconnect both people and objects on the Web in an interoperable, extensible way. The Semantic Web provides the required representation mechanisms for portability between social media sites: it links people and objects to record and represent the heterogeneous ties that bind each to the other. The FOAF (Friend-of-a-Friend) initiative provides a solution to the first requirement, and this paper discusses how the SIOC (Semantically-Interlinked Online Communities) project can address the latter. By using agreed-upon Semantic Web formats like FOAF and SIOC to describe people, content objects, and the connections that bind them together, social media sites can interoperate and provide portable data by appealing to some common semantics. In this paper, we will discuss the application of Semantic Web technology to enhance current social media sites with semantics and to address issues with portability between social media sites. It has been shown that social media sites can serve as rich data sources for SIOC-based applications such as the SIOC Browser, but in the other direction, we will now show how SIOC data can be used to represent and port the diverse social media contributions (SMCs) made by users on heterogeneous sites.
An Investigation into the Role of Social Media Marketing in Organisational Performance
Barakat, Bassam; DALZIEL, Nurdilek
2016-01-01
Purpose: In an era that is characterised by speed and ruled by technology, new communication tools are required to achieve business objectives in a fast and innovative manner. This is facilitated by the emergence of Web 2.0 tools. Consequently, social media aroused as an assemblage of internet-based platforms that utilise the technological and ideological foundations of Web 2.0. While social media changed the fundamentals of business, marketing and communications in general, it also redefined...
Holliman, Richard
2011-01-01
The globalised digital media ecosystem can be characterised as both dynamic and disruptive. Developments in digital technologies relate closely to emerging social practices. In turn these are influencing, and are influenced by, the political economy of professional media and user-generated content, and the introduction of political and institutional governance and policies. Together this wider context provides opportunities and challenges for science communication practitioners and researcher...
User-Generated Social Media Events in Tourism
Directory of Open Access Journals (Sweden)
Estela Marine-Roig
2017-12-01
Full Text Available Social media and mobile technologies have revolutionised communication and particular attention has been given to user-generated content (UGC and the formation of online communities; however, little attention has been given to tourist events entirely generated by users through social media. This paper aims to define and characterise the phenomenon of tourism user-generated events (UGEs through social media around the user’s new empowered role and to assess user-generated social media events’ online socialness. It is also our aim to provide a useful mixed-methodology analysis framework for UGEs in relation to social media and to highlight their interest for organisations. The methodological approach includes a quantitative model to store, analyse and compare events’ online socialness, which is combined with qualitative, participant observation at the events. This approach is applied to the analysis of three Instagram meetups organised by a specific online community at Catalan ski resorts. The paper’s results show the differential characteristic of tourism UGEs: user initiative and empowerment, full organisation and structure, great social media use and UGC production, brand dissemination, attraction capacity, strong online community bond and faithfulness. With UGEs, an event management paradigm shift occurs as organisations are no longer the main initiators and controllers of the event.
Migalska, M; Sebastian, A; Konczal, M; Kotlík, P; Radwan, J
2017-04-01
The major histocompatibility complex (MHC) plays a central role in the adaptive immune response and is the most polymorphic gene family in vertebrates. Although high-throughput sequencing has increasingly been used for genotyping families of co-amplifying MHC genes, its potential to facilitate early steps in the characterisation of MHC variation in nonmodel organism has not been fully explored. In this study we evaluated the usefulness of de novo transcriptome assembly in characterisation of MHC sequence diversity. We found that although de novo transcriptome assembly of MHC I genes does not reconstruct sequences of individual alleles, it does allow the identification of conserved regions for PCR primer design. Using the newly designed primers, we characterised MHC I sequences in the bank vole. Phylogenetic analysis of the partial MHC I coding sequence (2-4 exons) of the bank vole revealed a lack of orthology to MHC I of other Cricetidae, consistent with the high gene turnover of this region. The diversity of expressed alleles was characterised using ultra-deep sequencing of the third exon that codes for the peptide-binding region of the MHC molecule. High allelic diversity was demonstrated, with 72 alleles found in 29 individuals. Interindividual variation in the number of expressed loci was found, with the number of alleles per individual ranging from 5 to 14. Strong signatures of positive selection were found for 8 amino acid sites, most of which are inferred to bind antigens in human MHC, indicating conservation of structure despite rapid sequence evolution.
Risk of childhood otitis media with focus on potentially modifiable factors
DEFF Research Database (Denmark)
Kørvel-Hanquist, Asbjørn; Koch, Anders; Lous, Jørgen
2018-01-01
Introduction Otitis media is the primary cause of antibiotic prescription in children. Two-thirds of all children experience at least one episode of otitis media before the age of 7 years. The aim of this study was to characterise the attributable effect of several modifiable risk exposures...... on the risk of >3 episodes of otitis media at age 18 months and 7 years within a large prospective national birth cohort. Methods The study used the Danish National Birth Cohort comprising information about otitis media and risk exposures from more than 50,000 mother-child pairs from the period 1996...... with an increased risk of >3 episodes of otitis media at 18 months of age and at 7 years of age. The fraction of children with otitis media attributed from breastfeeding lasting for less than 6 months was 10%. Introduction to daycare before the age of 12 months attributed with 20% of the cases of >3 episodes...
Characterization of [3H] oxymorphone binding sites in mouse brain
DEFF Research Database (Denmark)
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza
2017-01-01
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear....... This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [3H]oxymorphone revealed high affinity binding sites in mouse......]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [3H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP...
DecoFungi: a web application for automatic characterisation of dye decolorisation in fungal strains.
Domínguez, César; Heras, Jónathan; Mata, Eloy; Pascual, Vico
2018-02-27
Fungi have diverse biotechnological applications in, among others, agriculture, bioenergy generation, or remediation of polluted soil and water. In this context, culture media based on color change in response to degradation of dyes are particularly relevant; but measuring dye decolorisation of fungal strains mainly relies on a visual and semiquantitative classification of color intensity changes. Such a classification is a subjective, time-consuming and difficult to reproduce process. DecoFungi is the first, at least up to the best of our knowledge, application to automatically characterise dye decolorisation level of fungal strains from images of inoculated plates. In order to deal with this task, DecoFungi employs a deep-learning model, accessible through a user-friendly web interface, with an accuracy of 96.5%. DecoFungi is an easy to use system for characterising dye decolorisation level of fungal strains from images of inoculated plates.
Narrated truths: the image of psychiatry in the media.
Nesseler, Thomas
2011-11-01
In recent years, we have witnessed an increase in media attention on the subject of mental illness, which mass media frequently portray as a new phenomenon affecting large sections of the population. Reports about people suffering from mental disorders and on psychiatric or psychotherapeutic clinics, however, are often characterised by their emphasis on stereotypes and one-sided invariably negative attributes both in the choice of wording and the images used. This paper is an attempt to elucidate this apparent contradiction from both a narrative and a socio-historical perspective. In view of the development of modern moving image formats and storytelling techniques, it seeks to identify possible ways of harnessing the media to present a more considered and differentiated picture of psychiatric disorders and mental illnesses. Professionally moderated discussion forums based on social media techniques are to serve just as well as stories that take account of the narrative universals such as reward, success and human relations.
International Nuclear Information System (INIS)
Boutaine; J. L.
2004-01-01
For the examination, characterisation and analysis of cultural heritage artefacts or art objects and their component materials, the conservation scientist needs a palette of non destructive and non invasive techniques, in order to improve our knowledge concerning their elaboration, their evolution and/or degradation during time, and to give rational basis for their restoration and conservation. A general survey and illustrations showing the usefulness of these techniques will be presented. Among these methods, many are based on the use of ionising radiation. 1. Radiography (using X-rays, gamma rays, beta particles, secondary electrons, neutrons), electron emission radiography, tomodensimetry, 2. Scanning electron microscope associated with X-ray spectrometry, 3. X-ray diffraction, 4. Synchrotron radiation characterisation, 5. X-ray fluorescence analysis, 6. Activation analysis, 7. Ion beam analysis (PIXE, PIGE, RBS, secondary X-ray fluorescence), 8. Thermoluminescence dating, 9. Carbon-14 dating. These methods are used alone or in connection with other analytical methods. Any kind of materials can be encountered, for instance: i. stones, gems, ceramics, terracotta, enamels, glasses, i i. wood, paper, textile, bone, ivory, i i i. metals, jewellery, i v. paint layers, canvas and wooden backings, pigments, dyers, oils, binding media, varnishes, glues. Some examples will be taken, among recent work done at the Centre of Research and Restoration of the Museums of France (C2RMF), from various geographical origins, various ages and different art disciplines. This will illustrate the kind of assistance that science and technology can provide to a better knowledge of mankind's cultural heritage and also to the establishment of rational basis for its better conservation for the future generations. (Author)
Mohajeri, Seyed Ahmad; Malaekeh-Nikouei, Bizhan; Sadegh, Hasan
2012-05-01
Three different molecularly imprinted polymers (MIPs) for drug delivery of diclofenac in gastrointestinal tract were synthesized employing bulk polymerization method and their binding and release properties were studied in different pH values. Methacrylic acid (MAA), methacrylamide (MAAM) and 4-vinyl pyridine (4VP) were tested as functional monomers and ethylene glycole dimethacrylate (EDMA) was used as a cross-linker monomer in polymeric feed. Binding properties and imprinting factor (IF) of MIPs were studied in comparison with their non-imprinted ones (Blank) in organic and aqueous media. Diclofenac release in aqueous solvents at pH values of 1.5, 6.0 and 8.0, simulating gastrointestinal fluids, were also studied. The results indicated the specific binding of diclofenac to imprinted polymers. Duo to the stronger non-specific bounds in aqueous solutions, IF values decreased in water compared to acetonitrile as an organic medium. Our results proved that all polymers represented pH-responsive diclofenac delivery at above conditions. The data showed that imprinted polymer, prepared by MAA had superior properties, in comparison with other polymers, for minimum release (14%) of drug in gastric acid and maximum release (90%) in basic condition. The results indicated that diclofenac imprinted polymer could be used as a pH-responsive matrix in preparation of a new drug delivery system for diclofenac.
Characterisation of ultrasonic structural noise in multiple scattering media using phased arrays
International Nuclear Information System (INIS)
Bedetti, T; Dorval, V; Jenson, F; Derode, A
2013-01-01
The ultrasonic inspection of multiple scattering media gives rise to structural noise which makes it difficult to detect potential damage or crack inside the component. In order to predict the performances of ultrasonic inspection over such complex media, scattering models can be used. Such models rely on specific key parameters describing the multiple scattering process, which can be determined by specific measurements and post-processing techniques. Such experiments were carried out on stainless steel plates using linear phased-arrays. They consist in recording the response matrix constituted by impulse responses between all the elements of the array. By conducting post-processing on this matrix, we measure the elastic mean free path l e and the correlation distance d c of the recorded noise. Additionally, the dynamic behaviour of the coherent backscattering effect was studied in order to measure the diffusion constant D. Plane-wave beamforming has been applied to the response matrix to improve the angular resolution and the signal-to-noise ratio of the backscattered intensity. Details of postprocessing techniques will be shown
Examining the sources of variability in cell culture media used for biopharmaceutical production.
McGillicuddy, Nicola; Floris, Patrick; Albrecht, Simone; Bones, Jonathan
2018-01-01
Raw materials, in particular cell culture media, represent a significant source of variability to biopharmaceutical manufacturing processes that can detrimentally affect cellular growth, viability and specific productivity or alter the quality profile of the expressed therapeutic protein. The continual expansion of the biopharmaceutical industry is creating an increasing demand on the production and supply chain consistency for cell culture media, especially as companies embrace intensive continuous processing. Here, we provide a historical perspective regarding the transition from serum containing to serum-free media, the development of chemically-defined cell culture media for biopharmaceutical production using industrial scale bioprocesses and review production mechanisms for liquid and powder culture media. An overview and critique of analytical approaches used for the characterisation of cell culture media and the identification of root causes of variability are also provided, including in-depth liquid phase separations, mass spectrometry and spectroscopic methods.
Thompson, Andrew J; Verheij, Mark H P; Verbeek, Joost; Windhorst, Albert D; de Esch, Iwan J P; Lummis, Sarah C R
2014-01-01
VUF10166 (2-chloro-3-(4-methyl piperazin-1-yl)quinoxaline) is a ligand that binds with high affinity to 5-HT3 receptors. Here we synthesise [(3)H]VUF10166 and characterise its binding properties at 5-HT3A and 5-HT3AB receptors. At 5-HT3A receptors [(3)H]VUF10166 displayed saturable binding with a Kd
International Nuclear Information System (INIS)
Azali Muhammad
2005-01-01
Various nuclear techniques have been developed and employed by technologies and scientists worldwide to physically and chemically characterise the material particularly those that have applications in industry. These include small angle neutron scattering (SANS), x-ray diffraction (XRD), scanning electron microscope (SEM) and transmission electron microscope (TEM) for the internal structural study of material, whereas, the x-ray fluorescence (XRF) for the chemical analysis, while the Moessbauer spectroscopy for the study on the magnetic properties and structural identity of material. Basic principle and instrumentations of the techniques are discussed in this chapter. Example of their applications in various disciplines particularly in characterisation of industrial materials also described
Energy Technology Data Exchange (ETDEWEB)
Brunsting, S.; Pol, M.; Mastop, J. [Energy research Centre of the Netherlands ECN, Policy Studies, Petten (Netherlands); Kaiser, M.; Zimmer, R. [UfU - Independent Institute for Environmental Issues, Berlin (Germany); Shackley, S.; Mabon, L.; Howell, R. [The University of Edinburgh - School of Geosciences, Edinburgh, Scotland (United Kingdom); Hepplewhite, F.; Loveridge, R. [Scottish Government, Edinburgh, Scotland (United Kingdom); Mazurowski, M. [PGNiG - Polskie Gornictwo Naftowe i Gazownictwo SA, Warszawa (Poland); Rybicki, C. [AGH - University of Science and Technology, Krakow (Poland)
2013-05-01
Public support has proven crucial to the implementation of CO2 capture and storage (CCS) demonstration projects. Whereas no method exists to guarantee local public acceptability of any project, a constructive stakeholder engagement process does increase the likelihood thereof. Social site characterisation can be used as an instrument to plan and evaluate an approach for actively engaging local stakeholders. Social site characterisation is the process of repeatedly investigating local public awareness and opinions of a specific CCS project, changes therein over time, and underlying factors shaping public opinion as a parallel activity to technical site characterization. This paper presents results from the EU FP7 SiteChar project in which social site characterisation (a.o. surveys) and public participation activities (focus conferences) were conducted by a multidisciplinary team at two prospective CCS sites in in Poland (onshore) and Scotland (offshore). Results demonstrate that social site characterization and focus conferences are powerful tools to raise public awareness about complex issues such as CCS and to initiate local discussion and planning processes with the appropriate type of information, through appropriate media, and involving all relevant stakeholders. Application and the duration of effects in real-life project settings will be discussed.
Energy Technology Data Exchange (ETDEWEB)
Nguyen, Vu H. E-mail: V.H.Nguyen@ansto.gov.au; Mardon, Karine; Kassiou, Michael; Christie, MacDonald J
1999-02-01
ABSTRACT. N-(4-phenylbutyl)-3-hydroxy-4-azahexacyclo[5.4.1.0{sup 2,6}.0{sup 3,10}.0{sup 5,9}.0{sup 8}= {sup ,11}]dodecane (ANSTO-14) showed the highest activity for the {sigma}{sub 1} site ( K{sub i}=9.4 nM) and 19-fold {sigma}{sub 1}/{sigma}{sub 2} selectivity. The present study showed that [{sup 3}H]ANSTO-14 binds to a single high-affinity site in guinea pig brain membranes with an equilibrium K{sub d} of 8.0 {+-} 0.3 nM, in good agreement with the kinetic studies ( K{sub d}=13.3{+-}5.4 nM, n=4), and a B{sub max} of 3,199 {+-} 105 fmol/mg protein ( n=4). The in vivo biodistribution of [{sup 3}H]ANSTO-14 showed a high uptake in the diencephalon. Pretreatment of rats with {sigma} ligands including (+)-pentazocine ({sigma}{sub 1}), ANSTO-14 ({sigma}{sub 1}), and DTG ({sigma}{sub 1} and {sigma}{sub 2}) did not significantly reduce radiotracer uptake in the brain, but did in the spleen. A labelled metabolite was found in the liver and brain. Due to its insensitivity to {sigma} ligands, the accumulation of [{sup 3}H]ANSTO-14 in the brain indicates high nonspecific binding. Therefore, [{sup 3}H]ANSTO-14 is a suitable ligand for labelling {sigma}{sub 1} sites in vitro but is not suitable for brain imaging of {sigma} binding sites in vivo.
International Nuclear Information System (INIS)
Andrieu, Caroline; Olivier Dehaye, Catherine; Tardy, Frederic; Boisserie, Thierry; Desnoyers, Yvon; Thierfeldt, Stefan; Martin, Nieves; Henrik Efraimsson; Haakansson, Lars; Larsson, Arne; Dunlop, Alister A.; Jarman, Sean; Orr, Peter; Abu-Eid, Boby
2013-01-01
Radiological characterisation plays an important role in the decommissioning of nuclear facilities. It is the basis for radiation protection, identification of contamination, assessment of potential risks, cost estimation, planning and implementation of decommissioning and other matters. At all stages of a decommissioning project, adequate radiological characterisation is of crucial importance. The focus of this report is the task of radiological characterisation. The important role and the significance of radiological characterisation become clear when its various objectives are considered, including in particular: - determination of the type, isotopic composition and extent of contamination in structures, systems, components and environmental media; - identification of the nature and extent of remedial actions and decontamination; - supporting planning of decommissioning; - estimation of decommissioning costs. A large number of measurement techniques are available for successful application of radiological characterisation, allowing rapid and comprehensive determination of the activities of most relevant radionuclides. For other radionuclides that are hard to detect, scaling factors can be established that relate their activities to key nuclides. Radiological characterisation is relevant in all phases of the life cycle of a nuclear installation, albeit with different levels of detail and with differing objectives. Basically, the following characterisation phases can be distinguished: pre-operational characterisation; characterisation during operation; characterisation during the transition phase (after final shutdown before initiation of dismantling); characterisation during dismantling (including remediation and decontamination); and characterisation to support the final status survey for site release. The most comprehensive characterisation campaigns are usually carried out during the transition phase in preparation for implementation of dismantling activities
LENUS (Irish Health Repository)
Vickers, I
2011-03-01
The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.
Brain network: social media and the cognitive scientist.
Stafford, Tom; Bell, Vaughan
2012-10-01
Cognitive scientists are increasingly using online social media, such as blogging and Twitter, to gather information and disseminate opinion, while linking to primary articles and data. Because of this, internet tools are driving a change in the scientific process, where communication is characterised by rapid scientific discussion, wider access to specialist debates, and increased cross-disciplinary interaction. This article serves as an introduction to and overview of this transformation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Current limitations and challenges in nanowaste detection, characterisation and monitoring
Energy Technology Data Exchange (ETDEWEB)
Part, Florian; Zecha, Gudrun [Department of Water-Atmosphere-Environment, University of Natural Resources and Life Sciences, Institute of Waste Management, Muthgasse 107, 1190 Vienna (Austria); Causon, Tim [Department of Chemistry, Division of Analytical Chemistry, University of Natural Resources and Life Sciences, Muthgasse 18, 1190 Vienna (Austria); Sinner, Eva-Kathrin [Department of Nanobiotechnology, Institute for Synthetic Bioarchitectures, University of Natural Resources and Life Sciences, Muthgasse 11/II, 1190 Vienna (Austria); Huber-Humer, Marion, E-mail: marion.huber-humer@boku.ac.at [Department of Water-Atmosphere-Environment, University of Natural Resources and Life Sciences, Institute of Waste Management, Muthgasse 107, 1190 Vienna (Austria)
2015-09-15
Highlights: • First review on detection of nanomaterials in complex waste samples. • Focus on nanoparticles in solid, liquid and gaseous waste samples. • Summary of current applicable methods for nanowaste detection and characterisation. • Limitations and challenges of characterisation of nanoparticles in waste. - Abstract: Engineered nanomaterials (ENMs) are already extensively used in diverse consumer products. Along the life cycle of a nano-enabled product, ENMs can be released and subsequently accumulate in the environment. Material flow models also indicate that a variety of ENMs may accumulate in waste streams. Therefore, a new type of waste, so-called nanowaste, is generated when end-of-life ENMs and nano-enabled products are disposed of. In terms of the precautionary principle, environmental monitoring of end-of-life ENMs is crucial to allow assessment of the potential impact of nanowaste on our ecosystem. Trace analysis and quantification of nanoparticulate species is very challenging because of the variety of ENM types that are used in products and low concentrations of nanowaste expected in complex environmental media. In the framework of this paper, challenges in nanowaste characterisation and appropriate analytical techniques which can be applied to nanowaste analysis are summarised. Recent case studies focussing on the characterisation of ENMs in waste streams are discussed. Most studies aim to investigate the fate of nanowaste during incineration, particularly considering aerosol measurements; whereas, detailed studies focusing on the potential release of nanowaste during waste recycling processes are currently not available. In terms of suitable analytical methods, separation techniques coupled to spectrometry-based methods are promising tools to detect nanowaste and determine particle size distribution in liquid waste samples. Standardised leaching protocols can be applied to generate soluble fractions stemming from solid wastes, while
International Nuclear Information System (INIS)
Tanley, Simon W. M.; Schreurs, Antoine M. M.; Kroon-Batenburg, Loes M. J.; Helliwell, John R.
2012-01-01
Binding of cisplatin to His15 in hen egg-white lysozyme in aqueous media is observed after prolonged chemical exposure for 15 months, in contrast to the lack of binding that was observed after 4 d in a previous study. Binding of carboplatin is seen in greater detail in the case of room-temperature data collection compared with cryo data collection. The anticancer complexes cisplatin and carboplatin are known to bind to both the N δ and the N ∊ atoms of His15 of hen egg-white lysozyme (HEWL) in the presence of dimethyl sulfoxide (DMSO). However, neither binds in aqueous media after 4 d of crystallization and crystal growth, suggesting that DMSO facilitates cisplatin/carboplatin binding to the N atoms of His15 by an unknown mechanism. Crystals of HEWL cocrystallized with cisplatin in both aqueous and DMSO media, of HEWL cocrystallized with carboplatin in DMSO medium and of HEWL cocrystallized with cisplatin and N-acetylglucosamine (NAG) in DMSO medium were stored for between seven and 15 months. X-ray diffraction studies of these crystals were carried out on a Bruker APEX II home-source diffractometer at room temperature. Room-temperature X-ray diffraction data collection removed the need for cryoprotectants to be used, ruling out any effect that the cryoprotectants might have had on binding to the protein. Both cisplatin and carboplatin still bind to both the N δ and N ∊ atoms of His15 in DMSO media as expected, but more detail for the cyclobutanedicarboxylate (CBDC) moiety of carboplatin was observed at the N ∊ binding site. However, two molecules of cisplatin were now observed to be bound to His15 in aqueous conditions. The platinum peak positions were identified using anomalous difference electron-density maps as a cross-check with F o − F c OMIT electron-density maps. The occupancies of each binding site were calculated using SHELXTL. These results show that over time cisplatin binds to both N atoms of His15 of HEWL in aqueous media, whereas this
FcγRll: Characterisation of novel Fc receptor interactions and a new receptor form.
JESSICA CLAIRE ANANIA
2018-01-01
Leukocyte Fc receptors (FcR) bind to immunogloulins (Ig) to link the innate and humoral immune system to help balance the immune system and clear infections. We have characterised a novel FcR for IgG (FcγR) form, designated FcγRIIa3, which contains a 19 amino acid insert. This insert interacts with cytoskeletal structures allowing the receptor to be retained for longer periods of time at the cells surface upon activation, higher cell signalling which causes greater cellular activation. Theref...
Directory of Open Access Journals (Sweden)
Sandra Macedo-Ribeiro
Full Text Available Inhibitors of coagulation factors from blood-feeding animals display a wide variety of structural motifs and inhibition mechanisms. We have isolated a novel inhibitor from the cattle tick Boophilus microplus, one of the most widespread parasites of farm animals. The inhibitor, which we have termed boophilin, has been cloned and overexpressed in Escherichia coli. Mature boophilin is composed of two canonical Kunitz-type domains, and inhibits not only the major procoagulant enzyme, thrombin, but in addition, and by contrast to all other previously characterised natural thrombin inhibitors, significantly interferes with the proteolytic activity of other serine proteinases such as trypsin and plasmin. The crystal structure of the bovine alpha-thrombin.boophilin complex, refined at 2.35 A resolution reveals a non-canonical binding mode to the proteinase. The N-terminal region of the mature inhibitor, Q16-R17-N18, binds in a parallel manner across the active site of the proteinase, with the guanidinium group of R17 anchored in the S(1 pocket, while the C-terminal Kunitz domain is negatively charged and docks into the basic exosite I of thrombin. This binding mode resembles the previously characterised thrombin inhibitor, ornithodorin which, unlike boophilin, is composed of two distorted Kunitz modules. Unexpectedly, both boophilin domains adopt markedly different orientations when compared to those of ornithodorin, in its complex with thrombin. The N-terminal boophilin domain rotates 9 degrees and is displaced by 6 A, while the C-terminal domain rotates almost 6 degrees accompanied by a 3 A displacement. The reactive-site loop of the N-terminal Kunitz domain of boophilin with its P(1 residue, K31, is fully solvent exposed and could thus bind a second trypsin-like proteinase without sterical restraints. This finding explains the formation of a ternary thrombin.boophilin.trypsin complex, and suggests a mechanism for prothrombinase inhibition in vivo.
CCS site characterisation criteria
Energy Technology Data Exchange (ETDEWEB)
Bachu, S.; Hawkes, C.; Lawton, D.; Pooladi-Darvish, M.; Perkins, E.
2009-12-15
IEA GHG recently commissioned the Alberta Research Counil in Canada to conduct a review of storage site selection criteria and site characterisation methods in order to produce a synthesis report. This report reviews the literature on the subject on the site seleciton and characterisation since the publication of the IPCC Special Report on CCS, and provides a synthesis and classification of criteria. 161 refs.
Lozano-Ojalvo, Daniel; Rodríguez, Alicia; Cordero, Mirian; Bernáldez, Victoria; Reyes-Prieto, Mariana; Córdoba, Juan J
2015-02-01
Moulds responsible for black spot spoilage of dry-cured fermented sausages were characterised. For this purpose, samples were taken from those dry-cured fermented sausages which showed black spot alteration. Most of the mould strains were first tentatively identified as Penicillium spp. due to their morphological characteristics in different culture conditions, with one strain as Cladosporium sp. The Cladosporium strain was the only one which provoked blackening in culture media. This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. This mould strain was able to reproduce black spot formation in dry-cured fermented sausage 'salchichón' throughout the ripening process. In addition, a specific and sensitive real-time PCR method was also developed to detect Cladosporium oxysporum responsible for the black spot formation in sausages. This method could be of great interest for the meat industry to detect samples contaminated with this mould before spoilage of product avoiding economic losses for this sector.
Characterisation of the aqueous corrosion process in NdFeB melt spun ribbon and MQI bonded magnets
McCain, Stephen
A major factor limiting the use and longevity of rare earth based magnetic materials is their susceptibility to aqueous corrosion and associated detrimental effects upon the magnetic properties of the material. This process was investigated through a combination of exposure to simulated environmental conditions and hydrogen absorption/desorption studies (HADS) in conjunction with magnetic characterisation. This study utilises NdFeB MQP-B melt-spun ribbon manufactured by Magnequench, in the form of MQI bonded magnets and also in its unbonded state as MQ powder. Specifically, it was concerned with how effective a variety of bonding media (epoxy resin,PTFE, zinc) and surface coatings (PTFE, Qsil, zinc LPPS, Dex-Cool) were at limiting the impact of aqueous corrosion in MQI bonded magnets. To characterise the effect of hydrogen absorption upon the magnetic properties of the MQP-B, hydrogen uptake was induced followed by a series of outgassing heat treatments with subsequent magnetic characterisation accompanied by HADS techniques performed after each outgas. This allowed comparisons to be made between the effects of aqueous corrosion process and hydrogen absorption upon the magnetic properties of the alloy.. This study has clearly demonstrated the link between the abundance of environmental moisture and rate of Hci losses in MQI bonded magnets. In addition to this the key mechanism responsible for the degradation of magnetic properties has been identified. These losses have been attributed to the absorption of hydrogen generated by the dissociation of water in the presence of NdFeB during the aqueous corrosion process. It has been shown that the use of a bonding media that is impermeable to water can limit the effects of aqueous corrosion by limiting water access to the Magnequench particles (MQP) and also the positive effects of the use of suitable surface coatings has been shown to be effective for the same reason..
Social media in disaster risk reduction and crisis management.
Alexander, David E
2014-09-01
This paper reviews the actual and potential use of social media in emergency, disaster and crisis situations. This is a field that has generated intense interest. It is characterised by a burgeoning but small and very recent literature. In the emergencies field, social media (blogs, messaging, sites such as Facebook, wikis and so on) are used in seven different ways: listening to public debate, monitoring situations, extending emergency response and management, crowd-sourcing and collaborative development, creating social cohesion, furthering causes (including charitable donation) and enhancing research. Appreciation of the positive side of social media is balanced by their potential for negative developments, such as disseminating rumours, undermining authority and promoting terrorist acts. This leads to an examination of the ethics of social media usage in crisis situations. Despite some clearly identifiable risks, for example regarding the violation of privacy, it appears that public consensus on ethics will tend to override unscrupulous attempts to subvert the media. Moreover, social media are a robust means of exposing corruption and malpractice. In synthesis, the widespread adoption and use of social media by members of the public throughout the world heralds a new age in which it is imperative that emergency managers adapt their working practices to the challenge and potential of this development. At the same time, they must heed the ethical warnings and ensure that social media are not abused or misused when crises and emergencies occur.
Home media server content management
Tokmakoff, Andrew A.; van Vliet, Harry
2001-07-01
With the advent of set-top boxes, the convergence of TV (broadcasting) and PC (Internet) is set to enter the home environment. Currently, a great deal of activity is occurring in developing standards (TV-Anytime Forum) and devices (TiVo) for local storage on Home Media Servers (HMS). These devices lie at the heart of convergence of the triad: communications/networks - content/media - computing/software. Besides massive storage capacity and being a communications 'gateway', the home media server is characterised by the ability to handle metadata and software that provides an easy to use on-screen interface and intelligent search/content handling facilities. In this paper, we describe a research prototype HMS that is being developed within the GigaCE project at the Telematica Instituut . Our prototype demonstrates advanced search and retrieval (video browsing), adaptive user profiling and an innovative 3D component of the Electronic Program Guide (EPG) which represents online presence. We discuss the use of MPEG-7 for representing metadata, the use of MPEG-21 working draft standards for content identification, description and rights expression, and the use of HMS peer-to-peer content distribution approaches. Finally, we outline explorative user behaviour experiments that aim to investigate the effectiveness of the prototype HMS during development.
Mannose-Binding Lectin Levels and Carotid Intima-Media Thickness in Type 2 Diabetic Patients
Directory of Open Access Journals (Sweden)
Miklós Káplár
2016-01-01
Full Text Available Introduction. Mannose-binding lectin (MBL activates complement system and has been suggested to play a role in vascular complications in diabetics. Carotid intima-media thickness (cIMT detects subclinical atherosclerosis. We evaluated the association of MBL and IMT in type 2 diabetic (T2DM patients. Methods. Serum MBL levels and cIMT were measured in a total of 103 diabetics and in 98 age-matched healthy controls. Results. There was no significant difference in MBL level in T2DM versus controls. As expected, IMT was significantly higher in T2DM patients than in controls (P=0.001. In T2DM, the lowest cIMT was seen in patients with normal MBL level (500–1000 while cIMT continuously increased with both high MBL and absolute MBL deficiency states. This was especially significant in high MBL versus normal MBL T2DM patients (P=0.002. According to multiple regression analysis the main predictors of IMT in T2DM are age (P<0.003, ApoA level (P=0.023, and the MBL (P=0.036. Conclusions. Our results suggest a dual role of MBL as a risk factor for cIMT in T2DM. MBL may also be used as a marker of macrovascular disease, as both low and high levels indicate the susceptibility for atherosclerosis in T2DM.
Characterisation: Challenges and Opportunities - A UK Perspective
International Nuclear Information System (INIS)
Emptage, Matthew; Loudon, David; Mcleod, Richard; Milburn, Helen
2016-01-01
Characterisation plays a very important role in the nuclear industry supporting: the development and implementation of decommissioning strategies/plans (and the optimisation of associated costs through reduction in technical risks); regulatory compliance demonstration; waste prevention/minimisation; evaluation and optimisation of worker radiation doses; and maintaining public confidence. Recognising these important drivers, the UK regulators are working with the UK Nuclear Decommissioning Authority (NDA) to undertake a review of characterisation practice in the UK nuclear (decommissioning) industry. The objective of the characterisation review is to understand the current characterisation challenges and to determine strategic and tactical opportunities (including sharing of standards and guidance, capabilities, learning from experience, good practice, research and development, training, quality assurance) to optimise characterisation practice. The work is being undertaken through review of nuclear operator's characterisation practice, with input from the NDA, the UK regulators, nuclear operators and representatives from the supply chain, and through consideration of good practice case studies. To support this, a catalogue of relevant national/international guidance documents is also be compiled. Finally a workshop with representatives from all parties has taken place to consider the findings and establish a common understanding of challenges and opportunities and to start to consider how they can be addressed. The review is establishing a collective (UK regulator's, NDA; nuclear operator's and supply chain) understanding of opportunities to improve characterisation practice in the UK. The characterisation review process is described and early results are presented and discussed. Subsequent work in 2016 will be required to prioritise the opportunities and to build a consensus to facilitate development and implementation of an improvement plan. The aim
Chiantore, Oscar; Riedo, Chiara; Scalarone, Dominique
2009-07-01
Plant gums are complex polysaccharides used in the field of cultural heritage especially as binding media. Classification of polysaccharides may be achieved on the basis of monosaccharides composition after cleavage of glycosidic bond. Characterization of plant gums in works of art is complicated by the necessity of to use a method minimally invasive and requiring a small mount of sample. Pyrolisys is an useful method to obtain polysaccharides decomposition and generally pyrolysis products can be identified by the use of gas chromatography-mass spectrometry. This paper describes a method where two plant gums, arabic and tragacanth, were pyrolized in presence of silylating agents (HMDS e BSTFA alone and with TMCS as catalyst) using an on-line Py-GC/MS apparatus. Some characteristic trimethylsilyl derivatives of monosaccharides were identified on the basis of mass spectra. The presence of characteristic pyrolysis products of sugars allows to distinguish the two gums.
The binding mechanism of a peptidic cyclic serine protease inhibitor
DEFF Research Database (Denmark)
Jiang, Longguang; Svane, Anna Sigrid P.; Sørensen, Hans Peter
2011-01-01
Serine proteases are classical objects for studies of catalytic and inhibitory mechanisms as well as interesting as therapeutic targets. Since small-molecule serine protease inhibitors generally suffer from specificity problems, peptidic inhibitors, isolated from phage-displayed peptide libraries......, have attracted considerable attention. Here, we have investigated the mechanism of binding of peptidic inhibitors to serine protease targets. Our model is upain-1 (CSWRGLENHRMC), a disulfide-bond-constrained competitive inhibitor of human urokinase-type plasminogen activator with a noncanonical...... inhibitory mechanism and an unusually high specificity. Using a number of modified variants of upain-1, we characterised the upain-1-urokinase-type plasminogen activator complex using X-ray crystal structure analysis, determined a model of the peptide in solution by NMR spectroscopy, and analysed binding...
Nevin, A.; Anglos, D.; Cather, S.; Burnstock, A.
2008-07-01
Spectrofluorimetric analysis of proteinaceous binding media is particularly promising because proteins employed in paintings are often fluorescent and media from different sources have significantly different fluorescence spectral profiles. Protein-based binding media derived from eggs, milk and animal tissue have been used for painting and for conservation, but their analysis using non-destructive techniques is complicated by interferences with pigments, their degradation and their low concentration. Changes in the fluorescence excitation emission spectra of films of binding media following artificial ageing to an equivalent of 50 and 100 years of museum lighting include the reduction of bands ascribed to tyrosine, tryptophan and Maillard reaction products and an increase in fluorescent photodegradation. Fluorescence of naturally aged paint is dependent on the nature of the pigment present and, with egg-based media, in comparison with un-pigmented films, emissions ascribed to amino acids are more pronounced.
Use of social media in urology: data from the American Urological Association (AUA).
Loeb, Stacy; Bayne, Christopher E; Frey, Christine; Davies, Benjamin J; Averch, Timothy D; Woo, Henry H; Stork, Brian; Cooperberg, Matthew R; Eggener, Scott E
2014-06-01
To characterise the use of social media among members of the American Urological Association (AUA), as the use of social media in medicine has greatly expanded in recent years. In December 2012 to January 2013, the AUA e-mailed a survey with 34 questions on social media use to 2000 randomly selected urologists and 2047 resident/fellow members. Additional data was collected from Symplur analytics on social media use surrounding the AUA Annual Meeting in May 2013. In all, 382 (9.4%) surveys were completed, indicating 74% of responders had an online social media account. The most commonly used social media platforms were Facebook (93%), followed in descending order by LinkedIn (46%), Twitter (36%) and Google+ (26%). Being aged social media use (83% vs 56%), with greater uptake among residents/fellows compared with attendings (86% vs 66%). Only 28% of respondents used social media partly or entirely for professional purposes. During the 2013 AUA Annual Meeting, there were >5000 tweets from >600 distinct contributors. As of early 2013, among respondents to an e-mail survey, most urologists and urology trainees used some form of social media, and its use in urology conferences has greatly expanded. © 2013 The Authors. BJU International © 2013 BJU International.
The RNA-binding protein repertoire of Arabidopsis thaliana
Marondedze, Claudius
2016-07-11
RNA-binding proteins (RBPs) have essential roles in determining the fate of RNA from synthesis to decay and have been studied on a protein-by-protein basis, or computationally based on a number of well-characterised RNA-binding domains. Recently, high-throughput methods enabled the capture of mammalian RNA-binding proteomes. To gain insight into the role of Arabidopsis thaliana RBPs at the systems level, we have employed interactome capture techniques using cells from different ecotypes grown in cultures and leaves. In vivo UV-crosslinking of RNA to RBPs, oligo(dT) capture and mass spectrometry yielded 1,145 different proteins including 550 RBPs that either belong to the functional category ‘RNA-binding’, have known RNA-binding domains or have orthologs identified in mammals, C. elegans, or S. cerevisiae in addition to 595 novel candidate RBPs. We noted specific subsets of RBPs in cultured cells and leaves and a comparison of Arabidopsis, mammalian, C. elegans, and S. cerevisiae RBPs reveals a common set of proteins with a role in intermediate metabolism, as well as distinct differences suggesting that RBPs are also species and tissue specific. This study provides a foundation for studies that will advance our understanding of the biological significance of RBPs in plant developmental and stimulus specific responses.
2007-03-01
Characterisation. In Nanotechnology Aerospace Applications – 2006 (pp. 4-1 – 4-8). Educational Notes RTO-EN-AVT-129bis, Paper 4. Neuilly-sur-Seine, France: RTO...the Commercialisation Processes Concept IDEA Proof-of- Principle Trial Samples Engineering Verification Samples Design Verification Samples...SEIC Systems Engineering for commercialisation Design Houses, Engineering & R&D USERS & Integrators SE S U R Integrators Fabs & Wafer Processing Die
The Role of Mannose-Binding Lectin Serum Level in Tubotympanic Chronic Suppurative Otitis Media
Directory of Open Access Journals (Sweden)
Anton Budhi Darmawan
2018-01-01
Full Text Available Background. Chronic suppurative otitis media (CSOM is a common public health problem worldwide and a major cause of hearing impairment especially in developing countries. The role of Mannose-Binding Lectin (MBL, a component of innate immunity, in CSOM has not been studied. The aim of the study was to examine whether MBL deficiency was more frequently present in cases group of tubotympanic CSOM patients rather than healthy subjects. Material and Methods. This was an analytic observational study. Subjects were enrolled in the Otorhinolaryngology Clinic at Margono Soekarjo Hospital, Purwokerto, Indonesia. An independent t-test was used to compare the mean of MBL serum concentration between tubotympanic CSOM subjects and control. Results. From 36 tubotympanic CSOM patients, there were 8 (22.22% patients with MBL deficiency (MBL level < 100 ng/ml, while no deficiency was found in the control group. The mean of MBL level in cases group was 354.88 ng/ml, with the lowest level being 0.001 ng/ml and the highest level 690.24 ng/ml, while in the control group MBL level mean was 376.27 with the lowest level being 188.71 and the highest level 794.54 ng/ml. Conclusion. There was no significant difference of MBL serum level between tubotympanic CSOM and control group. However, the presence of subjects with MBL deficiency in the tubotympanic CSOM group might be considered as playing a role in the tubotympanic CSOM.
An extended characterisation theorem for quantum logics
International Nuclear Information System (INIS)
Sharma, C.S.; Mukherjee, M.K.
1977-01-01
Two theorems are proved. In the first properties of an important mapping from an orthocomplemented lattice to itself are studied. In the second the characterisation theorem of Zierler (Pacific J. Math.; 11:1151 (1961)) is extended to obtain a very useful theorem characterising orthomodular lattices. Since quantum logics are merely sigma-complete orthomodular lattices, the principal result is, for application in quantum physics, a characterisation theorem for quantum logics. (author)
Radiological characterisation - Know your objective
International Nuclear Information System (INIS)
Lindow, Veronica; Moeller, Jennifer
2012-01-01
When developing a programme for mapping the radiological characteristics of a facility to be decommissioned it is important to take into account the objectives of the programme. Will the results be used to plan for radiological control and selection of appropriate decontamination and dismantling techniques? Will the radiological inventory be used for dimensioning of future waste repositories? These are two examples of the applications for such studies, which could require that a radiological characterisation programme be adapted to provide the data appropriate to the intended use. The level of detail and scope needed for a radiological characterisation will also vary depending on how the data will be used. An application to free-release a facility requires a comprehensive survey and well documented analysis in order to ensure that no radioactive contamination above prescribed levels is present. A bounding calculation to determine the maximum anticipated volumes and activity of radioactive waste requires a different approach. During the past few years, older decommissioning studies for the Swedish nuclear power plants have been updated (or are in the process of being updated). The decommissioning study's main purpose is to estimate the cost for decommissioning. The cost estimation is based on material and activity inventories, which in turn is based on previous and, in some cases, updated radiological characterisations of the facilities. The radiological inventory is an important part of the study as it affects the cost of decommissioning but also the uncertainties and accuracy of the cost estimation. The presentation will discuss the challenges in specifying a radiological characterisation programme with multiple objectives, together with insights on how data delivered can be applied to yield results suitable for the intended purpose, without introducing excessive conservatism. The intent of the presentation is to define issues that can be of use in various aspects
Media analysis of the representations of fusion and other future energy technologies
Energy Technology Data Exchange (ETDEWEB)
Delicado, Ana; Schmidt, Luisa; Pereira, Sergio [Institute of Social Sciences of the University of Lisbon, Av. Prof. Anibal de Bettencourt, 9 1600-189 Lisbon (Portugal); Oltra, Christian; Prades, Ana [CISOT-CIEMAT. Gran Via de les Corts Catalanes 604, 4, 2, 08007 Barcelona (Spain)
2015-07-01
Media representations of energy have a relevant impact on public opinion and public support for investment in new energy sources. Fusion energy is one among several emerging energy technologies that requires a strong public investment on its research and development. This paper aims to characterise and compare the media representations of fusion and other emerging energy technologies in Portugal and in Spain. The emerging energy technologies selected for analysis are wave and tidal power, hydrogen, deep sea offshore wind power, energy applications of nanotechnology, bio-fuels from microalgae and IV generation nuclear fission. This work covered the news published in a selection of newspapers in Portugal and Spain between January 2007 and June 2013. (authors)
Media analysis of the representations of fusion and other future energy technologies
International Nuclear Information System (INIS)
Delicado, Ana; Schmidt, Luisa; Pereira, Sergio; Oltra, Christian; Prades, Ana
2015-01-01
Media representations of energy have a relevant impact on public opinion and public support for investment in new energy sources. Fusion energy is one among several emerging energy technologies that requires a strong public investment on its research and development. This paper aims to characterise and compare the media representations of fusion and other emerging energy technologies in Portugal and in Spain. The emerging energy technologies selected for analysis are wave and tidal power, hydrogen, deep sea offshore wind power, energy applications of nanotechnology, bio-fuels from microalgae and IV generation nuclear fission. This work covered the news published in a selection of newspapers in Portugal and Spain between January 2007 and June 2013. (authors)
Characterisation of Tmmmian Local Sorghmn Varieties
African Journals Online (AJOL)
Many local varieties of sorghum grown in Tanzania have not been characterised in terms of their end uses. This study was conducted to characterise 14 such varieties. Three improved varieties commonly grown in this country were includedfor comparison. Physical analyses that included 100-grain weight, percent dehulling ...
Directory of Open Access Journals (Sweden)
Mads Gabrielsen
Full Text Available Thiol peroxidase, Tpx, has been shown to be a target protein of the salicylidene acylhydrazide class of antivirulence compounds. In this study we present the crystal structures of Tpx from Y. pseudotuberculosis (ypTpx in the oxidised and reduced states, together with the structure of the C61S mutant. The structures solved are consistent with previously solved atypical 2-Cys thiol peroxidases, including that for "forced" reduced states using the C61S mutant. In addition, by investigating the solution structure of ypTpx using small angle X-ray scattering (SAXS, we have confirmed that reduced state ypTpx in solution is a homodimer. The solution structure also reveals flexibility around the dimer interface. Notably, the conformational changes observed between the redox states at the catalytic triad and at the dimer interface have implications for substrate and inhibitor binding. The structural data were used to model the binding of two salicylidene acylhydrazide compounds to the oxidised structure of ypTpx. Overall, the study provides insights into the binding of the salicylidene acylhydrazides to ypTpx, aiding our long-term strategy to understand the mode of action of this class of compounds.
Jones, Stuart George; Ito, Takafumi; Phillips, Aled Owain
2003-09-01
Increased expression of the connective tissue polysaccharide hyaluronan (HA) in the renal corticointerstitium is associated with progressive renal fibrosis. Numerous studies have demonstrated involvement proximal tubular epithelial cells in the fibrotic process and in the current study we have characterised their expression of the HA receptor, CD44, and examined changes in CD44 expression and function in response to either IL-1beta or glucose. Characterisation of CD44 splice variant expression was carried out in primary cultures of human proximal tubular cells (PTC) and HK2 cells. Binding and internalisation HA was examined by addition of exogenous of fluorescein-HA (fl-HA), and expression of CD44 examined by immunoblot analysis and flow cytometry. Alteration in "functional" CD44 was determined by immunoprecipitation of CD44 following stimulation in the presence of fl-HA. PTC, both primary culture and the PTC cell line, HK2, express at least 5 CD44 splice variants, the expression of which are not altered by addition of either IL-1beta or 25mM D-glucose. Addition of either stimulus increased cell surface binding and internalisation of fl-HA and increased expression of functionally active CD44. Increased binding and internalisation of fl-HA, was blocked by anti-CD44 antibody, and by the inhibition of O-glycosylation. The data demonstrate that stimuli inducing PTC HA synthesis also regulate PTC-HA interactions. Furthermore increased HA binding and internalisation is the result of post-translational modification of CD44 by O-glycosylation, rather than by alteration in expression of CD44 at the cell surface, or by alternate use of CD44 splice variants.
Enhanced binding by dextran-grafting to Protein A affinity chromatographic media.
Zhao, Lan; Zhu, Kai; Huang, Yongdong; Li, Qiang; Li, Xiunan; Zhang, Rongyue; Su, Zhiguo; Wang, Qibao; Ma, Guanghui
2017-04-01
Dextran-grafted Protein A affinity chromatographic medium was prepared by grafting dextran to agarose-based matrix, followed by epoxy-activation and Protein A coupling site-directed to sulfhydryl groups of cysteine molecules. An enhancement of both the binding performance and the stability was achieved for this dextran-grafted Protein A chromatographic medium. Its dynamic binding capacity was 61 mg immunoglobulin G/mL suction-dried gel, increased by 24% compared with that of the non-grafted medium. The binding capacity of dextran-grafted medium decreased about 7% after 40 cleaning-in-place cycles, much lower than that of the non-grafted medium as decreased about 15%. Confocal laser scanning microscopy results showed that immunoglobulin G was bound to both the outside and the inside of dextran-grafted medium faster than that of non-grafted one. Atomic force microscopy showed that this dextran-grafted Protein A medium had much rougher surface with a vertical coordinate range of ±80 nm, while that of non-grafted one was ±10 nm. Grafted dextran provided a more stereo surface morphology and immunoglobulin G molecules were more easily to be bound. This high-performance dextran-grafted Protein A affinity chromatographic medium has promising applications in large-scale antibody purification. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Larsson, Arne; Weber, Inge; Emptage, Matthew; )
2016-01-01
Full text of publication follows: The Task Group on Radiological Characterisation and Decommissioning within the Nuclear Energy Agency (NEA) Working Party on Decommissioning was established to identify and present Best Practice in radiological characterisation at different stages of decommissioning as well as areas that could or should be developed further by international cooperation and coordination. The first phase of the project was focusing on general aspects of strategies for radiological characterisation in decommissioning of nuclear facilities. The second phase of the project focus on strategies for optimising radiological characterisation in a waste and materials end-state perspective, building on previous task group findings. One of the activities within the second phase has been to conduct a survey with the main objective to identify Best Practice. The survey was in the form of a questionnaire in two versions, one for regulators and one for owners/implementers. Sections of the questionnaire to gather views on Best Practice: - Initiation of a characterisation program; - Planning and preparation; - Implementation (i.e. conducting the characterisation measurements and samplings); - Data assessment phase (evaluation of the results); - Quality assurance. A section on the national legislation in the regulator version and a case study section in the owner version complement the questionnaire in order to get an overview of the regulatory frameworks and also practical experiences. The extensive questionnaire was distributed to a wide audience of recognised experts throughout the member states. 53 responses were received from in total 12 countries. Most responses were from Europe but also Asia and North America were represented. The preliminary conclusions are: - There is a solid experience in radiological characterisation among regulators as well as owners/implementers; - Responses demonstrates to large extent a common view of regulators and owners
Karetsou, Zoe; Emmanouilidou, Anastasia; Sanidas, Ioannis; Liokatis, Stamatis; Nikolakaki, Eleni; Politou, Anastasia S; Papamarcaki, Thomais
2009-04-09
The assembly of nucleosomes to higher-order chromatin structures is finely tuned by the relative affinities of histones for chaperones and nucleosomal binding sites. The myeloid leukaemia protein SET/TAF-Ibeta belongs to the NAP1 family of histone chaperones and participates in several chromatin-based mechanisms, such as chromatin assembly, nucleosome reorganisation and transcriptional activation. To better understand the histone chaperone function of SET/TAF-Ibeta, we designed several SET/TAF-Ibeta truncations, examined their structural integrity by circular Dichroism and assessed qualitatively and quantitatively the histone binding properties of wild-type protein and mutant forms using GST-pull down experiments and fluorescence spectroscopy-based binding assays. Wild type SET/TAF-Ibeta binds to histones H2B and H3 with Kd values of 2.87 and 0.15 microM, respectively. The preferential binding of SET/TAF-Ibeta to histone H3 is mediated by its central region and the globular part of H3. On the contrary, the acidic C-terminal tail and the amino-terminal dimerisation domain of SET/TAF-Ibeta, as well as the H3 amino-terminal tail, are dispensable for this interaction. This type of analysis allowed us to assess the relative affinities of SET/TAF-Ibeta for different histones and identify the domains of the protein required for effective histone recognition. Our findings are consistent with recent structural studies of SET/TAF-Ibeta and can be valuable to understand the role of SET/TAF-Ibeta in chromatin function.
DEFF Research Database (Denmark)
Severinsen, Kasper; Müller, Heidi Kaastrup; Wiborg, Ove
2008-01-01
and [(3)H]-escitalopram binding in transiently transfected human embryonic kidney cells; HEK-293-MSR. Residues responsible for altered affinities inhibitors were pinpointed by generating cross-species chimeras and subsequent point mutations by site directed mutagenesis. drSERT has a higher affinity...
Microbiology of otitis media in Indigenous Australian children: review.
Jervis-Bardy, J; Carney, A S; Duguid, R; Leach, A J
2017-07-01
To review research addressing the polymicrobial aetiology of otitis media in Indigenous Australian children in order to identify research gaps and inform best practice in effective prevention strategies and therapeutic interventions. Literature review. Studies of aspirated middle-ear fluid represented a minor component of the literature reviewed. Most studies relied upon specimens from middle-ear discharge or the nasopharynx. Culture-based middle-ear discharge studies have found that non-typeable Haemophilus influenzae and Streptococcus pneumoniae predominate, with Moraxella catarrhalis, Staphylococcus aureus and Streptococcus pyogenes isolated in a lower proportion of samples. Alloiococcus otitidis was detected in a number of studies; however, its role in otitis media pathogenesis remains controversial. Nasopharyngeal colonisation is a risk factor for otitis media in Indigenous infants, and bacterial load of otopathogens in the nasopharynx can predict the ear state of Indigenous children. Most studies have used culture-based methods and specimens from middle-ear discharge or the nasopharynx. Findings from these studies are consistent with international literature, but reliance on culture may incorrectly characterise the microbiology of this condition. Advances in genomic technologies are now providing microbiologists with the ability to analyse the entire mixed bacterial communities ('microbiomes') of samples obtained from Indigenous children with otitis media.
Characterisation of the Native Lipid Moiety of Echinococcus granulosus Antigen B
Obal, Gonzalo; Ramos, Ana Lía; Silva, Valeria; Lima, Analía; Batthyany, Carlos; Bessio, María Inés; Ferreira, Fernando; Salinas, Gustavo; Ferreira, Ana María
2012-01-01
Antigen B (EgAgB) is the most abundant and immunogenic antigen produced by the larval stage (metacestode) of Echinococcus granulosus. It is a lipoprotein, the structure and function of which have not been completely elucidated. EgAgB apolipoprotein components have been well characterised; they share homology with a group of hydrophobic ligand binding proteins (HLBPs) present exclusively in cestode organisms, and consist of different isoforms of 8-kDa proteins encoded by a polymorphic multigene family comprising five subfamilies (EgAgB1 to EgAgB5). In vitro studies have shown that EgAgB apolipoproteins are capable of binding fatty acids. However, the identity of the native lipid components of EgAgB remains unknown. The present work was aimed at characterising the lipid ligands bound to EgAgB in vivo. EgAgB was purified to homogeneity from hydatid cyst fluid and its lipid fraction was extracted using chloroform∶methanol mixtures. This fraction constituted approximately 40–50% of EgAgB total mass. High-performance thin layer chromatography revealed that the native lipid moiety of EgAgB consists of a variety of neutral (mainly triacylglycerides, sterols and sterol esters) and polar (mainly phosphatidylcholine) lipids. Gas-liquid chromatography analysis showed that 16∶0, 18∶0 and 18∶1(n-9) are the most abundant fatty acids in EgAgB. Furthermore, size exclusion chromatography coupled to light scattering demonstrated that EgAgB comprises a population of particles heterogeneous in size, with an average molecular mass of 229 kDa. Our results provide the first direct evidence of the nature of the hydrophobic ligands bound to EgAgB in vivo and indicate that the structure and composition of EgAgB lipoprotein particles are more complex than previously thought, resembling high density plasma lipoproteins. Results are discussed considering what is known on lipid metabolism in cestodes, and taken into account the Echinococcus spp. genomic information regarding both lipid
Characterisation of the native lipid moiety of Echinococcus granulosus antigen B.
Directory of Open Access Journals (Sweden)
Gonzalo Obal
Full Text Available Antigen B (EgAgB is the most abundant and immunogenic antigen produced by the larval stage (metacestode of Echinococcus granulosus. It is a lipoprotein, the structure and function of which have not been completely elucidated. EgAgB apolipoprotein components have been well characterised; they share homology with a group of hydrophobic ligand binding proteins (HLBPs present exclusively in cestode organisms, and consist of different isoforms of 8-kDa proteins encoded by a polymorphic multigene family comprising five subfamilies (EgAgB1 to EgAgB5. In vitro studies have shown that EgAgB apolipoproteins are capable of binding fatty acids. However, the identity of the native lipid components of EgAgB remains unknown. The present work was aimed at characterising the lipid ligands bound to EgAgB in vivo. EgAgB was purified to homogeneity from hydatid cyst fluid and its lipid fraction was extracted using chloroform∶methanol mixtures. This fraction constituted approximately 40-50% of EgAgB total mass. High-performance thin layer chromatography revealed that the native lipid moiety of EgAgB consists of a variety of neutral (mainly triacylglycerides, sterols and sterol esters and polar (mainly phosphatidylcholine lipids. Gas-liquid chromatography analysis showed that 16∶0, 18∶0 and 18∶1(n-9 are the most abundant fatty acids in EgAgB. Furthermore, size exclusion chromatography coupled to light scattering demonstrated that EgAgB comprises a population of particles heterogeneous in size, with an average molecular mass of 229 kDa. Our results provide the first direct evidence of the nature of the hydrophobic ligands bound to EgAgB in vivo and indicate that the structure and composition of EgAgB lipoprotein particles are more complex than previously thought, resembling high density plasma lipoproteins. Results are discussed considering what is known on lipid metabolism in cestodes, and taken into account the Echinococcus spp. genomic information regarding
Fernández, P E; Portiansky, E L; Barbeito, C G; Gimeno, E J
1998-10-01
This paper describes an approach to study the cells present in the subinvolution of placental sites (SIPS), a pathological post partum condition of the bitch that causes persistent hemorrhage of the genital tract. The expression of intermediate filament proteins was examined to determine the fetal or maternal origin of the cytotrophoblastic-like cells found in this entity. Lectin binding on tissue sections were also studied to characterise cellular glycoconjugates. Image processing and morphometrical analysis of the histological images were done. The results revealed that the cells observed in bitches with SIPS expressed pancytokeratins but neither vimentin nor desmin, in coincidence with normal cytotrophoblasts. The lectin binding pattern of both types of cells was similar, with the only exception of Arachis hypogaea agglutinin (PNA) and Triticum vulgaris agglutinin (WGA). These observations, in addition to the non statistically significant differences between morphometrical characteristics of cytotrophoblastic and cytotrophoblastic-like cells in SIPS, might suggest the fetal origin of the latter cells which could play a role in the pathogenesis of this entity.
Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J
2008-02-01
Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.
Directory of Open Access Journals (Sweden)
Jose L Ortega Roldan
Full Text Available SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination.
Karetsou, Zoe; Emmanouilidou, Anastasia; Sanidas, Ioannis; Liokatis, Stamatis; Nikolakaki, Eleni; Politou, Anastasia S; Papamarcaki, Thomais
2009-01-01
Background The assembly of nucleosomes to higher-order chromatin structures is finely tuned by the relative affinities of histones for chaperones and nucleosomal binding sites. The myeloid leukaemia protein SET/TAF-Iβ belongs to the NAP1 family of histone chaperones and participates in several chromatin-based mechanisms, such as chromatin assembly, nucleosome reorganisation and transcriptional activation. To better understand the histone chaperone function of SET/TAF-Iβ, we designed several SET/TAF-Iβ truncations, examined their structural integrity by circular Dichroism and assessed qualitatively and quantitatively the histone binding properties of wild-type protein and mutant forms using GST-pull down experiments and fluorescence spectroscopy-based binding assays. Results Wild type SET/TAF-Iβ binds to histones H2B and H3 with Kd values of 2.87 and 0.15 μM, respectively. The preferential binding of SET/TAF-Iβ to histone H3 is mediated by its central region and the globular part of H3. On the contrary, the acidic C-terminal tail and the amino-terminal dimerisation domain of SET/TAF-Iβ, as well as the H3 amino-terminal tail, are dispensable for this interaction. Conclusion This type of analysis allowed us to assess the relative affinities of SET/TAF-Iβ for different histones and identify the domains of the protein required for effective histone recognition. Our findings are consistent with recent structural studies of SET/TAF-Iβ and can be valuable to understand the role of SET/TAF-Iβ in chromatin function. PMID:19358706
Characterisation of semiconductor materials for ionising radiation detectors
International Nuclear Information System (INIS)
Vaitkus, J.; Gaubas, E.; Jasinskaite, R.; Juska, G.; Kazukauskas, V.; Puras, R.; Rahman, M.; Sakalauskas, S.; Smith, K.
2002-01-01
Methods for the detection and characterisation of semiconductor material parameters and inhomogeneities are analysed. The peculiarities of different 'classical' material and structure characterisation methods are discussed. The methods of lifetime and surface recombination mapping and electric field distribution in the samples are presented. Some results of investigations of GaAs, Si and SiC are used for the characterisation of different peculiarities or methods
New growing media and value added organic waste processing
Blok, C.; Rijpsma, E.; Ketelaars, J.J.M.H.
2016-01-01
Public pressure to use peat alternatives in horticultural rooting media offers room for the re-use of local organic waste materials. The re-use of organic wastes requires value added processing such as composting, co-composting, digestion, fractioning/sieving, pressing, binding, stabilising by
FCJ-146 Mannheim’s Paradox: Ideology, Utopia, Media Technologies, and the Arab Spring.
Directory of Open Access Journals (Sweden)
Rowan Wilken
2012-07-01
Full Text Available This article explores the complicated historical relationship between ideology and utopia in European thought, and what this relationship can teach us when faced with the exuberant promises and hype that characterise new media technologies. The article is structured in two parts. The first develops a detailed account of how this pairing of ideology and utopia has been theorised in the influential (if contentious earlier work of Karl Mannheim, and how the work and ideas of Mannheim have been taken up (and critiqued by more recent critics, including Paul Ricoeur and others. The second examines the use of media technologies associated with the so-called ‘Arab Spring’. The article concludes by considering the ongoing merit of, but challenges we face in, engaging critically with these twin ideas of ideology and utopia in unison, and in relation to media technologies and cultures.
Directory of Open Access Journals (Sweden)
Lu-Yun Lian
Full Text Available NCS-1 is a member of the neuronal calcium sensor (NCS family of EF-hand Ca(2+ binding proteins which has been implicated in several physiological functions including regulation of neurotransmitter release, membrane traffic, voltage gated Ca(2+ channels, neuronal development, synaptic plasticity, and learning. NCS-1 binds to the dopamine D2 receptor, potentially affecting its internalisation and controlling dopamine D2 receptor surface expression. The D2 receptor binds NCS-1 via a short 16-residue cytoplasmic C-terminal tail. We have used NMR and fluorescence spectroscopy to characterise the interactions between the NCS-1/Ca(2+ and D2 peptide. The data show that NCS-1 binds D2 peptide with a K(d of ∼14.3 µM and stoichiometry of peptide binding to NCS-1 of 2:1. NMR chemical shift mapping confirms that D2 peptide binds to the large, solvent-exposed hydrophobic groove, on one face of the NCS-1 molecule, with residues affected by the presence of the peptide spanning both the N and C-terminal portions of the protein. The NMR and mutagenesis data further show that movement of the C-terminal helix 11 of NCS-1 to fully expose the hydrophobic groove is important for D2 peptide binding. Molecular docking using restraints derived from the NMR chemical shift data, together with the experimentally-derived stoichiometry, produced a model of the complex between NCS-1 and the dopamine receptor, in which two molecules of the receptor are able to simultaneously bind to the NCS-1 monomer.
Characterisation of wastewater for modelling of wastewater ...
African Journals Online (AJOL)
Bio-process modelling is increasingly used in design, modification and troubleshooting of wastewater treatment plants (WWTPs). Characterisation of the influent wastewater to a WWTP is an important part of developing such a model. The characterisation required for modelling is more detailed than that routinely employed ...
Characterisation and application of NovaFiber lignin
Gosselink, R.J.A.; Snijder, M.H.B.; Kranenbarg, A.; Keijsers, E.R.P.; Jong, de E.; Stigsson, L.L.
2004-01-01
Sulphur-free lignin coming from a novel alkaline-pulping process called NovaFiber, which has been developed by KIRAM AB, has been characterised and evaluated for potential applications. A Kraft lignin has been used for comparison. Considering the characterisation results of a NovaFiber softwood and
Characterisation of nanomaterial hydrophobicity using engineered surfaces
Energy Technology Data Exchange (ETDEWEB)
Desmet, Cloé; Valsesia, Andrea; Oddo, Arianna; Ceccone, Giacomo; Spampinato, Valentina; Rossi, François; Colpo, Pascal, E-mail: pascal.colpo@ec.europa.eu [Directorate Health, Consumer and Reference Materials, Consumer Products Safety Unit (Italy)
2017-03-15
Characterisation of engineered nanomaterials (NMs) is of outmost importance for the assessment of the potential risks arising from their extensive use. NMs display indeed a large variety of physico-chemical properties that drastically affect their interaction with biological systems. Among them, hydrophobicity is an important property that is nevertheless only slightly covered by the current physico-chemical characterisation techniques. In this work, we developed a method for the direct characterisation of NM hydrophobicity. The determination of the nanomaterial hydrophobic character is carried out by the direct measurement of the affinity of the NMs for different collectors. Each collector is an engineered surface designed in order to present specific surface charge and hydrophobicity degrees. Being thus characterised by a combination of surface energy components, the collectors enable the NM immobilisation with surface coverage in relation to their hydrophobicity. The experimental results are explained by using the extended DLVO theory, which takes into account the hydrophobic forces acting between NMs and collectors.
DEFF Research Database (Denmark)
Andersen, Cecil Krarup; Bonaduce, Ilaria; Andreotti, Alessia
2017-01-01
of the canvas is suspected to respond dimensionally to changes in relative humidity. In this study, pigments, fillers and binding media in the preparation layers of nine paintings by different artists were identified using scanning electron microscopy with energy dispersive X-ray spectroscopy, Fourier transform...
International Nuclear Information System (INIS)
Soos, M.; Siddle, K.
1983-01-01
Twelve mouse monoclonal antibodies for human luteinising hormone were produced. The affinities varied from 4 X 10 7 to 1 X 10 10 l/mol. The specificity of each antibody was assessed by determining the relative reactivities with luteinising hormone, thyroid stimulating hormone, follicle stimulating hormone and chorionic gonadotrophin. Six antibodies bound to the α-subunit as shown by similar reactivity with all hormones, and the remainder to the β-subunit as shown by specificity for luteinising hormone. This latter group of antibodies cross-reacted only weakly with thyroid stimulating hormone (approximately 10%) and follicle stimulating hormone (approximately 3%). Three of these antibodies also showed low reactivity towards chorionic gonadotrophin (<10%), though the others did not (80-300%). The ability of different antibodies to bind simultaneously to luteinising hormone was examined and it was shown that several distinct antigenic determinants existed on both subunits. The characterisation of monoclonal binding sites is discussed in relation to the use of antibodies in two-site immunoradiometric assays. (Auth.)
ONKALO. Underground characterisation and research programme (UCRP)
International Nuclear Information System (INIS)
2003-09-01
The purpose of the ONKALO Underground Characterisation and Research Programme (UCRP) is to explore Olkiluoto rock conditions and thereby enhance the current geoscientific understanding of the site, to allow the submission of an application for a construction licence for the deep repository. The characterisation programme has the following geoscientific goals: to develop and demonstrate techniques for detailed characterising volumes of rock from the underground, to update the current descriptive model of Olkiluoto bedrock and to increase confidence in this model such that it will serve the needs of construction and the Preliminary Safety Assessment Report (PSAR) in the construction licence application, and to identify volumes of rock that could be suitable for housing parts of the repository. The development of ONKALO will be based on coordinated investigation, design and construction activities. Mapping data from the tunnel front and data obtained from short probe holes will constitute most of the data needed to control the construction of ONKALO. Pilot holes will be drilled along the tunnel profile as the excavation proceeds and investigations will be carried out for geological, rock mechanics, hydrogeological and hydrogeochemical characterisation. Investigations cover more detailed mapping and sampling in parts of the tunnel, mapping and sampling of potential groundwater inflows to the tunnel and investigations from characterisation bore holes drilled from ONKALO. In addition, monitoring is planned in surface-drilled boreholes, in boreholes drilled from ONKALO, and in ONKALO itself. Monitoring will reveal changes in bedrock conditions and thus provide important information for site characterisation. The information collected by characterisation and monitoring will all be assessed in an integrated modelling effort. The aim of this modelling is both to successively enhance the description and understanding of the rock volume around ONKALO and to assess potential
Waste package characterisation
Energy Technology Data Exchange (ETDEWEB)
Sannen, L.; Bruggeman, M.; Wannijn, J.P
1998-09-01
Radioactive wastes originating from the hot labs of the Belgian Nuclear Research Centre SCK-CEN contain a wide variety of radiotoxic substances. The accurate characterisation of the short- and long-term radiotoxic components is extremely difficult but required in view of geological disposal. This paper describes the methodology which was developed and adopted to characterise the high- and medium-level waste packages at the SCK-CEN hot laboratories. The proposed method is based on the estimation of the fuel inventory evacuated in a particular waste package; a calculation of the relative fission product contribution on the fuel fabrication and irradiation footing; a comparison of the calculated, as expected, dose rate and the real measured dose rate of the waste package. To cope with the daily practice an appropriate fuel inventory estimation route, a user friendly computer programme for fission product and corresponding dose rate calculation, and a simple dose rate measurement method have been developed and implemented.
Waste package characterisation
International Nuclear Information System (INIS)
Sannen, L.; Bruggeman, M.; Wannijn, J.P.
1998-09-01
Radioactive wastes originating from the hot labs of the Belgian Nuclear Research Centre SCK-CEN contain a wide variety of radiotoxic substances. The accurate characterisation of the short- and long-term radiotoxic components is extremely difficult but required in view of geological disposal. This paper describes the methodology which was developed and adopted to characterise the high- and medium-level waste packages at the SCK-CEN hot laboratories. The proposed method is based on the estimation of the fuel inventory evacuated in a particular waste package; a calculation of the relative fission product contribution on the fuel fabrication and irradiation footing; a comparison of the calculated, as expected, dose rate and the real measured dose rate of the waste package. To cope with the daily practice an appropriate fuel inventory estimation route, a user friendly computer programme for fission product and corresponding dose rate calculation, and a simple dose rate measurement method have been developed and implemented
Horak, Ema; Vianello, Robert; Hranjec, Marijana; Krištafor, Svjetlana; Zamola, Grace Karminski; Steinberg, Ivana Murković
2017-05-01
Heterocyclic donor-π-acceptor molecular systems based on an N,N-dimethylamino phenylacrylonitrile benzimidazole skeleton have been characterised and are proposed for potential use in sensing applications. The benzimidazole moiety introduces a broad spectrum of useful multifunctional properties to the system including electron accepting ability, pH sensitivity and compatibility with biomolecules. The photophysical characterisation of the prototropic forms of these chromophores has been carried out in both solution and on immobilisation in polymer films. The experimental results are further supported by computational determination of pKa values. It is noticed that compound 3 forms nanoaggregates in aqueous solutions with aggregation-induced emission (AIE) at 600 nm. All the systems demonstrate spectral pH sensitivity in acidic media which shifts towards near-neutral values upon immobilisation in polymer films or upon aggregation in an aqueous environment (compound 3). The structure-property relationships of these functional chromophores, involving their spectral characteristics, acid-base equilibria, pKa values and aggregation effects have been determined. Potential applications of the molecules as pH and biomolecular sensors are proposed based on their pH sensitivity and AIE properties.
Multifunctional media facades; Multifunktionale Medienfassaden
Energy Technology Data Exchange (ETDEWEB)
Ehling, K.; Hackner, M. [Lichtvision GmbH, Berlin (Germany)
2003-07-01
Nowadays glass facades characterise the urban appearance. They provide high transparency and make daylighting easily possible. The systems to minimise the negative effects of sunlight can be used for projecting medial contents onto the facade at night. The pictures become visible on the material for sun and glare protection respectively, as the material spreads the light from the projector. Thus there are new possibilities for the effects of architecture at night. The facade dominated by the materials glass, stone and steel at daytime changes via medial projection at night to a shining object. The medial contents come to the fore. The user has always the possibility to adjust these contents, e.g. for Christmas. Also he can show advertisement, logos or art. Media facades allow branding and can improve the image. So the building attracts attention by differing from others. One sample of media facades will be at the Museum for Modern and Contemporary Art in Bozen/Italy. The east and west facade of the building are transparent. Turnable white laminated glass fins allow sun protection and daylighting at daytime. At night they are used as a huge screen by turning the fins to vertical position. Video art is projected by beamers located in the building. (orig.)
The characterisation of precipitated magnetites
International Nuclear Information System (INIS)
Rush, D.F.; Segal, D.L.
1982-06-01
Methods are described for the preparation of magnetite by precipitation from aqueous solutions of iron(II) and iron(III) salts. The magnetites have been characterised by transmission electron microscopy, chemical analysis and X-ray diffraction. Transmission Moessbauer spectroscopy has also been used to characterise precipitated magnetites and a comparison of the spectra has been made with those obtained from nickel ferrite and hydrated ferric oxides. The hydrothermal stability of magnetite at 573 K has also been investigated. This work is relevant to corrosion processes that can occur in the water coolant circuits of nuclear reactors. (author)
C to U RNA editing mediated by APOBEC1 requires RNA-binding protein RBM47.
Fossat, Nicolas; Tourle, Karin; Radziewic, Tania; Barratt, Kristen; Liebhold, Doreen; Studdert, Joshua B; Power, Melinda; Jones, Vanessa; Loebel, David A F; Tam, Patrick P L
2014-08-01
Cytidine (C) to Uridine (U) RNA editing is a post-transcriptional modification that is accomplished by the deaminase APOBEC1 and its partnership with the RNA-binding protein A1CF. We identify and characterise here a novel RNA-binding protein, RBM47, that interacts with APOBEC1 and A1CF and is expressed in tissues where C to U RNA editing occurs. RBM47 can substitute for A1CF and is necessary and sufficient for APOBEC1-mediated editing in vitro. Editing is further impaired in Rbm47-deficient mutant mice. These findings suggest that RBM47 and APOBEC1 constitute the basic machinery for C to U RNA editing. © 2014 The Authors.
Debating poverty porn on Twitter:social media as a place for everyday socio-political talk
Brooker, Phil; Vines, John; Sutton, Selina; Barnett, Julie; Feltwell, Tom; Lawson, Shaun
2015-01-01
This paper presents an empirical investigation of how people appropriated Twitter for socio-political talk in response to a television (TV) portrayal of people supported by state welfare and benefits. Our findings reveal how online discussion during, and in-between, TV broadcasts was characterised by distinctly different qualities, topics and user behaviours. These findings offer design opportunities for social media services to (i) support more balanced real-time commentaries of politically-...
Current limitations and challenges in nanowaste detection, characterisation and monitoring.
Part, Florian; Zecha, Gudrun; Causon, Tim; Sinner, Eva-Kathrin; Huber-Humer, Marion
2015-09-01
Engineered nanomaterials (ENMs) are already extensively used in diverse consumer products. Along the life cycle of a nano-enabled product, ENMs can be released and subsequently accumulate in the environment. Material flow models also indicate that a variety of ENMs may accumulate in waste streams. Therefore, a new type of waste, so-called nanowaste, is generated when end-of-life ENMs and nano-enabled products are disposed of. In terms of the precautionary principle, environmental monitoring of end-of-life ENMs is crucial to allow assessment of the potential impact of nanowaste on our ecosystem. Trace analysis and quantification of nanoparticulate species is very challenging because of the variety of ENM types that are used in products and low concentrations of nanowaste expected in complex environmental media. In the framework of this paper, challenges in nanowaste characterisation and appropriate analytical techniques which can be applied to nanowaste analysis are summarised. Recent case studies focussing on the characterisation of ENMs in waste streams are discussed. Most studies aim to investigate the fate of nanowaste during incineration, particularly considering aerosol measurements; whereas, detailed studies focusing on the potential release of nanowaste during waste recycling processes are currently not available. In terms of suitable analytical methods, separation techniques coupled to spectrometry-based methods are promising tools to detect nanowaste and determine particle size distribution in liquid waste samples. Standardised leaching protocols can be applied to generate soluble fractions stemming from solid wastes, while micro- and ultrafiltration can be used to enrich nanoparticulate species. Imaging techniques combined with X-ray-based methods are powerful tools for determining particle size, morphology and screening elemental composition. However, quantification of nanowaste is currently hampered due to the problem to differentiate engineered from
Rat liver contains a limited number of binding sites for hepatic lipase
G.C. Schoonderwoerd (Kees); A.J.M. Verhoeven (Adrie); H. Jansen (Hans)
1994-01-01
textabstractThe binding of hepatic lipase to rat liver was studied in an ex vivo perfusion model. The livers were perfused with media containing partially purified rat hepatic lipase or bovine milk lipoprotein lipase. The activity of the enzymes was determined in the
Molecular and cellular characterisation of the zinc uptake (Znu) system of Nostoc punctiforme.
Hudek, Lee; Pearson, Leanne A; Michalczyk, Agnes; Neilan, Brett A; Ackland, M Leigh
2013-11-01
Metal homoeostasis in cyanobacteria is based on uptake and export systems that are controlled by their own regulators. This study characterises the zinc uptake (Znu) system in Nostoc punctiforme. The system was found to comprise of three subunits in an ACB operon: a Zn(2+)-binding protein (ZnuA18), a transmembrane domain (ZnuB) and an ATPase (ZnuC). These proteins are encoded within the znu operon regulated by a zinc uptake transcription repressor (Zur). Interestingly, a second Zn(2+)-binding protein (ZnuA08) was also identified at a distal genomic location. Interactions between components of the ZnuACB system were investigated using knockouts of the individual genes. The znuA08(-), znuA18(-), znuB(-) and znuC(-) mutants displayed overall reduced znuACB transcript levels, suggesting that all system components are required for normal expression of znu genes. Zinc uptake assays in the Zn(2+)-binding protein mutant strains showed that the disruption of znuA18 had a greater negative effect on zinc uptake than disruption of znuA08. Complementation studies in Escherichia coli indicated that both znuA08 and znuA18 were able to restore zinc uptake in a znuA(-) mutant, with znuA18 permitting the highest zinc uptake rate. The N. punctiforme zur was also able to complement the E. coli zur(-) mutant. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
A surface plasmon resonance assay for characterisation and epitope mapping of anti-GLP-1 antibodies.
Thomsen, Lasse; Gurevich, Leonid
2018-04-19
The incretin hormone glucagon-like peptide-1 (GLP-1) has been subject to substantial pharmaceutical research regarding the treatment of type 2 diabetes mellitus. However, quantification of GLP-1 levels remains complicated due to the low circulation concentration and concurrent existence of numerous metabolites, homologous peptides, and potentially introduced GLP-1 receptor agonists. Surface plasmon resonance (SPR) facilitates real-time monitoring allowing a more detailed characterisation of the interaction compared with conventional enzyme-linked immunosorbent assays (ELISA). In this paper, we describe the development of the first SPR assays for characterisation of anti-GLP-1 antibodies for ELISA purposes. Binding responses were obtained on covalently immobilised anti-GLP-1 antibodies at 12°C, 25°C, and 40°C and fitted to a biomolecular (1:1) interaction model showing association rates of 1.01 × 10 3 to 4.54 × 10 3 M -1 s -1 and dissociation rates of 3.56 × 10 -5 to 1.56 × 10 -3 s -1 leading to affinities of 35.2 to 344 nM, depending on the temperature. Determination of thermodynamic properties revealed an enthalpy driven interaction (ΔH polar amino acids (ΔC p < 0). Pair-wise epitope mapping was performed on captured anti-GLP-1 antibodies followed by subsequent interaction with GLP-1 (7-36) and other anti-GLP-1 antibodies. A global evaluation of every binding response led to an epitope map elucidating the potential of various anti-GLP-1 antibody pairs for sandwich ELISA and hence pinpointing the optimal antibody combinations. The SPR assays proved capable of providing vital information for ELISA development endorsing it as a useful optimisation tool. Copyright © 2018 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
Database characterisation of HEP applications
International Nuclear Information System (INIS)
Piorkowski, Mariusz; Grancher, Eric; Topurov, Anton
2012-01-01
Oracle-based database applications underpin many key aspects of operations for both the LHC accelerator and the LHC experiments. In addition to the overall performance, the predictability of the response is a key requirement to ensure smooth operations and delivering predictability requires understanding the applications from the ground up. Fortunately, database management systems provide several tools to check, measure, analyse and gather useful information. We present our experiences characterising the performance of several typical HEP database applications performance characterisations that were used to deliver improved predictability and scalability as well as for optimising the hardware platform choice as we migrated to new hardware and Oracle 11g.
Survey of the pharmacology of non-ionic X-ray contrast media
International Nuclear Information System (INIS)
Turnheim, K.
1986-01-01
The non-ionic X-ray contrast media metrizamide, iopamidol, iohexol, and iopromide do not bind calcium and are less hyperosmolar than the conventional ionic contrast media, for instance amidotrizoate (diatrizoate), iothalamte, or ioglicate. Hence the use of non-ionic contrast media is associated with less undesirable side-effects that are attributable to hypertonicity such as an increase in circulating plasma volume, decreased deformability of red blood cells, damage of vascular endothelium with consequent activation of blood coagulation, the complement system and fibrinolysis, increased release of bradykinin and histamine, cardiac arrhythimas, diuresis, vasodilation and decreased blood pressure, pain and heat sensation. Because of less dilution the quality of imaging is also better. According to the intravenous LD 50 in experimental animals the acute toxicity of non-ionic contrast media is lower than that of ionic media. With respect to contrast quality and the rate of side-effects tha various non-ionic contrast media appear to be equivalent. Despite their higher price and higher viscosity it is probable that the non-ionic contrast media will replace the classical ionic media, especially in angio- and myelography. (Author)
Mobility of engineered inorganic nanoparticles in porous media
Metreveli, George; Heidmann, Ilona; Schaumann, Gabriele Ellen
2013-04-01
Besides the excellent properties and great potential for various industrial, medical, pharmaceutical, cosmetic, and life science applications, engineered inorganic nanoparticles (EINP) can show also disadvantages concerning increasing risk potential with increasing application, if they are released in the environmental systems. EINP can influence microbial activity and can show toxic effects (Fabrega et al., 2009). Similar to the inorganic natural colloids, EINP can be transported in soil and groundwater systems (Metreveli et al., 2005). Furthermore, due to the large surface area and high sorption and complex formation capacity, EINP can facilitate transport of different contaminants. In this study the mobility behaviour of EINP and their effect on the transport of different metal(loid) species in water saturated porous media was investigated. For these experiments laboratory column system was used. The column was filled with quartz sand. The interactions between EINP and metal(loid)s were characterised by coupling of asymmetrical flow field flow fractionation (AF4) with inductively coupled plasma mass spectrometer (ICP-MS). As EINP laponite (synthetic three layer clay mineral), and as metal(loid)s Cu, Pb, Zn, Pt and As were used. In AF4 experiments sorption of metal(loid)s on the surface of EINP could be observed. The extent of interactions was influenced by pH value and was different for different metal(loid)s. Laboratory column experiments showed high mobility of EINP, which facilitated transport of most of metal(loid)s in water saturated porous media. Furthermore the migration of synthetic silver nanoparticles in natural soil columns was determined in leaching experiments. Acknowledgement Financial support by German Research Council (DFG) and Max-Buchner-Research Foundation (MBFSt) is gratefully acknowledged. We thank Karlsruhe Institute of Technology (KIT) for the opportunity to perform the column and AF4 experiments. References: Fabrega, J., Fawcett, S. R
Features, events and processes evaluation catalogue for argillaceous media
International Nuclear Information System (INIS)
Mazurek, M.; Pearson, F.J.; Volckaert, G.; Bock, H.
2003-01-01
The OECD/NEA Working Group on the Characterisation, the Understanding and the Performance of Argillaceous Rocks as Repository Host Formations for the disposal of radioactive waste (known as the 'Clay Club') launched a project called FEPCAT (Features, Events and Processes Catalogue for argillaceous media) in late 1998. The present report provides the results of work performed by an expert group to develop a FEPs database related to argillaceous formations, whether soft or indurated. It describes the methodology used for the work performed, provides a list of relevant FEPs and summarises the knowledge on each of them. It also provides general conclusions and identifies priorities for future work. (authors)
International Nuclear Information System (INIS)
Larsson, Arne; Lidar, Per; Desnoyers, Yvon
2014-01-01
Radiological characterisation plays an important role in the process to recycle contaminated or potentially contaminated metals. It is a platform for planning, identification of the extent and nature of contamination, assessing potential risk impacts, cost estimation, radiation protection, management of material arising from decommissioning as well as for the release of the materials as well as the disposal of the generated secondary waste as radioactive waste. Key issues in radiological characterisation are identification of objectives, development of a measurement and sampling strategy (probabilistic, judgmental or a combination thereof), knowledge management, traceability, recording and processing of obtained information. By applying advanced combination of statistical and geostatistical in the concept better performance can be achieved at a lower cost. This paper will describe the benefits with the usage of the available methods in the different stages of the characterisation, treatment and clearance processes aiming for reliable results in line with the data quality objectives. (authors)
Directory of Open Access Journals (Sweden)
Đekić Ljiljana M.
2014-01-01
Full Text Available Development of self-dispersing drug delivery systems (SMEDDS is a modern strategy for oral delivery improvement of poorly soluble drugs. Self-microemulsifying drug delivery systems (SMEDDS are isotropic mixtures of oils and hydrophilic surfactants, which form oil-in-water (o/w microemulsions by dilution in aqueous media (e.g., gastrointestinal fluids. Formulation of SMEDDS carriers requires consideration of a large number of formulation parameters and their influences on process of self-microemulsifying and releasing of drug. The aim of this work was formulation and characterisation of SMEDDS for oral administration of ibuprofen. In the experimental work, two series of potential SMEDDS were prepared (M1-M10, using surfactant (Labrasol®, Gattefosse, cosurfactant (PEG-40 hydrogenated castor (Cremophor® RH40, and oil (medium chain triglycerides (Crodamol® GTCC and olive oil (Cropur® Olive, at surfactant-to-cosurfactant mass ratios (Km 9:1, 7:3, 5:5, 3:7, and 1:9, and 10 % or 20 % of the oil phase. Ibuprofen was dissolved in formulations in concentration of 10 %. Characterisation of the investigated formulations included evaluation of physical stability, self-microemulsification ability in 0,1M HCl (pH 1.2 and phosphate buffer pH 7.2 (USP and in vitro drug release. Formation of o/w microemulsions with the average droplet size (Z-ave up to 100 nm, was observed in dispersions of formulations prepared with 10% w/w of medium chain triglycerides, within the entire investigated range of the Km values (M1-M5. These formulations were selected as SMEDDS. Results of characterisation pointed out the importance of the type and concentration of the oil as well as the Km value for the self-microemulsying ability as well as drug release kinetics from the investigated SMEDDS. Ibuprofen relase was in accordance with the request of USP 30-NF 25 (at least 80 %, after 60 min from the formulations M1 (Km 9:1 and M5 (Km 1:9. Furthermore, ibuprofen release was
Phosphoric acids as amplifiers of molecular chirality in liquid crystalline media
Eelkema, R; Feringa, BL
2006-01-01
A new system for the double amplification of the molecular chirality of simple chiral amines in achiral liquid crystalline media is described. It involves a conformationally flexible phosphoric acid based receptor that by binding to chiral amines induces chirality in the liquid crystalline matrix.
International Nuclear Information System (INIS)
Giraudi, G.; Baggiani, C.; Giovannoli, C.; Marletto, C.; Vanni, A.
1999-01-01
A derivative of 8-hydroxyquinoline (8-quinolinol, oxine) with a linking bridge containing a carboxylic group was covalently coupled to bovine serum albumin by the N-hydroxysuccinimide method to obtain stable monomeric conjugates with oxine to protein mole ratios up to 37. These conjugates were characterised spectrophotometrically and their complexation properties were confirmed by spectral analysis with and without the addition of Al(III), Cd(II), Co(II), Cu(II), Hg(II), Mn(II), Ni(II), Pb(II), V(IV), U(VI) and Zn(II) ions added. The maximum number of ions bound by these chelating proteins was determined spectrophotometrically by titration with metal ions at pH 6.0. The conjugates with a substitution ratio (moles of 8-hydroxyquinoline bound/mole of albumin) less than about 8 showed 1:1 binding with metal ions, while conjugates with higher substitution ratios were able to complex with 2:1 ratio of 8-hydroxyquinoline to metal ion. Association and dissociation kinetics of complexation with copper(II) ions showed a complex mechanism. The spectral and binding properties of these metal ion-binding proteins confirm that the coupling of the 8-hydroxyquinoline derivative to bovine serum albumin gives stable, water soluble, macromolecular chelating agents that retain the complexing ability of the original ligand. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)
Da Silva, M; Passarini, M R Z; Bonugli, R C; Sette, L D
2008-12-01
Marine-derived fungi represent a valuable source of structurally novel and biologically active metabolites of industrial interest. They also have drawn attention for their capacity to degrade several pollutants, including textile dyes, organochlorides and polycyclic aromatic hydrocarbons (PAHs), among others. The fungal tolerance to higher concentrations of salt might be considered an advantage for bioremediation processes in the marine environment. Therefore, filamentous fungi were isolated from cnidarians (scleractinian coral and zoanthids) collected from the north coast of São Paulo State, Brazil. A total of 144 filamentous fungi were morphologically and molecularly characterised. Among them there were several species of Penicillium and Aspergillus, in addition to Cladosporium spp., Eutypella sp., Fusarium spp., Khuskia sp., Mucor sp., Peacilomyces sp., Phoma sp. and Trichoderma spp. These fungi were tested regarding their decolourisation activity for Remazol Brilliant Blue R (RBBR), a textile dye used as an initial screening for PAH-degrading fungi. The most efficient fungi for RBBR decolourisation after 12 days were Penicillium citrinum CBMAI 853 (100%), Aspergillus sulphureus CBMAI 849 (95%), Cladosporium cladosporioides CBMAI 857 (93%) and Trichoderma sp. CBMAI 852 (89%). Besides its efficiency for dye decolourisation within liquid media, C. cladosporioides CBMAI 857 also decolourised dye on solid media, forming a decolourisation halo. Further research on the biotechnological potential, including studies on PAH metabolism, of these selected fungi are in progress.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
Characterisation of humic material for inter-laboratory comparison
International Nuclear Information System (INIS)
Peachy, D.; Bradley, A.D.; Davis, A.E.; Stuart, M.E.; Tait, B.A.R.; Vickers, B.P.; Williams, G.M.
1988-01-01
The characterisation and interlaboratory comparison of common humic materials by members of the European Commission's COCO group (set up to study complexes and colloids), forms part of a study of the effects of natural organic compounds in groundwater on the complexation and mobility of radionuclides. Three samples have been characterised: a sodium salt and a protonated form of the commercially available humic acid from Aldrich Chemicals; and a protonated humic acid from the Gorleben research site in Germany. Characterisation undertaken by BGS includes moisture content, elemental analysis, metal content, functional group analysis, infra-red spectroscopy, ultra-violet absorbance (E 4 /E 6 ratios), and ultra-filtration. (author)
Image analysis for material characterisation
Livens, Stefan
In this thesis, a number of image analysis methods are presented as solutions to two applications concerning the characterisation of materials. Firstly, we deal with the characterisation of corrosion images, which is handled using a multiscale texture analysis method based on wavelets. We propose a feature transformation that deals with the problem of rotation invariance. Classification is performed with a Learning Vector Quantisation neural network and with combination of outputs. In an experiment, 86,2% of the images showing either pit formation or cracking, are correctly classified. Secondly, we develop an automatic system for the characterisation of silver halide microcrystals. These are flat crystals with a triangular or hexagonal base and a thickness in the 100 to 200 nm range. A light microscope is used to image them. A novel segmentation method is proposed, which allows to separate agglomerated crystals. For the measurement of shape, the ratio between the largest and the smallest radius yields the best results. The thickness measurement is based on the interference colours that appear for light reflected at the crystals. The mean colour of different thickness populations is determined, from which a calibration curve is derived. With this, the thickness of new populations can be determined accurately.
“Maternal Devices”, Social Media and the Self-Management of Pregnancy, Mothering and Child Health
Directory of Open Access Journals (Sweden)
Sophia Alice Johnson
2014-06-01
Full Text Available In recent years the smartphone has revolutionised lay people’s management of health and illness, particularly in regards to pregnancy and parenting. This article analyses smartphone applications, or apps, and social media platforms as mediating technologies which act as performative devices. These devices encourage particular enactments of subjectivity and technologies of the self which combine the expert patient ideal with ideologies of mothering. Some apps and social media can be disciplinary and invoke biological responsibility in various ways including the monitoring of specific behaviours via “push responsibilisation”. Apps claim to allow for greater convenience, connectivity, flexibility, efficiency, and what will be characterised in this article as the “tidbitisation” of information. This article suggests the ways in which health-conscious pregnant or maternal subjects are likely to view apps and social media sites as a means to improve and monitor their pregnancies, health, and their children’s development and health.
Soil Radiological Characterisation Methodology
International Nuclear Information System (INIS)
Attiogbe, Julien; Aubonnet, Emilie; De Maquille, Laurence; De Moura, Patrick; Desnoyers, Yvon; Dubot, Didier; Feret, Bruno; Fichet, Pascal; Granier, Guy; Iooss, Bertrand; Nokhamzon, Jean-Guy; Ollivier Dehaye, Catherine; Pillette-Cousin, Lucien; Savary, Alain
2014-12-01
This report presents the general methodology and best practice approaches which combine proven existing techniques for sampling and characterisation to assess the contamination of soils prior to remediation. It is based on feedback of projects conducted by main French nuclear stakeholders involved in the field of remediation and dismantling (EDF, CEA, AREVA and IRSN). The application of this methodology will enable the project managers to obtain the elements necessary for the drawing up of files associated with remediation operations, as required by the regulatory authorities. It is applicable to each of the steps necessary for the piloting of remediation work-sites, depending on the objectives targeted (release into the public domain, re-use, etc.). The main part describes the applied statistical methodology with the exploratory analysis and variogram data, identification of singular points and their location. The results obtained permit assessment of a mapping to identify the contaminated surface and subsurface areas. It stakes the way for radiological site characterisation since the initial investigations from historical and functional analysis to check that the remediation objectives have been met. It follows an example application from the feedback of the remediation of a contaminated site on the Fontenay aux Roses facility. It is supplemented by a glossary of main terms used in the field from different publications or international standards. This technical report is a support of the ISO Standard ISO ISO/TC 85/SC 5 N 18557 'Sampling and characterisation principles for soils, buildings and infrastructures contaminated by radionuclides for remediation purposes'. (authors) [fr
Pulse radiolysis studies on DNA-Binding radioprotectors
International Nuclear Information System (INIS)
Anderson, R.F.
1996-01-01
Full text: Hoechst 33342 and newly-synthesised analogues exhibit radioprotective activity in cultured cells and in vivo, as described in accompanying abstracts. These minor groove binding ligands bind at discreet sites in DNA, characterised by 3 to 4 consecutive AT base pairs, and DNA sequencing studies have shown focussed radioprotection at these binding sites. There is evidence that the bound ligands also confer more 'global' protection including the intervening DNA between the binding sites. The observed focussed radioprotection could be explained by H-atom donation from the ligand to radiation-induced carbon-centred deoxyribosyl radicals, but this mechanism is unlikely to account for the global radioprotection. We now report pulse radiolysis studies on another possible mechanism, namely reduction of transient radiation-induced oxidising species on DNA by the ligand, which is consistent with the report of reduction of G + by TMPD. Oxidation of deoxyguanosine (dG) by Br 2 - , produced by radiolysis of Br- in N 2 0-saturated solutions, in the presence of Hoechst 33342 results in the appearance of a transient ligand species which is kinetically resolvable from that obtained from direct oxidation of Hoechst 33342 by Br 2 - . A plot of reaction rate versus ligand concentration indicates that the rate constant for reduction of G + is approximately 3 x 10 8 dm 3 M -1 sec -1 . Similar experiments with DNA, rather than dG, also revealed a transient species corresponding to oxidation of the ligand, but the absolute rate of oxidation was considerably slower for the DNA-bound ligand compared to that for oxidation of the free ligand by G+. These results are clearly consistent with the proposed mechanism of radioprotection by Hoechst 33342 and its analogues, moreover, pulse radiolysis may provide a very useful endpoint for screening new analogues, as a preliminary to radiobiological evaluation
Rangl, Martina; Leitner, Michael; Riihimäki, Tiina; Lehtonen, Soili; Hytönen, Vesa P; Gruber, Hermann J; Kulomaa, Markku; Hinterdorfer, Peter; Ebner, Andreas
2014-02-01
Molecular recognition force spectroscopy, a biosensing atomic force microscopy technique allows to characterise the dissociation of ligand-receptor complexes at the molecular level. Here, we used molecular recognition force spectroscopy to study the binding capability of recently developed testosterone binders. The two avidin-based proteins called sbAvd-1 and sbAvd-2 are expected to bind both testosterone and biotin but differ in their binding behaviour towards these ligands. To explore the ligand binding and dissociation energy landscape of these proteins, we tethered biotin or testosterone to the atomic force microscopy probe while the testosterone-binding protein was immobilized on the surface. Repeated formation and rupture of the ligand-receptor complex at different pulling velocities allowed determination of the loading rate dependence of the complex-rupturing force. In this way, we obtained the molecular dissociation rate (k(off)) and energy landscape distances (x(β)) of the four possible complexes: sbAvd-1-biotin, sbAvd-1-testosterone, sbAvd-2-biotin and sbAvd-2-testosterone. It was found that the kinetic off-rates for both proteins and both ligands are similar. In contrast, the x(β) values, as well as the probability of complex formations, varied considerably. In addition, competitive binding experiments with biotin and testosterone in solution differ significantly for the two testosterone-binding proteins, implying a decreased cross-reactivity of sbAvd-2. Unravelling the binding behaviour of the investigated testosterone-binding proteins is expected to improve their usability for possible sensing applications. Copyright © 2014 John Wiley & Sons, Ltd.
Characterisation of the first enzymes committed to lysine biosynthesis in Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Michael D W Griffin
Full Text Available In plants, the lysine biosynthetic pathway is an attractive target for both the development of herbicides and increasing the nutritional value of crops given that lysine is a limiting amino acid in cereals. Dihydrodipicolinate synthase (DHDPS and dihydrodipicolinate reductase (DHDPR catalyse the first two committed steps of lysine biosynthesis. Here, we carry out for the first time a comprehensive characterisation of the structure and activity of both DHDPS and DHDPR from Arabidopsis thaliana. The A. thaliana DHDPS enzyme (At-DHDPS2 has similar activity to the bacterial form of the enzyme, but is more strongly allosterically inhibited by (S-lysine. Structural studies of At-DHDPS2 show (S-lysine bound at a cleft between two monomers, highlighting the allosteric site; however, unlike previous studies, binding is not accompanied by conformational changes, suggesting that binding may cause changes in protein dynamics rather than large conformation changes. DHDPR from A. thaliana (At-DHDPR2 has similar specificity for both NADH and NADPH during catalysis, and has tighter binding of substrate than has previously been reported. While all known bacterial DHDPR enzymes have a tetrameric structure, analytical ultracentrifugation, and scattering data unequivocally show that At-DHDPR2 exists as a dimer in solution. The exact arrangement of the dimeric protein is as yet unknown, but ab initio modelling of x-ray scattering data is consistent with an elongated structure in solution, which does not correspond to any of the possible dimeric pairings observed in the X-ray crystal structure of DHDPR from other organisms. This increased knowledge of the structure and function of plant lysine biosynthetic enzymes will aid future work aimed at improving primary production.
Tanley, S.W.M.; Schreurs, A.M.M.; Kroon-Batenburg, L.M.J.; Helliwell, J.R.
2012-01-01
The anticancer complexes cisplatin and carboplatin are known to bind to both the N and the N" atoms of His15 of hen egg-white lysozyme (HEWL) in the presence of dimethyl sulfoxide (DMSO). However, neither binds in aqueous media after 4 d of crystallization and crystal growth, suggesting that DMSO
Peroxidase-mediated binding of aromatic amine carcinogens to tissue DNA
International Nuclear Information System (INIS)
Wise, R.W.; Lakshmi, V.M.; Zenser, T.V.; Davis, B.B.
1986-01-01
Benzidine is a aromatic amine bladder carcinogen in man and dog which requires endogenous metabolic activation. Dog bladder microsomes activate benzidine to bind glutathione and DNA by a peroxidatic but not a mixed-function oxidase mediated pathway. Prostaglandin H synthase was responsible for peroxidatic metabolism. This study was designed to assess benzidine metabolism in a whole cell system. Rabbit renal medullary slices (100 mg/ml) were incubated for 60 min. in Krebs-Ringer bicarbonate buffer containing 100 μM 3 H-benzidine and 250 μM arachidonic acid. Arachidonic acid increased 3-(glutathione-S-yL)-benzidine, a product of peroxidatically activated benzidine, (6-fold) and 3 H-benzidine binding to endogenous DNA (4-fold). Indomethacin (100 μM) completely inhibited arachidonic acid-mediated increases in conjugate formation and DNA binding. HPLC analysis of the media demonstrated benzidine (95% of total 3 H), 3-(glutathion-S-yL)-benzidine (1%) and two unidentified peaks (4%). These results are consistent with the hydroperoxidase activity of prostaglandin H synthase mediating metabolic activation of benzidine to bind tissue nucleophiles in a whole cell system. Inhibition of peroxidatic activation of aromatic amines to bind DNA may prevent initiation of bladder cancer
International Nuclear Information System (INIS)
Morcos, Sameh K.; Thomsen, Henrik S.; Webb, Judith A.W.
2002-01-01
In a previous survey we revealed uncertainty among responders about (a) whether or not to perform hemodialysis in patients with severely reduced renal function who had received contrast medium; and (b) when to perform hemodialysis in patients on regular treatment with hemodialysis or continuous ambulatory dialysis who received contrast medium. Therefore, the Contrast Media Safety Committee of The European Society of Urogenital Radiology decided to review the literature and to issue guidelines. The committee performed a Medline search. Based on this, a report and guidelines were prepared. The report was discussed at the Ninth European Symposium on Urogenital Radiology in Genoa, Italy. Hemodialysis and peritoneal dialysis safely remove both iodinated and gadolinium-based contrast media. The effectiveness of hemodialysis depends on many factors including blood and dialysate flow rate, permeability of dialysis membrane, duration of hemodialysis and molecular size, protein binding, hydrophilicity, and electrical charge of the contrast medium. Generally, several hemodialysis sessions are needed to removal all contrast medium, whereas it takes 3 weeks for continuous ambulatory dialysis to remove the agent completely. There is no need to schedule the dialysis in relation to the injection of iodinated or MR contrast media or the injection of contrast agent in relation to the dialysis program. Hemodialysis does not protect poorly functioning kidneys against contrast-medium-induced nephrotoxicity. Simple guidelines are given. (orig.)
Visual short-term memory binding deficit in familial Alzheimer's disease.
Liang, Yuying; Pertzov, Yoni; Nicholas, Jennifer M; Henley, Susie M D; Crutch, Sebastian; Woodward, Felix; Leung, Kelvin; Fox, Nick C; Husain, Masud
2016-05-01
Long-term episodic memory deficits in Alzheimer's disease (AD) are well characterised but, until recently, short-term memory (STM) function has attracted far less attention. We employed a recently-developed, delayed reproduction task which requires participants to reproduce precisely the remembered location of items they had seen only seconds previously. This paradigm provides not only a continuous measure of localization error in memory, but also an index of relational binding by determining the frequency with which an object is misplaced to the location of one of the other items held in memory. Such binding errors in STM have previously been found on this task to be sensitive to medial temporal lobe (MTL) damage in focal lesion cases. Twenty individuals with pathological mutations in presenilin 1 or amyloid precursor protein genes for familial Alzheimer's disease (FAD) were tested together with 62 healthy controls. Participants were assessed using the delayed reproduction memory task, a standard neuropsychological battery and structural MRI. Overall, FAD mutation carriers were worse than controls for object identity as well as in gross localization memory performance. Moreover, they showed greater misbinding of object identity and location than healthy controls. Thus they would often mislocalize a correctly-identified item to the location of one of the other items held in memory. Significantly, asymptomatic gene carriers - who performed similarly to healthy controls on standard neuropsychological tests - had a specific impairment in object-location binding, despite intact memory for object identity and location. Consistent with the hypothesis that the hippocampus is critically involved in relational binding regardless of memory duration, decreased hippocampal volume across FAD participants was significantly associated with deficits in object-location binding but not with recall precision for object identity or localization. Object-location binding may therefore
Ionised media and fractures: application to cartilaginous tissues and oil industry
Huyghe, J.M.R.J.; Kraaijeveld, F.; Remmers, J.J.C.; Borst, de R.; Denier, J; Finn, M.D.; Mattner, T
2008-01-01
ionized media are ubiquitous in nature. Our body holds onto water through ionised macromolecules that bind water up to a 1000 times their own mass. Clays and shales do a similar trick in the geoworld. Localization of deformation and fractures are very common. Bore hole instability through fracture
Toivonen, Laura; Vuononvirta, Juho; Mertsola, Jussi; Waris, Matti; He, Qiushui; Peltola, Ville
2017-05-01
Mannose-binding lectin (MBL) and toll-like receptors (TLRs) are important components of the innate immune system. We assessed the susceptibility of children with genetic variants in these factors to respiratory infections, rhinovirus infections and acute otitis media. In a prospective cohort study, blood samples from 381 Finnish children were analyzed for polymorphisms in MBL2 at codons 52, 54 and 57, TLR2 Arg753Gln, TLR3 Leu412Phe, TLR4 Asp299Gly, TLR7 Gln11Leu and TLR8 Leu651Leu. Children were followed up for respiratory infections until 24 months of age with daily diaries. Polymerase chain reaction and antigen tests were used for detection of respiratory viruses from nasal swabs. Children with MBL variant genotype had a mean of 59 days with symptoms of respiratory infection per year, compared with 49 days in those with wild-type (P = 0.01). TLR8 polymorphisms were associated with an increased risk and TLR7 polymorphisms with a decreased risk of recurrent rhinovirus infections (P = 0.02 for both). TLR2 polymorphisms were associated with recurrent acute otitis media (P = 0.02). MBL polymorphisms were associated with an increased and TLR7 polymorphisms with a decreased risk of rhinovirus-associated acute otitis media (P = 0.03 and P = 0.006, respectively). Genetic polymorphisms in MBL and TLRs promote susceptibility to or protection against respiratory infections. In addition to environmental factors, genetic variations may explain why some children are more prone to respiratory infections.
Modelling, fabrication and characterisation of THz fractal meta-materials
DEFF Research Database (Denmark)
Xiao, S.; Zhou, L.; Malureanu, Radu
2011-01-01
We present theoretical predictions, fabrication procedure and characterisation results of fractal metamaterials for the THz frequency range. The characterisation results match well the predicted response thus validating both the fabrication procedure as well as the simulation one. Such systems sh...
Two-phase flow characterisation by nuclear magnetic resonance
International Nuclear Information System (INIS)
Leblond, J.; Javelot, S.; Lebrun, D.; Lebon, L.
1998-01-01
The results presented in this paper demonstrate the performance of the PFGSE-NMR to obtain a complete characterisation of two-phase flows. Different methods are proposed to characterise air-water flows in different regimes: stationary two-phase flows and flows in transient condition. Finally a modified PFGSE is proposed to analyse the turbulence of air-water bubbly flow. (author)
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Troelsen, Jesper Thorvald; Balslev-Harder, Marie
2017-01-01
BACKGROUND: Levels of serum thyroid-stimulating hormone (TSH) indicate thyroid function, because thyroid hormone negatively controls TSH release. Genetic variants in the vascular endothelial growth factor A (VEGFA) gene are associated with TSH levels. The aim of this study was to characterise...... levels (p=0.0014). The SNP rs881858 is located in a binding site for CHOP (C/EBP homology protein) and c/EBPβ (ccaat enhancer binding protein β). Reporter-gene analysis showed increased basal enhancer activity of the rs881858 A-allele versus the G-allele (34.5±9.9% (average±SEM), p=0.0012), while co...
cDNA cloning and characterization of a mannose-binding lectin from ...
Indian Academy of Sciences (India)
Unknown
of kit protocol except that the RT step was prolonged for a further reaction ... ing a dA-tailing Kit (Sangon). DNA ligation with ... RT-PCR amplification was performed three times. 2.8 Expression of ..... of a new mannose-binding lectin gene from Taxus media; J. Biosci. ... ing: A Laboratory Manual, 2nd edition (New York: Cold.
Durán-Lara, Esteban F; López-Cortés, Xaviera A; Castro, Ricardo I; Avila-Salas, Fabián; González-Nilo, Fernando D; Laurie, V Felipe; Santos, Leonardo S
2015-02-01
Polyvinylpolypyrrolidone (PVPP) is a fining agent, widely used in winemaking and brewing, whose mode of action in removing phenolic compounds has not been fully characterised. The aim of this study was to evaluate the experimental and theoretical binding affinity of PVPP towards six phenolic compounds representing different types of phenolic species. The interaction between PVPP and phenolics was evaluated in model solutions, where hydroxyl groups, hydrophobic bonding and steric hindrance were characterised. The results of the study indicated that PVPP exhibits high affinity for quercetin and catechin, moderate affinity for epicatechin, gallic acid and lower affinity for 4-methylcatechol and caffeic acid. The affinity has a direct correlation with the hydroxylation degree of each compound. The results show that the affinity of PVPP towards phenols is related with frontier orbitals. This work demonstrates a direct correlation between the experimental affinity and the interaction energy calculations obtained through computational chemistry methods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Physico-chemical characterisation of Indian biomass ashes
Energy Technology Data Exchange (ETDEWEB)
K. Umamaheswaran; Vidya S. Batra [Energy and Resources Institute (TERI), New Delhi (India)
2008-05-15
India stands fourth in biomass utilisation for various purposes like domestic, commercial and industrial applications. While extensive studies have been made for coal ash characterisation and utilisation, studies on characterisation of biomass ash and its utilisation has not been addressed. In this paper, biomass ash from five sources i.e. rice husk, bagasse, groundnut shell, cashewnut shell, and arecanut shell have been characterised. Chemical composition analysis, particle size analysis, thermal analysis, and microstructure analysis were carried out. Results show that in all ashes silica is the major compound with particle size ranging from 15 to 30 {mu}m and having irregular shape. Ash powders originating from cashewnut shell, arecanut shell and groundnut shell also have compounds of calcium, magnesium and potassium. Bagasse and cashewnut shell ashes have high LOI due to presence of unburnt carbon, P{sub 2}O{sub 5} and other volatiles. 16 refs., 22 figs., 3 tabs.
Characterisation of mouse prothymocytes
W.J.A. Boersma (Wim)
1982-01-01
textabstractIn this thesis, the study of growth kinetics of thymocytes in lethally irradiated mice as a means to characterise the early T-cell progenitors is described. Normal bone marrow cells were used as the source of hemopoietic cells. The experiments show that it is possible to obtain
Characterisation of areal surface texture
Leach, Richard
2014-01-01
This book presents the areal framework that is being adopted by the international community, concentrating on characterisation methods, and presenting case studies highlighting use of areal methods in applications from automobile manufacturing to archaeology.
García, Miriam; Navas, Alejandro; Olza, Inés; Gómez-Baceiredo, Beatriz; Pujol, Francesc; Garralda, Eduardo; Centeno, Carlos
2017-01-01
Introduction The goal of palliative care (PC) is to improve the quality of life of terminal stage patients and their families. The subject frequently appears in the mass-media and this helps create a socially accepted identity. The aim of this study is to describe and analyse PC related news items appeared in the Spanish written media. Methodology A descriptive cross-sectional study was designed. Considering diffusion, scope and the range in editorial policy criteria, four printed newspapers (PN) were selected, together with four exclusively digital media sources (DM). Through Mynews, a newspaper content depository, and the search tool for each DM website, articles published between 2009 and 2014 which included the terms "palliative care" and "palliative medicine" were sought. A questionnaire was created to characterise each article identified and a descriptive analysis was undertaken. Results A total of 627 articles were identified, of which 359 (57%) were published in PN (42% in the printed editions -PE- 16% in their online editions -OE-) and 268 (43%) in DM. In general, they appeared mainly in sections concerning Health (23%), Culture and Society (18%) and General/Home News (15%). In PE, just 2% were found in the Health section and nearly 70% in Culture and Society and General/Home News. Most of the articles were informative in nature and contained socio-political messages (90%). Statements by PC professionals were found in 35% of the articles and by politicians in 32%. The most frequent content was related to facing end of life (74%) and patient quality of life (70%). Conclusions The Spanish written media reflects the socio-political interest aroused by PC. Nevertheless, messages circulating about PC do not describe professional practice, or the contribution of the same for patients. Content more in line with the clinical practice might help contribute to the development of this new area of medicine. PMID:28968433
Carrasco, José Miguel; García, Miriam; Navas, Alejandro; Olza, Inés; Gómez-Baceiredo, Beatriz; Pujol, Francesc; Garralda, Eduardo; Centeno, Carlos
2017-01-01
The goal of palliative care (PC) is to improve the quality of life of terminal stage patients and their families. The subject frequently appears in the mass-media and this helps create a socially accepted identity. The aim of this study is to describe and analyse PC related news items appeared in the Spanish written media. A descriptive cross-sectional study was designed. Considering diffusion, scope and the range in editorial policy criteria, four printed newspapers (PN) were selected, together with four exclusively digital media sources (DM). Through Mynews, a newspaper content depository, and the search tool for each DM website, articles published between 2009 and 2014 which included the terms "palliative care" and "palliative medicine" were sought. A questionnaire was created to characterise each article identified and a descriptive analysis was undertaken. A total of 627 articles were identified, of which 359 (57%) were published in PN (42% in the printed editions -PE- 16% in their online editions -OE-) and 268 (43%) in DM. In general, they appeared mainly in sections concerning Health (23%), Culture and Society (18%) and General/Home News (15%). In PE, just 2% were found in the Health section and nearly 70% in Culture and Society and General/Home News. Most of the articles were informative in nature and contained socio-political messages (90%). Statements by PC professionals were found in 35% of the articles and by politicians in 32%. The most frequent content was related to facing end of life (74%) and patient quality of life (70%). The Spanish written media reflects the socio-political interest aroused by PC. Nevertheless, messages circulating about PC do not describe professional practice, or the contribution of the same for patients. Content more in line with the clinical practice might help contribute to the development of this new area of medicine.
Directory of Open Access Journals (Sweden)
José Miguel Carrasco
Full Text Available The goal of palliative care (PC is to improve the quality of life of terminal stage patients and their families. The subject frequently appears in the mass-media and this helps create a socially accepted identity. The aim of this study is to describe and analyse PC related news items appeared in the Spanish written media.A descriptive cross-sectional study was designed. Considering diffusion, scope and the range in editorial policy criteria, four printed newspapers (PN were selected, together with four exclusively digital media sources (DM. Through Mynews, a newspaper content depository, and the search tool for each DM website, articles published between 2009 and 2014 which included the terms "palliative care" and "palliative medicine" were sought. A questionnaire was created to characterise each article identified and a descriptive analysis was undertaken.A total of 627 articles were identified, of which 359 (57% were published in PN (42% in the printed editions -PE- 16% in their online editions -OE- and 268 (43% in DM. In general, they appeared mainly in sections concerning Health (23%, Culture and Society (18% and General/Home News (15%. In PE, just 2% were found in the Health section and nearly 70% in Culture and Society and General/Home News. Most of the articles were informative in nature and contained socio-political messages (90%. Statements by PC professionals were found in 35% of the articles and by politicians in 32%. The most frequent content was related to facing end of life (74% and patient quality of life (70%.The Spanish written media reflects the socio-political interest aroused by PC. Nevertheless, messages circulating about PC do not describe professional practice, or the contribution of the same for patients. Content more in line with the clinical practice might help contribute to the development of this new area of medicine.
Media Education Initiatives by Media Organizations: The Uses of Media Literacy in Hong Kong Media
Chu, Donna; Lee, Alice Y. L.
2014-01-01
As more media organizations have engaged in media education, this paper investigates the goals and practices of these activities. This article coins media education initiatives by media organizations with the term "media-organization media literac"y (MOML). Four MOML projects in Hong Kong were selected for examination. Built on critical…
Allosteric activation of cytochrome P450 3A4 by efavirenz facilitates midazolam binding.
Ichikawa, Tomohiko; Tsujino, Hirofumi; Miki, Takahiro; Kobayashi, Masaya; Matsubara, Chiaki; Miyata, Sara; Yamashita, Taku; Takeshita, Kohei; Yonezawa, Yasushige; Uno, Tadayuki
2017-12-18
1. The purpose of this study is to investigate the heteroactivation mechanism of CYP3A4 by efavirenz, which enhances metabolism of midazolam in vivo, in terms of its binding to CYP3A4 with in vitro spectroscopic methods. 2. Efavirenz exhibited a type II spectral change with binding to CYP3A4 indicating a possible inhibitor. Although dissociation constant (K d ) was approximated as 520 μM, efavirenz enhanced binding affinity of midazolam as a co-existing drug with an estimated iK d value of 5.6 µM which is comparable to a clinical concentration. 3. Efavirenz stimulated the formation of 1'-hydroxymidazolam, and the product formation rate (V max ) concentration-dependently increased without changing the K m . Besides, an efavirenz analogue, [6-chloro-1,4-dihydro-4-(1-pentynyl)-4-(trifluoromethyl)-2H-3,1-benzoxazin-2-one] (efavirenz impurity) slightly facilitated the binding affinity of midazolam in a concentration-dependent manner. These results propose that efavirenz affects midazolam-binding via binding to the peripheral site which is apart from the active site of CYP3A4. 4. A molecular dynamics simulation also suggested the bound-efavirenz was repositioned to effector-binding site. As a consequence, our spectroscopic studies clarified the heteroactivation of CYP3A4 caused by efavirenz with a proper affinity to the peripheral site, and we concluded the method can be a useful tool for characterising the potential for drug-drug interactions.
Characterisation of mouse prothymocytes
Boersma, W.J.A.
1982-01-01
In this thesis, the study of growth kinetics of thymocytes in lethally irradiated mice as a means to characterise the early T-cell progenitors is described. Normal bone marrow cells were used as the source of hemopoietic cells. The experiments show that it is possible to obtain information on T-cell
Characterisation of COPD heterogeneity in the ECLIPSE cohort
DEFF Research Database (Denmark)
Agusti, Alvar; Calverley, Peter M A; Celli, Bartolome
2010-01-01
Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE).......Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE)....
Wastes Characterisation from Foundry Activities on European Level
International Nuclear Information System (INIS)
Andres, I.; Ruiz, C.; Ibanez, R.; Viguri, J.; Irabien, A.
1999-01-01
This work presents The results of the eco toxicological characterisation of 22 defined wastes from steel foundry activities. The wastes have been selected from three processes, steel mill (smelting). sand casting and cleaning and finishing of steel products,with the common characteristics of represent an important industrial activity in the area and generated the wastes considered in this study. The eco toxicological characterisation obtained applying the Spanish regulations on hazardous waste is compared to the hazardous attributions considered by the European Union in order to characterise a waste as hazardous (non hazardous). The results allow to conclude that a acceptable concordance between both methodologies is reached and remark the need to split the broad generic types of wastes given by the Spanish regulation (Eco toxic / non eco toxic) into clearly identifiable specific types of waste
Mobile news - a review and model of journalism in an age of mobile media
DEFF Research Database (Denmark)
Westlund, Oscar
2012-01-01
The technological convergence of mobile “phones” and multimedia has been taking place since the 1990s, but it was not until the commercial birth of touchscreen-enabled mobile devices, offered with flat-rate subscriptions for mobile internet, that widespread production and use of news....... This article explores the production of mobile news, by discussing and synthesising the findings of the contemporary literature found in the nexus of journalism and mobile media. It posits a model of journalism focusing on the roles of humans and technology in activities characterised by customising......-related content and services began to flourish. Accessing mobile news has gained traction in the everyday life of the public. In parallel, legacy news media have in recent years developed news provision, by repurposing or customising journalistic content published for mobile sites and/or applications...
Characterisation of focal liver lesions with contrast enhanced ultrasonography
International Nuclear Information System (INIS)
Dietrich, Christoph F.
2004-01-01
Ultrasound contrast agents (USCA) have improved the detection rate of liver tumours in recent years. Conventional ultrasound has been reported to be relatively unreliable in the characterisation of liver tumours. SonoVue [reg] (Bracco Imaging Spa) has been shown to be particularly advantageous in the differentiation of benign and malignant liver tumours and, therefore, possibly represents a new cost-effective competitive alternative to other liver imaging modalities (e.g. computed tomography and magnetic resonance imaging), thus allowing these important technologies to be available for other indications (e.g. brain, thorax). More detailed and specific liver tumour characterisation is possible in about 80% of liver tumours due to typical vascularity and perfusion patterns. The role of USCA for better characterisation, which is possible through the analysis of flow characteristics in real time, places a particular emphasis on agent use. Contrast enhanced real-time imaging techniques with SonoVue [reg] allow real-time analysis of tumour perfusion in patients with liver lesions. Liver tumours known to be hyperperfused in the arterial phase (e.g. focal nodular hyperplasia, hepatocellular adenoma and carcinoma, and hyperperfused metastases) can be better detected and characterised. Hypoperfused tumours (e.g. liver metastases of the gastrointestinal tract) can be recognised in the portal venous phase as less perfused 'black spots'. In this article we discuss liver tumour characterisation by contrast enhanced ultrasonography
Media Komunitas dan Media Literacy
Directory of Open Access Journals (Sweden)
Pawito .
2013-12-01
Full Text Available Abstract:This essay deals with community media in relation to media literacy. After a short discussion on a number of community media characters is made the essay goes further with somewhat detail theoretical presumptions of the roles of media community with respect primarily to the development as Amartya Sen mentioned about. The author suggests that community media may play some significant roles in the development including (a disseminating information (from varieties of perspective, (b facilitating public discussion, (c helping to reach solutions of problems, (d encouraging participations, and (e encouraging the development of media literacy. Regarding the last point the author remarks that media community may have a dual-roles i.e facilitating community’s member in media participation and facilitating community’s member in media education.
International Nuclear Information System (INIS)
Tyler, J.W.
1987-08-01
An understanding and quantification of iodine-131 attenuation within the gas circuit of a Commercial Advanced Gas-cooled Reactor is required for reactor safety assessments. To this end it is desirable to identify the chemical state of iodine in the gas phase or when deposited on reactor surfaces. Samples of 18%Cr/8%Ni and mild steel pipe, with iodine deposited on their surfaces following oxidation in CO 2 /CH 3 I gas mixtures, have been characterised in the present work using a variety of different spectroscopic techniques including X-ray photoelectron spectroscopy, scanning electron microscopy, energy dispersive X-ray analysis, scanning Auger microscopy and X-ray diffraction. The chemical nature of the deposited iodine has been determined by X-ray photoelectron spectroscopy to be a metal iodide by correlating I 3d binding energies with those obtained from well characterised standards; the binding energies of the ejected I 3d photoelectrons being sensitive to the chemical environment experienced by the iodine atoms. The distribution of iodine throughout the oxide layers formed on these steels was determined by repeated cycles of argon-ion bombardment and analysis to build up an elemental depth profile whilst at the same time determining the chemical state of the elements present. Differences in oxide composition and morphology are discussed in relation to the deposition behaviour observed on 18%Cr/8%Ni and mild steel and it is suggested that gradual incorporation of the iodine occurs throughout the oxidation/deposition period. (U.K.)
International Nuclear Information System (INIS)
Dupuy, B.
2011-11-01
Seismic wave propagation in multiphasic porous media have various environmental (natural risks, geotechnics, groundwater pollutions...) and resources (aquifers, oil and gas, CO 2 storage...) issues. When seismic waves are crossing a given material, they are distorted and thus contain information on fluid and solid phases. This work focuses on the characteristics of seismic waves propagating in multiphasic media, from the physical complex description to the parameter characterisation by inversion, including 2D numerical modelling of the wave propagation. The first part consists in the description of the physics of multiphasic media (each phase and their interactions), using several up-scaling methods, in order to obtain an equivalent mesoscale medium defined by seven parameters. Thus, in simple porosity saturated media and in complex media (double porosity, patchy saturation, visco-poro-elasticity), I can compute seismic wave propagation without any approximation. Indeed, I use a frequency-space domain for the numerical method, which allows to consider all the frequency dependent terms. The spatial discretization employs a discontinuous finite elements method (discontinuous Galerkin), which allows to take into account complex interfaces.The computation of the seismic attributes (velocities and attenuations) of complex porous media shows strong variations in respect with the frequency. Waveforms, computed without approximation, are strongly different if we take into account the full description of the medium or an homogenisation by averages. The last part of this work deals with the poro-elastic parameters characterisation by inversion. For this, I develop a two-steps method: the first one consists in a classical inversion (tomography, full waveform inversion) of seismograms data to obtain macro-scale parameters (seismic attributes). The second step allows to recover, from the macro-scale parameters, the poro-elastic micro-scale properties. This down-scaling step
Materials Characterisation of Glass/epoxy Composites - Focusing on Process Conditions
DEFF Research Database (Denmark)
Jakobsen, Johnny; Lyckegaard, Anders; Jensen, Erik Appel
2013-01-01
Predicting the behaviour of fibre reinforced polymer composites taking the process conditions into account involves advanced modelling techniques and an extensive materials characterisation. The materials characterisation of a chopped strand mat glass/epoxy composite has been the focus...
Analytical Characterisation of Nanoscale Zero-Valent Iron: A ...
Zero-valent iron nanoparticles (nZVI) have been widely tested as they are showing significant promise for environmental remediation. However, many recent studies have demonstrated that their mobility and reactivity in subsurface environments are significantly affected by their tendency to aggregate. Both the mobility and reactivity of nZVI mainly depends on properties such as particle size, surface chemistry and bulk composition. In order to ensure efficient remediation, it is crucial to accurately assess and understand the implications of these properties before deploying these materials into contaminated environments. Many analytical techniques are now available to determine these parameters and this paper provides a critical review of their usefulness and limitations for nZVI characterisation. These analytical techniques include microscopy and light scattering techniques for the determination of particle size, size distribution and aggregation state, and X-ray techniques for the characterisation of surface chemistry and bulk composition. Example characterisation data derived from commercial nZVI materials is used to further illustrate method strengths and limitations. Finally, some important challenges with respect to the characterisation of nZVI in groundwater samples are discussed. In recent years, manufactured nanoparticles (MNPs) have attracted increasing interest for their potential applications in the treatment of contaminated soil and water. In compar
Superficially located enlarged lymphoid follicles characterise nodular gastritis.
Okamura, Takuma; Sakai, Yasuhiro; Hoshino, Hitomi; Iwaya, Yugo; Tanaka, Eiji; Kobayashi, Motohiro
2015-01-01
Nodular gastritis is a form of chronic Helicobacter pylori gastritis affecting the gastric antrum and characterised endoscopically by the presence of small nodular lesions resembling gooseflesh. It is generally accepted that hyperplasia of lymphoid follicles histologically characterises nodular gastritis; however, quantitative analysis in support of this hypothesis has not been reported. Our goal was to determine whether nodular gastritis is characterised by lymphoid follicle hyperplasia.The number, size, and location of lymphoid follicles in nodular gastritis were determined and those properties compared to samples of atrophic gastritis. The percentages of high endothelial venule (HEV)-like vessels were also evaluated.The number of lymphoid follicles was comparable between nodular and atrophic gastritis; however, follicle size in nodular gastritis was significantly greater than that seen in atrophic gastritis. Moreover, lymphoid follicles in nodular gastritis were positioned more superficially than were those in atrophic gastritis. The percentage of MECA-79 HEV-like vessels was greater in areas with gooseflesh-like lesions in nodular versus atrophic gastritis.Superficially located hyperplastic lymphoid follicles characterise nodular gastritis, and these follicles correspond to gooseflesh-like nodular lesions observed endoscopically. These observations suggest that MECA-79 HEV-like vessels could play at least a partial role in the pathogenesis of nodular gastritis.
Energy Technology Data Exchange (ETDEWEB)
Wegkamp, Daniel; Krenz, Marcel; Wolf, Martin [Fritz Haber Institute of the MPG, Dept. of Physical Chemistry, Berlin (Germany); Freie Universitaet Berlin, Dept. of Physics, Berlin (Germany); Bovensiepen, Uwe [Universitaet Duisburg-Essen, Dept. of Physics, Duisburg (Germany); Freie Universitaet Berlin, Dept. of Physics, Berlin (Germany)
2010-07-01
To study ultrafast dynamics on a femtosecond timescale, laser pulses of comparable and shorter scale are used in this work in combination with 2-photon photoemission. Here, we report the principle, setup, and characterisation of a femtosecond light-source based on a noncollinear optical parametric amplifier (NOPA) and its application in studying the dynamics of Na/Cu(111) following. Laser pulses with duration <20 fs have been generated in the visible spectral range using a 300 kHz regenerative amplifier. In a single color scheme (h{nu}=2.3 eV) the NOPA pulses are used to excite and photoemit hot electrons, which are detected with a time of flight (TOF) spectrometer. With time independent measurements the binding energy of the adsorbate-induced resonance at 2 eV is observed in agreement with. As a function of pump-probe delay a time-dependent binding energy shift of the Na resonance with -2 meV/fs is observed. This shift is explained as a pump-induced movement of the sodium adsorbate away from the surface.
Elaboration and characterisation of plutonium waste reference materials
International Nuclear Information System (INIS)
Perolat, J.P.
1990-01-01
The Analysis Methods Establishment Commission (CETAMA) has set up a program for the elaboration and characterisation of plutonium waste reference materials. The object of this program is to give laboratories the possibility to test and calibrate apparatus used in non-destructive methods for the analysis of plutonium waste. The different parameters of this program are presented: - characterisation of plutonium, - type and number of containers, - plutonium distribution inside the different containers, - description of the matrix
Characterisation of contamination migration in the workplace
International Nuclear Information System (INIS)
Boulaud, D.; Laborde, J.C.; Pourprix, M.
1994-01-01
The Institute for Nuclear Safety and Protection (IPSN) has developed a procedure for characterising airborne contamination between processes and the workplace in nuclear facilities. It was initially intended to use this process to validate operator choices concerning the monitoring of indoor air contamination (personnel monitoring, and environmental detection at fixed locations), but also to optimise the fundamental parameters which have a more or less direct influence on potential exposure of staff in the workplace (at the same time optimising the contamination source, close confinement, process ventilation and general ventilation). In practice, the methods used to obtain these expert appraisals were usually based on experiments carried out in situ: (i) characterisation of aerosol contamination by accurate measurement of the nature, concentration and particle size distribution at various locations; (ii) characterisation of the migration of contamination by precise measurement involving gas and/or particle tracing techniques. In parallel with these experiments, a considerable effort was made to develop and qualify computer codes capable of predicting or estimating the migration of contamination through complex ventilated areas, by means of both fluid mechanics and aerosol science. (Author)
RELIGIOUS COMMUNICATION IN THE CONTEXT OF CULTURE MEDIA
Directory of Open Access Journals (Sweden)
Maria S. Petrushkevych
2014-06-01
Full Text Available Purpose. The aim of the work is to determine the features of media culture that bind it with mass culture and mass communications and have the most significant effect on the general principles of the religious mass communication. In addition, the objective is to identify the skills system and traits of mass human that are necessary for using media culture. Methodology. The methodological basis is related to structuring, analytical analysis and synthesis of media features; highlighting phenomena that illustrate modern communicative situation; characteristics of media trends influence for the specific functioning of religious communication. Scientific novelty. Main part of the work is devoted to the analysis of the progressive media culture, mass-media and their main features, design of religious communication in this culture. Media gradually form the appearance of religious communication quietly, especially the mass one, they adapt the modern religious discourse to rates of transfer and perception of information. Modern believer gets a lot of different kinds of religious information, on any subject, any explanation of the religious question, with respect to any religion. Such volume of religious information and the speed with which a person receives it, does not usually make it religious or spiritually advanced, but only informed. Spiritual perfection and religious development, religious communication is possible only when the customer is aware of media culture and way of seeing the ultimate goal of such communications using the Mass Media. So far these mechanisms are perfectly designed in traditional religious communication. Phenomena, that reflects the dramatic changes in the communicative environment are: mediatization of body and mind, the new practice of processing / reading information, the phenomenon of simultaneous perception of a large number of information channels – similar or different. Features of media culture that connect it with
From Augmentation Media to Meme Media.
Tanaka, Yuzuru
Computers as meta media are now evolving from augmentation media vehicles to meme media vehicles. While an augmentation media system provides a seamlessly integrated environment of various tools and documents, meme media system provides further functions to edit and distribute tools and documents. Documents and tools on meme media can easily…
International Nuclear Information System (INIS)
Mommaert, Chantal; Andrieu, Caroline; Desnoyers, Yvon; Denis Pombet; Salsac, Marie-Delphine; Knaack, Michael; Altavilla, Massimo; Manes, Daniela; Takahashi, Hiroaki; Ul Syed, Naeem; Palomo, Nieves Martin; Larsson, Arne; Dunlop, Alister; Susan Brown; Emptage, Matthew; Black, Greg; Abu-Eid, Rateb; Szilagyi, Andrew; Weber, Inge; )
2017-01-01
Radiological characterisation is a key enabling activity for the planning and implementation of nuclear facility decommissioning. Effective characterisation allows the extent, location and nature of contamination to be determined and provides crucial information for facility dismantling, the management of material and waste arisings, the protection of workers, the public and the environment, and associated cost estimations. This report will be useful for characterisation practitioners who carry out tactical planning, preparation, optimisation and implementation of characterisation to support the decommissioning of nuclear facilities and the management of associated materials and waste. It compiles recent experience from NEA member countries in radiological characterisation, including from international experts, international case studies, an international conference, and international standards and guidance. Using this comprehensive evidence base, the report identifies relevant good practice and provides practical advice covering all stages of the characterisation process
Sensory analysis of characterising flavours
Krüsemann, Erna J.Z.; Lasschuijt, Marlou P.; Graaf, de C.; Wijk, de René A.; Punter, Pieter H.; Tiel, van Loes; Cremers, Johannes W.J.M.; Nobelen, van de Suzanne; Boesveldt, Sanne; Talhout, Reinskje
2018-01-01
Objectives: Tobacco flavours are an important regulatory concept in several jurisdictions, for example in the USA, Canada and Europe. The European Tobacco Products Directive 2014/40/EU prohibits cigarettes and roll-your-own tobacco having a characterising flavour. This directive defines
Characterising performance of environmental models
Bennett, N.D.; Croke, B.F.W.; Guariso, G.; Guillaume, J.H.A.; Hamilton, S.H.; Jakeman, A.J.; Marsili-Libelli, S.; Newham, L.T.H.; Norton, J.; Perrin, C.; Pierce, S.; Robson, B.; Seppelt, R.; Voinov, A.; Fath, B.D.; Andreassian, V.
2013-01-01
In order to use environmental models effectively for management and decision-making, it is vital to establish an appropriate level of confidence in their performance. This paper reviews techniques available across various fields for characterising the performance of environmental models with focus
Social media management and media environment
Directory of Open Access Journals (Sweden)
Šiđanin Iva
2012-01-01
Full Text Available The paper deals with the system of services that social media management can offer to a variety of users. As social media systems are emerging, social media management can strengthen teams in social media and help to manage numerous social channels and distribution of social information from one place. Social media management is a system of procedures that are used to manage the flow of information in the environment of social media. This involves connecting with social media like Facebook, Twitter, LinkedIn, Plaxo, Ecademy, YouTube and many others, then the aggregation and management of social data. Social media management services are analysed through various fields, such as managing multiple social media profiles, mail scheduling and filtering, reporting and analytics. Social media management enables managing personal business through social media, which contributes to a significant reduction in expenditures. The paper also discusses the importance of social media management in marketing activities and various forms of social promotion, which allow companies to easily reach their customers.
Different Approach to the Aluminium Oxide Topography Characterisation
International Nuclear Information System (INIS)
Poljacek, Sanja Mahovic; Gojo, Miroslav; Raos, Pero; Stoic, Antun
2007-01-01
Different surface topographic techniques are being widely used for quantitative measurements of typical industrial aluminium oxide surfaces. In this research, specific surface of aluminium oxide layer on the offset printing plate has been investigated by using measuring methods which have previously not been used for characterisation of such surfaces. By using two contact instruments and non-contact laser profilometer (LPM) 2D and 3D roughness parameters have been defined. SEM micrographs of the samples were made. Results have shown that aluminium oxide surfaces with the same average roughness value (Ra) and mean roughness depth (Rz) typically used in the printing plate surface characterisation, have dramatically different surface topographies. According to the type of instrument specific roughness parameters should be used for defining the printing plate surfaces. New surface roughness parameters were defined in order to insure detailed characterisation of the printing plates in graphic reproduction process
Quantitative Characterisation of Surface Texture
DEFF Research Database (Denmark)
De Chiffre, Leonardo; Lonardo, P.M.; Trumpold, H.
2000-01-01
This paper reviews the different methods used to give a quantitative characterisation of surface texture. The paper contains a review of conventional 2D as well as 3D roughness parameters, with particular emphasis on recent international standards and developments. It presents new texture...
Safety in online media – freedom of the media; safety of media actors and media education
Moeller, Ch
2013-01-01
In this paper, prepared for the international conference ‘Mass Media – Society – Education: Media Safety Problems’ at the Chelyabinsk State University’s Department for Journalism and Media Education from September 30 – October 3, 2013, I would like to address three dimensions of media safety and security in online media.
[3H]Ouabain binding and Na+, K+-ATPase in resealed human red cell ghosts
International Nuclear Information System (INIS)
Shoemaker, D.G.; Lauf, P.K.
1983-01-01
The interaction of the cardiac glycoside [ 3 H]ouabain with the Na+, K+ pump of resealed human erythrocyte ghosts was investigated. Binding of [ 3 H]ouabain to high intracellular Na+ ghosts was studied in high extracellular Na+ media, a condition determined to produce maximal ouabain binding rates. Simultaneous examination of both the number of ouabain molecules bound per ghost and the corresponding inhibition of the Na+, K+-ATPase revealed that one molecule of [ 3 H]ouabain inhibited one Na+, K+-ATPase complex. Intracellular magnesium or magnesium plus inorganic phosphate produced the lowest ouabain binding rate. Support of ouabain binding by adenosine diphosphate (ADP) was negligible, provided synthesis of adenosine triphosphate (ATP) through the residual adenylate kinase activity was prevented by the adenylate kinase inhibitor Ap5A. Uridine 5'-triphosphate (UTP) alone did not support ouabain binding after inhibition of the endogenous nucleoside diphosphokinase by trypan blue and depletion of residual ATP by the incorporation of hexokinase and glucose. ATP acting solely at the high-affinity binding site of the Na+, K+ pump (Km approximately 1 microM) promoted maximal [ 3 H]ouabain binding rates. Failure of 5'-adenylyl-beta-gamma-imidophosphate (AMP-PNP) to stimulate significantly the rate of ouabain binding suggests that phosphorylation of the pump was required to expose the ouabain receptor
Kørvel-Hanquist, Asbjørn; Koch, Anders; Lous, Jørgen; Olsen, Sjurdur Frodi; Homøe, Preben
2018-03-01
Otitis media is the primary cause of antibiotic prescription in children. Two-thirds of all children experience at least one episode of otitis media before the age of 7 years. The aim of this study was to characterise the attributable effect of several modifiable risk exposures on the risk of >3 episodes of otitis media at age 18 months and 7 years within a large prospective national birth cohort. The study used the Danish National Birth Cohort comprising information about otitis media and risk exposures from more than 50,000 mother-child pairs from the period 1996-2002. Logistic regression models were used to estimate odds ratios for the risk factors and to calculate the population attributable fraction. Short time with breastfeeding, early introduction to daycare, cesarean section, and low compliance to the national vaccination program were all associated with an increased risk of >3 episodes of otitis media at 18 months of age and at 7 years of age. The fraction of children with otitis media attributed from breastfeeding lasting for less than 6 months was 10%. Introduction to daycare before the age of 12 months attributed with 20% of the cases of >3 episodes of otitis media. Short duration of breastfeeding, early introduction into daycare, cesarean section, and low compliance with the national vaccination program increased the risk of experiencing >3 episodes of otitis media at 18 months, and at 7 years of age. These are factors that all can be modulated. Copyright © 2018 Elsevier B.V. All rights reserved.
Negotiating the New Media Platforms: Youth and Political Images in Kenya
Directory of Open Access Journals (Sweden)
Lynete Lusike Mukhongo
2014-03-01
Full Text Available New media platforms, particularly social networks act as vehicles for visual representation of a nation’s political discourse among the youth. Web 2.0 has created online spaces (private and public that have been appropriated by Kenyan youth, locally, and in the Diaspora to weave their own political narratives and present them in forums that accommodate their views without fear of censorship or regulation that characterises “offline” communications. Using post structuralism, with emphasis on Roland Barthes “Death of the Author” and “Camera Lucida”, the article critically analyses how cultural values affect the interpretation of online political images from Kenya, by internet users from different culture zones. Further, the article discusses whether political images posted by the youth in Kenya on their online private spaces can be used to promote political stereotypes, subjectivities and perpetuate visual hegemonies; or whether it allows the youth to circumvent government surveillance tactics and afford nations an opportunity to correct the media hegemony by rewriting their own stories on a platform that is not just national, but transnational
Characterisation of subsonic axisymmetric nozzles
Czech Academy of Sciences Publication Activity Database
Tesař, Václav
2008-01-01
Roč. 86, č. 11 (2008), s. 1253-1262 ISSN 0263-8762 R&D Projects: GA AV ČR IAA200760705 Institutional research plan: CEZ:AV0Z20760514 Keywords : nozzle * characterisation * nozzle properties * nozzle invariants Subject RIV: BK - Fluid Dynamics Impact factor: 0.989, year: 2008
McCrea, Keith R.; Ward, Robert S.
2016-06-01
Removal of several drug-resistant bacteria from blood by affinity adsorption onto a heparin-functional media is reported. Heparin is a chemical analogue of heparan sulfate (HS) proteoglycans, found on transmembrane proteins of endothelial cells. Many blood-borne human pathogens, including bacteria, viruses, parasites, and fungi have been reported to target HS as an initial step in their pathogenesis. Here, we demonstrate the binding and removal of Methicillin-resistant Staphylococcus aureus (MRSA), Extended-Spectrum Betalactamase Klebsiella pneumoniae (ESBL), and two Carbapenem-resistant Enterobacteriaceae (both CRE Escherichia coli and CRE K. pneumoniae) using 300 μm polyethylene beads surface modified with end-point-attached heparin. Depending on the specific bacteria, the amount removed ranged between 39% (ESBL) and 99.9% (CRE). The total amount of bacteria adsorbed ranged between 2.8 × 105 and 8.6 × 105 colony forming units (CFU) per gram of adsorption media. Based on a polymicrobial challenge which showed no competitive binding, MRSA and CRE apparently utilize different binding sequences on the immobilized heparin ligand. Since the total circulating bacterial load during bacteremia seldom exceeds 5 × 105 CFUs, it appears possible to significantly reduce bacterial concentration in infected patients by multi-pass recirculation of their blood through a small extracorporeal affinity filter containing the heparin-functional adsorption media. This 'dialysis-like therapy' is expected to improve patient outcomes and reduce the cost of care, particularly when there are no anti-infective drugs available to treat the infection.
Media Literacy in Times of Media Divides
Directory of Open Access Journals (Sweden)
Kaja Žuran
2013-12-01
Full Text Available We live in a post-modern society, an information society, a society based around knowledge and participation, and above all in a media society. In a media culture where media holds a dominant position, we cannot overlook the emerging idea of a ‘media divide’ within the frame of media education, media literate individuals and the expansion of the traditional concept of media literacy. Firstly, we are in an era of technological revolution, and it is time to consider the meaning and function of media and how we experience it in our everyday life. Secondly, as a society we are subject to intense media invasion and we all need to learn how to use it to our benefit and apply a critical and autonomous perspective towards selecting media content. Otherwise the media divide between the media literate and illiterate will widen; but is there even a chance to overcome the supposed divide between those who are formally media educated and those who are not?
Diel, P; Friedel, A; Geyer, H; Kamber, M; Laudenbach-Leschowsky, U; Schänzer, W; Thevis, M; Vollmer, G; Zierau, O
2007-02-28
Desoxymethyltestosterone (DMT), also known as Madol, is a steroid recently identified to be misused as a doping agent. Since, the knowledge of functions of this substance is rather limited, it was our aim to characterise the pharmacological profile of DMT and to identify potential adverse side effects. DMT was synthesised, its purity was confirmed and its biological activity was tested. The potency of Madol (DMT) to transactivate androgen receptor (AR) dependent reporter gene expression was two times lower as compared to dihydrotestosterone (DHT). Receptor binding tests demonstrate that DMT binds with high selectivity to the AR, binding to the progesterone receptor (PR) was low. In vivo experiments in orchiectomised rats demonstrated that treatment with DMT resulted only in a stimulation of the weight of the levator ani muscle; the prostate and seminal vesicle weights remained unaffected. Like testosterone, administration of DMT resulted in a stimulation of IGF-1 and myostatin mRNA expression in the gastrocnemius muscle. In the prostate proliferation was stimulated by TP (testosteronepropionate), but remained unaffected by DMT. Remarkably, treatment with DMT, in contrast to TP, resulted in a significant increase of the heart weight. In the liver, DMT slightly stimulates the expression of the tyrosine aminotransferase gene (TAT). Our results demonstrate that DMT is a potent AR agonist with an anabolic activity. Besides the levator ani weight, DMT also modulates the gene expression in the musculus gastrocnemius. The observed stimulation of TAT expression in the liver and the significant increase of the heart weight after DMT treatment can be taken as an indication for side effects. Summarizing these data it is obvious that DMT is a powerful anabolic steroid with selective androgen receptor modulators (SARM) like properties and some indications for toxic side effects. Therefore, there is a need for a strict control of a possible misuse.
DEFF Research Database (Denmark)
Serena, Anja; Bach Knudsen, Knud Erik
2007-01-01
was responsible for the relatively low EDOM. There was a variation from year to year in the concentration of ash (Pprotein (P=0.04) and EDOM (P=0.003) in pea hull. In conclusion, co-products from the vegetable food and agro industries are characterised by a high......Six co-products from the vegetable food and agro industres in Denmark - brewer's spent grain, pea hull, seed residue (rye grass), potato pulp, sugar beet pulp and pectin residue - were collected eight times during two seasons (four samples from each season) (n = 8; N = 48). The samples were...... analysed for dry matter (DM), ash, sand, protein, amino acids, ether extract (EE), carbohydrate constituents, enzyme digestible organic matter (EDOM) and physicochemical properties-water binding capacity (WBC) and swelling. The co-products in general had a low DM (142-216 g/kg as is), EE (6-54 g/kg DM...
Characterisation of ferroelectric bulk materials and thin films
Cain, Markys G
2014-01-01
This book presents a comprehensive review of the most important methods used in the characterisation of piezoelectric, ferroelectric and pyroelectric materials. It covers techniques for the analysis of bulk materials and thick and thin film materials and devices. There is a growing demand by industry to adapt and integrate piezoelectric materials into ever smaller devices and structures. Such applications development requires the joint development of reliable, robust, accurate and - most importantly - relevant and applicable measurement and characterisation methods and models. In the past f
Molecular weight characterisation of synthetic polymers
Holding, Steve R
1995-01-01
The report comprises a state-of-the-art overview of the subject of molecular weight characterisation, supported by an extensive, indexed bibliography. The bibliography contains over 400 references and abstracts, compiled from the Polymer Library.
[Chronic otitis mediaChronic Otitis Media].
Kohles, N; Schulz, T; Eßer, D
2015-11-01
There are 2 different kinds of chronic otitis media: Otitis media chronica mesotympanalis and otitis media chronica epitympanalis (cholesteatoma). The incidence of chronic otitis media as reported in literature differs in a wide range. The incidence rates vary between 0.45 and 46%. Both, otitis media chronica mesotympanalis and cholesteatoma, lead to eardrum perforation due to lengthy and recurring inflammations. Furthermore, chronic otitis media is characterized by frequently recurring otorrhea and conductive hearing loss. Georg Thieme Verlag KG Stuttgart · New York.
International Nuclear Information System (INIS)
Larsson, Arne; Weber, Inge
2016-01-01
Radiological characterisation plays a significant role in the process of decommissioning of shut-down nuclear facilities in order to ensure the protection of the environment and radiation safety. At all stages of a decommissioning programme or project, adequate radiological characterisation is of crucial importance, not least from a material and waste perspective. The radiological characterisation is a key element for planning, controlling and optimising decommissioning and dismantling activities. Experience has shown that data and information from the operation of a facility can - supplemented by recently collected and analysed data and information - be of crucial importance for decisions on waste management and for characterisation of radioactive waste. Once the dismantling has been done, some information may be hard, costly or even impossible to obtain later in the waste management process. This was the reason why the Working Party on Decommissioning and Dismantling (WPDD) of the OECD Nuclear Energy Agency (NEA) decided in late 2013 to extend the mandate of the Task Group on Radiological Characterisation and Decommissioning (TGRCD) for a second phase focusing on nuclear facility characterisation from a waste and material end-state perspective whereas the first phase focused on overall strategies of radiological characterisation. This paper gives an overview of the activities and findings within both phases up to now. (authors)
Energy Technology Data Exchange (ETDEWEB)
Belgiorno, Francesco [Politecnico di Milano, Dipartimento di Matematica, Milano (Italy); INdAM-GNFM, Milano (Italy); Cacciatori, Sergio L. [Universita dell' Insubria, Department of Science and High Technology, Como (Italy); INFN sezione di Milano, Milano (Italy); Dalla Piazza, Francesco [Universita ' ' La Sapienza' ' , Dipartimento di Matematica, Roma (Italy); Doronzo, Michele [Universita dell' Insubria, Department of Science and High Technology, Como (Italy)
2016-06-15
We investigate the quantisation in the Heisenberg representation of a model which represents a simplification of the Hopfield model for dielectric media, where the electromagnetic field is replaced by a scalar field φ and the role of the polarisation field is played by a further scalar field ψ. The model, which is quadratic in the fields, is still characterised by a non-trivial physical content, as the physical particles correspond to the polaritons of the standard Hopfield model of condensed matter physics. Causality is also taken into account and a discussion of the standard interaction representation is also considered. (orig.)
International Nuclear Information System (INIS)
Grundt, Kirsten; Haga, Ingvild Vagslid; Aleporou-Marinou, Vasiliki; Drosos, Yiannis; Wanvik, Birgit; Ostvold, Anne Carine
2004-01-01
The NUCKS gene is located on human chromosome 1q32.1 and consists of seven exons and six introns. The gene lacks a TATA box but contains two Inr elements, two GC boxes, and one consensus-binding site for E2F-1. NUCKS is expressed in all human adult and foetal tissues investigated, and has all the features of being a housekeeping gene. Both data searches and Western immunoblotting experiments show that a homologous protein is present in fish, amphibians, and birds but not in insects and yeast, suggesting that NUCKS is a vertebrate specific gene. In all the species investigated, the protein contains several consensus phosphorylation sites for cyclin-dependent kinases and CK-2, and we have shown that the fish protein (like mammalian NUCKS) indeed is a substrate for CDK1 and CK-2 in vitro. The NUCKS protein is also conserved with respect to a DNA-binding domain previously characterised in mammals, and two putative bipartite nuclear localisation signals
Girls, Guys and Games: How News Media Perpetuate Stereotypes of Male and Female Gamers
Directory of Open Access Journals (Sweden)
Erin Maclean
2016-07-01
Full Text Available Despite the sheer popularity of gaming, stereotypes of gamers are persistent and often ill-informed. The average age of an Australian gamer, for example, is 33 and nearly half of gamers are female. Yet, few mainstream and gaming news articles seem to acknowledge this diversity. Because news media and public perception are intertwined, such misrepresentation may affect the way gamers are perceived by the public and, in turn, how gamers negotiate their identities. This paper, through a primarily qualitative analysis of 75 online news articles, explores many examples of simplistic and distorted portrayals of gamers that characterise news coverage. In particular, it examines three gendered tropes—‘not real’ female gamers, women as the victims and oppressors of gamers, and toxic male gamers—that news media use to frame the narratives that misrepresent gaming in social life. Ultimately, this article argues that two prevailing themes underlie many news stories about gaming: the perpetuation of male technocratic privilege and moral panic. Both of these phenomena have relevance to the #GamerGate controversy of 2014, which news media portrayed as a ‘culture war’ between these inaccurate notions of male and female gamers. Thus, this indicates that the media blame game and alienation of gaming culture, as a multibillion-dollar international industry of increasing social importance, must be acknowledged and addressed.
Messner, Donald J; Surrago, Christine; Fiordalisi, Celia; Chung, Wing Yin; Kowdley, Kris V
2017-10-01
Iron overload disorders may be treated by chelation therapy. This study describes a novel method for isolating iron chelators from complex mixtures including plant extracts. We demonstrate the one-step isolation of curcuminoids from turmeric, the medicinal food spice derived from Curcuma longa. The method uses iron-nitrilotriacetic acid (NTA)-agarose, to which curcumin binds rapidly, specifically, and reversibly. Curcumin, demethoxycurcumin, and bisdemethoxycurcumin each bound iron-NTA-agarose with comparable affinities and a stoichiometry near 1. Analyses of binding efficiencies and purity demonstrated that curcuminoids comprise the primary iron binding compounds recovered from a crude turmeric extract. Competition of curcuminoid binding to the iron resin was used to characterize the metal binding site on curcumin and to detect iron binding by added chelators. Curcumin-Iron-NTA-agarose binding was inhibited by other metals with relative potency: (>90% inhibition) Cu 2+ ~ Al 3+ > Zn 2+ ≥ Ca 2+ ~ Mg 2+ ~ Mn 2+ (80% by addition of iron to the media; uptake was completely restored by desferoxamine. Ranking of metals by relative potencies for blocking curcumin uptake agreed with their relative potencies in blocking curcumin binding to iron-NTA-agarose. We conclude that curcumin can selectively bind toxic metals including iron in a physiological setting, and propose inhibition of curcumin binding to iron-NTA-agarose for iron chelator screening.
CO2 Storage Feasibility: A Workflow for Site Characterisation
Directory of Open Access Journals (Sweden)
Nepveu Manuel
2015-04-01
Full Text Available In this paper, we present an overview of the SiteChar workflow model for site characterisation and assessment for CO2 storage. Site characterisation and assessment is required when permits are requested from the legal authorities in the process of starting a CO2 storage process at a given site. The goal is to assess whether a proposed CO2 storage site can indeed be used for permanent storage while meeting the safety requirements demanded by the European Commission (EC Storage Directive (9, Storage Directive 2009/31/EC. Many issues have to be scrutinised, and the workflow presented here is put forward to help efficiently organise this complex task. Three issues are highlighted: communication within the working team and with the authorities; interdependencies in the workflow and feedback loops; and the risk-based character of the workflow. A general overview (helicopter view of the workflow is given; the issues involved in communication and the risk assessment process are described in more detail. The workflow as described has been tested within the SiteChar project on five potential storage sites throughout Europe. This resulted in a list of key aspects of site characterisation which can help prepare and focus new site characterisation studies.
Jaspal, Rusi; Nerlich, Brigitte
2014-02-01
Climate change has become a pressing environmental concern for scientists, social commentators and politicians. Previous social science research has explored media representations of climate change in various temporal and geographical contexts. Through the lens of Social Representations Theory, this article provides a detailed qualitative thematic analysis of media representations of climate change in the 1988 British broadsheet press, given that this year constitutes an important juncture in this transition of climate change from the domain of science to that of the socio-political sphere. The following themes are outlined: (i) "Climate change: a multi-faceted threat"; (ii) "Collectivisation of threat"; (iii) "Climate change and the attribution of blame"; and (iv) "Speculative solutions to a complex socio-environmental problem." The article provides detailed empirical insights into the "starting-point" for present-day disputes concerning climate change and lays the theoretical foundations for tracking the continuities and discontinuities characterising social representations of climate change in the future.
Glaser, Robert; Venus, Joachim
2017-07-25
Three Bacillus coagulans strains were characterised in terms of their ability to grow in lignin-containing fermentation media and to consume the lignocellulose-related sugars glucose, xylose, and arabinose. An optical-density high-throughput screening was used for precharacterisation by means of different mathematical models for comparison (Logistic, Gompertz, Baranyi, Richards & Stannard, and Schnute). The growth response was characterised by the maximum growth rate and lag time. For a comparison of the screening and fermentation results, an unstructured mathematical model was proposed to characterise the lactate production, bacterial growth and substrate consumption. The growth model was then applied to fermentation procedures using wheat straw hydrolysates. The results indicated that the unstructured growth model can be used to evaluate lactate producing fermentation. Under the experimental fermentation conditions, one strain showed the ability to tolerate a high lignin concentration (2.5g/L) but lacked the capacity for sufficient pentose uptake. The lactate yield of the strains that were able to consume all sugar fractions of glucose, xylose and arabinose was ∼83.4%. A photometric measurement at 280nm revealed a dynamic change in alkali-lignin concentrations during lactate producing fermentation. A test of decolourisation of vanillin, ferulic acid, and alkali-lignin samples also showed the decolourisation performance of the B. coagulans strains under study. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rafael Mesquita
2016-06-01
Full Text Available Abstract This study analyses whether Brazilian foreign policy under Lula successfully legitimised the country's international identity as a rising power in the eyes of the domestic and international media. Based on a constructivist framework, we have applied French Discourse Analysis to a corpus of 36 official addresses by the President of the Republic and the Minister of Foreign Relations and 137 news articles from four news outlets, two Brazilian and two international, concerning two diplomatic episodes deemed representative of Brazil's quest for greater pre-eminence: the leadership of MINUSTAH (2004 and the Nuclear Deal signed with Iran and Turkey (2010. Results show that official discourse characterises Brazil's identity as a rising power chiefly by South-South diplomacy, while media discourse was more heterogeneous, being the discursive formation of each news outlet determinant in explaining their interpretation of Brazil's international identity.
Investigating the DNA-binding ability of GATA-1-N-terminal zinc finger
International Nuclear Information System (INIS)
Wong, R.; Newton, A.; Crossley, M.; Mackay, J.
2001-01-01
Erythroid transcription factor GATA-1 interacts with both DNA and other proteins through its zinc finger domains (ZnFs). While it has been known for me time that the C-terminal ZnF binds DNA at GATA sites, only recently has it been observed that the N-terminal finger (NF) is capable of interacting with GATC sites. Further, a number of naturally occurring mutations in NF (V205M, G208S, R216Q, D218G) that lead to anaemia and thrombocytopenia have been identified. We are interested in characterising the NF-DNA interaction and determining the effects of mutation upon this interaction. Using nuclear magnetic resonance (NMR) spectroscopy, we have observed an interaction between recombinant NF and a 16-mer DNA duplex containing a core GATC sequence. This result forms the basis from which residues in NF involved in DNA binding can be identified, and work is being carried out to improve the quality of the NMR data with the aim of determining the solution structure of the NF-DNA complex. The DNA-binding affinity of both wild-type and mutant NFs mentioned above is also being investigated using isothermal titration calorimetry. These data suggest that the strength of the interaction between NF and the 16-mer DNA duplex is in the sub-micromolar range, and comparisons between the DNA-binding affinities of the NF mutants are being made. Together, these studies will help us to understand how GATA-1 acts as a transcriptional regulator and how mutations in NF domain of GATA-1 may lead to blood disorders
Towards an understanding of Mesocestoides vogae fatty acid binding proteins' roles.
Directory of Open Access Journals (Sweden)
Gabriela Alvite
Full Text Available Two fatty acid binding proteins, MvFABPa and MvFABPb were identified in the parasite Mesocestoides vogae (Platyhelmithes, Cestoda. Fatty acid binding proteins are small intracellular proteins whose members exhibit great diversity. Proteins of this family have been identified in many organisms, of which Platyhelminthes are among the most primitive. These proteins have particular relevance in flatworms since de novo synthesis of fatty acids is absent. Fatty acids should be captured from the media needing an efficient transport system to uptake and distribute these molecules. While HLBPs could be involved in the shuttle of fatty acids to the surrounding host tissues and convey them into the parasite, FABPs could be responsible for the intracellular trafficking. In an effort to understand the role of MvFABPs in fatty acid transport of M. vogae larvae, we analysed the intracellular localization of both MvFABPs and the co-localization with in vivo uptake of fatty acid analogue BODIPY FL C16. Immunohistochemical studies on larvae sections using specific antibodies, showed a diffuse cytoplasmic distribution of each protein with some expression in nuclei and mitochondria. MvFABPs distribution was confirmed by mass spectrometry identification from 2D-electrophoresis of larvae subcellular fractions. This work is the first report showing intracellular distribution of MvFABPs as well as the co-localization of these proteins with the BODIPY FL C16 incorporated from the media. Our results suggest that fatty acid binding proteins could target fatty acids to cellular compartments including nuclei. In this sense, M. vogae FABPs could participate in several cellular processes fulfilling most of the functions attributed to vertebrate's counterparts.
International Nuclear Information System (INIS)
Thierfeldt, Stefan; Haneke, K.
2012-01-01
In the first half of 2011, the Radiological Characterization and Decommissioning Task Group (RCD) of the WPDD of the OECD/NEA has prepared a questionnaire on the characterisation of nuclear facilities that has been circulated among nuclear installations in various OECD countries. The aim of this questionnaire was to gather information on the approaches and methods that are used for radiological characterisation (RC) for systems and components, for buildings and for sites (land), on domestic and international guidance and regulations that govern RC, and on the experience with RC that is already available in the particular country. The number of responses to this questionnaire that were received in the second half of 2011 was very satisfactory, so that a broad overview is now available from the following countries: Belgium, Canada, Denmark, Finland, France, Germany, Japan, Korea, Spain, Sweden, and United Kingdom. The presentation deals with the results that were obtained from the evaluation of these questionnaires and gives overviews of the objectives of characterisation, the input data for planning of characterisation, the measurement techniques that were used for metallic structures and components, for buildings and for sites, the data management and QA measures, the obstacles that were encountered, the experience with availability of as-built plans, the regulatory framework and guidelines, and the costs for RC. All information on RC is further broken down with respect to the operational phase (where RC is used for preliminary decommissioning planning), the transition phase (where RC supports decommissioning planning) and the actual decommissioning phase (where RC is needed for dismantling, decontamination and treatment of systems, components, buildings etc.). The presentation also offers conclusions on these subjects. (authors)
Characterisation of a Sr-90 based electron monochromator
Arfaoui, S; CERN; Casella, C; ETH Zurich
2015-01-01
This note describes the characterisation of an energy filtered Sr-90 source to be used in laboratory studies that require Minimum Ionising Particles (MIP) with a kinetic energy of up to approx. 2 MeV. The energy calibration was performed with a LYSO scintillation crystal read out by a digital Silicon Photomultiplier (dSiPM). The LYSO/dSiPM set-up was pre-calibrated using a Na-22 source. After introducing the motivation behind the usage of such a device, this note presents the principle and design of the electron monochromator as well as its energy and momentum characterisation.
Managing Media: Segmenting Media Through Consumer Expectancies
Directory of Open Access Journals (Sweden)
Matt Eastin
2014-04-01
Full Text Available It has long been understood that consumers are motivated to media differently. However, given the lack of comparative model analysis, this assumption is without empirical validation, and thus, the orientation of segmentation from a media management perspective is without motivational grounds. Thus, evolving the literature on media consumption, the current study develops and compares models of media segmentation within the context of use. From this study, six models of media expectancies were constructed so that motivational differences between media (i.e., local and national newspapers, network and cable television, radio, and Internet could be observed. Utilizing higher order statistical analyses the data indicates differences across a model comparison approach for media motivations. Furthermore, these differences vary across numerous demographic factors. Results afford theoretical advancement within the literature of consumer media consumption as well as provide media planners’ insight into consumer choices.
Characterisation of the carbohydrate components of Taenia solium metacestode glycoprotein antigens.
Restrepo, B I; Obregón-Henao, A; Mesa, M; Gil, D L; Ortiz, B L; Mejía, J S; Villota, G E; Sanzón, F; Teale, J M
2000-05-01
Human neurocysticercosis is caused by Taenia solium metacestodes. It usually affects the central nervous system of humans and can be confused with other brain pathologies. The Lens culinaris-binding glycoproteins from this parasite have been shown to be ideal targets for the development of a highly specific immunoassay for the diagnosis of neurocysticercosis. In the present study we characterised the carbohydrates associated with five antigenic glycoproteins of T. solium metacestodes in the range of 12-28 kilodaltons. Lectin-affinities and enzymatic deglycosylations suggested that each of the five antigens contain various glycoforms of asparagine-linked carbohydrates of the hybrid, complex and probably high mannose type. These carbohydrates accounted for at least 30-66% of the apparent molecular mass of the glycoconjugates. In contrast, there was no evidence for the presence of O-linked carbohydrates. Lectin affinity patterns suggested that the sugars are short and truncated in their biosynthetic route, and that some contain terminal galactose moieties. Elucidating the precise structure of the carbohydrates and establishing their role in antigenicity will be essential to design strategies to produce them in large and reproducible amounts for the development of improved immunoassays.
Characterisation of a low pathogenic form of Gyrodactylus salaris from rainbow trout
DEFF Research Database (Denmark)
Jørgensen, Thomas Rohde; Larsen, Thomas Bjerre; Jørgensen, Louise von Gersdorff
2007-01-01
A Danish form of Gyrodactylus salaris has been isolated and characterised. It is not pathogenic to Atlantic salmon.......A Danish form of Gyrodactylus salaris has been isolated and characterised. It is not pathogenic to Atlantic salmon....
Detailed Electrochemical Characterisation of Large SOFC Stacks
DEFF Research Database (Denmark)
Mosbæk, Rasmus Rode; Hjelm, Johan; Barfod, R.
2012-01-01
application of advanced methods for detailed electrochemical characterisation during operation. An operating stack is subject to steep compositional gradients in the gaseous reactant streams, and significant temperature gradients across each cell and across the stack, which makes it a complex system...... Fuel Cell A/S was characterised in detail using electrochemical impedance spectroscopy. An investigation of the optimal geometrical placement of the current probes and voltage probes was carried out in order to minimise measurement errors caused by stray impedances. Unwanted stray impedances...... are particularly problematic at high frequencies. Stray impedances may be caused by mutual inductance and stray capacitance in the geometrical set-up and do not describe the fuel cell. Three different stack geometries were investigated by electrochemical impedance spectroscopy. Impedance measurements were carried...
Radiological characterisation experience with Magnox reactors
International Nuclear Information System (INIS)
Westall, Bill A.; Towton, Barbara
2012-01-01
At the end of generation, power reactors will be decommissioned. Whether decommissioning is prompt or deferred, knowledge of the radioactive inventory of plant and structures is needed to develop and underpin the decommissioning strategy. As decommissioning progresses the level of detail required for the radioactive inventory increases as more specific and detailed questions need answering. Failure to adequately characterise will result in increased costs and project overruns due to missing optimal solutions, over pessimistic assumptions or unforeseen problems and regulatory issues. Radiological characterisation for decommissioning of Magnox power stations in the UK has been in progress for over a quarter of a century. Firstly measurements and calculations were carried out to develop a strategy. These have been followed by measurements to determine radioactive inventories of waste streams and packages or to allow decontamination of structures and most recently for partial de-licensing of sites. Some examples of the work carried out for the Magnox stations will be given, ranging from the neutron activation calculations to estimate the radioactive inventory within a bio-shield and measurements to validate them. Various plant and structures where the radioactive inventory is due to contamination have been characterised by measurements and examples for boilers and cooling ponds will be discussed. Various routine and ad-hoc measurements and shielding assessments have been performed on waste forms to help satisfy conditions for acceptance for disposal or exemption, which will be reviewed. Finally the measurements for de-licensing and the successful application of Data Quality Objectives will be addressed. (authors)
Media relations after the introduction of social media
Mesila, Helin
2010-01-01
In the light of the popularity of social media on one hand, and the contradictive relationships between journalists and public relations practitioners on the other hand, the thesis studies media relations after the introduction of social media. The study focuses on media relations in Estonian public relations scenery. The research answers to the questions: - What are media relations today? - What are the functions of social media and media relations in organizational communication? ...
Synthesis and characterisation of doxorubicin-loaded functionalised ...
African Journals Online (AJOL)
that it modified the CFNP surface from hydrophobic to hydrophilic. VSM analysis ... characterisation of. XG-coated. CFNPs ..... nanoparticles display a characteristic plasmon resonance .... coating method and its application to grow thin films of.
An exploration of the use of social media by surgical colleges.
Ralston, Maximilian R; O'Neill, Stephen; Wigmore, Stephen J; Harrison, Ewen M
2014-12-01
Social media use has become common for organisations in surgery, however the nature and reach of these communications is unknown. This study aimed to characterise and compare the use of "Twitter" by five prominent organisations in surgery. Data were collected from Twitter and the scale, reach, nature and sentiment of messages analysed. Message influence was determined and content analysed by frequency and association using hierarchical clustering and network analysis. Poisson regression was used to compare institutional message and "re-tweet" counts. 7712 messages were analysed from a four-year period up to 13th April 2013. The American College of Surgeons (ACS) had tweeted most and posted the greatest number of messages per day (3.3/day). The number of followers reflects social reach and the Royal College of Surgeons of England (RCSEng) had the greatest number (11,600) followed by the ACS (7320). The number of "retweets" a message receives is a measure of influence with the RCSEng (2.0) demonstrating a significantly greater count than the Royal College of Surgeons of Ireland (RCSI; 0.8, p social media. UK colleges frequently communicate about education/training opportunities while the ACS focuses on patient-related matters. Only one organisation was found to have an explicit social media policy, which would be considered best practice and can focus on-line activity. Copyright © 2014 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.
Popovic, B; Breed, J; Rees, D G; Gardener, M J; Vinall, L M K; Kemp, B; Spooner, J; Keen, J; Minter, R; Uddin, F; Colice, G; Wilkinson, T; Vaughan, T; May, R D
2017-01-20
Interleukin (IL)-13 is a pleiotropic T helper type 2 cytokine frequently associated with asthma and atopic dermatitis. IL-13-mediated signalling is initiated by binding to IL-13Rα1, which then recruits IL-4Rα to form a heterodimeric receptor complex. IL-13 also binds to IL-13Rα2, considered as either a decoy or a key mediator of fibrosis. IL-13-neutralising antibodies act by preventing IL-13 binding to IL-13Rα1, IL-4Rα and/or IL-13Rα2. Tralokinumab (CAT-354) is an IL-13-neutralising human IgG4 monoclonal antibody that has shown clinical benefit in patients with asthma. To decipher how tralokinumab inhibits the effects of IL-13, we determined the structure of tralokinumab Fab in complex with human IL-13 to 2 Å resolution. The structure analysis reveals that tralokinumab prevents IL-13 from binding to both IL-13Rα1 and IL-13Rα2. This is supported by biochemical ligand-receptor interaction assay data. The tralokinumab epitope is mainly composed of residues in helices D and A of IL-13. It is mostly light chain complementarity-determining regions that are driving paratope interactions; the variable light complementarity-determining region 2 plays a key role by providing residue contacts for a network of hydrogen bonds and a salt bridge in the core of binding. The key residues within the paratope contributing to binding were identified as Asp50, Asp51, Ser30 and Lys31. This study demonstrates that tralokinumab prevents the IL-13 pharmacodynamic effect by binding to IL-13 helices A and D, thus preventing IL-13 from interacting with IL-13Rα1 and IL-13Rα2. Copyright © 2016 AstraZeneca. Published by Elsevier Ltd.. All rights reserved.
RESPONSIBILITY CENTCOM COALITION MEDIA SOCIAL MEDIA NEWS ARTICLES PRESS RELEASES IMAGERY VIDEOS TRANSCRIPTS VISITORS AND PERSONNEL FAMILY CENTER FAMILY READINESS CENTCOM WEBMAIL SOCIAL MEDIA SECURITY ACCOUNTABILITY HomeMEDIASOCIAL MEDIA Social Media CENTCOM'S ENGLISH SOCIAL MEDIA ACCOUNTS There are many U.S. military commands
DEFF Research Database (Denmark)
Tulsiani, Suhella; Craig, S B; Graham, G C
2010-01-01
A new test for pathogenic Leptospira isolates, based on RAPD-PCR and high-resolution melt (HRM) analysis (which measures the melting temperature of amplicons in real time, using a fluorescent DNA-binding dye), has recently been developed. A characteristic profile of the amplicons can be used...... typed against 13 previously published RAPD primers, using a real-time cycler (the Corbett Life Science RotorGene 6000) and the optimised reagents from a commercial kit (Quantace SensiMix). RAPD-HRM at specific temperatures generated defining amplicon melt profiles for each of the tested serovars....... These profiles were evaluated as difference-curve graphs generated using the RotorGene software package, with a cut-off of at least 8 'U' (plus or minus). The results demonstrated that RAPD-HRM can be used to measure serovar diversity and establish identity, with a high degree of stability. The characterisation...
Imaging spectroscopy for characterisation of grass swards
Schut, A.G.T.
2003-01-01
Keywords: Imaging spectroscopy, imaging spectrometry, remote sensing, reflection, reflectance, grass sward, white clover, recognition, characterisation, ground cover, growth monitoring, stress detection, heterogeneity quantification
The potential of imaging spectroscopy as a tool for
KKS:The new power plant characterisation system in practice
International Nuclear Information System (INIS)
Becker, G.; Bohr, E.; Wildberg, D.
1982-01-01
These use of the new power plant characterisation system (KKS) in power plant operation is discussed. KKS intends to ensure reliable characterisation of plant components. It must be read, interpreted, communicated directly or by telephone and written down. An analysis under the aspects of information psychology and ergonomy has shown that the findings of ergonomy and information psychology have hardly been considerd in the design of KKS. The conclusions of this analysis are investigated with regard to their consequences for KKS application in power plant operation. Possibilities of improvement are discussed. (orig./HP) [de
CLASSICAL MEDIA RELATIONS AND NEW MEDIA RELATIONS IN SPORT
Directory of Open Access Journals (Sweden)
Alexandru Lucian MIHAI
2014-06-01
Full Text Available Media relations in sport mean maintenance of networks and positive relationships with people in the media to obtain positive media exposure for a sport product (informal and formal information sessions with media representatives. Because of the pervasive influence the media has on marketing success, sport marketers must make concerted efforts to create a positive relationship between their sport event and the media. They may accomplish this by providing the media with press releases, having news conferences, having media-day events (in which the media are invited to interact with the players, coaches, and administrators, providing media guides for the respective sport events and so on. Each of these activities promotes active involvement from the media, which will subsequently contribute to relationship building with the community.
Activation of NLRP3 inflammasome in human middle ear cholesteatoma and chronic otitis media.
Kariya, Shin; Okano, Mitsuhiro; Zhao, Pengfei; Kataoka, Yuko; Yoshinobu, Junko; Maeda, Yukihide; Ishihara, Hisashi; Higaki, Takaya; Nishizaki, Kazunori
2016-01-01
The nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) inflammasome plays an important role in the pathogenesis of middle ear diseases. Modulation of inflammasome-mediated inflammation may be a novel therapeutic strategy for cholesteatoma and chronic otitis media. NLRP3 inflammasome is a critical molecule mediating interleukin (IL)-1β responses. However, the expression of NLRP3 in the pathogenesis of cholesteatoma and chronic otitis media has not been fully examined. This study sought to assess the expression of NLRP3, ASC (apoptosis-associated speck-like protein containing a caspase recruitment domain and a pyrin domain), and caspase-1 in middle ear tissues in patients with cholesteatoma or chronic otitis media. Middle ear tissue samples were obtained from patients with cholesteatoma or chronic otitis media. Control middle ear samples were collected during cochlear implant surgery of patients without middle ear inflammation. The expression of NLRP3, ASC, and caspase-1 were examined by reverse transcription polymerase chain reaction (RT-PCR) assay and immunohistochemical study. The levels of mRNA of NLRP3, ASC, and caspase-1 were significantly elevated in cholesteatoma and chronic otitis media as compared with that of normal controls. The proteins of NLRP3, ASC, and caspase-1 were observed in infiltrating inflammatory cells in cholesteatoma and chronic otitis media.
Hyphenated analytical techniques for materials characterisation
International Nuclear Information System (INIS)
Armstrong, Gordon; Kailas, Lekshmi
2017-01-01
This topical review will provide a survey of the current state of the art in ‘hyphenated’ techniques for characterisation of bulk materials, surface, and interfaces, whereby two or more analytical methods investigating different properties are applied simultaneously to the same sample to better characterise the sample than can be achieved by conducting separate analyses in series using different instruments. It is intended for final year undergraduates and recent graduates, who may have some background knowledge of standard analytical techniques, but are not familiar with ‘hyphenated’ techniques or hybrid instrumentation. The review will begin by defining ‘complementary’, ‘hybrid’ and ‘hyphenated’ techniques, as there is not a broad consensus among analytical scientists as to what each term means. The motivating factors driving increased development of hyphenated analytical methods will also be discussed. This introduction will conclude with a brief discussion of gas chromatography-mass spectroscopy and energy dispersive x-ray analysis in electron microscopy as two examples, in the context that combining complementary techniques for chemical analysis were among the earliest examples of hyphenated characterisation methods. The emphasis of the main review will be on techniques which are sufficiently well-established that the instrumentation is commercially available, to examine physical properties including physical, mechanical, electrical and thermal, in addition to variations in composition, rather than methods solely to identify and quantify chemical species. Therefore, the proposed topical review will address three broad categories of techniques that the reader may expect to encounter in a well-equipped materials characterisation laboratory: microscopy based techniques, scanning probe-based techniques, and thermal analysis based techniques. Examples drawn from recent literature, and a concluding case study, will be used to explain the
Radiological characterisation and decommissioning in Denmark
International Nuclear Information System (INIS)
Nellemenn, Thomas
2012-01-01
Danish Decommissioning (DD) is currently decommissioning the last Danish research reactor (DR3) and the Hot Cell facility. The DR3 project will soon finish dismantling of the external parts of the reactor (January 2012). The approval for dismantling of neutron activated and tritium contaminated heavy water pumps and tubing was granted in December 2011. DD will begin the work on the inner parts as the tendering process for equipment will start in 2012. Hereafter the dismantling of the top of the reactor will begin using the obtained remote controlled equipment. The Hot Cell facility consists of 6 contaminated cells. The first cell have been opened and cleaned. Currently the work progresses by removing parts and hot spots from the other cells with the use of robotic equipment. Challenges, lack of conventional and radiological documentation, dose rates and contamination higher than expected and the confined space in the cells have delayed the project. No final repository exists in Denmark. Therefore no official Waste Acceptance Criteria (WAC) have been formulated. However the Danish authority (SIS) does require a description of the waste in the interim storage facility (Inventory). Furthermore radiological characterisation of key nuclides is needed during decommissioning and dismantling. The information gained from the characterisation helps in the planning phase prior to the dismantling and for inventory calculations for later use. DD performs the radiological characterisation via both non-destructive and destructive analysis on samples. The samples are measured with gamma spectroscopy using mathematical and geometrical analysis. Scaling factors are used for neutron activated waste (DR3) to determine the difficult-to-measure isotopes and pure beta emitters. The primary scaling isotope is Co-60. Waste from the Hot Cell facility is alpha contaminated and scaling procedures for determination of alpha contamination are currently used in the planning process. Scaling of
Hyphenated analytical techniques for materials characterisation
Armstrong, Gordon; Kailas, Lekshmi
2017-09-01
This topical review will provide a survey of the current state of the art in ‘hyphenated’ techniques for characterisation of bulk materials, surface, and interfaces, whereby two or more analytical methods investigating different properties are applied simultaneously to the same sample to better characterise the sample than can be achieved by conducting separate analyses in series using different instruments. It is intended for final year undergraduates and recent graduates, who may have some background knowledge of standard analytical techniques, but are not familiar with ‘hyphenated’ techniques or hybrid instrumentation. The review will begin by defining ‘complementary’, ‘hybrid’ and ‘hyphenated’ techniques, as there is not a broad consensus among analytical scientists as to what each term means. The motivating factors driving increased development of hyphenated analytical methods will also be discussed. This introduction will conclude with a brief discussion of gas chromatography-mass spectroscopy and energy dispersive x-ray analysis in electron microscopy as two examples, in the context that combining complementary techniques for chemical analysis were among the earliest examples of hyphenated characterisation methods. The emphasis of the main review will be on techniques which are sufficiently well-established that the instrumentation is commercially available, to examine physical properties including physical, mechanical, electrical and thermal, in addition to variations in composition, rather than methods solely to identify and quantify chemical species. Therefore, the proposed topical review will address three broad categories of techniques that the reader may expect to encounter in a well-equipped materials characterisation laboratory: microscopy based techniques, scanning probe-based techniques, and thermal analysis based techniques. Examples drawn from recent literature, and a concluding case study, will be used to explain the
Media education and media influence on youth
LILÁK, Karel
2011-01-01
Bachelor´s work is focused on the questions of the medial education and the medias themselves. This work also investigate with the influence of the action of medias to the students of apprenticeship. The first part of the theoretical work has generally explains what is media education, what is its significance for society and for the benefit of education in school. They are given functions, types and objectives of media education and communications capabilities via the media. The second part ...
Characterisation of long-lived low and intermediate-level radioactive wastes in the Nordic Countries
International Nuclear Information System (INIS)
Broden, K.; Carugati, S.; Brodersen, K.; Carlsson, T.; Viitanen, P.; Walderhaug, T.; Sneve, M.; Hornkjoel, S.; Backe, S.
1997-11-01
The present report is final report from a study on characterisation of radioactive waters in the Nordic countries. The study has mainly been focused on long-lived low and intermediate level radioactive waste. Methods to measure or estimate the activity content and the general composition are discussed. Recommendations are given regarding characterisation of waste under treatment and characterisation of already produced waste packages. (au)
Characterisation of long-lived low and intermediate-level radioactive wastes in the Nordic Countries
Energy Technology Data Exchange (ETDEWEB)
Broden, K. [Studsvik RadWaste AB, (El Salvador); Carugati, S.; Brodersen, K. [Forskningscenter Risoe, (Denmark); Carlsson, T.; Viitanen, P. [VVT, (Finland); Walderhaug, T. [Icelandic Radiation Protection Institute (Iceland); Sneve, M.; Hornkjoel, S. [Norwegian Radiation Protection Authority (Norway); Backe, S. [Institute for Energy Technology (Norway)
1997-11-01
The present report is final report from a study on characterisation of radioactive waters in the Nordic countries. The study has mainly been focused on long-lived low and intermediate level radioactive waste. Methods to measure or estimate the activity content and the general composition are discussed. Recommendations are given regarding characterisation of waste under treatment and characterisation of already produced waste packages. (au).
Experimental characterisation of Polyethylene Terephthalate (PET) bottle Eco-bricks
International Nuclear Information System (INIS)
Taaffe, Jonathan; O’Sullivan, Seán; Rahman, Muhammad Ekhlasur; Pakrashi, Vikram
2014-01-01
Highlights: • Characterisation of a novel “Eco-brick” by recycling PET bottles and plastic waste. • Eco-bricks have properties for possible uses in construction. • Consistent manufacturing of Eco-bricks demonstrated to be possible. • Weight of Eco-bricks has a nearly linear relationship with mechanical strength. • Light passage and sound reduction potential of Eco-bricks shown to be good. - Abstract: This paper addresses the issue of recycling waste plastic by considering the feasibility of use of Eco-bricks for constructional purposes. The Eco-bricks are formed by packing plastic within Polyethylene Terephthalate (PET) bottles. Guidelines were provided for the construction of Eco-bricks. Experiments were carried out to characterise some of the properties of these bricks. Compression test, sound insulation assessment and light transmission were considered in this regard and compared with traditional construction materials and conditions. Possible applications of Eco-bricks were discussed. The paper presents the first attempt to characterise these bricks and the results encourage future use of them to a significantly wider extent and for various purposes
Preparation and characterisation of glass surfaces for experimental purposes
International Nuclear Information System (INIS)
Serruys, Y.
1986-01-01
Experimental investigation of glasses, applied especially to the prevision of the behaviour of vitrified nuclear wastes, requires the preparation of well-defined and reproducibles surfaces, in order to separate the investigated phenomena from artifacts due to surface anomalies and to allow a valuable comparison between results obtained in different laboratories. The aim of the present report is to determine which characters, both physical and chemical, of glass surfaces, have to be controlled, because of their influence upon the investigated phenomena or the experimental processes employed in the investigation. A method is then presented for a surface preparation giving good guaranties of quality and reproducibility. The physical and chemical aspects of surface characterisation are successively considered. The relevant characters and their importance are described, then the corresponding techniques of characterisation are reviewed and it has been attempted to propose a set of techniques allowing a characterisation as complete as possible for laboratory purposes. A preparation method for experimental sample, aiming to satisfy all the previously defined criteria, is then proposed, and present results obtained with this method are described [fr
Rising bonds: wars, media propaganda, culture of fear and ¨hedocynicism¨
Directory of Open Access Journals (Sweden)
Dr. Tasio Camiñas Hernández
2007-01-01
Full Text Available This article is a critical reflection based on the study of the events of September 11, 2001 as presented by experts in the Spanish press of reference. This analysis shows evidence of an official propagandistic discourse imposed by the global media companies as well as by the political and economic powers to promote the culture of fear and war within a society deeply rooted in two rising values: cynicism and hedonism (henceforth "hedocynicism". The September 11 events initiated a period of "war on terrorism" characterised by a new conflict between the East and the West, the clash of religionism (radical Christianity versus radical Islamism and a third phase of the globalization, this time based on global armament deterrence.
Characterising the 750 GeV diphoton excess
International Nuclear Information System (INIS)
Bernon, Jérémy; Goudelis, Andreas; Kraml, Sabine; Mawatari, Kentarou; Sengupta, Dipan
2016-01-01
We study kinematic distributions that may help characterise the recently observed excess in diphoton events at 750 GeV at the LHC Run 2. Several scenarios are considered, including spin-0 and spin-2 750 GeV resonances that decay directly into photon pairs as well as heavier parent resonances that undergo three-body or cascade decays. We find that combinations of the distributions of the diphoton system and the leading photon can distinguish the topology and mass spectra of the different scenarios, while patterns of QCD radiation can help differentiate the production mechanisms. Moreover, missing energy is a powerful discriminator for the heavy parent scenarios if they involve (effectively) invisible particles. While our study concentrates on the current excess at 750 GeV, the analysis is general and can also be useful for characterising other potential diphoton signals in the future.
Phenotypic characterisation and molecular polymorphism of ...
African Journals Online (AJOL)
The study of the phenotypic characterisation and molecular polymorphism of local chicken populations was carried out in Benin on 326 chickens of the Forest ecological area and 316 of the Savannah ecological area, all were 7 months old at least. The collection of blood for the molecular typing was achieved on 121 ...
International Nuclear Information System (INIS)
Hussien, H.H.; El-Shatoury, E.H.
2010-01-01
six lactic acid bacterial strains were isolated from yoghurt and cottage (unfatted cheese) cheese. only three strains namely lactococcus lactis, lactobacillus helveticus and streptococcus thermophilus were able to produce exopolysaccharides (EPS) when cultured in de Man-Rogosa-Sharpe broth (MRS) medium. MRS containing sucrose, instead of the original media containing glucose was found to be the best media for EPS production . lactococcus lactis, lactobacillus helveticus and streptococcus thermophilus produced 650, 644 and 649 mg/L EPS when grown on MRS containing sucrose compared with 567, 584 and 293 mg/L when they grown on MRS containing glucose, respectively. by increasing the concentration of sucrose in the medium, significant increases in EPS production was observed. maximum EPS was produced at 15 g/L sucrose for both lactococcus lactis and streptococcus thermophilus (900 mg/L). 800 mg/L EPS was produced by lactobacillus helveticus at 20 g/L sucrose. exposing the bacterial isolates to 1 kGy increased their ability to bind malathion. malathion binding of irradiated lactococcus lactis, lactobacillus helveticus and streptococcus thermophilus cells were 30 %, 19.8 % and 13 % more than non-irradiated controls. also exposing lactococcus lactis to 1 kGy increased their binding capacity to seliton by 33.8 % on the other land irradiating lactobacillus helveticus cells caused a decrease in the binding capacity of seliton by 5 % . irradiated and non-irradiated cells of streptococcus thermophilus failed to bind the seliton.
DEFF Research Database (Denmark)
Hougaard, Simone Quach; Trankjær, Mie Bohn; Schlichter, Bjarne Rerup
2014-01-01
to facilitate study group work in the course. Most students were positive towards the use of these platforms and found that their group work had become more effective as a direct result. However, some limitations were also found in using New Media platforms in all aspects of the ISB course, as some of the more......The Information Society is characterised by its technological development; the many New Media platforms offered on the World Wide Web have changed the communication culture from a traditional one-way transaction to a co-creation culture (Mangold and Faulds 2009). This paper investigates which...... implications New Media platforms – with special emphasis on Blackboard, Facebook, Google Docs and Dropbox – have on study group work in the environment of the course Information Systems for Business (ISB) at Aarhus University. Additionally, it is investigated which opportunities these platforms potentially...
Characterisation of polymers, 1
Crompton, Roy
2008-01-01
This essential guide to Polymer Characterisation is a complete compendium of methodologies that have evolved for the determination of the chemical composition of polymers. This 478-page book gives an up-to-date and thorough exposition of the state-of-the-art theories and availability of instrumentation needed to effect chemical and physical analysis of polymers. This is supported by approximately 1200 references. Volume 1 covers the methodology used for the determination of metals, non-metals and organic functional groups in polymers, and for the determination of the ratio in which different m
International Nuclear Information System (INIS)
2012-01-01
The OECD Nuclear Energy Agency (NEA), in cooperation with Studsvik Nuclear AB, the Swedish Radiation Safety Authority (SSM), Swedish Nuclear Fuel and Waste Management Co (SKB) and AB SVAFO, has arranged a workshop on Radiological characterisation for decommissioning and dismantling. The objective of the workshop was to highlight, examine and discuss strategic issues related to radiological characterisation of nuclear facilities to facilitate their safe and efficient decommissioning. The workshop was a forum for learning about current practices, exchange of experiences of both successful and less successful projects, discussion of best practice and needs for improvement, and development of networks in the area of radiological characterisation, waste management and decommissioning. The workshop was arranged in coordination with an ongoing NEA WPDD project on radiological characterisation for decommissioning. The outcome of the workshop was captured in workshop proceedings and in the final NEA WPDD project report. A three-day programme was planned. A short introduction by representatives from Studsvik and OECD/NEA started the workshop followed by presentations by invited speakers from international organisations. Four topical sessions covered issues relating to Characterisation of materials and systems, Characterisation of rooms and buildings, Characterisation of land and groundwater, Software support, record keeping, quality assurance and logistics. Each session contained 3 - 5 presentations and group discussions. Each session was concluded with a short analysis of the presentations and the outcome of the group discussions. The workshop also held a poster session with topics as above. After the formal closing of the workshop, half a day was dedicated for guided tours at the Studsvik and SVAFO facilities. It was possible to visit waste management facilities, the reactor decommissioning project and materials technology laboratories. This document is the Compilation of
Synthesis and characterisation of doxorubicin-loaded functionalised ...
African Journals Online (AJOL)
The synthesised cobalt ferrite nanoparticles (CFNPs) were functionalised with xanthine gum (XG) and subsequently characterised by Fourier transform-infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA) and contact angle studies. Vibrating sample magnetometry (VSM) was used for magnetic measurements of ...
Directory of Open Access Journals (Sweden)
Víctor Fco. Sampedro Blanco
2004-10-01
Full Text Available The media establish, in large part, the patterns of visibility and public recognition of collective identities. We define media identities as those that are the object of production and diffusion by the media. From this discourse, the communities and individuals elaborate media-influenced identifications; that is, processes of recognition or banishment; (rearticulating the identity markers that the media offer with other cognitive and emotional sources. The generation and appropriation of the identities are subjected to a media hierarchisation that influences their normalisation or marginalisation. The identities presented by the media and assumed by the audience as part of the official, hegemonic discourse are normalised, whereas the identities and identifications formulated in popular and minority terms are marginalised. After presenting this conceptual and analytical framework, this study attempts to outline the logics that condition the presentation, on the one hand, andthe public recognition, on the other hand, of contemporary identities.
Analysis of amines by pH-Metrie in organic media
International Nuclear Information System (INIS)
Hamidi, A.; Elias, Abdelhamid; Achache, M.; Didi, M.
1999-01-01
Amines with long hydro carbonic strength and principally Trioclkylamines, are characterised by an important complexation mechanism for certain metals. This is the case for trioctylamine (TOA) which is very used in purification and uranium recovery from certain ores (1,2). This substance is generally found mixed with mono and di-octyl amines in commercial products and in synthesis mixtures. The purpose of this work is to develop a pH titration method in an organic media for a mixture consisted of mono, di and tri octyl amines (MOA, DOA et TOA). Adequate operating analysis condition have been proposed, based on intrinsic chemical properties for each precipitated substances (3,4). The obtained results show that this technique is recommended for qualitative and quantitative analysis of precipitated amines mixtures. The method is reproducible and the detection limit can reach 0,0001 molar
Li, Bao-Ping; Zhao, Jian-Xin; Greig, Alan; Collerson, Kenneth D.; Zhuo, Zhen-Xi; Feng, Yue-Xin
2005-11-01
We compare the trace element and Sr isotopic compositions of stoneware bodies made in Yaozhou and Jizhou to characterise these Chinese archaeological ceramics and examine the potential of Sr isotopes in provenance studies. Element concentrations determined by ICP-MS achieve distinct characterisation for Jizhou samples due to their restricted variation, yet had limited success with Yaozhou wares because of their large variability. In contrast, 87Sr/86Sr ratios in Yaozhou samples have a very small variation and are all significantly lower than those of Jizhou samples, which show a large variation and cannot be well characterised with Sr isotopes. Geochemical interpretation reveals that 87Sr/86Sr ratios will have greater potential to characterise ceramics made of low Rb/Sr materials such as kaolin clay, yet will show larger variations in ceramics made of high Rb/Sr materials such as porcelain stone.
International Nuclear Information System (INIS)
Li Baoping; Zhao Jianxin; Greig, Alan; Collerson, Kenneth D.; Zhuo Zhenxi; Feng Yuexin
2005-01-01
We compare the trace element and Sr isotopic compositions of stoneware bodies made in Yaozhou and Jizhou to characterise these Chinese archaeological ceramics and examine the potential of Sr isotopes in provenance studies. Element concentrations determined by ICP-MS achieve distinct characterisation for Jizhou samples due to their restricted variation, yet had limited success with Yaozhou wares because of their large variability. In contrast, 87 Sr/ 86 Sr ratios in Yaozhou samples have a very small variation and are all significantly lower than those of Jizhou samples, which show a large variation and cannot be well characterised with Sr isotopes. Geochemical interpretation reveals that 87 Sr/ 86 Sr ratios will have greater potential to characterise ceramics made of low Rb/Sr materials such as kaolin clay, yet will show larger variations in ceramics made of high Rb/Sr materials such as porcelain stone
Defining Jazz Revisited - Taking a social constructionist approach to the characterisation of jazz
DEFF Research Database (Denmark)
Høyer, Ole Izard
2017-01-01
the concept of jazz from a social constructionist perspective and examines how constructions of a genre formation of jazz are characterised by ideas about the social. It is argued that ‘characterisations of jazz’ are central to such genre-definitions and are as tightly bound to social context......This article reconsiders the definition of jazz as a case study in relation to how a musical genre is constituted through narratives of culture and identity in musical culture. Rethinking the definition of jazz as a way of characterisation through a social constructionist approach, this article...
Underground characterisation and research facility ONKALO
International Nuclear Information System (INIS)
Ikonen, Antti; Ylae-Mella, Mia; Aeikaes, Timo
2006-01-01
Posiva's repository for geological disposal of the spent fuel from Finnish nuclear reactors will be constructed at Olkiluoto. The selection of Olkiluoto was made based on site selection research programme conducted between 1987-2001. The next step is to carry out complementary investigations of the site and apply for the construction license for the disposal facility. The license application will be submitted in 2012. To collect detailed information of the geological environment at planned disposal depth an underground characterisation and research facility will be built at the site. This facility, named as ONKALO, will comprise a spiral access tunnel and two vertical shafts. The excavation of ONKALO is in progress and planned depth (400 m) will be reached in 2009. During the course of the excavation Posiva will conduct site characterisation activities to assess the structure and other properties of the site geology. The aim is that construction will not compromise the favourable conditions of the planned disposal depth or introduce harmful effects in the surrounding bedrock which could jeopardize the long-term safety of the geological disposal. (author)
Quantitative characterisation of an engineering write-up using random walk analysis
Directory of Open Access Journals (Sweden)
Sunday A. Oke
2008-02-01
Full Text Available This contribution reports on the investigation of correlation properties in an English scientific text (engineering write-up by means of a random walk. Though the idea to use a random walk to characterise correlations is not new (it was used e.g. in the genome analysis and in the analysis of texts, a random walk approach to the analysis of an English scientific text is still far from being exploited in its full strength as demonstrated in this paper. A method of high-dimensional embedding is proposed. Case examples were drawn arbitrarily from four engineering write-ups (Ph.D. synopsis of three engineering departments in the Faculty of Technology, University of Ibadan, Nigeria. Thirteen additional analyses of non-engineering English texts were made and the results compared to the engineering English texts. Thus, a total of seventeen write-ups of eight Faculties and sixteen Departments of the University of Ibadan were considered. The characterising exponents which relate the average distance of random walkers away from a known starting position to the elapsed time steps were estimated for the seventeen cases according to the power law and in three different dimensional spaces. The average characteristic exponent obtained for the seventeen cases and over three different dimensional spaces studied was 1.42 to 2-decimal with a minimum and a maximum coefficient of determination (R2 of 0.9495 and 0.9994 respectively. This is found to be 284% of the average characterising exponent value (0.5, as supported by the literature for random walkers based on the pseudo-random number generator. The average characteristic exponent obtained for the four cases that were engineering-based and over the three different dimensional studied spaces was 1.41 to 2-decimal (closer by 99.3% to 1.42 with a minimum and a maximum coefficient of determination (R2 of 0.9507 and 0.9974 respectively. This is found to be 282% of the average characterising exponent value (0.5, as
Baar, B.L.M. van
2000-01-01
Chemical analysis for the characterisation of micro-organisms is rapidly evolving, after the recent advent of new ionisation methods in mass spectrometry (MS): electrospray (ES) and matrix-assisted laser desorption/ionisation (MALDI). These methods allow quick characterisation of micro-organisms,
Dynamic and Acoustic Characterisation of Automotive Wheels
Directory of Open Access Journals (Sweden)
Francesca Curà
2004-01-01
Full Text Available The subject of this paper is the dynamic and acoustic characterisation of an automotive wheel. In particular, an experimental research activity previously performed by the authors about the dynamic behaviour of automotive wheels has been extended to the acoustic field.
Characterisation of potential aquaculture pond effluents, and ...
African Journals Online (AJOL)
Conventional treatment of effluents from these small-scale, low-volume operations, which discharge relatively dilute effluents infrequently, might not be cost-effective. Keywords: aquaculture–environment interaction, earthen ponds, effluent characterisation, K-means clustering, t ilapia, water quality. African Journal of Aquatic ...
Characterisation of gold from Fiji
Naden, Jon; Henney, P.J.
1995-01-01
This is a study of the variation in chemistry and inclusion mineralogy of bedrock and placer gold from Fiji. It forms part of a large project, undertaking gold characterisation from a wide range of geological environments in Ecuador, Zimbabwe, Malaysia and Fiji. The work was carried out under the Overseas Development AdministratiodBritish Geological Survey Technology Development and Research programme (Project R5549) as part of the British Government’s provision of technical...
Directory of Open Access Journals (Sweden)
You Wang
2016-04-01
Full Text Available Yeast cells expressing cDNA libraries have provided two new approaches to facilitate further identification of cytokinin-binding proteins and receptors. These are the yeast three hybrid (Y3H system and fluorescence activated cell sorting (FACS. The Y3H system requires a synthetic hybrid ligand comprising an “anchor” moiety (e.g., dexamethasone linked to a cytokinin via a spacer. In the yeast nucleus, this ligand by binding connects two fusion proteins leading to a reporter gene activation and detection and characterisation of cytokinin binding proteins. Herein is reported the first synthesis of dexamethasone-cytokinin ligands with a spacer linkage. This was attached to the purine ring of 6-benzylaminopurine (BAP at positions 2, 8 or 9. To achieve this, dexamethasone was modified by periodate oxidation yielding a carboxylic group used for conjugation to the spacer by amide formation. Biotinyl derivatives of cytokinins for FACS included those synthesised by reaction of an activated ester of biotin with 8-(10-amino-decylamino derivatives of BAP and BAP 9-riboside. Properties of the conjugates and some biological situations where they could be applicable are discussed briefly.
Cross-genus amplification and characterisation of microsatellite loci ...
African Journals Online (AJOL)
Cross-genus amplification and characterisation of microsatellite loci in the little free tailed bat, Chaerephon pumilus s. l. (Molossidae) from South Eastern Africa. Theshnie Naidoo, Angus Macdonald, Jennifer M Lamb ...
Zhong, Chan; Sun, Le-Chang; Yan, Long-Jie; Lin, Yi-Chen; Liu, Guang-Ming; Cao, Min-Jie
2018-01-24
In this study, production of bioactive peptides with angiotensin converting enzyme (ACE) inhibitory activity from sea cucumber (Stichopus japonicus) gonad using commercial protamex was optimised by response surface methodology (RSM). As a result, the optimal condition to achieve the highest ACE inhibitory activity in sea cucumber gonad hydrolysate (SCGH) was hydrolysis for 1.95 h and E/S of 0.75%. For further characterisation, three individual peptides (EIYR, LF and NAPHMR) were purified and identified. The peptide NAPHMR showed the highest ACE inhibitory activity with IC 50 of 260.22 ± 3.71 μM. NAPHMR was stable against simulated gastrointestinal digestion and revealed no significant cytotoxicity toward Caco-2 cells. Molecular docking study suggested that Arg, His and Asn residues in NAPHMR interact with the S2 pocket or Zn 2+ binding motifs of ACE via hydrogen or π-bonds, potentially contributing to ACE inhibitory effect. Sea cucumber gonad is thus a potential resource to produce ACE inhibitory peptides for preparation of functional foods.
Komunikasi Krisis di Era New Media dan Social Media
Prastya, Narayana Mahendra
2016-01-01
New media and social media have changed the practice of public relations. One area that changed is crisis communication. Because of these new technologies, crisis can be more complex. The pace of information, the uncertainty, and the rumors, are increasing. Public relations practitioners should include the new media and social media use in their crisis communication plan. Before doing that, public relations practitioners should change their mindset about social media and new media. The first ...
Energy Technology Data Exchange (ETDEWEB)
Li Baoping [Advanced Centre for Queensland University Isotope Research Excellence (ACQUIRE), University of Queensland, Brisbane, Qld 4072 (Australia)]. E-mail: b.li@uq.edu.au; Zhao Jianxin [Advanced Centre for Queensland University Isotope Research Excellence (ACQUIRE), University of Queensland, Brisbane, Qld 4072 (Australia); Greig, Alan [Advanced Centre for Queensland University Isotope Research Excellence (ACQUIRE), University of Queensland, Brisbane, Qld 4072 (Australia); Collerson, Kenneth D. [Advanced Centre for Queensland University Isotope Research Excellence (ACQUIRE), University of Queensland, Brisbane, Qld 4072 (Australia); Zhuo Zhenxi [Shaanxi Provincial Institute of Archaeology, Xi' an 710054 (China); Feng Yuexin [Advanced Centre for Queensland University Isotope Research Excellence (ACQUIRE), University of Queensland, Brisbane, Qld 4072 (Australia)
2005-11-15
We compare the trace element and Sr isotopic compositions of stoneware bodies made in Yaozhou and Jizhou to characterise these Chinese archaeological ceramics and examine the potential of Sr isotopes in provenance studies. Element concentrations determined by ICP-MS achieve distinct characterisation for Jizhou samples due to their restricted variation, yet had limited success with Yaozhou wares because of their large variability. In contrast, {sup 87}Sr/{sup 86}Sr ratios in Yaozhou samples have a very small variation and are all significantly lower than those of Jizhou samples, which show a large variation and cannot be well characterised with Sr isotopes. Geochemical interpretation reveals that {sup 87}Sr/{sup 86}Sr ratios will have greater potential to characterise ceramics made of low Rb/Sr materials such as kaolin clay, yet will show larger variations in ceramics made of high Rb/Sr materials such as porcelain stone.
Data analysis for radiological characterisation: Geostatistical and statistical complementarity
International Nuclear Information System (INIS)
Desnoyers, Yvon; Dubot, Didier
2012-01-01
Radiological characterisation may cover a large range of evaluation objectives during a decommissioning and dismantling (D and D) project: removal of doubt, delineation of contaminated materials, monitoring of the decontamination work and final survey. At each stage, collecting relevant data to be able to draw the conclusions needed is quite a big challenge. In particular two radiological characterisation stages require an advanced sampling process and data analysis, namely the initial categorization and optimisation of the materials to be removed and the final survey to demonstrate compliance with clearance levels. On the one hand the latter is widely used and well developed in national guides and norms, using random sampling designs and statistical data analysis. On the other hand a more complex evaluation methodology has to be implemented for the initial radiological characterisation, both for sampling design and for data analysis. The geostatistical framework is an efficient way to satisfy the radiological characterisation requirements providing a sound decision-making approach for the decommissioning and dismantling of nuclear premises. The relevance of the geostatistical methodology relies on the presence of a spatial continuity for radiological contamination. Thus geo-statistics provides reliable methods for activity estimation, uncertainty quantification and risk analysis, leading to a sound classification of radiological waste (surfaces and volumes). This way, the radiological characterization of contaminated premises can be divided into three steps. First, the most exhaustive facility analysis provides historical and qualitative information. Then, a systematic (exhaustive or not) surface survey of the contamination is implemented on a regular grid. Finally, in order to assess activity levels and contamination depths, destructive samples are collected at several locations within the premises (based on the surface survey results) and analysed. Combined with
Media education and media enlightenment as attributes of information society
Directory of Open Access Journals (Sweden)
Лилия Борисовна Белоглазова
2014-12-01
Full Text Available The article deals with the problem of the functioning of media-education and media-enlightenment in modern society. Focuses on the impact of this socio-cultural phenomenon on consciousness of members of the Information Society. Are the main characteristics of media-education and media-education and media-enlightenment. Concludes that media-education and media-enlightenment forms unscientific and anti-scientific thinking and style speech.
Raw materials resources classification and characterisation for ...
African Journals Online (AJOL)
Raw materials resources classification and characterisation for ceramic tableware production in Nigeria. PSA Irabor. Abstract. No Abstract. Journal of Applied Science, Engineering and Technology Vol. 2(1) 2002: 48-52. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.
Characterisation of bovine epiblast-derived outgrowth colonies
DEFF Research Database (Denmark)
Østrup, Esben; Gjørret, Jakob; Schauser, Kirsten Hallundbæk
2010-01-01
The aim of the present study was to characterise bovine epiblast-derived outgrowth colonies (OCs) with respect to the embryonic origin of their cellular components. Epiblasts were isolated mechanically from bovine Day 12 embryos. Epiblasts were cultured on feeder layers of SNL cells (neomycin...
Mikkilä, Vera; Räsänen, Leena; Laaksonen, Marika M L; Juonala, Markus; Viikari, Jorma; Pietinen, Pirjo; Raitakari, Olli T
2009-11-01
A whole-diet approach has proven useful for characterising dietary exposure in cardiovascular epidemiology research. In our previous analyses, we found dietary patterns to be significant determinants of CVD risk factor levels among the Cardiovascular Risk in Young Finns cohort. We investigated the associations of major dietary patterns with carotid intima media thickness (IMT), a subclinical predictor of CVD, in healthy adults. The Young Finns Study is an ongoing, prospective cohort study with a 21-year follow-up to date. The subjects were children and adolescents at baseline in 1980 (aged 3-18 years), and all had reached adulthood by the latest follow-up in 2001 (aged 24-39 years). Complete dietary data from the years 1980, 1986 and 2001 and outcome data from the year 2001 were obtained from 785 subjects. The long-term average pattern score for a traditional dietary pattern (characterised by high consumption of rye, potatoes, butter, sausages, milk and coffee) was associated with IMT especially among subjects with a low score for the health-conscious dietary pattern (characterised by high consumption of vegetables, legumes and nuts, rye, tea, cheese and other dairy products). In multivariable regression analyses using long-term pattern scores as predictors, the traditional dietary pattern was independently associated with IMT in men (P < 0.01), but not in women (P = 0.66). Long-term adherence to traditional food choices seems to increase the risk of developing subclinical atherosclerosis among Finnish men.
Characterisation of COPD heterogeneity in the ECLIPSE cohort
DEFF Research Database (Denmark)
Agusti, Alvar; Calverley, Peter M A; Celli, Bartolome
2010-01-01
Chronic obstructive pulmonary disease (COPD) is a complex condition with pulmonary and extra-pulmonary manifestations. This study describes the heterogeneity of COPD in a large and well characterised and controlled COPD cohort (ECLIPSE)....
Directory of Open Access Journals (Sweden)
Malinowska Anna
2017-12-01
Full Text Available The paper engages with what we refer to as “sensitive media,” a concept associated with developments in the overall media environment, our relationships with media devices, and the quality of the media themselves. Those developments point to the increasing emotionality of the media world and its infrastructures. Mapping the trajectories of technological development and impact that the newer media exert on human condition, our analysis touches upon various forms of emergent affect, emotion, and feeling in order to trace the histories and motivations of the sensitization of “the media things” as well as the redefinition of our affective and emotional experiences through technologies that themselves “feel.”
Media Sites Site Registration Contact Us Search AF.mil: Home > AF Sites > Social Media Sites Social Media Welcome to the Air Force social media directory! The directory is a one-stop shop of official Air Force social media pages across various social media sites. Social media is all about
Characterisation of Silicon Pad Diodes
Hodson, Thomas Connor
2017-01-01
Silicon pad sensors are used in high luminosity particle detectors because of their excellent timing resolution, radiation tolerance and possible high granularity. The effect of different design decisions on detector performance can be investigated nondestructively through electronic characterisation of the sensor diodes. Methods for making accurate measurements of leakage current and cell capacitance are described using both a standard approach with tungsten needles and an automated approach with a custom multiplexer and probing setup.
Stereotypes in media and media literacy among young people
Directory of Open Access Journals (Sweden)
Đerić Ivana
2006-01-01
Full Text Available Young people, the most common consumers of media content, bear out the view that media shapes people’s lives. Therefore we must not underestimate the effect media exerts on young people’s values and behavioral patterns. Television is the medium which draws children and young people for the greatest part of their free time. Regardless whether television programs are described as positive or negative, whether they abound with stereotypes or not, it is important that young people develop a critical attitude towards them so that they may resist different forms of media manipulation. The paper discusses how stereotypes are generated and used by media and the manners in which stereotypical concepts affect young people’s attitudes. It highlights the importance of the development of media literacy which implies a critical attitude towards media images and discourses, the development of criteria for the selection and evaluation of information broadcast by media, the development of skills in interpreting and understanding stereotypical concepts and familiarity with alternative forms of media culture. The paper draws special attention to the issue of media education. The conclusion is that schools should offer media literacy as part of their curriculum and in it possible solutions to the problems discussed. .
Killing spinors as a characterisation of rotating black hole spacetimes
International Nuclear Information System (INIS)
Cole, Michael J; Kroon, Juan A Valiente
2016-01-01
We investigate the implications of the existence of Killing spinors in a spacetime. In particular, we show that in vacuum and electrovacuum a Killing spinor, along with some assumptions on the associated Killing vector in an asymptotic region, guarantees that the spacetime is locally isometric to the Kerr or Kerr–Newman solutions. We show that the characterisation of these spacetimes in terms of Killing spinors is an alternative expression of characterisation results of Mars (Kerr) and Wong (Kerr–Newman) involving restrictions on the Weyl curvature and matter content. (paper)
Characterising atmospheric optical turbulence using stereo-SCIDAR
Osborn, James; Butterley, Tim; Föhring, Dora; Wilson, Richard
2015-04-01
Stereo-SCIDAR (SCIntillation Detection and Ranging) is a development to the well known SCIDAR method for characterisation of the Earth's atmospheric optical turbulence. Here we present some interesting capabilities, comparisons and results from a recent campaign on the 2.5 m Isaac Newton Telescope on La Palma.
Hydrothermal synthesis and characterisation of amine-templated ...
African Journals Online (AJOL)
Hydrothermal synthesis and characterisation of amine-templated metal phosphate framework. ... The complexes were thermally stable up to 3000C, after which the organic components starts decomposing. The solubility test in a wide spectrum of solvents (at room temperature) showed that the complexes were insoluble in ...
Directory of Open Access Journals (Sweden)
Rebecca Williams
Full Text Available BACKGROUND: Articular cartilage displays a poor repair capacity. The aim of cell-based therapies for cartilage defects is to repair damaged joint surfaces with a functional replacement tissue. Currently, chondrocytes removed from a healthy region of the cartilage are used but they are unable to retain their phenotype in expanded culture. The resulting repair tissue is fibrocartilaginous rather than hyaline, potentially compromising long-term repair. Mesenchymal stem cells, particularly bone marrow stromal cells (BMSC, are of interest for cartilage repair due to their inherent replicative potential. However, chondrocyte differentiated BMSCs display an endochondral phenotype, that is, can terminally differentiate and form a calcified matrix, leading to failure in long-term defect repair. Here, we investigate the isolation and characterisation of a human cartilage progenitor population that is resident within permanent adult articular cartilage. METHODS AND FINDINGS: Human articular cartilage samples were digested and clonal populations isolated using a differential adhesion assay to fibronectin. Clonal cell lines were expanded in growth media to high population doublings and karyotype analysis performed. We present data to show that this cell population demonstrates a restricted differential potential during chondrogenic induction in a 3D pellet culture system. Furthermore, evidence of high telomerase activity and maintenance of telomere length, characteristic of a mesenchymal stem cell population, were observed in this clonal cell population. Lastly, as proof of principle, we carried out a pilot repair study in a goat in vivo model demonstrating the ability of goat cartilage progenitors to form a cartilage-like repair tissue in a chondral defect. CONCLUSIONS: In conclusion, we propose that we have identified and characterised a novel cartilage progenitor population resident in human articular cartilage which will greatly benefit future cell
DEFF Research Database (Denmark)
Birkved, Morten; Heijungs, Reinout
2011-01-01
The impact assessment of chemical compounds in Life Cycle Impact Assessment (LCIA) and Environmental Risk Assessment (ERA) requires a vast amount of data on the properties of the chemical compounds being assessed. The purpose of the present study is to explore statistical options for reduction...... of the data demand associated with characterisation of chemical emissions in LCIA and ERA.Based on a USEtox™ characterisation factor set consisting of 3,073 data records, multi-dimensional bilinear models for emission compartment specific fate characterisation of chemical emissions were derived by application...... the independent chemical input parameters from the minimum data set, needed for characterisation in USEtox™, according to general availability, importance and relevance for fate factor prediction.Each approach (63% and 75% of the minimum data set needed for characterisation in USEtox™) yielded 66 meta...
Impedance Characterisation of the SPS Wire Scanner
AUTHOR|(CDS)2091911; Prof. Sillanpää, Mika
As a beam diagnostic tool, the SPS wire scanner interacts with the proton bunches traversing the vacuum pipes of the Super Proton Synchrotron particle accelerator. Following the interaction, the bunches decelerate or experience momentum kicks off-axis and couple energy to the cavity walls, resonances and to the diagnostic tool, the scanning wire. The beam coupling impedance and, in particular, the beam induced heating of the wire motivate the characterisation and redesign of the SPS wire scanner. In this thesis, we characterise RF-wise the low frequency modes of the SPS wire scanner. These have the highest contribution to the impedance. We measure the cavity modes in terms of resonance frequency and quality factor by traditional measurement techniques and data analysis. We carry out a 4-port measurement to evaluate the beam coupling to the scanning wire, that yields the spectral heating power. If combined with the simulations, one is able to extract the beam coupling impedance and deduce the spectral dissipa...
Methodology for characterisation of glass fibre composite architecture
DEFF Research Database (Denmark)
Hansen, Jens Zangenberg; Larsen, J.B.; Østergaard, R.C.
2012-01-01
of the fibres. The information is used for different analyses to investigate and characterise the fibre architecture. As an example, the methodology is applied to glass fibre reinforced composites with varying fibre contents. The different fibre volume fractions (FVFs) affect the number of contact points per......The present study outlines a methodology for microstructural characterisation of fibre reinforced composites containing circular fibres. Digital micrographs of polished cross-sections are used as input to a numerical image processing tool that determines spatial mapping and radii detection...... fibre, the communal fibre distance and the local FVF. The fibre diameter distribution and packing pattern remain somewhat similar for the considered materials. The methodology is a step towards a better understanding of the composite microstructure and can be used to evaluate the interconnection between...
International Nuclear Information System (INIS)
Ben Said, K.
1999-11-01
Technetium is important as a long half-life multi-valent radioelement within the framework of the nuclear waste storage especially in underground geological sites. So, the safety studies require the knowledge of the redox and of the chemical properties of this element in order to model its geochemical behaviour in the environment. Our studies deal with the redox behaviour and the speciation of technetium in chloride and carbonate media. Similar natural systems possess redox potentials likely to reduce Tc(VII) into Tc(V), Tc(IV) and Tc(III). The question of the standard redox potential of the Tc(VII)Tc(IV) couple is settled in non complexing media where Tc(IV) exists as TcO 2 (s) but is still a matter of debate in complexing media. The formal potential of the Tc(VII)/Tc(IV couple has been determined by an indirect method in 1.0 M HCl media where Tc(IV) exists as chloride complexes. The species formed by dissolving K 2 TcCl 6 (s) in chloride media have been characterised by complementary techniques of speciation (UV-visible and Raman spectrometry, X-rays absorption spectroscopy and polarography). Two chemical formulae have been proposed for the chloride species of Tc(IV) in 1.0 M HCl media as hydrolyzed TcCl 6 2- : TcCl 5 (H 2 O) - or TcCl 4 (H 2 O) 2 . The chemical or electrochemical reduction of pertechnetate in carbonate media leads to amorphous oxides or carbonate complexes of Tc(IV) and/or of Tc(III). In carbonate media, the stability of the species under γ irradiation has been estimated by UV/VIS spectrophotometry: Tc(VII) is stable but reduced into Tc(IV) in the presence of formate when the carbonate complex of Tc(IV) is oxidised into Tc(VII). So the most mobile valency Tc(VII) seems to be the stable one in irradiated carbonate media. (author)
Media evolution and ‘epi-technic’ digital media: Media as cultural selection mechanisms
DEFF Research Database (Denmark)
Olesen, Mogens
2016-01-01
The explosive development of new digital media technologies is often described as a media evolution but hardly ever is the concept of ‘media evolution’ taken at face value. This article takes up that challenge by combining cultural evolution theories with medium theory. The article argues that bi...
Analysis of mebendazole binding to its target biomolecule by laser flash photolysis.
Jornet, Dolors; Bosca, Francisco; Andreu, Jose M; Domingo, Luis R; Tormos, Rosa; Miranda, Miguel A
2016-02-01
Mebendazole (MBZ) and related anticancer benzimidazoles act binding the β-subunit of Tubulin (TU) before dimerization with α-TU with subsequent blocking microtubule formation. Laser flash photolysis (LFP) is a new tool to investigate drug-albumin interactions and to determine binding parameters such as affinity constant or population of binding sites. The aim of this study was to evaluate the interactions between the nonfluorescent mebendazole (MBZ) and its target biomolecule TU using this technique. Before analyzing the MBZ@TU complex it was needed to determine the photophysical properties of MBZ triplet excited state ((3)MBZ(⁎)) in different media. Hence, (3)MBZ(⁎) showed a transient absorption spectrum with maxima at 520 and 375 nm and a lifetime much longer in acetonitrile (12.5 μs) than in water (260 ns). The binding of MBZ to TU produces a greater increase of the lifetime of (3)MBZ(⁎) (25 μs). This fact and the strong electron acceptor capability observed for (3)MBZ* evidence that MBZ must not be located close to any electron donor amino acid of TU such as its tryptophan or cysteine residues. Adding increasing amounts of MBZ to aqueous TU was determined the MBZ-TU binding constant (2.0 ± 0.5 × 10(5)M(-1) at 298K) which decreased with increasing temperature. The LFP technique has proven to be a powerful tool to analyze the binding of drug-TU systems when the drug has a detectable triplet excited state. Results indicate that LFP could be the technique of choice to study the interactions of non-fluorescent drugs with their target biomolecules. Copyright © 2015 Elsevier B.V. All rights reserved.
Identification and Characterisation of Major Hydrocarbons in ...
African Journals Online (AJOL)
Identification and Characterisation of Major Hydrocarbons in Thermally Degraded Low Density Polyethylene Films. ... There were alkanes, alkenes, halogenated alkanes, and very few aromatics in the liquid product and, the hydrocarbons were observed to range between C10 - C27. The FTIR and GC-MS results show the ...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Scanning laser techniques for dynamic thermo-magnetic recording onto stationary media
Energy Technology Data Exchange (ETDEWEB)
Clegg, Warwick; Jenkins, David; Helian, Na; Windmill, James; Windmill, Robert; Atkinson, Ron; Hendren, Bill; Wright, C. David
2002-09-01
Scanning laser microscopes (SLMs) have been used to characterise the magnetic properties of materials for some time (J. Magn. Magn. Mater. 95(1) (1991); IEEE Trans. Magn. 31(6 Pt. 1) (1995)). An SLM has been designed to facilitate a number of operating modes: both for writing and reading magneto-optical data. The current SLM is capable of thermo-magnetically recording bits onto magneto-optical thin films. Unlike previous SLMs, the current instrument has been designed to write bits both statically and dynamically onto stationary media. It will be used to write to magneto-optic (MO) disk material thermo-magnetically prior to imaging. Images may be derived from the longitudinal and polar magneto-optic Kerr effects, which are wavelength dependent, using the appropriate laser wavelength. In this paper the two configurations for dynamic recording are described.
Scanning laser techniques for dynamic thermo-magnetic recording onto stationary media
International Nuclear Information System (INIS)
Clegg, Warwick; Jenkins, David; Helian, Na; Windmill, James; Windmill, Robert; Atkinson, Ron; Hendren, Bill; Wright, C. David
2002-01-01
Scanning laser microscopes (SLMs) have been used to characterise the magnetic properties of materials for some time (J. Magn. Magn. Mater. 95(1) (1991); IEEE Trans. Magn. 31(6 Pt. 1) (1995)). An SLM has been designed to facilitate a number of operating modes: both for writing and reading magneto-optical data. The current SLM is capable of thermo-magnetically recording bits onto magneto-optical thin films. Unlike previous SLMs, the current instrument has been designed to write bits both statically and dynamically onto stationary media. It will be used to write to magneto-optic (MO) disk material thermo-magnetically prior to imaging. Images may be derived from the longitudinal and polar magneto-optic Kerr effects, which are wavelength dependent, using the appropriate laser wavelength. In this paper the two configurations for dynamic recording are described
CARBOHYDRATE-CONTAINING COMPOUNDS WHICH BIND TO CARBOHYDRATE BINDING RECEPTORS
DEFF Research Database (Denmark)
1995-01-01
Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases.......Carbohydrate-containing compounds which contain saccharides or derivatives thereof and which bind to carbohydrate binding receptors are useful in pharmaceutical products for treatment of inflammatory diseases and other diseases....
Modeled effects on permittivity measurements of water content in high surface area porous media
International Nuclear Information System (INIS)
Jones, S.B.; Or, Dani
2003-01-01
Time domain reflectometry (TDR) has become an important measurement technique for determination of porous media water content and electrical conductivity due to its accuracy, fast response and automation capability. Water content is inferred from the measured bulk dielectric constant based on travel time analysis along simple transmission lines. TDR measurements in low surface area porous media accurately describe water content using an empirical relationship. Measurement discrepancies arise from dominating influences such as bound water due to high surface area, extreme aspect ratio particles or atypical water phase configuration. Our objectives were to highlight primary factors affecting dielectric permittivity measurements for water content determination in porous mixtures, and demonstrate the influence of these factors on mixture permittivity as predicted by a three-phase dielectric mixture model. Modeled results considering water binding, higher porosity, constituent geometry or phase configuration suggest any of these effects individually are capable of causing permittivity reduction, though all likely contribute in high surface area porous media
Characterisation of the steel concrete interface submitted to chloride-induced corrosion
International Nuclear Information System (INIS)
L'Hostis, V.; Amblard, E.; Guillot, W.; Paris, C.; Bellot-Gurlet, L.
2013-01-01
This paper deals with the characterisation by means of electrochemical, gravimetric and analytical methods of chloride-induced-corrosion behaviour of steel coupons embedded in chloride-containing-cement pastes. Corrosion rates were estimated from electrochemical measurements as well as gravimetric ones. They vary from 2.6 to 5.7μm/year for 5 and 10 g/L chloride-containing cement pastes. Analytical characterisations (including optical and electron microscopy and Raman micro-spectroscopy) showed that corrosion patterns are not depending on the chloride content of the cement paste (5 and 10 g/L chloride in the interstitial solution). A localised corrosion pattern composed of pits growing inside the metallic substratum, a corrosion products layer (CPL) and a transformed medium (TM) was pointed out. CPL can be divided into two sub-layers (CPL1 and CPL2), characterised by the presence or absence of calcium coming from the cement matrix. (authors)
ADM1-based methodology for the characterisation of the influent sludge in anaerobic reactors.
Huete, E; de Gracia, M; Ayesa, E; Garcia-Heras, J L
2006-01-01
This paper presents a systematic methodology to characterise the influent sludge in terms of the ADM1 components from the experimental measurements traditionally used in wastewater engineering. For this purpose, a complete characterisation of the model components in their elemental mass fractions and charge has been used, making a rigorous mass balance for all the process transformations and enabling the future connection with other unit-process models. It also makes possible the application of mathematical algorithms for the optimal characterisation of several components poorly defined in the ADM1 report. Additionally, decay and disintegration have been necessarily uncoupled so that the decay proceeds directly to hydrolysis instead of producing intermediate composites. The proposed methodology has been applied to the particular experimental work of a pilot-scale CSTR treating real sewage sludge, a mixture of primary and secondary sludge. The results obtained have shown a good characterisation of the influent reflected in good model predictions. However, its limitations for an appropriate prediction of alkalinity and carbon percentages in biogas suggest the convenience of including the elemental characterisation of the process in terms of carbon in the analytical program.
Analytical protocols for characterisation of sulphur-free lignin
Gosselink, R.J.A.; Abächerli, A.; Semke, H.; Malherbe, R.; Käuper, P.; Nadif, A.; Dam, van J.E.G.
2004-01-01
Interlaboratory tests for chemical characterisation of sulphur-free lignins were performed by five laboratories to develop useful analytical protocols, which are lacking, and identify quality-related properties. Protocols have been established for reproducible determination of the chemical
Trolling new media: violent extremist groups recruiting through social media
Chang, Mark D.
2015-01-01
Approved for public release; distribution is unlimited With the advent and subsequent growth of several new media technologies, violent extremist groups have incorporated social media into recruiting strategies. How are violent extremist groups using social media for recruiting? This thesis explores several new media technologies—websites, blogs, social media, mobile phones, and online gaming—to determine if violent extremist groups rely on social media for recruiting. By comparing the com...
International Nuclear Information System (INIS)
Hedvall, Robert
2012-01-01
AB SVAFO is a nuclear waste technology and decommissioning company based in Sweden in the scenic surroundings of Studsvik on the Baltic coast. SVAFO is owned by the Swedish nuclear power industry. The company was created in 1992 by Sydsvenska Vaermekraft AB, Vattenfall AB, Forsmarks Kraftgrupp AB and Oskarshamns Kraftgrupp AB as a consequence of the Act on the Financing of the Management of Certain Radioactive Waste etc, from 1988. AB SVAFO's main business is to take care of formerly state-owned spent nuclear waste at the site, including small amounts of nuclear fuel. Buildings are also included, mainly nuclear waste storage buildings and a research reactor. Some buildings have already been decommissioned and all the fuel is treated. In the past 30 years, various decommissioning projects have been carried out, encompassing areas such as an underground research reactor, a Van de Graaff accelerator, 15,000 m 2 of nuclear laboratories, two 150 m 3 underground concrete sludge silos and several waste-storage buildings. Up till now only one or two persons did a simple characterisation before the project started to get the level of contamination. With the start of the decommissioning of the former uranium mine in Ranstad and the R2-reactor, more efforts have been put for the characterisation. The change in methods will be described. (author)
Strasburger, Victor C
2010-11-01
The American Academy of Pediatrics recognizes that exposure to mass media (eg, television, movies, video and computer games, the Internet, music lyrics and videos, newspapers, magazines, books, advertising) presents health risks for children and adolescents but can provide benefits as well. Media education has the potential to reduce the harmful effects of media and accentuate the positive effects. By understanding and supporting media education, pediatricians can play an important role in reducing harmful effects of media on children and adolescents.
Characterisation and concentration profile of aluminium during ...
African Journals Online (AJOL)
An aluminium(Al) characterisation study was conducted at a surface water treatment plant (Buffalo Pound Water Treatment Plant (BPWTP) in Moose Jaw, Saskatchewan, Canada) to understand better the effect of alum coagulant on various Al fractions. The raw water source for BPWTP is Buffalo Pound Lake water. The Al ...
Characterisation of fracture network and groundwater preferential ...
African Journals Online (AJOL)
Characterisation of fractured rocks and evaluation of fracture connectivity are essential for the study of subsurface flow and transport in fractured rock aquifers. In this study, we use a new method to present fracture networks and analyse the connectivity of the fractures, based on the technique of randomly-generated ...
Characterisation of Gliclazide-PEG 8000 Solid Dispersions
African Journals Online (AJOL)
Erah
Purpose: The aim of the present study was to characterise gliclazide solid dispersions (SDs) ... Results: The solubility of gliclazide increased with increasing amount of PEG 8000 in aqueous medium. ... FTIR analysis demonstrated the absence of well-defined gliclazide - PEG 8000 .... voltage of 35 kV and 20 mA current. The.
Characterisation of childhood and adolescence accidental fatalities ...
African Journals Online (AJOL)
Background: Accidental death in childhood and adolescence is posing a public health problem in Nigeria, as most of these deaths were not caused by the victims. There is need to research into the pattern and circumstances surrounding the death. Aim: To characterise and study accidental deaths in childhood and ...
Endothelial cell capture of heparin-binding growth factors under flow.
Directory of Open Access Journals (Sweden)
Bing Zhao
2010-10-01
Full Text Available Circulation is an important delivery method for both natural and synthetic molecules, but microenvironment interactions, regulated by endothelial cells and critical to the molecule's fate, are difficult to interpret using traditional approaches. In this work, we analyzed and predicted growth factor capture under flow using computer modeling and a three-dimensional experimental approach that includes pertinent circulation characteristics such as pulsatile flow, competing binding interactions, and limited bioavailability. An understanding of the controlling features of this process was desired. The experimental module consisted of a bioreactor with synthetic endothelial-lined hollow fibers under flow. The physical design of the system was incorporated into the model parameters. The heparin-binding growth factor fibroblast growth factor-2 (FGF-2 was used for both the experiments and simulations. Our computational model was composed of three parts: (1 media flow equations, (2 mass transport equations and (3 cell surface reaction equations. The model is based on the flow and reactions within a single hollow fiber and was scaled linearly by the total number of fibers for comparison with experimental results. Our model predicted, and experiments confirmed, that removal of heparan sulfate (HS from the system would result in a dramatic loss of binding by heparin-binding proteins, but not by proteins that do not bind heparin. The model further predicted a significant loss of bound protein at flow rates only slightly higher than average capillary flow rates, corroborated experimentally, suggesting that the probability of capture in a single pass at high flow rates is extremely low. Several other key parameters were investigated with the coupling between receptors and proteoglycans shown to have a critical impact on successful capture. The combined system offers opportunities to examine circulation capture in a straightforward quantitative manner that
The synthesis and characterisation of some aliphatic monoamides and diamides
International Nuclear Information System (INIS)
Ruikar, P.B.; Prabhu, D.R.; Mahajan, G.R.; Nagar, M.S.; Nair, G.M.; Subramanian, M.S.
1992-01-01
This report summarises the synthesis and characterisation of several symmetrical, unsymmetrical and branched chain amides which have potential application as alternate extractants to TBP in the Purex Process. Some substituted diamides which have importance in the removal of actinides from transuranium waste have also been synthesised and characterised. The amides contents determined by nonaqueous potentiometric titration indicate a purity of 97-100%. The relative basicity of these amides and diamides have been determined by measuring the equilibrium constants for the uptake of nitric acid by them. The streching frequency of their carbonyl bond has also been listed. (author). 26 refs., 3 tabs
Geochemical characterisation of Elbe river high flood sediments
Energy Technology Data Exchange (ETDEWEB)
Krueger, F. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Falkenberg (Germany). Sektion Boden-/Gewaesserforschung]|[UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Magdeburg (Germany). Sektion Gewaesserforschung; Rupp, H.; Meissner, R. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Falkenberg (Germany). Sektion Boden-/Gewaesserforschung; Lohse, M.; Buettner, O.; Friese, K. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Magdeburg (Germany). Sektion Gewaesserforschung; Miehlich, G. [Hamburg Univ. (Germany). Inst. fuer Bodenkunde
2001-07-01
Quality aims for land usage in flood plains have to be worked out in the Russian-German research project 'Effects of floods on the pollution of agricultural used flood plain soils of the Oka River and the Elbe River'. It is financed by the Germany Ministry of Education and Research (FKZ 02 WT 9617/0). Beside the characterisation of the present pollution of soils for the middle Elbe, it is necessary to prognosticate the current pollutant input. At the examination site nearby Wittenberge, Elbe River kilometers 435 and 440, natural deposited flood sediments were sampled by artificial lawn mats. By the geochemical characterisation it is possible to record the metal input into the flood plain and to win knowledge about the sedimentation process. The results of sediment investigation of the high flood in spring 1997 are presented. (orig.)
Thermoluminescence characterisation of chemical vapour deposited diamond films
Mazzocchi, S; Bucciolini, M; Cuttone, G; Pini, S; Sabini, M G; Sciortino, S
2002-01-01
The thermoluminescence (TL) characteristics of a set of six chemical vapour deposited diamond films have been studied with regard to their use as off-line dosimeters in radiotherapy. The structural characterisation has been performed by means of Raman spectroscopy. Their TL responses have been tested with radiotherapy beams ( sup 6 sup 0 Co photons, photons and electrons from a linear accelerator (Linac), 26 MeV protons from a TANDEM accelerator) in the dose range 0.1-7 Gy. The dosimetric characterisation has yielded a very good reproducibility, a very low dependence of the TL response on the type of particle and independence of the radiation energy. The TL signal is not influenced by the dose rate and exhibits a very low thermal fading. Moreover, the sensitivity of the diamond samples compares favourably with that of standard TLD100 dosimeters.
Chemical characterisation of zircon-cadmium sulfoselenide ceramic pigments
International Nuclear Information System (INIS)
Gazulla Barreda, M. F.; Rodrigo Edo, M.; Blasco Roca, E.; Orduna Cordero, M.
2013-01-01
The present paper addresses the development of a methodology that allows the complete chemical characterisation of zircon cadmium sulfoselenide ceramic pigments including minor and major elements. To develop the methodology, five zircon-cadmium sulfoselenide pigments with different hues were selected, studying the different measurement process steps, from sample preparation to the optimisation of the measurement of the different components of the pigments by spectroscopic techniques (WD-XRF and elemental analysis by combustion and IR detection). The chemical characterisation method developed was validated with synthetic standards prepared from the mixture of certified reference materials and pure oxides because no certified referenced materials of this type of pigments were commercially available. The developed method can be used for a complete chemical characterization of zircon-cadmium sulfoselenide ceramic pigments with a very low uncertainty for all the elements analysed. (Author)
Neutralisation and binding of VHS virus by monovalent antibody fragments
DEFF Research Database (Denmark)
Cupit, P.M.; Lorenzen, Niels; Strachan, G.
2001-01-01
We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...
DEFF Research Database (Denmark)
Pedersen, Rasmus T.
2017-01-01
The concept of media framing refers to the way in which the news media organize and provide meaning to a news story by emphasizing some parts of reality and disregarding other parts. These patterns of emphasis and exclusion in news coverage create frames that can have considerable effects on news...... consumers’ perceptions and attitudes regarding the given issue or event. This entry briefly elaborates on the concept of media framing, presents key types of media frames, and introduces the research on media framing effects....
Bugajska-Schretter, A; Grote, M; Vangelista, L; Valent, P; Sperr, W R; Rumpold, H; Pastore, A; Reichelt, R; Valenta, R; Spitzauer, S
2000-05-01
Almost 4% of the population suffer from food allergy which is an adverse reaction to food with an underlying immunological mechanism. To characterise one of the most frequent IgE defined food allergens, fish parvalbumin. Tissue and subcellular distribution of carp parvalbumin was analysed by immunogold electron microscopy and cell fractionation. Parvalbumin was purified to homogeneity, analysed by mass spectrometry and circular dichroism (CD) spectroscopy, and its allergenic activity was analysed by IgE binding and basophil histamine release tests. The isoelectric point (pI) 4.7 form of carp parvalbumin, a three EF-hand calcium-binding protein, was purified to homogeneity. CD analysis revealed a remarkable stability and refolding capacity of calcium-bound parvalbumin. This may explain why parvalbumin, despite cooking and exposure to the gastrointestinal tract, can sensitise patients. Purified parvalbumin reacted with IgE of more than 95% of individuals allergic to fish, induced dose-dependent basophil histamine release and contained, on average, 83% of the IgE epitopes present in other fish species. Calcium depletion reduced the IgE binding capacity of parvalbumin which, according to CD analysis, may be due to conformation-dependent IgE recognition. Purified carp parvalbumin represents an important cross reactive food allergen. It can be used for in vitro and in vivo diagnosis of fish-induced food allergy. Our finding that the apo-form of parvalbumin had a greatly reduced IgE binding capacity indicates that this form may be a candidate for safe immunotherapy of fish-related food allergy.
On the fate of carbon nanotubes : morphological characterisations
Loos, J.; Grossiord, N.; Koning, C.E.; Regev, O.
2007-01-01
Single-walled and multi-walled carbon nanotubes (SWNTs and MWNTs) were characterised as-produced, after exfoliation and purification, and imbedded in the polymer matrix of nanocomposites by using various microscopic techniques. Transmission electron microscopy (TEM) shows thickness distribution as
Krüsemann, Erna J Z; Lasschuijt, Marlou P; de Graaf, C; de Wijk, René A; Punter, Pieter H; van Tiel, Loes; Cremers, Johannes W J M; van de Nobelen, Suzanne; Boesveldt, Sanne; Talhout, Reinskje
2018-05-23
Tobacco flavours are an important regulatory concept in several jurisdictions, for example in the USA, Canada and Europe. The European Tobacco Products Directive 2014/40/EU prohibits cigarettes and roll-your-own tobacco having a characterising flavour. This directive defines characterising flavour as 'a clearly noticeable smell or taste other than one of tobacco […]'. To distinguish between products with and without a characterising flavour, we trained an expert panel to identify characterising flavours by smelling. An expert panel (n=18) evaluated the smell of 20 tobacco products using self-defined odour attributes, following Quantitative Descriptive Analysis. The panel was trained during 14 attribute training, consensus training and performance monitoring sessions. Products were assessed during six test sessions. Principal component analysis, hierarchical clustering (four and six clusters) and Hotelling's T-tests (95% and 99% CIs) were used to determine differences and similarities between tobacco products based on odour attributes. The final attribute list contained 13 odour descriptors. Panel performance was sufficient after 14 training sessions. Products marketed as unflavoured that formed a cluster were considered reference products. A four-cluster method distinguished cherry-flavoured, vanilla-flavoured and menthol-flavoured products from reference products. Six clusters subdivided reference products into tobacco leaves, roll-your-own and commercial products. An expert panel was successfully trained to assess characterising odours in cigarettes and roll-your-own tobacco. This method could be applied to other product types such as e-cigarettes. Regulatory decisions on the choice of reference products and significance level are needed which directly influences the products being assessed as having a characterising odour. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use
Feedback from performance assessment to site characterisation. The SITE-94 example
International Nuclear Information System (INIS)
Dverstorp, B.; Geier, J.
1999-01-01
Interaction and information exchange between site characterisation and performance assessment are key features of any successful radioactive waste management programme. Some examples are presented of the types of feedback that can be offered from performance assessment to site characterisation, based on SKI's most recent performance assessment project, SITE-94. SITE-94 in Sweden was an assessment of a hypothetical repository for spent nuclear fuel, based on real data gathered in the surface-based investigation of the Aespoe Hard Rock Laboratory site. Examples of feedback are given concerning quality control of data and site investigation procedures, identification of key parameters for the performance assessment, use of models for planning and evaluation of a site investigation, data sampling strategies, and guidance on future priorities for further development of site investigation methods. Because site characterisation serves multiple purposes, including provision of data for repository design and construction, it must account for and compromise among requirements from several lines of analyses in the performance assessment. (author)
DEFF Research Database (Denmark)
Khajeheian, Datis
2017-01-01
Media Entrepreneurship has been an ambiguous, unclear and controversial concept and despite of growing academic efforts in the last decade, it is still a poorly defined subject. This paper is an effort to fill this gap by providing a comprehensive definition of media entrepreneurship. Firstly......, a literature review conducted and entrepreneurship, media, opportunity and innovation as building blocks of media entrepreneurship explained. Then by using of a mixed of bibliographic method and a Delphi method with multi-stage analysis process, a consensual definition of media entrepreneurship proposed...... entrepreneurship....
Fast-Scan DSC and its role in pharmaceutical physical form characterisation and selection.
Ford, James L; Mann, Timothy E
2012-04-01
Conventional rate Differential Scanning Calorimetry (DSC) has been used for many years as a tool in the analysis of pharmaceutical materials. In recent years an extension of the technique to include fast heating and cooling rates has become more prevalent. Broadly termed Fast-Scan DSC, this review examines the current applications of this technique to the characterisation and selection of pharmaceutical materials. Its increasing use encompasses the characterisation of amorphousness in crystalline materials, the characterisation of polymorphs and polymorphic transitions, the solubility of drugs in polymers, and characterisation of dosage forms. Notwithstanding the advantages of analytical speed in analytical turnover, the review emphasises the advantages of Fast-Scan DSC in its sensitivity which allows the separation of overlapping thermal events, the reduction it provides in degradation during the scanning process and its role in determining solubility in waxy and polymeric based systems. A comparison of the uses of Fast-Scan DSC to modulated DSC techniques and localised thermal analysis is also given. © 2011 Elsevier B.V. All rights reserved.
Solution structure of an archaeal DNA binding protein with an eukaryotic zinc finger fold.
Directory of Open Access Journals (Sweden)
Florence Guillière
Full Text Available While the basal transcription machinery in archaea is eukaryal-like, transcription factors in archaea and their viruses are usually related to bacterial transcription factors. Nevertheless, some of these organisms show predicted classical zinc fingers motifs of the C2H2 type, which are almost exclusively found in proteins of eukaryotes and most often associated with transcription regulators. In this work, we focused on the protein AFV1p06 from the hyperthermophilic archaeal virus AFV1. The sequence of the protein consists of the classical eukaryotic C2H2 motif with the fourth histidine coordinating zinc missing, as well as of N- and C-terminal extensions. We showed that the protein AFV1p06 binds zinc and solved its solution structure by NMR. AFV1p06 displays a zinc finger fold with a novel structure extension and disordered N- and C-termini. Structure calculations show that a glutamic acid residue that coordinates zinc replaces the fourth histidine of the C2H2 motif. Electromobility gel shift assays indicate that the protein binds to DNA with different affinities depending on the DNA sequence. AFV1p06 is the first experimentally characterised archaeal zinc finger protein with a DNA binding activity. The AFV1p06 protein family has homologues in diverse viruses of hyperthermophilic archaea. A phylogenetic analysis points out a common origin of archaeal and eukaryotic C2H2 zinc fingers.
Barrett, Jessica R; Shetty, Hitesh; Broadbent, Matthew; Cross, Sean; Hotopf, Matthew; Stewart, Robert; Lee, William
2016-05-01
In cases of non-fatal self-harm, suicide notes are a major risk factor for repeated self-harm and suicide. Suicide notes can now be left on new media services, emails or text messages, as well as on paper. In a group of people who had harmed themselves, we aimed to compare new media note-leavers with paper note-leavers and characterise these groups demographically and by risk factors. Clinical notes of patients who presented with non-fatal self-harm to two London emergency departments were anonymously searched for mentions of new media use. These were categorised and risk factors were compared for those who had left a new media note, a paper note, or no note to establish differences in risk of note-leaving. New media note-leaving was associated with younger age and substance use; both risk factors for repeated self-harm. However, suicidal intent remained highest in paper note-leavers. Paper note-leavers remain at greatest risk, however new media note leaving is still correlated with risk factors related to repeated self-harm and suicide. Clinicians should enquire about new media use during emergency department assessments of self-harm. None. © The Royal College of Psychiatrists 2016. This is an open access article distributed under the terms of the Creative Commons Non-Commercial, No Derivatives (CC BY-NC-ND) licence.
Statistical deconvolution of enthalpic energetic contributions to MHC-peptide binding affinity
Directory of Open Access Journals (Sweden)
Drew Michael GB
2006-03-01
Full Text Available Abstract Background MHC Class I molecules present antigenic peptides to cytotoxic T cells, which forms an integral part of the adaptive immune response. Peptides are bound within a groove formed by the MHC heavy chain. Previous approaches to MHC Class I-peptide binding prediction have largely concentrated on the peptide anchor residues located at the P2 and C-terminus positions. Results A large dataset comprising MHC-peptide structural complexes was created by re-modelling pre-determined x-ray crystallographic structures. Static energetic analysis, following energy minimisation, was performed on the dataset in order to characterise interactions between bound peptides and the MHC Class I molecule, partitioning the interactions within the groove into van der Waals, electrostatic and total non-bonded energy contributions. Conclusion The QSAR techniques of Genetic Function Approximation (GFA and Genetic Partial Least Squares (G/PLS algorithms were used to identify key interactions between the two molecules by comparing the calculated energy values with experimentally-determined BL50 data. Although the peptide termini binding interactions help ensure the stability of the MHC Class I-peptide complex, the central region of the peptide is also important in defining the specificity of the interaction. As thermodynamic studies indicate that peptide association and dissociation may be driven entropically, it may be necessary to incorporate entropic contributions into future calculations.
Characterising and comparing the spawning habitats of anchovy ...
African Journals Online (AJOL)
The spawning habitats of anchovy Engraulis encrasicolus and sardine Sardinops sagax in the southern Benguela upwelling ecosystem were characterised by comparing their egg abundances with environmental variables measured concomitantly during two different survey programmes: the South African Sardine and ...
International Nuclear Information System (INIS)
Barbieri, Renato; Bertini, Ivano; Lee, Yong-Min; Luchinat, Claudio; Velders, Aldrik H.
2002-01-01
Lanthanide-substituted calcium binding proteins are known to partially orient in high magnetic fields. Orientation provides residual dipolar couplings (rdc's). Two of these systems, Tm 3+ - and Dy 3+ -substituted calbindin D 9k , dissolved in an external orienting medium (nonionic liquid crystalline phase) provide rdc values which are the sum of those induced by the lanthanides and by the liquid crystalline phase on the native calcium binding protein. This structure-independent check shows the innocence of the orienting medium with respect to the structure of the protein in solution. Furthermore, the simultaneous use of lanthanide substitution and external orienting media provides a further effective tool to control and tune the orientation tensor
Alles, E. J.; Heo, J.; Noimark, S.; Colchester, R.; Parkin, I.; Baac, H. W.; Desjardins, A.
2017-01-01
An optical ultrasound generator was used to perform broadband (2-35 MHz) acoustical characterisation measurements of a nanocomposite comprising carbon nanotubes (CNT) and polydimethylsiloxane (PDMS), a composite that is commonly used as optical ultrasound generator. Samples consisting of either pure PDMS or CNT-loaded PDMS were characterised to determine the influence of CNTs on the speed of sound and power-law acoustic attenuation parameters. A small weight fraction (
New media technologies and mass media reform processes
Directory of Open Access Journals (Sweden)
Tomić Boban
2017-01-01
Full Text Available This paper reviews and assesses the chances for survival and development of the media in Serbia and ib the region, from the perspective of new information and communication technologies (ICT applied in media business. In the paper theoretical method is used and harmonized with the needs of describing the problems and the observed processes and phenomena, as well as empirical method which is used for collecting and interpreting concrete facts and data on the observed processes and phenomena. The starting point lies in the fact that modern media is definitely, more and more, dependent on new technologies. A part of the new technologies is used in the process of collecting, selecting and editing media content, while the other part of the technology is used in the process of dissemination and propulsion of media content to the mass audience, and also in the feedback function as well. The technology revolution, which we describe, started with mp3, jpg and avi files, and continues with internet broadcasting, social networks, cloud technologies and new digital platforms which are used by today's media for distribution of media content. The particularity of the media in the region lies in the fact that they operating in the societes with delay of political and economic transition, so all the productive resources of society, due to this backlog, are slower adapted to the new conditions of business in the digital era. The consequences that have arisen from such dynamics of development make many media in Serbia and the region quite dysfunctional, especially those who were exposed during this transition to long-standing legal, economic and program crises. That is why most of the existing media in Serbia, especially small ones, are unprepared for modernization and they are not ready for re-modeling in accordance with the new technological circumstances.
Kropp, Jenna; Khatib, Hasan
2015-01-01
In vitro production (IVP) systems have been used to bypass problems of fertilization and early embryonic development. However, embryos produced by IVP are commonly selected for implantation based on morphological assessment, which is not a strong indicator of establishment and maintenance of pregnancy. Thus, there is a need to identify additional indicators of embryonic developmental potential. Previous studies have identified microRNA expression in in vitro culture media to be indicative of embryo quality in both bovine and human embryos. Like microRNAs, mRNAs have been shown to be secreted from cells into the extracellular environment, but it is unknown whether or not these RNAs are secreted by embryos. Thus, the objective of the present study was to determine whether mRNAs are secreted into in vitro culture media and if their expression in the media is indicative of embryo quality. In vitro culture medium was generated and collected from both blastocyst and degenerate (those which fail to develop from the morula to blastocyst stage) embryos. Small-RNA sequencing revealed that many mRNA fragments were present in the culture media. A total of 17 mRNA fragments were differentially expressed between blastocyst and degenerate conditioned media. Differential expression was confirmed by quantitative real-time PCR for fragments of mRNA POSTN and VSNL-1, in four additional biological replicates of media. To better understand the mechanisms of mRNA secretion into the media, the expression of a predicted RNA binding protein of POSTN, PUM2, was knocked down using an antisense oligonucleotide gapmer. Supplementation of a PUM2 gapmer significantly reduced blastocyst development and decreased secretion of POSTN mRNA into the media. Overall, differential mRNA expression in the media was repeatable and sets the framework for future study of mRNA biomarkers in in vitro culture media to improve predictability of reproductive performance.
[Media for 21st century--towards human communication media].
Harashima, H
2000-05-01
Today, with the approach of the 21st century, attention is focused on multi-media communications combining computer, visual and audio technologies. This article discusses the communication media target and the technological problems constituting the nucleus of multi-media. The communication media is becoming an environment from which no one can escape. Since the media has such a great power, what is needed now is not to predict the future technologies, but to estimate the future world and take to responsibility for future environments.
DEFF Research Database (Denmark)
Harkness, Linda; Rasmussen, Iben Anne; Erb, Karin
2010-01-01
The derivation and characterisation of human embryonic stem cells provides a source of pluripotent stem cells with potential for clinical applications. Utilising locally sourced embryos from two IVF clinics, we derived and characterised five new cell lines for use in a non-clinical setting. Analy...
Justiniano, A.; Jaya, Y.; Diephuis, G.; Veenhof, R.; Pringle, T.
2015-01-01
The objective of the study is to characterise the Triassic massive stacked sandstone deposits of the Main Buntsandstein Subgroup at Block Q16 located in the West Netherlands Basin. The characterisation was carried out through combining rock-physics modelling and seismic inversion techniques. The
Directory of Open Access Journals (Sweden)
Marina Ašković
2015-05-01
Full Text Available Does the trend in which electronic media are gradually becoming extension of human body have to move towards full enslavement of a human and his personality, or the same human will unpredictably, with the aid of his personal media literacy, exit the whirls of media and technological censorships? Personality crisis is closely related to the crisis of language no matter how contradicted to global ideology of transnational transhumanism it may seem. Considering the fact that recent media presentations of the world are based on commercialization of environmentalism, philosophical and aesthetic thought appears as an important subject of ecology. As media mediates, the scenery of civilized living increasingly becomes more appealing even though it derives from commercial and political background. Consequently, the future of humanity depends by large on the philosophy of media. Media have to truly ecologise returning the humanum to its essence making it into the extension of the natural world.
Media Education and Media Criticism in the Educational Process in Russia
Fedorov, Alexander; Levitskaya, Anastasia
2017-01-01
Media criticism and media education have a lot in common. For example, both media education and media criticism attach great importance to the development of analytical thinking of the audience. Indeed, one of the most important tasks of media education is precisely to teach the audience not only to analyze media texts of any types, but also to…
Towards water compatible MIPs for sensing in aqueous media.
Horemans, F; Weustenraed, A; Spivak, D; Cleij, T J
2012-06-01
When synthesizing molecularly imprinted polymers (MIPs), a few fundamental principles should be kept in mind. There is a strong correlation between porogen polarity, MIP microenvironment polarity and the imprinting effect itself. The combination of these parameters eventually determines the overall binding behavior of a MIP in a given solvent. In addition, it is shown that MIP binding is strongly influenced by the polarity of the rebinding solvent. Because the use of MIPs in biomedical environments is of considerable interest, it is important that these MIPs perform well in aqueous media. In this article, various approaches are explored towards a water compatible MIP for the target molecule l-nicotine. To this end, the imprinting effect together with the MIP matrix polarity is fine-tuned during MIP synthesis. The binding behavior of the resulting MIPs is evaluated by performing batch rebinding experiments that makes it possible to select the most suitable MIP/non-imprinted polymer couple for future application in aqueous environments. One method to achieve improved compatibility with water is referred to as porogen tuning, in which porogens of varying polarities are used. It is demonstrated that, especially when multiple porogens are mixed, this approach can lead to superior performance in aqueous environments. Another method involves the incorporation of polar or non-polar comonomers in the MIP matrix. It is shown that by carefully selecting these monomers, it is also possible to obtain MIPs, which can selectively bind their target in water. Copyright © 2012 John Wiley & Sons, Ltd.
Optimisation and Characterisation of Anti-Fouling Ternary SAM Layers for Impedance-Based Aptasensors
Directory of Open Access Journals (Sweden)
Anna Miodek
2015-09-01
Full Text Available An aptasensor with enhanced anti-fouling properties has been developed. As a case study, the aptasensor was designed with specificity for human thrombin. The sensing platform was developed on screen printed electrodes and is composed of a self-assembled monolayer made from a ternary mixture of 15-base thiolated DNA aptamers specific for human thrombin co-immobilised with 1,6-hexanedithiol (HDT and further passivated with 1-mercapto-6-hexanol (MCH. HDT binds to the surface by two of its thiol groups forming alkyl chain bridges and this architecture protects from non-specific attachment of molecules to the electrode surface. Using Electrochemical Impedance Spectroscopy (EIS, the aptasensor is able to detect human thrombin as variations in charge transfer resistance (Rct upon protein binding. After exposure to a high concentration of non-specific Bovine Serum Albumin (BSA solution, no changes in the Rct value were observed, highlighting the bio-fouling resistance of the surface generated. In this paper, we present the optimisation and characterisation of the aptasensor based on the ternary self-assembled monolayer (SAM layer. We show that anti-fouling properties depend on the type of gold surface used for biosensor construction, which was also confirmed by contact angle measurements. We further studied the ratio between aptamers and HDT, which can determine the specificity and selectivity of the sensing layer. We also report the influence of buffer pH and temperature used for incubation of electrodes with proteins on detection and anti-fouling properties. Finally, the stability of the aptasensor was studied by storage of modified electrodes for up to 28 days in different buffers and atmospheric conditions. Aptasensors based on ternary SAM layers are highly promising for clinical applications for detection of a range of proteins in real biological samples.
International Nuclear Information System (INIS)
Berkowitz, R.L.; Travis, R.L.
1981-01-01
The binding of concanavalin A (Con A) to soybean root membranes in plasma membrane enriched fractions (recovered from the 34/45% interface of simplified discontinuous sucrose density gradients) was studied using a radiochemical assay employing tritated ( 3 H)-Con A. The effect of lectin concentration, time, and membrane protein concentration on the specific binding of 3 H-Con A by the membranes was evaluated. Kinetic analyses showed that Con A will react with membranes in that fraction in a characteristic and predictable manner. The parameters for an optimal and standard binding assay were established. Maximal binding occurred with Con A concentrations in the range of 8 to 16% of the total membrane protein with incubation times greater than 40 min at 22 C. Approximately 10 15 molecules of 3 H-Con A were bound per microgram of membrane protein at saturation. Binding was reversible. Greater than 92% of the total Con A bound at saturation was released by addition of α-methyl mannoside. A major peak of 3 H-Con A binding was also observed in fractions recovered from the 25/30% interface of a complex discontinuous sucrose density gradient when membranes were isolated in the absence of Mg 2+ . When high Mg 2+ was present in the isolation and gradient media, the peak was shifted to a fraction recovered from the 34/38% sucrose interface. These results suggest that Con A binding sites are also present on membranes of the endoplasmic reticulum. The amount of Con A bound by endoplasmic reticulum membranes was at least twice the amount bound by membranes in plasma membrane enriched fractions when binding was compared on a per unit membrane protein basis. In contrast, mitochondrial inner membranes, which equilibrate at the same density as plasma membranes, had little ability to bind the lectin
Lukinbeal, Chris
2014-01-01
While the use of media permeates geographic research and pedagogic practice, the underlying literacies that link geography and media remain uncharted. This article argues that geographic media literacy incorporates visual literacy, information technology literacy, information literacy, and media literacy. Geographic media literacy is the ability…
RESPONSIBILITY CENTCOM COALITION MEDIA SOCIAL MEDIA NEWS ARTICLES PRESS RELEASES IMAGERY VIDEOS TRANSCRIPTS VISITORS AND PERSONNEL FAMILY CENTER FAMILY READINESS CENTCOM WEBMAIL SOCIAL MEDIA SECURITY ACCOUNTABILITY HomeVISITORS AND PERSONNELSOCIAL MEDIA SECURITY FAQ on Security for Social Media Due to the widespread use of
Differential plasma protein binding to metal oxide nanoparticles
International Nuclear Information System (INIS)
Deng, Zhou J; Mortimer, Gysell; Minchin, Rodney F; Schiller, Tara; Musumeci, Anthony; Martin, Darren
2009-01-01
Nanoparticles rapidly interact with the proteins present in biological fluids, such as blood. The proteins that are adsorbed onto the surface potentially dictate the biokinetics of the nanomaterials and their fate in vivo. Using nanoparticles with different sizes and surface characteristics, studies have reported the effects of physicochemical properties on the composition of adsorbed plasma proteins. However, to date, few studies have been conducted focusing on the nanoparticles that are commonly exposed to the general public, such as the metal oxides. Using previously established ultracentrifugation approaches, two-dimensional gel electrophoresis and mass spectrometry, the current study investigated the binding of human plasma proteins to commercially available titanium dioxide, silicon dioxide and zinc oxide nanoparticles. We found that, despite these particles having similar surface charges in buffer, they bound different plasma proteins. For TiO 2 , the shape of the nanoparticles was also an important determinant of protein binding. Agglomeration in water was observed for all of the nanoparticles and both TiO 2 and ZnO further agglomerated in biological media. This led to an increase in the amount and number of different proteins bound to these nanoparticles. Proteins with important biological functions were identified, including immunoglobulins, lipoproteins, acute-phase proteins and proteins involved in complement pathways and coagulation. These results provide important insights into which human plasma proteins bind to particular metal oxide nanoparticles. Because protein absorption to nanoparticles may determine their interaction with cells and tissues in vivo, understanding how and why plasma proteins are adsorbed to these particles may be important for understanding their biological responses.
Methods and systems for identifying ligand-protein binding sites
Gao, Xin
2016-05-06
The invention provides a novel integrated structure and system-based approach for drug target prediction that enables the large-scale discovery of new targets for existing drugs Novel computer-readable storage media and computer systems are also provided. Methods and systems of the invention use novel sequence order-independent structure alignment, hierarchical clustering, and probabilistic sequence similarity techniques to construct a probabilistic pocket ensemble (PPE) that captures even promiscuous structural features of different binding sites for a drug on known targets. The drug\\'s PPE is combined with an approximation of the drug delivery profile to facilitate large-scale prediction of novel drug- protein interactions with several applications to biological research and drug development.
Towards a complete characterisation of guaiacwood oil.
Tissandié, Loïc; Viciana, Stéphane; Brevard, Hugues; Meierhenrich, Uwe J; Filippi, Jean-Jacques
2018-05-01
Guaiacwood oil is a common perfume ingredient used in modern compositions for its suave woody-rosy scent. This essential oil is a byproduct of the timber industry obtained by hydrodistillation of the heartwood of Bulnesia sarmientoi, a tree native from Latin America. Despite being widely used in perfumery, guaiacwood oil has been poorly described in the past. This study aims at giving an in-depth characterisation of its chemical composition as well as disclosing the odorant compounds responsible for its characteristic fragrance. Our methodology was based on a combination of fractionation and analytical techniques, including comprehensive two-dimensional gas chromatography coupled to mass spectrometry and preparative capillary-gas chromatography. The entire analytical work led to the isolation of 20 constituents among which 14 have never been reported so far in natural extracts. Each isolated compound was fully characterised by spectroscopic methods. Finally, the accurate knowledge of the chemical composition permitted the identification of the odour-active constituents by gas chromatography-olfactometry. Copyright © 2018 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Elsayed, Y. [Advanced Materials Group, University of Surrey, Guildford, Surrey GU2 7XH (United Kingdom); Lekakou, C., E-mail: C.Lekakou@surrey.ac.uk [Advanced Materials Group, University of Surrey, Guildford, Surrey GU2 7XH (United Kingdom); Labeed, F. [Centre of Biomedical Engineering, University of Surrey, Guildford, Surrey GU2 7XH (United Kingdom); Tomlins, P. [National Physical Laboratory (NPL), Teddington, Middlesex TW11 0LW (United Kingdom)
2016-04-01
It is increasingly recognised that biomimetic, natural polymers mimicking the extracellular matrix (ECM) have low thrombogenicity and functional motifs that regulate cell–matrix interactions, with these factors being critical for tissue engineered vascular grafts especially grafts of small diameter. Gelatin constitutes a low cost substitute of soluble collagen but gelatin scaffolds so far have shown generally low strength and suture retention strength. In this study, we have devised the fabrication of novel, electrospun, multilayer, gelatin fibre scaffolds, with controlled fibre layer orientation, and optimised gelatin crosslinking to achieve not only compliance equivalent to that of coronary artery but also for the first time strength of the wet tubular acellular scaffold (swollen with absorbed water) same as that of the tunica media of coronary artery in both circumferential and axial directions. Most importantly, for the first time for natural scaffolds and in particular gelatin, high suture retention strength was achieved in the range of 1.8–1.94 N for wet acellular scaffolds, same or better than that for fresh saphenous vein. The study presents the investigations to relate the electrospinning process parameters to the microstructural parameters of the scaffold, which are further related to the mechanical performance data of wet, crosslinked, electrospun scaffolds in both circumferential and axial tubular directions. The scaffolds exhibited excellent performance in human smooth muscle cell (SMC) proliferation, with SMCs seeded on the top surface adhering, elongating and aligning along the local fibres, migrating through the scaffold thickness and populating a transverse distance of 186 μm and 240 μm 9 days post-seeding for scaffolds of initial dry porosity of 74 and 83%, respectively. - Highlights: • Novel crosslinked electrospun gelatin scaffolds of specific fibre layer orientation • These scaffolds have compliance equivalent to that of coronary
Characterisation, control, and energy management of electrified turbocharged diesel engines
International Nuclear Information System (INIS)
Zhao, Dezong; Winward, Edward; Yang, Zhijia; Stobart, Richard; Steffen, Thomas
2017-01-01
Highlights: • A real-time energy management framework for electrified engines is proposed. • A multi-variable robust controller is designed. • Characterisation on the air system of electrified diesel engines is given. • Reliable for engine downsizing because of the promising transient performance. - Abstract: The electrification of engine components offers significant opportunities for fuel efficiency improvements. The electrified turbocharger is one of the most attractive options since it recovers part of the engine exhaust gas mechanical energy to assist boosting. Therefore, the engine can be downsized through improved transient responsiveness. In the electrified turbocharger, an electric machine is mounted on the turbine shaft and changes the air system dynamics, so characterisation of the new layout is essential. A systematic control solution is required to manage energy flows in the hybrid system. In this paper, a framework for characterisation, control, and energy management for an electrified turbocharged diesel engine is proposed. The impacts of the electric machine on fuel economy and air system variables are analysed. Based on the characterisation, a two-level control structure is proposed. A real-time energy management strategy is employed as the supervisory level controller to generate the optimal values of critical variables, while a model-based multi-variable controller is designed as the low level controller to track the values. The two controllers work together in a cascade to address both fuel economy optimisation and battery state-of-charge maintenance. The proposed control strategy is validated on a high fidelity physical engine model. The tracking performance shows the proposed framework is a promising solution in regulating the behavior of electrified engines.
Location and characterisation of pollution sites by principal ...
African Journals Online (AJOL)
Location and characterisation of pollution sites by principal component analysis of trace contaminants in a slightly polluted seasonal river: a case study of the Arenales River (Salta, Argentina) ... Keywords: trace element contamination, water quality, principal component analysis, Arenales River, Salta, Argentina ...
Who takes care of the children? The presentation of female top politicians in the media
Directory of Open Access Journals (Sweden)
Christina Holtz-Bacha
2013-10-01
Full Text Available The essay reflects on the media representation commonly associates with women politicians. Starting with a critique of media coverage about some political leaders in several countries, such as Angela Merkel, Michelle Bachelet, Ségolène Royal, Cristina Fernández de Kirchner and Hillary Clinton, the paper discusses the phenomenon of the double bind to which women are subjected in politics: if a woman presents herself as being cool, calculating and aggressive as it is expected in the political business she risks to be rejected as a virago. If she recommends herself with allegedly female traits, she will be regarded as not being viable for the serious challenges of the political business. There is no easy formula for how women should represent themselves. Since there are only few opportunities for direct contact between politicians and the electorate, it is necessary to deal with public image reported by media.
Preparation and characterisation of immobilised humic acid on silicon wafer
International Nuclear Information System (INIS)
Szabo, Gy.; Guczi, J.; Telegdi, J.; Pashalidis, I.; Szymczak, W.; Buckau, G.
2005-01-01
Full text of publication follows: The chemistry of the interactions of radionuclides with humic acid needs to be understood in details so that humate-mediated migration of radionuclides through the environment can be predicted. To achieve such a data in microscopic scale, several detective techniques, such as atomic force microscopy (AFM), chemical force microscopy (CFM), nuclear microprobe analysis (NMA) and X-ray photoelectron spectroscopy (XPS) can be used to measure intermolecular forces and to visualize the surface morphology. The main aim of this work was to provide humic material with specific properties in order to study with different spectroscopic techniques, the complexation behaviour of surface bound humic acid in microscopic scale. Namely, humic acid has been immobilised on silicon wafers in order to mimic surface bound humic substances in natural aquatic systems. In this communication, we present a simple protocol to immobilize humic acid on silicon wafer surface. A tri-functional silane reagent 3-amino-propyl-tri-methoxy-silane (APTES) was used to modify the surface of silicon wafers and appeared to be able to strongly attached soluble humic acid through their carboxylic groups to solid support. Characterisation of the surfaces, after any preparation steps, was done by ATR-FTIR, AFM and TOF-SIMS. These methods have proved that the humic acid forms a relatively homogeneous layer on the wafers. Immobilisation of humic acid on silicon wafer was further proved by binding isotherm of Am/Nd. (authors)
ANALISIS CATEGORY ADVERTISING EXPENDITURE DAN CONSUMER MEDIA HABIT DI MEDIA TELEVISI DAN MEDIA CETAK
Directory of Open Access Journals (Sweden)
Zifwen Zifwen
2011-08-01
Full Text Available Normal 0 false false false MicrosoftInternetExplorer4 The purpose of the study is to identify the category of advertising expenditure and media habit on media advertising, especially on television and print ad such as newspapers, magazines and tabloids. The Data were collected from Nielsen Media Research (NMR data base from a number of cities in Indonesia, such as Jakarta,Surabaya, Bandung, Semarang, Surabaya, Yogyakarta, Bali, Medan,Palembang and Makassar. There are three different type of data used to acquire the secondary data for the study: (1 Telescope (data collected for rating analysis January 1st, 2005 to March 31st, 2005, (2 Print scope (data collected from the readership of magazines, tabloids and newspaper January 1st, 2004 to December 31st, 2004 and (3 Ad quest (data collected from advertising expenditure for all categories. The data were collected, calculated and analyzed from January 1st, 2002 to December 31st, 2004. The purpose of the study is to uncover the trend of advertising budget from all categories on the television and print ads, in order to describe the consumption tendency of the people within advertising media. Index analysis and Biplot were used to analyze the data. Based on the result of advertising expenditure analysis of data, showing that all categories were completely different in the utilization of the media for advertisement. Some categories used mix media to support their campaign and others used a single media. Characteristic of the categories were strongly involved in the decision making in way of choosing and using the advertising media. The result of consumer media analysis found that the people habit were completely different and unique in media consumption. Different of age, sex and social economic status can create a different habit in term of hobbies and desire within the channel, programme, newspaper, magazines and the tabloids. Finally, to create an effective and efficient advertising activity
Directory of Open Access Journals (Sweden)
Fabiano Tófoli de Araújo
Full Text Available BACKGROUND: The uptake of sulphur-containing compounds plays a pivotal role in the physiology of bacteria that live in aerobic soils where organosulfur compounds such as sulphonates and sulphate esters represent more than 95% of the available sulphur. Until now, no information has been available on the uptake of sulphonates by bacterial plant pathogens, particularly those of the Xanthomonas genus, which encompasses several pathogenic species. In the present study, we characterised the alkanesulphonate uptake system (Ssu of Xanthomonas axonopodis pv. citri 306 strain (X. citri, the etiological agent of citrus canker. METHODOLOGY/PRINCIPAL FINDINGS: A single operon-like gene cluster (ssuEDACB that encodes both the sulphur uptake system and enzymes involved in desulphurisation was detected in the genomes of X. citri and of the closely related species. We characterised X. citri SsuA protein, a periplasmic alkanesulphonate-binding protein that, together with SsuC and SsuB, defines the alkanesulphonate uptake system. The crystal structure of SsuA bound to MOPS, MES and HEPES, which is herein described for the first time, provides evidence for the importance of a conserved dipole in sulphate group coordination, identifies specific amino acids interacting with the sulphate group and shows the presence of a rather large binding pocket that explains the rather wide range of molecules recognised by the protein. Isolation of an isogenic ssuA-knockout derivative of the X. citri 306 strain showed that disruption of alkanesulphonate uptake affects both xanthan gum production and generation of canker lesions in sweet orange leaves. CONCLUSIONS/SIGNIFICANCE: The present study unravels unique structural and functional features of the X. citri SsuA protein and provides the first experimental evidence that an ABC uptake system affects the virulence of this phytopathogen.
Sun, Fang; Bai, Tao; Zhang, Lei; Ella-Menye, Jean-Rene; Liu, Sijun; Nowinski, Ann K; Jiang, Shaoyi; Yu, Qiuming
2014-03-04
A new strategy is proposed to sensitively and rapidly detect analytes with weak Raman signals in complex media using surface-enhanced Raman spectroscopy (SERS) via detecting the SERS signal changes of the immobilized probe molecules on SERS-active substrates upon binding of the analytes. In this work, 4-mercaptophenylboronic acid (4-MPBA) was selected as the probe molecule which was immobilized on the gold surface of a quasi-three-dimensional plasmonic nanostructure array (Q3D-PNA) SERS substrate to detect fructose. The molecule of 4-MPBA possesses three key functions: molecule recognition and reversible binding of the analyte via the boronic acid group, amplification of SERS signals by the phenyl group and thus shielding of the background noise of complex media, and immobilization on the surface of SERS-active substrates via the thiol group. Most importantly, the symmetry breaking of the 4-MPBA molecule upon fructose binding leads to the change of area ratio between totally symmetric 8a ring mode and nontotally symmetric 8b ring mode, which enables the detection. The detection curves were obtained in phosphate-buffered saline (PBS) and in undiluted artificial urine at clinically relevant concentrations, and the limit of detection of 0.05 mM was achieved.
Impact of cultivation on characterisation of species composition of soil bacterial communities.
McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.
2001-03-01
The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated
Characterisation of a uranium fire aerosol
International Nuclear Information System (INIS)
Leuscher, A.H.
1976-01-01
Uranium swarf, which can burn spontaneously in air, creates an aerosol which is chemically toxic and radiotoxic. The uptake of uranium oxide in the respiratory system is determined to a large extent by the characteristics of the aerosol. A study has been made of the methods by which aerosols can be characterised. The different measured and defined characteristics of particles are given. The normal and lognormal particle size distributions are discussed. Shape factors interrelating characteristics are explained. Experimental techniques for the characterisation of an aerosol are discussed, as well as the instruments that have been used in this study; namely the Andersen impactor, point-to-plane electrostatic precipitator and the Pollak counter. Uranium swarf was made to burn with a heated filament, and the resulting aerosol was measured. Optical and electron microscopy have been used for the determination of the projected area diameters, and the aerodynamic diameters have been determined with the impactor. The uranium fire aerosol can be represented by a bimodal, or monomodal, lognormal particle size distribution depending on the way in which the swarf burns. The determined activity median aerodynamic diameter of the two peaks were 0,49μm and 6,0μm respectively [af
Further training in the fields of radiological characterisation and clearance
International Nuclear Information System (INIS)
Bothe, M.; Feinhals, J.; Neukaeter, E.
2016-01-01
Radiological characterisation and clearance require specific knowledge and skills. Targeted further training of the staff is one possibility to get this knowledge and skills. A modular concept was established, which allows adaption to specific requests of the institution and state of knowledge and skills of participants. The modules have following focuses: ''radiological characterisation and clearance'', ''sampling'' and ''measurement and sampling plans'' and consist half-and-half of lectures and group works. In group works participants apply new knowledge to examples of the installation or simulated scenarios and afterwards they present and discuss the results. This concept was carried out for different institutions and is planned for some more.
Synthesis and Characterisation of Eight Isomeric Bis(2-pyridyloxynaphthalenes
Directory of Open Access Journals (Sweden)
Peter J. Steel
2006-09-01
Full Text Available Eight isomeric bis(2-pyridyloxynaphthalenes have been prepared from reactions of 2-bromopyridine with the appropriate dihydroxynaphthalene and the products fully characterised by 1- and 2-D NMR spectroscopy.
Workplace Field Characterisation at Chernobyl Unit 4 Shelter
International Nuclear Information System (INIS)
Chumak, V.; Bakhanova, E.; Volosky, V.; Shylo, S.; Chernyshov, G.; Dmitrienko, A.; Rozumny, V.
2001-01-01
Full text: When assessment of effective dose is required, radiation field needs to be characterised in terms of energy spectrum and geometry of exposure. Prior to application of pre-calculated (e.g. ICRP 74) or site-specific conversion coefficients, one need to demonstrate compliance with one of standard irradiation geometries and determine appropriate energy (or energy spectrum). Particular conditions of the entombment of Chernobyl Unit 4 (Object 'Shelter') high dose rate fields, complex source-target geometry, presence of heavy shielding structures and, as a result, significant scattered component in radiation field make application of conventional area monitoring instruments like in situ spectrometers complicated if possible at all. Unique techniques and devices were developed for workplace field characterisation at Object 'Shelter'. The set of devices includes passive spectrometric system, which makes use of simultaneous exposing several TLD detectors placed inside spherical attenuators (principle much similar to Bonner sphere neutron spectroscopy). Deconvolution of gamma spectra is performed through solving a system of simultaneous linear equations. Geometry of irradiation at given workplace is determined by TLD detectors placed in the six-vector collimator. This simple device allows determination of anisotropy of radiation field, both horizontal and vertical. Another design incorporates portable gamma spectrometer with 1'x2' NaI detector placed in the specially designed lead-copper collimator with aperture compatible with the one of the described above six-vector passive system. The discussed experimental set-up was extensively tested in various locations within Object 'Shelter'. Results of both energy spectrum and exposure geometry characterisation demonstrated feasibility of the proposed approach. (author)
Media Culture and Media Education in Modern School
Tolic, Mirela
2011-01-01
Culture is no longer conceivable without the media and/or new phenomena called. "Cyber" culture. The article discusses issues in what respect the different media, like TV, film and Internet are with different cultures, how it changes everyday life under influence of various forms of sophisticated communications media and what…
In-flight scalar calibration and characterisation of the Swarm magnetometry package
DEFF Research Database (Denmark)
Tøffner-Clausen, Lars; Lesur, Vincent; Olsen, Nils
2016-01-01
of magnetometers is demonstrated, confirming the high performance of these instruments. The results presented here, including the characterisation of a Sun-driven disturbance field, form the basis of the correction of the magnetic vector measurements from Swarm which is applied to the Swarm Level 1b magnetic data.......We present the in-flight scalar calibration and characterisation of the Swarm magnetometry package consisting of the absolute scalar magnetometer, the vector magnetometer, and the spacecraft structure supporting the instruments. A significant improvement in the scalar residuals between the pairs...
Ashu-Arrah, Benjamin A; Glennon, Jeremy D
2017-06-09
This research reports supercritical carbon dioxide versus toluene as reaction media in silica functionalisation for use in liquid chromatography. Bonded aminopropyl silica (APS) intermediates were prepared when porous silica particles (Exsil-pure, 3μm) were reacted with 3-aminopropyltriethoxysilane (3-APTES) or N,N-dimethylaminopropyltrimethoxysilane (DMAPTMS) using supercritical carbon dioxide (sc-CO 2 ) and toluene as reaction media. Covalent bonding to silica was confirmed using elemental microanalysis (CHN), thermogravimetric analysis (TGA), zeta potential (ξ), diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy, scanning electron microscopy (SEM) and solid-state nuclear magnetic resonance (CP/MAS NMR) spectroscopy. The results demonstrate that under sc-CO 2 conditions of 100°C/414bar in a substantial reduced time of 3h, the surface coverage of APS (evaluated from%C obtained from elemental analysis) prepared with APTES (%C: 8.03, 5.26μmol/m -2 ) or DMAPTES (%C: 5.12, 4.58μmol/m 2 ) is somewhat higher when compared to organic based reactions under reflux in toluene at a temperature of 110°C in 24h with APTES (%C: 7.33, 4.71μmol/m 2 ) and DMAPTMS (%C: 4.93, 4.38μmol/m 2 ). Zeta potential measurements revealed a change in electrostatic surface charge from negative values for bare Exsil-pure silica to positive for functionalised APS materials indicating successful immobilization of the aminosilane onto the surface of silica. Copyright © 2017 Elsevier B.V. All rights reserved.
Characterisation of North American Brucella isolates from marine mammals.
Whatmore, Adrian M; Dawson, Claire; Muchowski, Jakub; Perrett, Lorraine L; Stubberfield, Emma; Koylass, Mark; Foster, Geoffrey; Davison, Nicholas J; Quance, Christine; Sidor, Inga F; Field, Cara L; St Leger, Judy
2017-01-01
Extension of known ecological niches of Brucella has included the description of two novel species from marine mammals. Brucella pinnipedialis is associated predominantly with seals, while two major Brucella ceti clades, most commonly associated with porpoises or dolphins respectively, have been identified. To date there has been limited characterisation of Brucella isolates obtained from marine mammals outside Northern European waters, including North American waters. To address this gap, and extend knowledge of the global population structure and host associations of these Brucella species, 61 isolates from marine mammals inhabiting North American waters were subject to molecular and phenotypic characterisation enabling comparison with existing European isolates. The majority of isolates represent genotypes previously described in Europe although novel genotypes were identified in both B. ceti clades. Harp seals were found to carry B. pinnipedialis genotypes previously confined to hooded seals among a diverse repertoire of sequence types (STs) associated with this species. For the first time Brucella isolates were characterised from beluga whales and found to represent a number of distinct B. pinnipedialis genotypes. In addition the known host range of ST27 was extended with the identification of this ST from California sea lion samples. Finally the performance of the frequently used diagnostic tool Bruce-ladder, in differentiating B. ceti and B. pinnipedialis, was critically assessed based on improved knowledge of the global population structure of Brucella associated with marine mammals.
Post Media Literacy: Menyaksikan Kuasa Media Bersama Michel Foucault
Directory of Open Access Journals (Sweden)
Iswandi Syahputra
2017-01-01
Full Text Available This article would like to present Michel Foucault’s idea concerning Knowledge and Power in media industry. As a contemporary intellectual, Foucault’s thought has a unique style of postmodernism. His thought had gone beyond traditional critical theory whose trying to disclose the relation of power and economic behind the ideology of media. Foucault’s thought had given new perspective in understanding how the media produce truth under tightly control process into something that seems normal. With the assumption of media has the power to create mass culture, which has to be studied critically by media literacy approach, Foucault’s thought had given new space of discursive. An alternative thought on how to estimate the work of mass media as supervisor of truth and creator of information trough normalization practice.
Wilken, Rowan
2014-01-01
Not only is locative media one of the fastest growing areas in digital technology, but questions of location and location-awareness are increasingly central to our contemporary engagements with online and mobile media, and indeed media and culture generally. This volume is a comprehensive account of the various location-based technologies, services, applications, and cultures, as media, with an aim to identify, inventory, explore, and critique their cultural, economic, political, social, and policy dimensions internationally. In particular, the collection is organized around the perception that the growth of locative media gives rise to a number of crucial questions concerning the areas of culture, economy, and policy.
Physicochemical characterisation of hexanic seed oil extract from ...
African Journals Online (AJOL)
The physicochemical characterisation of oil extracts from Schinus molle seeds collected in South Africa was performed. The oils were extracted in hexane, physicochemical parameters determined and lipids profiled by gas chromatography, in order to determine its potential for use in industry, ethnomedicine and its ...
Characterisation of tectonic lineaments in the Central Equatorial ...
African Journals Online (AJOL)
Characterisation of tectonic lineaments in the Central Equatorial Atlantic region of Africa using Bouguer anomaly gravity data. ... Ife Journal of Science ... 3-D standard Euler deconvolution analysis was carried out on Bouguer anomaly gravity data for configuration definition and approximate depth estimate of tectonic ...
DEFF Research Database (Denmark)
2002-01-01
, food and feed preparations, tissue extracts, acyl-CoA synthetase reaction media and various laboratory conditions using a modified Coenzyme A- and acyl-CoA binding protein (ACBP) is provided. Furthermore the invention relates to a construct comprising a peptide and a signal moiety for performing...
Fedorov, Alexander
2008-01-01
This monograph analyzes the theory and practice of media education and media literacy. The book also includes the list of Russian media education literature and addresses of websites of the associations for media education.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Isolation and characterisation of barium sulphate and titanium oxides in monument crusts
Energy Technology Data Exchange (ETDEWEB)
Luis Perez-Rodriguez, Jose; Carmen Jimenez de Haro, Maria del; Maqueda, Celia
2004-10-25
Black crusts from historical ornamental materials contain Ba and Ti. These elements are in low proportion, making their determination difficult and especially the characterisation of the phases in which they are present. For this reason, works on the mineralogical composition of the two elements in black crusts is scarce. Thus the isolation, previous to their characterisation, is important for the study of the surface layer in altered monuments. An acid attack for the isolation of barium sulphate and titanium oxides in black crusts from polluted areas has been used. The acid employed is a mixture of HF, HNO{sub 3} and HClO{sub 4}. The residue isolated by acid attack was analysed by energy dispersive X-ray fluorescence and X-ray diffraction. It was characterised, and the percentages of barite (barium sulphate), anatase (titanium oxide), and rutile (titanium oxide) phases present in the surface layers were calculated.
Characterisation of hydrides in a zirconium alloy, by EBSD
International Nuclear Information System (INIS)
Ubhi, H.S.; Larsen, K.
2012-01-01
Zirconium alloys are used in nuclear reactors owing to their low capture cross-section for thermal neutrons and good mechanical and corrosion properties. However, they do suffer from delayed hydrogen cracking (DHC) due to formation of hydride particles. This study shows how the electron back-scatter diffraction (EBSD) technique can be used to characterise hydrides and their orientation relationship with the matrix. Hydrided EB weld specimens were prepared by electro-polishing, characterised using Oxford instruments AZtecHKL EBSD apparatus and software attached to a FEG SEM. Hydrides were found to exist as fine intra granular plates and having the Blackburn orientation relationship, i.e. (0002)Zr//(111)hydride and (1120)Zr//(1-10)hydride. The hydrides were also found to contain sigma 3 boundaries as well as local misorientations. (author)
Physico-chemical characterisation of material fractions in household waste
DEFF Research Database (Denmark)
Götze, Ramona; Boldrin, Alessio; Scheutz, Charlotte
2016-01-01
State-of-the-art environmental assessment of waste management systems rely on data for the physico-chemical composition of individual material fractions comprising the waste in question. To derive the necessary inventory data for different scopes and systems, literature data from different sources...... and backgrounds are consulted and combined. This study provides an overview of physico-chemical waste characterisation data for individual waste material fractions available in literature and thereby aims to support the selection of data fitting to a specific scope and the selection of uncertainty ranges related...... to the data selection from literature. Overall, 97 publications were reviewed with respect to employed characterisation method, regional origin of the waste, number of investigated parameters and material fractions and other qualitative aspects. Descriptive statistical analysis of the reported physico...
Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M
2016-03-14
Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.
Hydraulic and hydrochemical characterisation of argillaceous rocks
International Nuclear Information System (INIS)
1995-01-01
Throughout the OECD member countries many national programmes on radioactive waste management are considering geological disposal in argillaceous media. In order to determine their suitability for waste disposal, evaluations and understanding of basic physical and chemical processes that govern radionuclides transport through these formations are required. Clay-rich media have a very marked capacity to retard the movement of radionuclides by sorption, filtration and other mechanisms. However, a complicating factor to make quantitative predictions of the performance of clay barriers is our incomplete knowledge of the mechanisms of groundwater and solute transport in compact clays. Application of hydraulic testing and groundwater sampling methods to low and very low permeability rocks, and in particular to argillaceous media, requires modifications in equipment, testing procedures, and interpretation methods. In this context, the NEA Coordinating Group on Site Evaluation and Design of Experiments for Radioactive Waste Disposal (SEDE) established the NEA Working Group on Measurement and Physical Understanding of Groundwater Flow through Argillaceous Media (the Clay Club) to address the many issues associated with this subject. The workshop on hydraulic and hydrochemical characteristics of argillaceous media was hosted by the British Geological Survey in Keyworth, United Kingdom, on 7-9 June 1994
Spatial distribution and habitat characterisation of mosquito species ...
African Journals Online (AJOL)
Background: Infections with mosquito-borne parasites are common in human populations inhabiting tropical regions of the world. Malaria is endemic along Kenyan Lake Victoria basin and its vectors are fresh water breeders. However, much less is known about the current spatial distribution and habitat characterisation of ...
More Media, More People—On Social & Multimodal Media Intelligence
Degerstedt, Lars; Pelle, Snickars
2017-01-01
The purpose of this article is to address some challenges facing media intelligence in general, and competitive intelligence in particular within an altered information landscape. To understand this new situation, the notion of social and multimodal media intelligence are introduced. With cases taken primarily from the Swedish media intelligence sector, we argue that data driven media intelligence today needs to pay increasing attention to new forms of (A.) crowd-oriented and (B.) multimedia-...
Geophysical characterisation of the groundwater-surface water interface
McLachlan, P. J.; Chambers, J. E.; Uhlemann, S. S.; Binley, A.
2017-11-01
Interactions between groundwater (GW) and surface water (SW) have important implications for water quantity, water quality, and ecological health. The subsurface region proximal to SW bodies, the GW-SW interface, is crucial as it actively regulates the transfer of nutrients, contaminants, and water between GW systems and SW environments. However, geological, hydrological, and biogeochemical heterogeneity in the GW-SW interface makes it difficult to characterise with direct observations. Over the past two decades geophysics has been increasingly used to characterise spatial and temporal variability throughout the GW-SW interface. Geophysics is a powerful tool in evaluating structural heterogeneity, revealing zones of GW discharge, and monitoring hydrological processes. Geophysics should be used alongside traditional hydrological and biogeochemical methods to provide additional information about the subsurface. Further integration of commonly used geophysical techniques, and adoption of emerging techniques, has the potential to improve understanding of the properties and processes of the GW-SW interface, and ultimately the implications for water quality and environmental health.
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
Energy Technology Data Exchange (ETDEWEB)
Gangi Setty, Thanuja [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Cho, Christine [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Govindappa, Sowmya [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India); Apicella, Michael A. [Carver College of Medicine, University of Iowa, Iowa City, IA 52242-1109 (United States); Ramaswamy, S., E-mail: ramas@instem.res.in [Institute for Stem Cell Biology and Regenerative Medicine, NCBS Campus, GKVK Post, Bangalore, Karnataka 560 065 (India)
2014-07-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.
Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site
International Nuclear Information System (INIS)
Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.
2014-01-01
Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states
Quantitative characterisation of complexity and predictability
International Nuclear Information System (INIS)
Badii, R.
1990-04-01
A measure of complexity for sequentially created symbolic patterns is introduced. The underlying grammatical rules are systematically detected in terms of variable-length prefix-free codewords and arranged on a 'logic' tree. Predictions on the scaling structure of the system are then formulated and compared with the observation. The discrepancy between the two, evaluated through a generalisation of the information gain, characterises the complexity of the system, relative to the unfolding scheme. (author) 1 fig., 20 refs
PENGEMBANGAN MEDIA PEMBELAJARAN FILM ANIMASI SEBAGAI MEDIA PEMBELAJARAN KONSEP FOTOSINTESIS
Directory of Open Access Journals (Sweden)
Umrotul Hasanah
2015-11-01
Full Text Available The research aims to develop animation film as a learning media in photosynthesis concept learning and to know the results of the assessment of the learning media expert test the concept of photosynthesis animated films. This research is Research and Development (R&D. The research used questionnaire Aspects of assessment in terms of the media covering aspects of technical quality, narration, and music/sound effects. Aspects of the assessment of the suitability of the material terms covering the material aspects of the curriculum, the clarity of the material, the order of the material, communicative, suitability of the material with the purpose of learning, material relationship with the students’ critical thinking skill, and material relationship with motivation. Media expert test against “Cahaya dan Fotosintesis” animated film made by media experts with a percentage of 80,6% with the as good category, and 92,5% are material expert excellent category. Based on the “Cahaya dan Fotosintesis” animated film expert test to students can be tasted on a limited basis, after the media deficiencies corrected. Penelitian ini bertujuan untuk mengembangkan media pembelajaran film animasi pada konsep fotosintesis dan untuk mengetahui hasil penilaian uji ahli terhadap media pembelajaran film animasi pada konsep fotosintesis. Penelitian ini merupakan penelitian research and development (R & D. Teknik pengumpulan data dengan menggunakan angket. Aspek penilaian dari segi media meliputi aspek kualitas teknik, narasi dan musik/efek suara. Aspek penilaian dari segi materi meliputi aspek kesesuaian materi dengan kurikulum, kejelasan materi, urutan materi, komunikatif, kesesuaian soal evaluasi, kesesuaian materi dengan tujuan pembelajaran, hubungan materi dengan kemampuan berpikir kritis dan hubungan materi dengan motivasi. Uji ahli terhadap media film animasi “Cahaya dan Fotosintesis” dilakukan oleh ahli media dengan perolehan persentse 80,6% dengan
Abu-Reidah, Ibrahim M; Arráez-Román, David; Segura-Carretero, Antonio; Fernández-Gutiérrez, Alberto
2013-12-01
The aim of this work was to characterise the phenolic compounds in artichoke (hearts) by using HPLC coupled to DAD-ESI-QTOF-MS, which proved useful in characterising 61 phenolic and other polar compounds. Notably, of the 61 compounds characterised, 34 new phenolic compounds with their isomers have been tentatively characterised in artichoke for the first time, namely: 3 hydroxybenzoic acids, 17 hydroxycinnamic acids, 4 lignans, 7 flavones, 2 flavonols, and 1 phenol derivative. Moreover, a total of 28 isomers of previously described phenolics have also been detected. The data compiled from the qualitative polyphenol characterisation indicate that the artichoke extract analysed (Blanca de Tudela variety) could be regarded as a bioactive functional food and also as a promising source of antioxidant phenolic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.
[3]tetrahydrotrazodone binding. Association with serotonin binding sites
International Nuclear Information System (INIS)
Kendall, D.A.; Taylor, D.P.; Enna, S.J.
1983-01-01
High (17 nM) and low (603 nM) affinity binding sites for [ 3 ]tetrahydrotrazodone ([ 3 ] THT), a biologically active analogue of trazodone, have been identified in rat brain membranes. The substrate specificity, concentration, and subcellular and regional distributions of these sites suggest that they may represent a component of the serotonin transmitter system. Pharmacological analysis of [ 3 ]THT binding, coupled with brain lesion and drug treatment experiments, revealed that, unlike other antidepressants, [ 3 ] THT does not attach to either a biogenic amine transporter or serotonin binding sites. Rather, it would appear that [ 3 ]THT may be an antagonist ligand for the serotonin binding site. This probe may prove of value in defining the mechanism of action of trazodone and in further characterizing serotonin receptors
International Nuclear Information System (INIS)
Zampieron, Joao Vicente
2002-01-01
The powder injection moulding process is a recent technology, which offers as advantages a high production of complex geometry metal parts, with low cost, where secondary operations of machinery are unnecessary. The main of this thesis was centered on a coarse powders feedstock injection. The process begins with the composition of the mass, that is the combination of metal powders with organic binders. The following steps succeed injection in moulds, debinding, sintering and, if necessary, cleaning. For the formulation of the feedstock it is indispensable the characterisation of the powders. This is little mentioned in the open literature and brings up controversy among authors. At first, a series of powders characterisations of AISI 316 L stainless steel (below 25 μm) was adopted. The next step was to characterise the rheological behaviour of the feedstock using different rheological apparatus, so as to find the most appropriate equipment to the low-pressure powder injection molding process. The mass has to present a favourable rheological behaviour, which is low viscosity. The results of the physical characterisation were correlated among themselves and with the rheological characterisation. This was undertaken with the purpose of finding agreement among their values. Finally, the possibility of injection of water and gas atomised stainless steel coarse powders feedstock was studied. This presents as main advantage, the reduction of costs for the process. According to the literature, only powders with size below 25 μm are possible to be injected. Hence, starting from the physical characterisation of particles and rheological characterisation of the feedstock, the formulation of an appropriate mass was found for the coarse powders. These coarse powders were characterised by particles below 45 μm. In this case it was necessary to alter drastically the feedstock composition, using high amounts of wax, which lead to unstable rheological conditions. But, it was
The hydrological characterisation and water budget of a South ...
African Journals Online (AJOL)
The hydrological characterisation and water budget of a South African rehabilitated ... Hydrograph separation, based on stable isotopes (18O), revealed that the ... during the summer rains when the wetlands soil moisture deficit is close to 0, ...
Dynamics of foam flow in porous media in the presence of oil
Shokri, N.; Osei-Bonsu, K.
2016-12-01
Foams demonstrate great potential for fluid displacement in porous media which is important in a number of subsurface operations such as the enhanced oil recovery and soil remediation. The application of foam in these processes is down to its unique ability to reduce gas mobility by increasing its effective viscosity and to divert gas to un-swept low permeability zones in porous media [1-4]. To investigate the fundamental aspects of foam flow in porous media, we have conducted a systematic series of experiment using a well-characterised porous medium manufactured by a high resolution 3D printer. This enabled us to design and control the properties of porous media with high accuracy. The model porous medium was initially saturated with oil. Then the pre-generated foam was injected into the model at well-defined injection rates to displace oil. The dynamics of foam-oil displacement in porous media was recorded using a digital camera controlled by a computer [5]. The recorded images were analysed in MATLAB to determine the dynamics of foam-oil displacement under different boundary conditions. Effects of the type of oil, foam quality and foam flow rate were investigated. Our results reveal that generation of stable foam is delayed in the presence of light oil in the porous medium compared to the heavy oil. Furthermore, higher foam quality appears to be less stable in the presence of oil lowering its recovery efficiency. Pore-scale inspection of foam-oil patterns formed during displacement revealed formation of a more stable front in the case of lower foam quality which affected the oil recovery efficiency. This study extends the physical understanding of governing mechanisms controlling oil displacement by foam in porous media. Grassia, P., E. Mas-Hernandez, N. Shokri, S.J. Cox, G. Mishuris, W.R. Rossen (2014), J. Fluid Mech., 751, 346-405. Grassia, P., C. Torres-Ulloa, S. Berres, E. Mas-Hernandez, N. Shokri (2016), European Physical Journal E, 39 (4), 42. Mas
DEFF Research Database (Denmark)
Etter, Michael Andreas; Ravasi, Davide; Colleoni, Elanor
motivational drivers and contextual conditions associated with the formation of narratives in traditional news media and social media influence their content, diffusion, and impact significantly. Our analysis suggests that current theories of media reputation may provide an incomplete representation......Social media enable millions of users to create and disseminate narratives about organizations that increase their public exposure and shape public perceptions. In this paper, we draw on the sociology of news production and research on computer-mediated communication to discuss how different...... of the phenomenon, and highlight theoretically relevant differences and interrelationships between reputational dynamics involving news media and social media....
DEFF Research Database (Denmark)
Borel, Peter Ingo; Frandsen, Lars Hagedorn; Lavrinenko, Andrei
2006-01-01
We have characterised photonic-crystal and photonic-wire waveguides fabricated by thermal nanoimprint lithography. The structures, with feature sizes down below 20 nm, are benchmarked against similar structures defined by direct electron beam lithography.......We have characterised photonic-crystal and photonic-wire waveguides fabricated by thermal nanoimprint lithography. The structures, with feature sizes down below 20 nm, are benchmarked against similar structures defined by direct electron beam lithography....
International Nuclear Information System (INIS)
Mullice, L.A.; Buurma, N.J.; Pope, S.J.A.; Laye, R.H.; Harding, L.P.
2008-01-01
The syntheses of two chromophore-appended dipicolylamine-derived ligands and their reactivity with penta-carbonyl-chloro-rhenium have been studied. The resultant complexes each possess the fac-Re(CO) 3 core. The ligands L 1 1-[bis(pyridine-2-yl-methyl)amino]methyl-pyrene and L 2 2-[bis(pyridine-2-yl-methyl)amino]methyl-quinoxaline were isolated via a one-pot reductive amination in moderate yield. The corresponding rhenium complexes were isolated in good yields and characterised by 1 H NMR, MS, IR and UV-Vis studies. X-Ray crystallographic data were obtained for fac-{Re(CO) 3 (L 1 )}(BF 4 ), C 34 H 26 BF 4 N 4 O 3 Re: monoclinic, P2(1)/c, a 18.327(2) Angstroms, α = 90.00 degrees, b 14.1537(14) Angstroms, β96.263(6) degrees, c = 23.511(3) Angstroms, γ 90.00 Angstroms, 6062.4(11) (Angstroms) 3 , Z=8. The luminescence properties of the ligands and complexes were also investigated, with the emission attributed to the appended chromophore in each case. Isothermal titration calorimetry suggests that fac-{Re(CO) 3 (L 1 )}(BF 4 ) self-aggregates cooperatively in aqueous solution, probably forming micelle-like aggregates with a cmc of 0.18 mM. Investigations into the DNA-binding properties of fac-{Re(CO) 3 (L 1 )}(BF 4 ) were undertaken and revealed that fac-{Re(CO) 3 (L 1 )}(BF 4 ) binding to fish sperm DNA (binding constant 1.5 ± 0.2 * 10 5 M -1 , binding site size 3.2 ± 0.3 base pairs) is accompanied by changes in the UV-Vis spectrum as typically observed for pyrene-based intercalators while the calorimetrically determined binding enthalpy (-14 ± 2 kcal mol -1 ) also agrees favourably with values as typically found for intercalators. (authors)
AMAMM - All Media Are Mixed Media
DEFF Research Database (Denmark)
All Media Are Mixed Media Alle medier er blandingsmedier. Alle kunstarter er kompositte. Alle sanser er sammensatte. Alle medialiteter er miksede og mangfoldige. Alle er AMAMM. Denne påstand står centralt i ord-, billed- og medie-teoretikeren W.J.T. Mitchells forfatterskab. I hosstående bog tager...
Characterisation of North American Brucella isolates from marine mammals.
Directory of Open Access Journals (Sweden)
Adrian M Whatmore
Full Text Available Extension of known ecological niches of Brucella has included the description of two novel species from marine mammals. Brucella pinnipedialis is associated predominantly with seals, while two major Brucella ceti clades, most commonly associated with porpoises or dolphins respectively, have been identified. To date there has been limited characterisation of Brucella isolates obtained from marine mammals outside Northern European waters, including North American waters. To address this gap, and extend knowledge of the global population structure and host associations of these Brucella species, 61 isolates from marine mammals inhabiting North American waters were subject to molecular and phenotypic characterisation enabling comparison with existing European isolates. The majority of isolates represent genotypes previously described in Europe although novel genotypes were identified in both B. ceti clades. Harp seals were found to carry B. pinnipedialis genotypes previously confined to hooded seals among a diverse repertoire of sequence types (STs associated with this species. For the first time Brucella isolates were characterised from beluga whales and found to represent a number of distinct B. pinnipedialis genotypes. In addition the known host range of ST27 was extended with the identification of this ST from California sea lion samples. Finally the performance of the frequently used diagnostic tool Bruce-ladder, in differentiating B. ceti and B. pinnipedialis, was critically assessed based on improved knowledge of the global population structure of Brucella associated with marine mammals.
Parents and the media: causes and consequences of parental media socialization
Notten, N.J.W.R.
2011-01-01
Media literacy is an important part of socialization and with media use becoming ever more essential in modern society, research on parental media socialization is vital. This study proposes the intergenerational transmission of parent’s media competencies, as a specific kind of cultural
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Characterisation of Oil-Gas Mixtures by Raman Spectroscopy
DEFF Research Database (Denmark)
Hansen, Susanne Brunsgaard; Berg, Rolf W.; Stenby, Erling Halfdan
2004-01-01
. The present project deals with development of a technique for quick analysis of oil-gas mixtures. The main emphasis is laid on characterisation of gas phases in equilibrium with oil at high pressures and high temperatures by Raman spectroscopy. The Raman technique has a great potential of being useful, due...
Duncan, Barry
1989-01-01
Provides an up-to-date bibliography of resources available for teaching media literacy. Groups resources into the areas of media education methodology, mass media texts, general background, television, film, the news and medium of print, advertising, gender and the media, popular culture, popular music and rock video, periodicals, and…
Interference of medical contrast media on laboratory testing.
Lippi, Giuseppe; Daves, Massimo; Mattiuzzi, Camilla
2014-01-01
The use of contrast media such as organic iodine molecules and gadolinium contrast agents is commonplace in diagnostic imaging. Although there is widespread perception that side effects and drug interactions may be the leading problems caused by these compounds, various degrees of interference with some laboratory tests have been clearly demonstrated. Overall, the described interference for iodinate contrast media include inappropriate gel barrier formation in blood tubes, the appearance of abnormal peaks in capillary zone electrophoresis of serum proteins, and a positive bias in assessment of cardiac troponin I with one immunoassay. The interference for gadolinium contrast agents include negative bias in calcium assessment with ortho-cresolphthalein colorimetric assays and occasional positive bias using some Arsenazo reagents, negative bias in measurement of angiotensin converting enzyme (ACE) and zinc (colorimetric assay), as well as positive bias in creatinine (Jaffe reaction), total iron binding capacity (TIBC, ferrozine method), magnesium (calmagite reagent) and selenium (mass spectrometry) measurement. Interference has also been reported in assessment of serum indices, pulse oximetry and methaemoglobin in samples of patients receiving Patent Blue V. Under several circumstances the interference was absent from manufacturer-supplied information and limited to certain type of reagents and/or analytes, so that local verification may be advisable to establish whether or not the test in use may be biased. Since the elimination half-life of these compounds is typically lower than 2 h, blood collection after this period may be a safer alternative in patients who have received contrast media for diagnostic purposes.
Directory of Open Access Journals (Sweden)
Chaban Christina
2010-11-01
Full Text Available Abstract Background About 10% of all genes in eukaryote genomes are predicted to encode transcription factors. The specific binding of transcription factors to short DNA-motifs influences the expression of neighbouring genes. However, little is known about the DNA-protein interaction itself. To date there are only a few suitable methods to characterise DNA-protein-interactions, among which the EMSA is the method most frequently used in laboratories. Besides EMSA, several protocols describe the effective use of an ELISA-based transcription factor binding assay e.g. for the analysis of human NFκB binding to specific DNA sequences. Results We provide a unified protocol for this type of ELISA analysis, termed DNA-Protein-Interaction (DPI-ELISA. Qualitative analyses with His-epitope tagged plant transcription factors expressed in E. coli revealed that EMSA and DPI-ELISA result in comparable and reproducible data. The binding of AtbZIP63 to the C-box and AtWRKY11 to the W2-box could be reproduced and validated by both methods. We next examined the physical binding of the C-terminal DNA-binding domains of AtWRKY33, AtWRKY50 and AtWRKY75 to the W2-box. Although the DNA-binding domain is highly conserved among the WRKY proteins tested, the use of the DPI-ELISA discloses differences in W2-box binding properties between these proteins. In addition to these well-studied transcription factor families, we applied our protocol to AtBPC2, a member of the so far uncharacterised plant specific Basic Pentacysteine transcription factor family. We could demonstrate binding to GA/TC-dinucleotide repeat motifs by our DPI-ELISA protocol. Different buffers and reaction conditions were examined. Conclusions We successfully applied our DPI-ELISA protocol to investigate the DNA-binding specificities of three different classes of transcription factors from Arabidopsis thaliana. However, the analysis of the binding affinity of any DNA-binding protein to any given DNA
Characterisation of metal combustion with DUST code
Energy Technology Data Exchange (ETDEWEB)
García-Cascales, José R., E-mail: jr.garcia@upct.es [DITF, ETSII, Universidad Politécnica de Cartagena, Dr Fleming s/n, 30202 Murcia (Spain); Velasco, F.J.S. [Centro Universitario de la Defensa de San Javier, MDE-UPCT, C/Coronel Lopez Peña s/n, 30730 Murcia (Spain); Otón-Martínez, Ramón A.; Espín-Tolosa, S. [DITF, ETSII, Universidad Politécnica de Cartagena, Dr Fleming s/n, 30202 Murcia (Spain); Bentaib, Ahmed; Meynet, Nicolas; Bleyer, Alexandre [Institut de Radioprotection et Sûreté Nucléaire, BP 17, 92260 Fontenay-aux-Roses (France)
2015-10-15
Highlights: • This paper is part of the work carried out by researchers of the Technical University of Cartagena, Spain and the Institute of Radioprotection and Nuclear Security of France. • We have developed a code for the study of mobilisation and combustion that we have called DUST by using CAST3M, a multipurpose software for studying many different problems of Mechanical Engineering. • In this paper, we present the model implemented in the code to characterise metal combustion which describes the combustion model, the kinetic reaction rates adopted and includes a first comparison between experimental data and calculated ones. • The results are quite promising although suggest that improvement must be made on the kinetic of the reaction taking place. - Abstract: The code DUST is a CFD code developed by the Technical University of Cartagena, Spain and the Institute of Radioprotection and Nuclear Security, France (IRSN) with the objective to assess the dust explosion hazard in the vacuum vessel of ITER. Thus, DUST code permits the analysis of dust spatial distribution, remobilisation and entrainment, explosion, and combustion. Some assumptions such as particle incompressibility and negligible effect of pressure on the solid phase make the model quite appealing from the mathematical point of view, as the systems of equations that characterise the behaviour of the solid and gaseous phases are decoupled. The objective of this work is to present the model implemented in the code to characterise metal combustion. In order to evaluate its ability analysing reactive mixtures of multicomponent gases and multicomponent solids, two combustion problems are studied, namely H{sub 2}/N{sub 2}/O{sub 2}/C and H{sub 2}/N{sub 2}/O{sub 2}/W mixtures. The system of equations considered and finite volume approach are briefly presented. The closure relationships used are commented and special attention is paid to the reaction rate correlations used in the model. The numerical
Coyne, Sarah M; Radesky, Jenny; Collier, Kevin M; Gentile, Douglas A; Linder, Jennifer Ruh; Nathanson, Amy I; Rasmussen, Eric E; Reich, Stephanie M; Rogers, Jean
2017-11-01
Understanding the family dynamic surrounding media use is crucial to our understanding of media effects, policy development, and the targeting of individuals and families for interventions to benefit child health and development. The Families, Parenting, and Media Workgroup reviewed the relevant research from the past few decades. We find that child characteristics, the parent-child relationship, parental mediation practices, and parents' own use of media all can influence children's media use, their attitudes regarding media, and the effects of media on children. However, gaps remain. First, more research is needed on best practices of parental mediation for both traditional and new media. Ideally, this research will involve large-scale, longitudinal studies that manage children from infancy to adulthood. Second, we need to better understand the relationship between parent media use and child media use and specifically how media may interfere with or strengthen parent-child relationships. Finally, longitudinal research on how developmental processes and individual child characteristics influence the intersection between media and family life is needed. The majority of children's media use takes place within a wider family dynamic. An understanding of this dynamic is crucial to understanding child media use as a whole. Copyright © 2017 by the American Academy of Pediatrics.
Social Media, Traditional Media and Marketing Communication of Public Relations
DEFF Research Database (Denmark)
Khajeheian, Datis; Mirahmadi, Fereshteh
2015-01-01
Public relations are undertaking more important role in the marketing communication and advertising. The present paper reports a survey conducted in three Iranian banks’ public relations departments to understand how they use different media in their marketing communications and other related...... functions. A classification of public relations functions including fourteen functions in three categories has taken as research framework and by using a questionnaire, eight media have been asked to rank for each function, includes Television, Radio, Newspaper, Magazine, Classified Ads, Internet Websites......, Social media and finally Mobile and SMS ads. Findings show that traditional media still play a dominant role in media consumption of public relations, while new Web2.0 media consist of Mobile communications and Social networks, have never ranked better than fifth from eight. Some reasons have been argues...
Aabenhus, Rune; Hansen, Malene Plejdrup; Saust, Laura Trolle; Bjerrum, Lars
2017-05-19
Inappropriate use of antibiotics is contributing to the increasing rates of antimicrobial resistance. Several Danish guidelines on antibiotic prescribing for acute respiratory tract infections in general practice have been issued to promote rational prescribing of antibiotics, however it is unclear if these recommendations are followed. We aimed to characterise the pattern of antibiotic prescriptions for patients diagnosed with acute respiratory tract infections, by means of electronic prescriptions, labeled with clinical indications, from Danish general practice. Acute respiratory tract infections accounted for 456,532 antibiotic prescriptions issued between July 2012 and June 2013. Pneumonia was the most common indication with 178,354 prescriptions (39%), followed by acute tonsillitis (21%) and acute otitis media (19%). In total, penicillin V accounted for 58% of all prescriptions, followed by macrolides (18%) and amoxicillin (15%). The use of second-line agents increased with age for all indications, and comprised more than 40% of the prescriptions in patients aged >75 years. Women were more often prescribed antibiotics regardless of clinical indication. This is the first Danish study to characterise antibiotic prescription patterns for acute respiratory tract infections by data linkage of clinical indications. The findings confirm that penicillin V is the most commonly prescribed antibiotic agent for treatment of patients with an acute respiratory tract infection in Danish general practice. However, second-line agents like macrolides and amoxicillin with or without clavulanic acid are overused. Strategies to improve the quality of antibiotic prescribing especially for pneumonia, acute otitis media and acute rhinosinusitis are warranted. TRACKING THE OVERUSE OF ANTIBIOTICS: Better adherence to guidelines for prescribing antibiotics for different respiratory tract infections are warranted in Danish general practice. The over-use of antibiotics, particularly so
Media - Our friends (improving our relationship with media)
International Nuclear Information System (INIS)
Stiopol, Mihaela; Bilegan, Iosif Constantin
2000-01-01
The paper will present the principles, goals and the steps followed in establishing media relationships. It will highlight the company' s activity developed over this year within the Romanian Public Information Programme in the nuclear field, in order to establish friendly relationship with media, as well as the conclusions we have reached in performing such an activity. In this moment, the way public receives the real information has a great impact on the future development of this alternative and the role of media is an essential one. So, we consider that the utility mission is to act promptly to transmit to the public complete and honest information with the help of this important segment which is media
Characterisation of Oyster Shell for Neutralisation of Bio- Leached ...
African Journals Online (AJOL)
Michael
2016-12-02
Dec 2, 2016 ... (Goodall et al., 2005; O'Connor and Dunne, 1994;. Kydros et al. ... while the gold is concentrated in the iron oxide (hemaetite) residue ..... leaching in the characterisation of complex gold ores” ... Australia, 413 pp. O'Connor ...
International Nuclear Information System (INIS)
Holland, T.R.; Lee, D.J.
1985-09-01
Progress is reported in a programme to characterise both the sludge wastes generated during operation and maintenance of the Winfrith SGHWR, and the solidified end product after cementation. The main programme includes the preparation of more representative simulant sludges, the effect of scale on process parameters and product properties, continued tests on cemented sludge, the active demonstration of sludge homogenisation, sludge dewatering, the characterisation of homogenised active sludge and data evaluation and report presentation. (UK)
Mannose-Binding Lectin Binds to Amyloid Protein and Modulates Inflammation
Directory of Open Access Journals (Sweden)
Mykol Larvie
2012-01-01
Full Text Available Mannose-binding lectin (MBL, a soluble factor of the innate immune system, is a pattern recognition molecule with a number of known ligands, including viruses, bacteria, and molecules from abnormal self tissues. In addition to its role in immunity, MBL also functions in the maintenance of tissue homeostasis. We present evidence here that MBL binds to amyloid β peptides. MBL binding to other known carbohydrate ligands is calcium-dependent and has been attributed to the carbohydrate-recognition domain, a common feature of other C-type lectins. In contrast, we find that the features of MBL binding to Aβ are more similar to the reported binding characteristics of the cysteine-rich domain of the unrelated mannose receptor and therefore may involve the MBL cysteine-rich domain. Differences in MBL ligand binding may contribute to modulation of inflammatory response and may correlate with the function of MBL in processes such as coagulation and tissue homeostasis.
Annemarie Wennekers; Jos de Haan; Frank Huysmans
2016-01-01
Original title: Media:Tijd in kaart The Dutch spend a daily average of 8 hours 33 minutes using media. Men and people aged over 50 spend most time using media, at an average of 9 hours per day. Older media users prefer traditional media and devices over new media and modern devices. Young and
Directory of Open Access Journals (Sweden)
David Gauntlett
2015-12-01
Full Text Available This podcast is a recording of a research seminar that took place on December 3, 2015, at the University of Westminster's Communication and Media Research Institute (CAMRI. In this contribution, David Gauntlett discusses his new book, Making Media Studies, and other new work. In Making Media Studies (Peter Lang, 2015, Gauntlett proposes a vision of media studies based around doing and making – not about the acquisition of skills, as such, but an experience of building knowledge and understanding through creative hands-on engagement with all kinds of media. Gauntlett suggests that media studies scholars have failed to recognise the significance of everyday creativity – the vital drive of people to make, exchange, and learn together, supported by online networks. He argues that we should think about media in terms of conversations, inspirations, and making things happen. Media studies can be about genuine social change, he suggests, if we recognise the significance of everyday creativity, work to transform our tools, and learn to use them wisely. David Gauntlett is a Professor in the School of Media, Arts and Design at the University of Westminster, where he is also the School's Co-Director of Research. He is the author of several books, including: Creative Explorations (2007, Media, Gender and Identity: An Introduction (2nd edition 2008, Making is Connecting (2011, and Making Media Studies (2015. He has made a number of popular online resources, videos and playthings, and has pioneered creative research and workshop methods. He is external examiner for Information Experience Design at the Royal College of Art, London.
Studying User Income through Language, Behaviour and Affect in Social Media.
Preoţiuc-Pietro, Daniel; Volkova, Svitlana; Lampos, Vasileios; Bachrach, Yoram; Aletras, Nikolaos
2015-01-01
Automatically inferring user demographics from social media posts is useful for both social science research and a range of downstream applications in marketing and politics. We present the first extensive study where user behaviour on Twitter is used to build a predictive model of income. We apply non-linear methods for regression, i.e. Gaussian Processes, achieving strong correlation between predicted and actual user income. This allows us to shed light on the factors that characterise income on Twitter and analyse their interplay with user emotions and sentiment, perceived psycho-demographics and language use expressed through the topics of their posts. Our analysis uncovers correlations between different feature categories and income, some of which reflect common belief e.g. higher perceived education and intelligence indicates higher earnings, known differences e.g. gender and age differences, however, others show novel findings e.g. higher income users express more fear and anger, whereas lower income users express more of the time emotion and opinions.
Studying User Income through Language, Behaviour and Affect in Social Media.
Directory of Open Access Journals (Sweden)
Daniel Preoţiuc-Pietro
Full Text Available Automatically inferring user demographics from social media posts is useful for both social science research and a range of downstream applications in marketing and politics. We present the first extensive study where user behaviour on Twitter is used to build a predictive model of income. We apply non-linear methods for regression, i.e. Gaussian Processes, achieving strong correlation between predicted and actual user income. This allows us to shed light on the factors that characterise income on Twitter and analyse their interplay with user emotions and sentiment, perceived psycho-demographics and language use expressed through the topics of their posts. Our analysis uncovers correlations between different feature categories and income, some of which reflect common belief e.g. higher perceived education and intelligence indicates higher earnings, known differences e.g. gender and age differences, however, others show novel findings e.g. higher income users express more fear and anger, whereas lower income users express more of the time emotion and opinions.
Characterisations of Partition of Unities Generated by Entire Functions in Cd
DEFF Research Database (Denmark)
Christensen, Ole; Kim, Hong Oh; Kim, Rae Young
2017-01-01
Collections of functions forming a partition of unity play an important role in analysis. In this paper we characterise for any N∈N the entire functions P for which the partition of unity condition ∑n∈ZdP(x+n)χ[0,N]d(x+n)=1 holds for all x∈Rd. The general characterisation leads to various easy wa...
Towards an easy access to Annexin-A5 protein binding block copolymer micelles
International Nuclear Information System (INIS)
Schmidt, Vanessa; Giacomelli, Cristiano; Brisson, Alain R.; Borsali, Redouane
2008-01-01
The formation of Annexin-A5 decorated (bio-functionalized) nanoparticles is of particular interest in micelle-mediated target drug delivery, in vivo magnetic resonance imaging, and controlled fabrication of biochips. This work describes an easy access to the synthesis and manipulation of block copolymer nano-objects exhibiting Annexin-A5 protein binding ability. Well-defined spherical micelles containing negatively charged phosphonic diacid groups - which are potential binding sites for Annexin-A5 proteins - at their hydrophilic periphery originate from the self-assembly of polystyrene-b-poly(2-phosphatethyl methacrylate-stat-2-hydroxyethyl methacrylate) (PS-b-P(PEMA-stat-HEMA)) amphiphilic macromolecules in aqueous media. PS-b-P(PEMA-stat-HEMA) can be prepared in a three-step phosphorylation/silylation/methanolysis procedure applied to PS-b-PHEMA precursors synthesized via Atom Transfer Radical Polymerization (ATRP). The herein discussed approach allows precise control over micellar dimensions and properties such as core radius (i.e., loading capacity), corona width, and density of phosphate groups at the micelle periphery
Laser detritiation and co-deposited layer characterisation for future ITER Installation
International Nuclear Information System (INIS)
Semerok, Alexandre; Brygo, Francois; Fomichev, Sergey V.; Champonnois, Francois; Weulersse, Jean-Marc; Thro, Pierre-Yves; Fichet, Pascal; Grisolia, Christian
2006-01-01
The experimental equipment in combination with pulsed Nd-YAG lasers was developed and applied to investigate co-deposited layer characterisation and ablation. Heating and ablation regimes were distinguished by ablation threshold fluence that was determined experimentally for graphite samples from TexTor (Germany) and TORE SUPRA (France) tokamaks. With 100 ns pulses, the ablation threshold for graphite substrate (2.5±0.5 J/cm 2 ) was much higher than the one for co-deposited layer (0.4±0.1 J cm -2 ). These threshold features are very promising to ensure self-controlled laser cleaning without substrate surface damage. The obtained optimal conditions (laser fluence F=1-2 J/cm 2 , 10-20 kHz repetition rate) were applied for co-deposited layer cleaning. The TexTor 50 μm thickness layer was almost completely removed after a single scanning without any damage of the graphite substrate. Cleaning rate of 0.2 m 2 /hour was demonstrated experimentally for 20 W mean laser power. A theoretical model of a complex surface heating (graphite or metal with a co-deposited layer) was developed to explain the experimental results and to obtain laser cleaning optimisation. A good agreement of the theoretical data with the experimental results was obtained. The studies on LIBS method for co-deposited layer characterisation have determined the analytical spectral lines for hydrogen, carbon, and other impurities (B, Fe, Si, and Cu) in TexTor graphite tile. The obtained results should be regarded optimistic for co-deposited layers characterisation by LIBS method. The development of certain laser methods and their application for in-situ detritiation and co-deposited layer characterisation are presented and discussed. (authors)
Characterising price fixing: a journey through the looking glass with ANSAC
Directory of Open Access Journals (Sweden)
Kasturi Moodaliyar
2012-10-01
Full Text Available In February 2005 the Supreme Court of Appeal of South Africa ruled that in deciding whether firms have contravened section 4(1(b of the Competition Act 89 of 1998, as amended, by engaging in, for example, ‘per se’ illegal price fixing, the Competition Tribunal must admit evidence relating to the nature, purpose and effect of the horizontal agreement or practice in question. This article examines the economic and legal rationale, as well as the implications, for allowing an appropriate characterisation of conduct to determine whether such conduct falls within the per se prohibition. Firstly, we comment on the rationale behind the per se rule as a standard for the adjudication of certain types of conduct. We analyse a number of cases in the United States, which, post 1979, revolutionised the approach to the strict per se rule. Secondly, we examine how the per se standard is reflected in the particular structure found in section 4(1 of the Competition Act and evaluate whether it makes for a sufficiently robust application of the per se rule. Thirdly, the content of the Supreme Court decision regarding characterisation is critically examined with a view to assessing whether such characterisation is consistent with the policy objective of achieving maximum deterrence of hard core cartel behaviour like price fixing and market division. Finally, we explore and suggest (in the absence of a Tribunal decision a possible framework, based on decision theory, for determining a method of characterisation that is consistent with the robust application of the per se standard and is in line with the Supreme Court ruling.
Ageing in media: rethinking the studying of media use in later life
DEFF Research Database (Denmark)
Givskov, Cecilie
in the realms of politics and commerce – and, of course, media. Ageing populations are key drivers of media sales, especially in the areas of mobile and online media, and they are the dominant audience groups following the news. At the same time, social institutions realign their relations with (older) citizens...... characterized by chronological life phase and generational perspectives, to some extent influenced by medicalised images of old age where ageing after the 60s gets correlated with a loss of intellectual and creative resources, a decline of social life and physical health, and with regard to media, a lack...... through digital media. In spite of this inversion of the age pyramid and their significance as media users and active citizens, older people’s media use is rarely the focus of media producers or communication scholars. What research does get carried out involving older people’s media use is generally...
Gao, Ruixia; Su, Xiaoqian; He, Xiwen; Chen, Langxing; Zhang, Yukui
2011-01-15
This paper reports the preparation of carbon nanotubes (CNTs) functionalized with molecularly imprinted polymers (MIPs) for advanced removal of estrone. CNTs@Est-MIPs nanocomposites with a well-defined core-shell structure were obtained using a semi-covalent imprinting strategy, which employed a thermally reversible covalent bond at the surface of silica-coated CNTs for a large-scale production. The morphology and structure of the products were characterised by transmission electron microscopy and Fourier transform infrared spectroscopy. The adsorption properties were demonstrated by equilibrium rebinding experiments and Scatchard analysis. The results demonstrate that the imprinted nanocomposites possess favourable selectivity, high capacity and fast kinetics for template molecule uptake, yielding an adsorption capacity of 113.5 μmol/g. The synthetic process is quite simple, and the different batches of synthesized CNTs@Est-MIPs nanocomposites showed good reproducibility in template binding. The feasibility of removing estrogenic compounds from environmental water using the CNTs@Est-MIPs nanocomposites was demonstrated using water samples spiked with estrone. Copyright © 2010 Elsevier B.V. All rights reserved.
Usha, Veeraraghavan; Lloyd, Adrian J; Roper, David I; Dowson, Christopher G; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T; Blindauer, Claudia A; Besra, Gurdyal S
2016-03-15
With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug.
Nano-scaled semiconductor devices physics, modelling, characterisation, and societal impact
Gutiérrez-D, Edmundo A
2016-01-01
This book describes methods for the characterisation, modelling, and simulation prediction of these second order effects in order to optimise performance, energy efficiency and new uses of nano-scaled semiconductor devices.
Media violence in the information society in the context of media anthropology
Directory of Open Access Journals (Sweden)
N. A. Mazorenko
2014-01-01
Full Text Available The article discusses media violence as special case of deviant manifestations of the individual and collective social body. It’s stated that in the late 20th century emphasis had shifted from the sociological and ethnographic works towards a more wide format of a man and the media studies. According to the author, it was caused by the forming of the media anthropology as humanoriented paradigm of the postmodern media. The place of media violence in problematic field of the media anthropology field is defined. It’s considered as a result of the somatic transformations in the media and the cultural space of the information society. Mass media have been products of culture and social life and at the same time factors of the identity’s construction. Such characteristic properties require more conscious of morality and responsibility. Media need to understand and represent new modes of physicality / spirituality and rationality / irrationality in the media and sociopolitical life. Due to weakening or decline of spiritual and intellectual component in the psychosomatic existence threatens to turn society into collective grotesque body, and media that exploit these social strain, into media spectacle, distorted and grotesque in the worst sense of the word. In this article, the method of anthropological reduction, and elements of culturalhistorical and structuralfunctional analysis have been used.
On Logical Characterisation of Human Concept Learning based on Terminological Systems
DEFF Research Database (Denmark)
Badie, Farshad
2018-01-01
The central focus of this article is the epistemological assumption that knowledge could be generated based on human beings' experiences and over their conceptions of the world. Logical characterisation of human inductive learning over their produced conceptions within terminological systems and ...... and analysis of actual human inductive reasoning (and learning). This research connects with the topics 'logic & learning', 'cognitive modelling' and 'terminological knowledge representation'.......The central focus of this article is the epistemological assumption that knowledge could be generated based on human beings' experiences and over their conceptions of the world. Logical characterisation of human inductive learning over their produced conceptions within terminological systems...
International Nuclear Information System (INIS)
Myones, B.L.; Ross, G.D.
1986-01-01
CR 2 is a 140-145Kd glycoprotein expressed on B lymphocytes which binds both C3d and Epstein-Barr virus (EBV). OKB7, an IgG/sub 2a/ monoclonal antibody to CR 2 , blocks C3d and EBV binding, while HB-5, another monoclonal IgG/sub 2a/ anti-CR 2 , does not. A 72Kd C3d-binding glycoprotein (gp72), isolated from Raji cell media, was previously thought to be CR 2 because a polyclonal rabbit anti-gp72 inhibited EC3d rosettes. ELISA assay demonstrated that OKB7, but not HB-5, bound to purified gp72 fixed to microtiter wells. Insoluble and soluble gp72 blocked Raji cell uptake of 125 I-labeled OKB7, but not labeled anti-B2 or HB-5. Rabbit anti-gp72 immunoprecipitated bands at 140Kd and 72Kd from 125 I-labelled and solubilized B cell membranes. Culture media from Raji cells grown in the presence 3 H-labeled amino acids was sequentially immunoprecipitated by irrelevant antibody, OKB7, and HB-5. A single 72Kd radiolabeled band was demonstrated only with OKB7, and this was identical to that produced by the immunoprecipitation of 125 I-labeled gp72 with rabbit anti-gp72. Thus, OKB7, which identifies the 140Kd CR 2 molecule, also identifies a 72Kd shed fragment of CR 2 isolated from Raji cell media, which contains the C3d-binding site
International Nuclear Information System (INIS)
Golman, K.; Holtz, E.; Almen, T.
1987-01-01
Contrast media are used in diagnostic radiology to enhance the X-ray attenuation between a body structure of interest and the surrounding tissue. A detail becomes perceptible on a roentgenogram only when its contrast exceeds a minimum value in relation to the background. Small areas of interest must have higher contrast than the background. The contrast effect depends on concentration of the contrast media with the body. A high contrast media concentration difference thus gives rise to more morphological details in the radiographs. Contrast media can be divided into negative contrast media such as air and gas which attenuate X-rays less than the body tissues, and positive contrast materials which attenuate X-rays more than the body tissues. The positive contrast media all contain either iodine (atomic number 53) or barium (atomic number 56) and can be divided into water-insoluble and water-soluble contrast media
DEFF Research Database (Denmark)
Vestergaard, Vitus; Mortensen, Christian Hviid
2011-01-01
content. The media content is created by the user in the museum's physical environment, but it can be mixed with material from web archives. It is the intention that the users learn about media through participatory and creative processes with media where the borders between producing, playing......We explore how remixing and content sharing can be used as a means for user participation in a digital museum age. Remix culture is seen as a culture that allows and encourages the production of derivative works; works that are based on already existing works. This cultural practice thrives...... throughout the Internet, most notably on web 2.0 sites like YouTube. The Media Museum has embraced the remix paradigm with the development of an interactive media experience centre called the Media Mixer. Here the museum users can produce, deconstruct, reconstruct and finally publish and share digital media...
Effect of Host Media on Microbial Influenced Corrosion due to Desulfotomaculum nigrificans
Lata, Suman; Sharma, Chhaya; Singh, Ajay K.
2013-04-01
This article reports about the tests carried to investigate microbial-induced corrosion on stainless steels due to sulfate-reducing bacteria sp. Desulfotomaculum nigrificans in different host media. Stainless steel 304L, 316L, and 2205 were selected for the test. Modified Baar's media (BM), sodium chloride solution, and artificial sea water (SW) were used as test solutions in anaerobic conditions. Electrochemical polarization and immersion test were performed to estimate the extent of corrosion rate and pitting on stainless steels. SEM/EDS were used to study the details inside/outside pits formed on the corroded samples. Biofilm formed on corroded coupons was analyzed for its components by UV/Visible spectroscopy. Corrosion attack on the test samples was observed maximum in case of exposure to SW followed by NaCl solution, both having sulfide and chloride whereas stainless steel exposed to BM, having sulfide, showed minimum attack. Tendency of extracellular polymeric substances to bind metal ions is observed to be responsible for governing the extent of corrosion attack.
International Nuclear Information System (INIS)
Almonacid, F.; Rus, C.; Hontoria, L.; Munoz, F.J.
2010-01-01
The presence of PV modules made with new technologies and materials is increasing in PV market, in special Thin Film Solar Modules (TFSM). They are ready to make a substantial contribution to the world's electricity generation. Although Si wafer-based cells account for the most of increase, technologies of thin film have been those of the major growth in last three years. During 2007 they grew 133%. On the other hand, manufacturers provide ratings for PV modules for conditions referred to as Standard Test Conditions (STC). However, these conditions rarely occur outdoors, so the usefulness and applicability of the indoors characterisation in standard test conditions of PV modules is a controversial issue. Therefore, to carry out a correct photovoltaic engineering, a suitable characterisation of PV module electrical behaviour is necessary. The IDEA Research Group from Jaen University has developed a method based on artificial neural networks (ANNs) to electrical characterisation of PV modules. An ANN was able to generate V-I curves of si-crystalline PV modules for any irradiance and module cell temperature. The results show that the proposed ANN introduces a good accurate prediction for si-crystalline PV modules performance when compared with the measured values. Now, this method is going to be applied for electrical characterisation of PV CIS modules. Finally, a comparative study with other methods, of electrical characterisation, is done. (author)
A rock characterisation facility consultative document
International Nuclear Information System (INIS)
1992-10-01
This U.K. Nirex Ltd., consultative document describes a proposed underground rock characterisation facility, east of Sellafield, for conducting geophysical surveys as a basis for refining long-term safety analysis of an underground repository for intermediate-level and low-level radioactive wastes. Planning application will be submitted in 1993. The construction of shafts and galleries is described and the site's geologic, topographical, climatic and archaeological features discussed. The effects to the local environment and on local populations and other socio-economic factors are discussed. (UK)
Characterising encapsulated nuclear waste using cosmic-ray muon tomography
International Nuclear Information System (INIS)
Clarkson, A.; Hamilton, D.J.; Hoek, M.; Ireland, D.G.; Kaiser, R.; Keri, T.; Lumsden, S.; Mahon, D.F.; McKinnon, B.; Murray, M.; Nutbeam-Tuffs, S.; Yang, G.; Johnstone, J.R.; Shearer, C.; Zimmerman, C.
2015-01-01
Tomographic imaging techniques using the Coulomb scattering of cosmic-ray muons have been shown previously to successfully identify and characterise low- and high-Z materials within an air matrix using a prototype scintillating-fibre tracker system. Those studies were performed as the first in a series to assess the feasibility of this technology and image reconstruction techniques in characterising the potential high-Z contents of legacy nuclear waste containers for the U.K. Nuclear Industry. The present work continues the feasibility study and presents the first images reconstructed from experimental data collected using this small-scale prototype system of low- and high-Z materials encapsulated within a concrete-filled stainless-steel container. Clear discrimination is observed between the thick steel casing, the concrete matrix and the sample materials assayed. These reconstructed objects are presented and discussed in detail alongside the implications for future industrial scenarios
Characterising encapsulated nuclear waste using cosmic-ray muon tomography
Clarkson, A.; Hamilton, D. J.; Hoek, M.; Ireland, D. G.; Johnstone, J. R.; Kaiser, R.; Keri, T.; Lumsden, S.; Mahon, D. F.; McKinnon, B.; Murray, M.; Nutbeam-Tuffs, S.; Shearer, C.; Yang, G.; Zimmerman, C.
2015-03-01
Tomographic imaging techniques using the Coulomb scattering of cosmic-ray muons have been shown previously to successfully identify and characterise low- and high-Z materials within an air matrix using a prototype scintillating-fibre tracker system. Those studies were performed as the first in a series to assess the feasibility of this technology and image reconstruction techniques in characterising the potential high-Z contents of legacy nuclear waste containers for the U.K. Nuclear Industry. The present work continues the feasibility study and presents the first images reconstructed from experimental data collected using this small-scale prototype system of low- and high-Z materials encapsulated within a concrete-filled stainless-steel container. Clear discrimination is observed between the thick steel casing, the concrete matrix and the sample materials assayed. These reconstructed objects are presented and discussed in detail alongside the implications for future industrial scenarios.
Electronic cigarettes: product characterisation and design considerations
Brown, Christopher J; Cheng, James M
2014-01-01
Objective To review the available evidence regarding electronic cigarette (e-cigarette) product characterisation and design features in order to understand their potential impact on individual users and on public health. Methods Systematic literature searches in 10 reference databases were conducted through October 2013. A total of 14 articles and documents and 16 patents were included in this analysis. Results Numerous disposable and reusable e-cigarette product options exist, representing w...
Media work as public affairs: moving beyond media savvy
DEFF Research Database (Denmark)
Trapp, Leila; Laursen, Bo
Much research exists which examines how politically-motivated organizations adapt their communication practices to suit the news media’s routines and values to gain media coverage and thereby exert political influence. The mediatization literature describes these adaptation processes as constantly...... evolving, with professional communicators exhibiting an ever-growing amount of media savvy. The purpose of this study is to gain up-to-date insights into current forms of media adaptation in political organizations through interviews with professional press contact staff in 52 Danish interest groups....... The interviews reveal that media work is considered an effective, though potentially risky, form of public affairs. Indeed, media work is said to damage, or even ruin, an organization’s lobbying efforts or relationships with political actors. The study’s key finding is that in order to deal with these risks...
Characterisation of radionuclide migration and plant uptake for performance assessment
International Nuclear Information System (INIS)
Mathias, S. A.; Ireson, A. M.; Butler, A. P.; Jackson, B. M.; Wheater, H. S.
2008-01-01
Unsaturated vegetated soils are an important component in performance assessment models used to quantify risks associated with deep engineered repositories for underground radioactive waste disposal. Therefore, experimental studies, funded by Nirex over nearly 20 years, have been undertaken at Imperial College to study the transfer of radionuclides (Cl-36, I-129, Tc-99) from contaminated groundwater into crops. In parallel to this has been a modelling programme to aid interpretation of the experimental data, obtain parameter values characterising transport in soil and plant uptake and provide new representations of near-surface processes for performance assessment. A particular challenge in achieving these objectives is that the scale of the experimental work (typically ≤1 m) is much smaller than that required in performance assessment. In this paper, a new methodology is developed for up-scaling model results obtained at the experimental scale for use in catchment scale models. The method is based on characterising soil heterogeneity using soil texture. This has the advantage of allowing hydrological and radionuclide transport parameters to be correlated in a consistent manner. An initial investigation into the calculation of effective (i.e. up-scaled) hydrological and transport parameters has been undertaken and shows the results to be potentially highly (and non-linearly) sensitive to soil properties. Consequently, they have important implications for future site characterisation programmes supporting a proposed underground waste repository. (authors)
Characterisation of a novel reverse-biased PPD CMOS image sensor
Stefanov, K. D.; Clarke, A. S.; Ivory, J.; Holland, A. D.
2017-11-01
A new pinned photodiode (PPD) CMOS image sensor (CIS) has been developed and characterised. The sensor can be fully depleted by means of reverse bias applied to the substrate, and the principle of operation is applicable to very thick sensitive volumes. Additional n-type implants under the pixel p-wells, called Deep Depletion Extension (DDE), have been added in order to eliminate the large parasitic substrate current that would otherwise be present in a normal device. The first prototype has been manufactured on a 18 μm thick, 1000 Ω .cm epitaxial silicon wafers using 180 nm PPD image sensor process at TowerJazz Semiconductor. The chip contains arrays of 10 μm and 5.4 μm pixels, with variations of the shape, size and the depth of the DDE implant. Back-side illuminated (BSI) devices were manufactured in collaboration with Teledyne e2v, and characterised together with the front-side illuminated (FSI) variants. The presented results show that the devices could be reverse-biased without parasitic leakage currents, in good agreement with simulations. The new 10 μm pixels in both BSI and FSI variants exhibit nearly identical photo response to the reference non-modified pixels, as characterised with the photon transfer curve. Different techniques were used to measure the depletion depth in FSI and BSI chips, and the results are consistent with the expected full depletion.
Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2016-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946
Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2016-01-15
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Der-Thanq “victor” Chen
2011-04-01
Full Text Available The 21st century has marked an unprecedented advancement of new media. New media has become so pervasive that it has penetrated into every aspect of our society. New media literacy plays an essential role for any citizen to participate fully in the 21st century society. Researchers have documented that literacy has evolved historically from classic literacy (reading-writing-understanding to audiovisual literacy to digital literacy or information literacy and recently to new media literacy. A review of literature on media literacy reveals that there is a lack of thorough analysis of unique characteristics of new media and its impacts upon the notion of new media literacy. The purpose of the study is to unpack new media literacy and propose a framework for a systematic investigation of new media literacy.
Media Activism and the Academy, Three Cases: Media Democracy Day, Open Media, and NewsWatch Canada
Directory of Open Access Journals (Sweden)
David Skinner
2015-12-01
Full Text Available In Canada, there is a relatively strong tradition of activist scholarship in media and communication studies. However, very little research has been undertaken on how working in the university may contextualize the ways in which academic workers participate in activist media projects. Focusing on three such projects – Media Democracy Day, Open Media, and NewsWatch Canada – this article draws upon elements of political economy and Bourdieu’s field theory to consider how the different characters of the academic and activist fields work to enable and constrain the abilities of faculty to engage with them.
Nurhaliza, Ade
2017-01-01
This study entitled “Critical Awareness of Communication Student in Social Media”. This study aimed to find out how student’s critical awareness in social media in media literacy context. The Theories used in this study are media literacy theory, critical awareness theory, new media and digital media literacy, and social media. The method used in this study is qualitative descriptive which describes the condition on the ground, reality, and the situation or some phenomenones. The result showe...
Directory of Open Access Journals (Sweden)
Yu-Ru Zhang
Full Text Available BACKGROUND: Retinoids are a class of compounds that are chemically related to vitamin A, which is an essential nutrient that plays a key role in vision, cell growth and differentiation. In vivo, retinoids must bind with specific proteins to perform their necessary functions. Plasma retinol-binding protein (RBP and epididymal retinoic acid binding protein (ERABP carry retinoids in bodily fluids, while cellular retinol-binding proteins (CRBPs and cellular retinoic acid-binding proteins (CRABPs carry retinoids within cells. Interestingly, although all of these transport proteins possess similar structures, the modes of binding for the different retinoid ligands with their carrier proteins are different. METHODOLOGY/PRINCIPAL FINDINGS: In this work, we analyzed the various retinoid transport mechanisms using structure and sequence comparisons, binding site analyses and molecular dynamics simulations. Our results show that in the same family of proteins and subcellular location, the orientation of a retinoid molecule within a binding protein is same, whereas when different families of proteins are considered, the orientation of the bound retinoid is completely different. In addition, none of the amino acid residues involved in ligand binding is conserved between the transport proteins. However, for each specific binding protein, the amino acids involved in the ligand binding are conserved. The results of this study allow us to propose a possible transport model for retinoids. CONCLUSIONS/SIGNIFICANCE: Our results reveal the differences in the binding modes between the different retinoid-binding proteins.
Media exposure and health in Europe: Mediators and moderators of media systems
Blom, N.; Zanden, R. van der; Buijzen, M.A.; Scheepers, P.L.H.
2016-01-01
This study examined media exposure as an explanatory factor for individual and cross-national differences in self-assessed general health. In studying media exposure, traditional media (television, radio, and newspapers) and contemporary media (internet) were separately considered. Aside from
Directory of Open Access Journals (Sweden)
Daniel Estanislao Goszczynski
2016-04-01
Full Text Available Abstract Background Peroxisome proliferator-activated receptor gamma (PPARG, CCAAT/enhancer binding protein alpha (CEBPA and retinoid X receptor alpha (RXRA are nuclear transcription factors that play important roles in regulation of adipogenesis and fat deposition. The objectives of this study were to characterise the variability of these three candidate genes in a mixed sample panel composed of several cattle breeds with different meat quality, validate single nucleotide polymorphisms (SNPs in a local crossbred population (Angus - Hereford - Limousin and evaluate their effects on meat quality traits (backfat thickness, intramuscular fat content and fatty acid composition, supporting the association tests with bioinformatic predictive studies. Results Globally, nine SNPs were detected in the PPARG and CEBPA genes within our mixed panel, including a novel SNP in the latter. Three of these nine, along with seven other SNPs selected from the Single Nucleotide Polymorphism database (SNPdb, including SNPs in the RXRA gene, were validated in the crossbred population (N = 260. After validation, five of these SNPs were evaluated for genotype effects on fatty acid content and composition. Significant effects were observed on backfat thickness and different fatty acid contents (P < 0.05. Some of these SNPs caused slight differences in mRNA structure stability and/or putative binding sites for proteins. Conclusions PPARG and CEBPA showed low to moderate variability in our sample panel. Variations in these genes, along with RXRA, may explain part of the genetic variation in fat content and composition. Our results may contribute to knowledge about genetic variation in meat quality traits in cattle and should be evaluated in larger independent populations.
Cantor, J
2000-08-01
Research on the effects of media violence is not well understood by the general public. Despite this fact, there is an overwhelming consensus in the scientific literature about the unhealthy effects of media violence. Meta-analyses show that media-violence viewing consistently is associated with higher levels of antisocial behavior, ranging from the trivial (imitative violence directed against toys) to the serious (criminal violence), with many consequential outcomes in between (acceptance of violence as a solution to problems, increased feelings of hostility, and the apparent delivery of painful stimulation to another person). Desensitization is another well-documented effect of viewing violence, which is observable in reduced arousal and emotional disturbance while witnessing violence, the reduced tendency to intervene in a fight, and less sympathy for the victims of violence. Although there is evidence that youth who are already violent are more likely to seek out violent entertainment, there is strong evidence that the relationship between violence viewing and antisocial behavior is bidirectional. There is growing evidence that media violence also engenders intense fear in children which often lasts days, months, and even years. The media's potential role in solutions to these problems is only beginning to be explored, in investigations examining the uses and effects of movie ratings, television ratings, and the V-chip, and the effects of media literacy programs and public education efforts. Future research should explore important individual differences in responses to media violence and effective ways to intervene in the negative effects.
International Nuclear Information System (INIS)
Pendrill, L R; Fisher, William P Jr
2013-01-01
A better understanding of how to characterise human response is essential to improved person-centred care and other situations where human factors are crucial. Challenges to introducing classical metrological concepts such as measurement uncertainty and traceability when characterising Man as a Measurement Instrument include the failure of many statistical tools when applied to ordinal measurement scales and a lack of metrological references in, for instance, healthcare. The present work attempts to link metrological and psychometric (Rasch) characterisation of Man as a Measurement Instrument in a study of elementary tasks, such as counting dots, where one knows independently the expected value because the measurement object (collection of dots) is prepared in advance. The analysis is compared and contrasted with recent approaches to this problem by others, for instance using signal error fidelity
Fonte, D; Blondé, J; Girandola, F
2017-06-01
Our study aims to test the effectiveness of binding communication based interventions (vs classical persuasive communication based ones) inciting non-donors to act in favour of blood donation. The implementation of effective communication interventions represents a major public health issue. Nevertheless, persuasive media campaigns appear to have little effect on behaviours. Even though non-donors hold a positive attitude towards blood donation, they are not inclined to donate. As an alternative to producing behavioural changes, many recent studies have shown the superiority of binding communication over persuasive communication. All participants, non-donors, were randomly assigned to one of four experimental conditions of a 2 (type of communication: persuasive vs binding) × 2 (source credibility: low vs high) factorial design. Then, they were asked to report their intention to donate blood, and their intention to distribute leaflets regarding blood donation. Binding communication is a more effective strategy for increasing intention towards blood donation compared with persuasive communication, especially when combined with high credibility source. Accordingly this study calls for more consideration of knowledge of social psychology to design effective communication interventions and increase the number of donations. © 2016 British Blood Transfusion Society.
DEFF Research Database (Denmark)
Uldam, Julie
2018-01-01
of activists remains under-researched. This article examines BP’s surveillance of activists who criticise the company’s corporate social responsibility (CSR) programme as ‘greenwashing’. In this way, it goes beyond corporations’ uses of big data and instead explores how they monitor and discuss strategies......As activists move from alternative media platforms to commercial social media platforms, they face increasing challenges in protecting their online security and privacy. While government surveillance of activists is well-documented in scholarly research and the media, corporate surveillance...... for responding to the activities of individual activists in social media. It shows that while social media afford an unprecedented level of visibility for activists, it comes with the risk of being monitored by corporations. Theoretically, it draws on conceptions of visibility in social sciences and media...
DEFF Research Database (Denmark)
Madsen, Vibeke Thøis
2018-01-01
Internal social media is a web-based communication arena that provides all organizational members with a communication opportunity. The media has emerged in organizations since 2004, and is increasingly seen as a way of giving employees a voice in organizations which can benefit the organization...... in terms of knowledge sharing, collaboration, and employee participation and engagement. The first wave of studies of internal social media was primarily from an information-systems perspective and focused more on its adoption, its affordances, and the outcome of its introduction. The second wave...... of studies was more concerned with studying the dynamics of communication on internal social media, in order to understand coworkers as strategic communicators and how communication on internal social media can constitute the organization. With a successful introduction of internal social media, coworkers...
Nurdiningrum, Nurul
2017-01-01
130904171 Penelitian ini berjudul Akun Resmi Media Sosial IMAJINASI FISIP USU sebagai Media Pencarian Informasi (Studi Deskriptif Kuantitatif Penggunaan Akun Resmi Media Sosial IMAJINASI FISIP USU sebagai Media Pencarian Informasi pada Mahasiswa Ilmu Komunikasi).Tujuan penelitian adalah untuk mengetahui peranan akun resmi media sosial IMAJINASI FISIP USU sebagai media pencarian informasi pada mahasiswa Departemen Ilmu Komunikasi FISIP USU, untuk mengetahui jenis-jenis informasi yang dibagi...
'Frozen' media subsidies during a time of media change
DEFF Research Database (Denmark)
Nielsen, Rasmus Kleis
2014-01-01
documents and secondary sources, I show that media subsidies have largely remained frozen in their late-20th century form. The absence of major reform means that media subsidies are increasingly subject to policy drift, a process by which the operations and effectiveness of policies change not because......Media systems around the world have changed in significant ways in the early 21st century. In this article, I analyse how various forms of media subsidies have changed in response to these transformations in a sample of six different affluent democracies. On the basis of interviews, official......) a perceived shortage of desirable, cost-effective, and governable alternatives to existing policies....
Harnessing the landscape of microbial culture media to predict new organism–media pairings
Oberhardt, Matthew A.; Zarecki, Raphy; Gronow, Sabine; Lang, Elke; Klenk, Hans-Peter; Gophna, Uri; Ruppin, Eytan
2015-01-01
Culturing microorganisms is a critical step in understanding and utilizing microbial life. Here we map the landscape of existing culture media by extracting natural-language media recipes into a Known Media Database (KOMODO), which includes >18,000 strain–media combinations, >3300 media variants and compound concentrations (the entire collection of the Leibniz Institute DSMZ repository). Using KOMODO, we show that although media are usually tuned for individual strains using biologically common salts, trace metals and vitamins/cofactors are the most differentiating components between defined media of strains within a genus. We leverage KOMODO to predict new organism–media pairings using a transitivity property (74% growth in new in vitro experiments) and a phylogeny-based collaborative filtering tool (83% growth in new in vitro experiments and stronger growth on predicted well-scored versus poorly scored media). These resources are integrated into a web-based platform that predicts media given an organism's 16S rDNA sequence, facilitating future cultivation efforts. PMID:26460590
Media Pembelajaran Global Warming
Tham, Fikri Jufri; Liliana, Liliana; Purba, Kristo Radion
2016-01-01
Computer based learning media is one of the media has an important role in learning. Learning media will be attractive when packaged through interactive media , such as interactive media created in paper manufacture " instructional media global warming" . The advantage gained is that it can increase knowledge, generally educate people to be more concerned about the environment , and also can be a means of entertainment. This application is focused to learn about global warming and packaged in...
Maksl, Adam; Ashley, Seth; Craft, Stephanie
2015-01-01
News media literacy refers to the knowledge and motivations needed to identify and engage with journalism. This study measured levels of news media literacy among 500 teenagers using a new scale measure based on Potter's model of media literacy and adapted to news media specifically. The adapted model posits that news media literate individuals…
Directory of Open Access Journals (Sweden)
Vivienne Elizabeth
2016-06-01
Full Text Available Custody abductions and filicides-suicides are not every day occurrences and typically become ‘media events’. Through an analysis of newspaper representations of two custody abductions and one filicide-suicide, this article examines the role played by fathers’ rights discourse in the construction of the separated father in each case. It argues that fathers’ rights discourse played a central role in the sympathetic portrayal of the two fathers involved in the custody abductions, but was less obviously present in the case of the filicide-suicide. These divergent representations indicate that news media representations are contingent on circumstances and also point to the limits of fathers’ rights discourses in legitimating and neutralising the actions of fathers in pain over the loss of intimate personal relationships. However, the use of a forensic approach to reporting meant that each case remained decontextualised from the pattern of violence and coercive control that typically characterises conflictual separations and custody disputes.
Küter-Luks, Theresa; Heuvelman, A.; Peters, O.
2011-01-01
Despite clear European and Dutch policies about media education, there is currently no media education curriculum in Dutch schools. A survey among preadolescents (n = 257) in six primary schools in the Netherlands included questions regarding media access, fears, risks, parental mediation of
Educational Potential of New Media
Directory of Open Access Journals (Sweden)
Maria Yu. Kazak
2017-11-01
Full Text Available Digitalization of the mass media, which has radically changed the information environment, creates new opportunities for self-education and upgrowth of the audience. The paper defines the communicative and cultural status of new media, characterizes the socio-cultural and technological aspects of their dynamics; substantiates the necessity of elaborating mechanisms for systematization of heterogeneous information flows and elaborating criteria for their evaluation in the era of globalization of the media sphere, what implies a qualitatively different level of media competence of the audience, provided with such factors as media education, media coverage, media criticism. The definition of concepts "media competence", "media enlightenment", "media education", "media criticism" is given and their functional areas are delineated. Social networks are considered as an important tool for media enlightenment which provides significant opportunities for promoting cultural achievements in the new media environment.
Directory of Open Access Journals (Sweden)
M.S. Nadiye–Tabbiruka
2009-12-01
Full Text Available Aerosil samples, heat treated and then silylated with various silanes at various temperatures have been characterised by adsorption of ethanol at 293 K. Adsorption isotherms were plotted and the BET specific surface areas were determined. Contact angles were measured by the captive bubble method at the three phase contact line in ethanol, on glass slides similarly modified. Silylation was found to alter the ethanol adsorptive properties on aerosil and increase the contact angles on the glass slides to extents that depend on the silane used as well as the concentration of residual silanols and that of surface silyl groups.
Solution of Media Risk and Social Responsibility Governance of Social Media
Directory of Open Access Journals (Sweden)
Zhang Yuan
2017-01-01
Full Text Available The rapid development of media technology makes the modern society become a “social media” or even “over social media”, the rise of social media makes it beyond the tool attribute, and become an important force in the reconstruction of contemporary society, the risk of concomitant. The anomie and breach of Social media regularly staged, weakened its positive social function, forcing us to think about the social responsibility of social media,which are reflections on the lack of responsibility, but also positive response of resolving the media risk and ask for moral strength.
Adolescents and media literacy.
McCannon, Robert
2005-06-01
In the face of media industry consolidation, fewer people control media content which makes it harder for parents and citizens to know the research about media-related issues, such as video game violence, nutrition, and sexual risk-taking. Media literacy offers a popular and potentially successful way to counter the misinformation that is spread by Big Media public relations.
Directory of Open Access Journals (Sweden)
Mikkel Fugl Eskjær
2010-11-01
Full Text Available Systems theoretical media research raises the question whether the mass media constitute a unified institution, or whether the media, due to their internal differences, should be considered individually and independent of each other. By inscribing the media in a general social theory, systems theory conceptualises the media as an autonomous functional system. This intention is most clearly illustrated by the efforts to identify a shared code for the entire media system. Based on the media theory of Niklas Luhmann, this paper offers a critical presentation of the code discussion within systems theoretical media research. The first part of the paper briefly introduces the systems theoretical notion of a code as well as Luhmann’s definition of the media system as organised and regulated by the code of information. The second part presents a number of alternative suggestions and definitions of the media system’s code, which both indicate the scope of systems theoretical media research, but also point to some of the limitations in the systems theoretical approach. In the last part, the paper takes a critical look at the systems theoretical code discussion by arguing that a too narrow focus on code definitions is blocking a more productive investigation of the conditions, evolution, and autonomy of the media system.
DNA Binding and Phosphorylation Regulate the Core Structure of the NF-κB p50 Transcription Factor.
Vonderach, Matthias; Byrne, Dominic P; Barran, Perdita E; Eyers, Patrick A; Eyers, Claire E
2018-06-05
The NF-κB transcription factors are known to be extensively phosphorylated, with dynamic site-specific modification regulating their ability to dimerize and interact with DNA. p50, the proteolytic product of p105 (NF-κB1), forms homodimers that bind DNA but lack intrinsic transactivation function, functioning as repressors of transcription from κB promoters. Here, we examine the roles of specific phosphorylation events catalysed by either protein kinase A (PKA c ) or Chk1, in regulating the functions of p50 homodimers. LC-MS/MS analysis of proteolysed p50 following in vitro phosphorylation allows us to define Ser328 and Ser337 as PKA c - and Chk1-mediated modifications, and pinpoint an additional four Chk1 phosphosites: Ser65, Thr152, Ser242 and Ser248. Native mass spectrometry (MS) reveals Chk1- and PKA c -regulated disruption of p50 homodimer formation through Ser337. Additionally, we characterise the Chk1-mediated phosphosite, Ser242, as a regulator of DNA binding, with a S242D p50 phosphomimetic exhibiting a > 10-fold reduction in DNA binding affinity. Conformational dynamics of phosphomimetic p50 variants, including S242D, are further explored using ion-mobility MS (IM-MS). Finally, comparative theoretical modelling with experimentally observed p50 conformers, in the absence and presence of DNA, reveals that the p50 homodimer undergoes conformational contraction during electrospray ionisation that is stabilised by complex formation with κB DNA. Graphical Abstract ᅟ.
Media multitasking and implicit learning.
Edwards, Kathleen S; Shin, Myoungju
2017-07-01
Media multitasking refers to the simultaneous use of different forms of media. Previous research comparing heavy media multitaskers and light media multitaskers suggests that heavy media multitaskers have a broader scope of attention. The present study explored whether these differences in attentional scope would lead to a greater degree of implicit learning for heavy media multitaskers. The study also examined whether media multitasking behaviour is associated with differences in visual working memory, and whether visual working memory differentially affects the ability to process contextual information. In addition to comparing extreme groups (heavy and light media multitaskers) the study included analysis of people who media multitask in moderation (intermediate media multitaskers). Ninety-four participants were divided into groups based on responses to the media use questionnaire, and completed the contextual cueing and n-back tasks. Results indicated that the speed at which implicit learning occurred was slower in heavy media multitaskers relative to both light and intermediate media multitaskers. There was no relationship between working memory performance and media multitasking group, and no relationship between working memory and implicit learning. There was also no evidence for superior performance of intermediate media multitaskers. A deficit in implicit learning observed in heavy media multitaskers is consistent with previous literature, which suggests that heavy media multitaskers perform more poorly than light media multitaskers in attentional tasks due to their wider attentional scope.
DEFF Research Database (Denmark)
Kabel, Lars
2016-01-01
News and other kinds of journalistic stories, 16-17 hours a day, all year round, on all platforms, also the moderated social media. The key research thesis behind this article is that the continuous and speedy stream of news stories and media content now is becoming the centre of the production...... processes and the value creation in converged multimedia newsrooms. The article identify new methods and discuss editorial challenges in handling media flow....
Energy Technology Data Exchange (ETDEWEB)
Myones, B.L.; Ross, G.D.
1986-03-05
CR/sub 2/ is a 140-145Kd glycoprotein expressed on B lymphocytes which binds both C3d and Epstein-Barr virus (EBV). OKB7, an IgG/sub 2a/ monoclonal antibody to CR/sub 2/, blocks C3d and EBV binding, while HB-5, another monoclonal IgG/sub 2a/ anti-CR/sub 2/, does not. A 72Kd C3d-binding glycoprotein (gp72), isolated from Raji cell media, was previously thought to be CR/sub 2/ because a polyclonal rabbit anti-gp72 inhibited EC3d rosettes. ELISA assay demonstrated that OKB7, but not HB-5, bound to purified gp72 fixed to microtiter wells. Insoluble and soluble gp72 blocked Raji cell uptake of /sup 125/I-labeled OKB7, but not labeled anti-B2 or HB-5. Rabbit anti-gp72 immunoprecipitated bands at 140Kd and 72Kd from /sup 125/I-labelled and solubilized B cell membranes. Culture media from Raji cells grown in the presence /sup 3/H-labeled amino acids was sequentially immunoprecipitated by irrelevant antibody, OKB7, and HB-5. A single 72Kd radiolabeled band was demonstrated only with OKB7, and this was identical to that produced by the immunoprecipitation of /sup 125/I-labeled gp72 with rabbit anti-gp72. Thus, OKB7, which identifies the 140Kd CR/sub 2/ molecule, also identifies a 72Kd shed fragment of CR/sub 2/ isolated from Raji cell media, which contains the C3d-binding site.
Development of comprehensive techniques for coastal site characterisation. (1) Strategic overview
International Nuclear Information System (INIS)
Ota, Kunio; Amano, Kenji; Niizato, Tadafumi; Alexander, W. Russell; Yamanaka, Yoshiaki
2011-01-01
Any assessment of long-term repository safety will require development of a set of analyses and arguments to demonstrate the persistence of the key safety functions of the geological environment up to several hundred thousand years into the future. However, likely future global climatic and sea-level fluctuations and uplift/subsidence would result in a dramatic change in the location of the current coastline with a subsequent significant change to hydraulic and hydrochemical conditions at coastal sites. It is thus of great importance in the Japanese disposal programme to establish comprehensive techniques for coastal site characterisation. To this end, a systematic framework, which is known as a 'Geosynthesis Data Flow Diagram', has been formulated, which outlines a basic radmap of the geosynthesis methodology for characterising temporal and spatial changes of various properties and processes of coastal sites, with particular focus on the palaeohydrogeology. A basic strategy for stepwise surface-based investigations has also been proposed, which incorporates the geosynthesis methodology in an effective manner. This Technique has been introduced in an ongoing collaborative programme for characterising the coastal geological environment around Horonobe in northern Hokkaido, Japan, and now tested and optimised based on accumulated technical knowledge and experience during the progress of the investigations. (author)
Characterising antimicrobial protein-membrane complexes
International Nuclear Information System (INIS)
Xun, Gloria; Dingley, Andrew; Tremouilhac, Pierre
2009-01-01
Full text: Antimicrobial proteins (AMPs) are host defence molecules that protect organisms from microbial infection. A number of hypotheses for AMP activity have been proposed which involve protein membrane interactions. However, there is a paucity of information describing AMP-membrane complexes in detail. The aim of this project is to characterise the interactions of amoebapore-A (APA-1) with membrane models using primarily solution-state NMR spectroscopy. APA-1 is an AMP which is regulated by a pH-dependent dimerisation event. Based on the atomic resolution solution structure of monomeric APA-1, it is proposed that this dimerisation is a prerequisite for ring-like hexameric pore formation. Due to the cytotoxicity of APA-1, we have developed a cell-free system to produce this protein. To facilitate our studies, we have adapted the cell-free system to isotope label APA-1. 13 C /15 N -enriched APA-1 sample was achieved and we have begun characterising APA-1 dimerisation and membrane interactions using NMR spectroscopy and other biochemical/biophysical methods. Neutron reflectometry is a surface-sensitive technique and therefore represents an ideal technique to probe how APA-1 interacts with membranes at the molecular level under different physiological conditions. Using Platypus, the pH-induced APA-1-membrane interactions should be detectable as an increase of the amount of protein adsorbed at the membrane surface and changes in the membrane properties. Specifically, detailed information of the structure and dimensions of the protein-membrane complex, the position and amount of the protein in the membrane, and the perturbation of the membrane phospholipids on protein incorporation can be extracted from the neutron reflectometry measurement. Such information will enable critical assessment of current proposed mechanisms of AMP activity in bacterial membranes and complement our NMR studies
The development of children's language and ethical media competences and media skills
Valli, Raine; Hautaviita, Janika; Meriläinen, Merja
2015-01-01
The children's developing media competences and media skills are evaluated in this article on the basis of the evaluation indicator developed by Hautaviita (2012). The indicator has been developed for measuring the 6–9-year-old children's (the preschoolers and the pupils in grades 1-2) media competences. In it, the children's developing media skills are divided into practical, social, language and ethical media competences, of which this article concentrates on the last two, language and ethi...
Applying East Asian Media Diplomacy Models to African Media: A ...
African Journals Online (AJOL)
The last two decades have seen the extensive expansion of South African and Nigerian media on the African continent. However, while the link between media and diplomacy, and the role of media in visualising the state for foreign audiences have received a lot of scholarly attention internationally, relatively little work has ...
Need for Orientation, Media Uses and Gratifications, and Media Effects.
Weaver, David
In order to study the influence of need for orientation and media gratifications on media use and media effects in political communication, two previous surveys were studied to compare the causal modeling approach and the contingent conditions approach. In the first study, 339 personal interviews were conducted with registered voters during a…
Competitive protein binding assay
International Nuclear Information System (INIS)
Kaneko, Toshio; Oka, Hiroshi
1975-01-01
The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)
DEFF Research Database (Denmark)
In the western world, a diverse and pluralistic media landscape is deemed essential for democracy. But how universal is media pluralism as a concept underpinning media policies? To what extent do normative approaches, regulatory dimensions and monitoring systems differ throughout the world......? Adopting a truly global, theoretical and multidisciplinary perspective, Media Pluralism and Diversity advances our understanding of media pluralism across the globe. It compares metrics developed in different parts of the world to assess levels of, or threats to, media pluralism. It identifies common...
Nutrient characterisation of river inflow into the estuaries of the ...
African Journals Online (AJOL)
Nutrient characterisation of river inflow into the estuaries of the Gouritz Water ... into the estuaries within the Gouritz Water Management Area (WMA) of South Africa. ... Long-term water quality monitoring data (dissolved inorganic nitrogen, i.e. ...
Grandjean, Thomas; Barai, Anup; Hosseinzadeh, Elham; Guo, Yue; McGordon, Andrew; Marco, James
2017-08-01
It is crucial to maintain temperature homogeneity in lithium ion batteries in order to prevent adverse voltage distributions and differential ageing within the cell. As such, the thermal behaviour of a large-format 20 Ah lithium iron phosphate pouch cell is investigated over a wide range of ambient temperatures and C rates during both charging and discharging. Whilst previous studies have only considered one surface, this article presents experimental results, which characterise both surfaces of the cell exposed to similar thermal media and boundary conditions, allowing for thermal gradients in-plane and perpendicular to the stack to be quantified. Temperature gradients, caused by self-heating, are found to increase with increasing C rate and decreasing temperature to such an extent that 13.4 ± 0.7% capacity can be extracted using a 10C discharge compared to a 0.5C discharge, both at -10 °C ambient temperature. The former condition causes an 18.8 ± 1.1 °C in plane gradient and a 19.7 ± 0.8 °C thermal gradient perpendicular to the stack, which results in large current density distributions and local state of charge differences within the cell. The implications of these thermal and electrical inhomogeneities on ageing and battery pack design for the automotive industry are discussed.
The Potential of an Alliance of Media Literacy Education and Media Criticism in Russia
Levitskaya, Anastasia
2015-01-01
Media criticism and media literacy education have much in common. For example, media literacy education and media criticism attaches great importance to the development of analytical thinking audience. Indeed, one of the most important tasks of media literacy education is precisely to teach the audience not only to analyze media texts of any kinds…
Murugesan, Arul; Gengan, Robert Moonsamy; Rajamanikandan, Ramar; Ilanchelian, Malaichamy
2017-12-01
A series of novel dispiro piperazinyl-quinolinyl-thioxothiazolidin-2, 4-dione derivatives were synthesised and characterised by FT-IR 1H, 13C, 2D NMR and HRMS spectroscopic techniques. A representative compound 1'-(2-(4-methylpiperazin-1-yl)quinolin-3-yl)-2″-thioxo-5‧,6‧,7‧,7a'-tetrahydro-1‧H,2H-dispiro[acenaphthylene-1,3‧-pyrrolizine-2‧,5″-thiazolidine]-2,4″-dione was studied for its binding ability with human serum albumin (HSA) using the fluorescence quench titration method. Addition of the compound to HSA produced slight fluorescence quenching and red shift. The free energy change for the complexation process was evaluated as -29.98 kJ mol-1 thereby indicating a spontaneous and highly favourable reaction. Molecular docking analyses revealed the binding as -20.79 kJ mol-1 which was analogous with the experimental value obtained from emission data. It was concluded that TYR-263 is the moiety responsible for the binding in the complex.
Mass Media: The Invisible Environment.
Glessing, Robert J.; White, William P.
This anthology for students of media consists of essays and articles grouped under four topics: media forms, media content, media environments, and "the last word." Media forms deals with the nature of these kinds of media: electronic, print, film, music, and comics, graffiti, and clothing. Media content contains articles on the news, advertising,…
The spatial and temporal characterisation of flooding within the ...
African Journals Online (AJOL)
The inundated area of a wetland is characterised by annual and interannual variability. This paper presents remotely-sensed imagery in order to better understand the spatial and temporal patterns of flooding within the floodplain wetland of the Nyl River, Limpopo Province. A detailed understanding of the hydrological ...
Procedural Media Representation
Henrysson, Anders
2002-01-01
We present a concept for using procedural techniques to represent media. Procedural methods allow us to represent digital media (2D images, 3D environments etc.) with very little information and to render it photo realistically. Since not all kind of content can be created procedurally, traditional media representations (bitmaps, polygons etc.) must be used as well. We have adopted an object-based media representation where an object can be represented either with a procedure or with its trad...
DEFF Research Database (Denmark)
Vestergaard, Vitus; Mortensen, Christian Hviid
In recent years many museums have experimented with different approaches to involving users through digital media. We explore how remixing and content sharing can be used as a means for user participation. Remix culture is seen as a culture that allows and encourages the production of derivative...... works; works that are based on already existing works. This cultural practice thrives throughout the Internet, most notably on web2.0 sites like YouTube. The Media Museum has embraced the remix paradigm with the development of an interactive media experience centre called the Media Mixer. Here...... the museum users can produce, deconstruct, reconstruct and finally publish and share digital media content. The media content is created by the user in the museums physical environment, but it can be mixed with material from local or global archives. In that way the gap between the analogue and the digital...
PENGEMBANGAN MEDIA PEMBELAJARAN FILM ANIMASI SEBAGAI MEDIA PEMBELAJARAN KONSEP FOTOSINTESIS
Directory of Open Access Journals (Sweden)
Umrotul Hasanah
2015-11-01
Full Text Available The research aims to develop animation film as a learning media in photosynthesis concept learning and to know the results of the assessment of the learning media expert test the concept of photosynthesis animated films. This research is Research and Development (R&D. The research used questionnaire Aspects of assessment in terms of the media covering aspects of technical quality, narration, and music/sound effects. Aspects of the assessment of the suitability of the material terms covering the material aspects of the curriculum, the clarity of the material, the order of the material, communicative, suitability of the material with the purpose of learning, material relationship with the students’ critical thinking skill, and material relationship with motivation. Media expert test against “Cahaya dan Fotosintesis” animated film made by media experts with a percentage of 80,6% with the as good category, and 92,5% are material expert excellent category. Based on the “Cahaya dan Fotosintesis” animated film expert test to students can be tasted on a limited basis, after the media deficiencies corrected.
Media Outlook 2016: A Survey of UK Media Trends and Firm Capabilities
Oliver, John James
2016-01-01
The aim of this survey is to understand the changing nature of the UK media environment, emerging trends and the management practices of media executives. This is the fourth year that the survey has run, and already we are seeing immense changes in the way media firms are adapting to a changing competitive landscape. This year, the focus of the survey has been on assessing media firm capabilities and the ability to adapt media strategy, business models and capabilities to new industry dynamic...
Fial, Julian; Carosella, Stefan; Langheinz, Mario; Wiest, Patrick; Middendorf, Peter
2018-05-01
This paper investigates the application of sensors on carbon fibre textiles for the purpose of textile characterisation and draping process optimisation. The objective is to analyse a textile's condition during the draping operation and actively manipulate boundary conditions in order to create better preform qualities. Various realisations of textile integrated sensors are presented, focusing on the measurement of textile strain. Furthermore, a complex textile characterisation approach is presented where these sensors shall be implemented in.
International Nuclear Information System (INIS)
Blanke, D.
1982-01-01
In-vitro experiments with Jodipamid, Jothalamat and Diatrizoat served the purpose of determining influences of contrast media on blood coagulation, fibrinolysis and the complement system. For all three contrast media investigated the effect noted was dose-dependent and was only brought about by concentrations higher than physiological ones. Liver-pathway Jodipamid was seen to have a much stronger effect than the two renal-pathway contrast media Jothalamat and Diatrizoat, which is probably due to the different protein binding capacities. In detail, the results with Jodipamid were as follows: a sharp fall in thrombinogen, a distinct decrease in fibrinogen both in the immunological and functional test, but only delayed decrease in complement factor C 4. Fibrinolytic fission products were found after applying the dose of 30 mM, as compared to 400 mM for the renal-pathway contrast media. Furthermore the functional tests (F I and F II) with Jothalamat and Diatrizoat showed only slight effects, the immunological ones (F I and C 4) none at all. The influence of the contrast media on factors I and II is interpreted by the author as an inhibition of fibrin polymerization. What seems to be the verification of fibrinolytic fission products is explained by a non-specific agglutination reaction, the decrease in C 4 by contrast-medium-induced protein denaturation. (orig./MG) [de
Rapporteur's Report of the Workshop on Radiological Characterisation for Decommissioning
International Nuclear Information System (INIS)
Thierfeldt, Stefan
2012-01-01
In April 2012, the Nuclear Energy Agency, in co-operation with Studsvik Nuclear AB, the Swedish Radiation Safety Authority (SSM), Swedish Nuclear Fuel and Waste Management Company (SKB) and AB SVAFO, held a Workshop on Radiological Characterisation in Decommissioning in Studsvik near Nykoeping (Sweden). During three days, a wide range of presentations, posters, discussions and site visits brought together over 120 participants from 23 countries and 4 international organisations, the IAEA, the WNA, the European Commission and the OECD/NEA. Members of the Task Group on Radiological Characterisation for Decommissioning (RCD) of the WPDD were involved in the preparation of the workshop. Many decommissioning projects of all types of nuclear installations have progressed substantially and/or have been completed to brown field or green field conditions, so that it was the right time to bring together operators, regulators, scientists, consultants and contractors to exchange information and views and to evaluate the information on radiological characterisation gained from this multitude of projects. The outcome will be valuable for the large number of decommissioning projects about to start in the near future. The Workshop consisted of 5 topical sessions and a poster session. The topical sessions were complemented by discussions in the plenary and in smaller groups. This report provides a short summary of the various presentations and discussions. It concentrates on the outcome of the presentations, posters and discussions than giving an account of the spoken word
2010-12-13
... Known as Idearc Media, LLC, a Subsidiary of SuperMedia Information Services, LLC Publishing Group, Troy... Subsidiary of SuperMedia Information Services, LLC, Troy, New York, to apply for Trade Adjustment Assistance..., Publishing Group, Troy, New York, who became totally or partially separated from employment on or after...
Advocates' Experiences With Media and the Impact of Media on Human Trafficking Advocacy.
Houston-Kolnik, Jaclyn D; Soibatian, Christina; Shattell, Mona M
2017-02-01
The present qualitative study explores advocates' opinions of misinformation about human trafficking in the media and describes advocates' strategies to counter the misinformation presented by the media. Thus, 15 advocates who work against human trafficking in Chicago-based nonprofit organizations participated in semistructured interviews about their opinions and strategies. Data were analyzed using thematic content analysis. The present study identifies specific misperceptions of human trafficking in the media, highlights advocates' opinions of this misinformation, and discusses advocates' strategies to counteract inaccurate media, adding support to the role of media advocacy. Advocates note how media images shape and perpetuate stereotypes of trafficking through glamorizing sex work and sensationalizing stories that are most often international depictions of trafficking. Advocates report media generally shares only a piece of the story, simplifying the stories of survivors and the issue of human trafficking. Advocates critique media perpetuating these misperceptions for how they may contribute to policies and programs which fail to address structural factors that create vulnerabilities to be trafficked and the multisystem needs of survivors. However, advocates also note misperceptions can be counteracted by producing sensitive, informed media through social platforms. Advocates share their strategies counteracting misinformation through engaging in informative conversations, utilizing social media to educate, and promoting media messages of survivor agency. Research, clinical, and policy implications are also discussed. The present study emphasizes the importance of decision makers and service providers being critical consumers of media and to assess how media portrayals may (or may not) inform their understanding and response to the issue.
DEFF Research Database (Denmark)
Martiny, Kristian Møller Moltke; Pedersen, David Budtz; Hansted, Alfred Birkegaard
2016-01-01
and extend into a fully-fledged Open Media movement engaging with new media and non-traditional formats of science communication. We discuss two cases where experiments with open media have driven new collaborations between scientists and documentarists. We use the cases to illustrate different advantages...
DEVELOPMENT OF STUDENTS’ MEDIA LITERACY IN THE PROCESS OF CREATING SCHOOL MEDIA
Directory of Open Access Journals (Sweden)
Julia Rybina
2017-04-01
Full Text Available Nowadays, a rapid development of information and communication technologies enables combine a number of formats for presenting information into one communication unit. That is why the media (Internet especially is not just tools for young generation for learning the modern world. Children enjoy in dealing with modern technologies. However not everyone has sufficient skills to objectively assess the true meaning of the information received. That is why children are more inclined for their mind to be manipulated and they are more inclined for blind imitating of attractive images. Owning to the above, the most priority-driven of modern education is the usage of information and communication technologies and media education for forming the skills of students' orientation in the information field and for forming the development of media immunity of the personality which makes the personality able to resist to the aggressive media space. Teachers face the challenge of introducing media education in middle and high schools. To implement the media education at the municipal institution regional specialized residential school “Giftedness” the pedagogical experiment was carried out there. The basis of the experiment is the generalized model of media literacy development for students that was used during for making and functioning the school newspaper «D.A.R-media». Theoretical aspects of the implementation of media education in the teaching and educational process of a specialized educational institution are considered in this study. A model for the development of the media literacy of students in the process of creating a school printed publication is proposed. Some results of research on the level of media literacy of students are highlighted and prospects for work on introducing media education of teachers and teachers are outlined.
Fabrication and Characterisation of Low-noise Monolithic Mode-locked Lasers
DEFF Research Database (Denmark)
Larsson, David
2007-01-01
This thesis deals with the fabrication and characterisation of monolithic semiconductor mode-locked lasers for use in optical communication systems. Other foreseeable applications may be as sources in microwave photonics and optical sampling. The thesis also deals with the design and fabrication...... of intracavity monolithically integrated filters. The common dnominator among the diffrent parts of the thesis is how to achieve and measure the lowest possible noise. Achieving low noise has been pinpointed as one of the most important and difficult challenges for semiconductor mode-locked lasers. The main...... result of this thesis are a fabrication process of a monolithic and deeply etched distributed Bragg reflector and a characterisation system for measurement of quantum limitid timing noise at high repetition rates. The Bragg reflector is a key component in achieving transform limited pulses with low noise...
Nanocatalysts for Ethanol Oxidation: Synthesis and Characterisation
Bonesi, A.; Triaca, W. E.; Luna, A. M. Castro
2009-01-01
Carb on-supported binary PtSn/C and ternary PtSnNi/C catalysts were prepared for the electro-oxidation of ethanol. The carbon-supported nanoparticles were synthesised by employing a modified polyol methodology and characterised in terms of structure, morphology and composition by using XRD, EDX and TEM techniques. Their electro-catalytic behaviour for ethanol oxidation (EO) was investigated by employing a disc-composite electrode covered by a thin layer of catalyst imbedded in a Nafion polyme...
Characterisation of cemented/bituminized LAW and MAW waste products
International Nuclear Information System (INIS)
Vejmelka, P.; Johnsen, P.; Kluger, W.; Koester, R.
1987-01-01
In the context of work for characterising low and medium activity waste products, investigations were carried out to determine the release of radioactivity from binding waste in given accidents, such as mechanical and thermal loading for the operating phase of a final store. The effects of mechanical loads on MAW cement products and the effects of thermal laods on MAW cement and MAW bitumen products were examined. The release of fine dust reaching the lungs, with a particle size of ≤10 μm from a 200 litre roller seam cement binder with a maximum mechanical load of 3x10 5 Nm covering the accident case is about 1.5 g and therefore corresponds to ≅ 10 -4 % of the total radio-activity inventory for homogeneous products. With thermal loading (60 minute oil fire, 800 0 C) ≅ 10 -3 % of the radioactivity inventory is released via the release of water from the waste binder. The activity release of MAW bitumen products containing NaNO 3 (175 litre drum) with thermal load is considerably higher, as due to the NaNO 3 content of the products, after an induction period of about 20 minutes there is an exothermal reaction between the bitumen and the NaNO 3 , which leads to burning of the bitumen with considerable aerosol formation. The Na losses are about 32% and the Pu losses, derived from the results of laboratory experiments with samples containing Eu and Pu and samples containing Eu on the original size, are only 15% maximum, even with complete burn up. It was shown for all the investigations with samples of the original size that the effects of the load cases considered can be reduced or completely avoided by additional packing (concrete shielding). (orig./RB) [de
Characterisation and modelling of defect formation in direct-chill cast AZ80 alloy
Energy Technology Data Exchange (ETDEWEB)
Mackie, D.; Robson, J.D.; Withers, P.J. [School of Materials, University of Manchester, Manchester M13 9PL (United Kingdom); Turski, M. [Magnesium Elektron UK, Rake Lane, Manchester, M27 8BF (United Kingdom)
2015-06-15
Wrought magnesium alloys for demanding structural applications require high quality defect free cast feedstock. The aim of this study was to first identify and characterise typical defects in direct chill cast magnesium–aluminium–zinc (AZ) alloy billet and then use modelling to understand the origins of these defects so they can be prevented. Defects were first located using ultrasonic inspection and were then characterised using X-ray computed tomography (XCT) and serial sectioning, establishing the presence of oxide films and intermetallic particles Al{sub 8}Mn{sub 5} in all defects. A model was developed to predict the flow patterns and growth kinetics of the intermetallic phases during casting, which influence the formation of defects. Simulation of the growth of the intermetallic particles demonstrated that precipitation from the liquid occurs in the mould. The combination of the entrained oxide films and intermetallic particles recirculates in the liquid metal and continues to grow, until large enough to settle, which is predicted to occur at the centre of the mould where the flow is the slowest. Based on these predictions, strategies to reduce the susceptibility to defect formation are suggested. - Highlights: • Casting defects in magnesium direct chill casting have been imaged and characterised in 3-dimensions. • The occurrences of co-located clusters of particles and oxide films have been characterised and explained. • A coupled model has been developed to help interpret the observed trend for defects located towards the centre of billets.
Characterisation and modelling of defect formation in direct-chill cast AZ80 alloy
International Nuclear Information System (INIS)
Mackie, D.; Robson, J.D.; Withers, P.J.; Turski, M.
2015-01-01
Wrought magnesium alloys for demanding structural applications require high quality defect free cast feedstock. The aim of this study was to first identify and characterise typical defects in direct chill cast magnesium–aluminium–zinc (AZ) alloy billet and then use modelling to understand the origins of these defects so they can be prevented. Defects were first located using ultrasonic inspection and were then characterised using X-ray computed tomography (XCT) and serial sectioning, establishing the presence of oxide films and intermetallic particles Al 8 Mn 5 in all defects. A model was developed to predict the flow patterns and growth kinetics of the intermetallic phases during casting, which influence the formation of defects. Simulation of the growth of the intermetallic particles demonstrated that precipitation from the liquid occurs in the mould. The combination of the entrained oxide films and intermetallic particles recirculates in the liquid metal and continues to grow, until large enough to settle, which is predicted to occur at the centre of the mould where the flow is the slowest. Based on these predictions, strategies to reduce the susceptibility to defect formation are suggested. - Highlights: • Casting defects in magnesium direct chill casting have been imaged and characterised in 3-dimensions. • The occurrences of co-located clusters of particles and oxide films have been characterised and explained. • A coupled model has been developed to help interpret the observed trend for defects located towards the centre of billets
The effect of ethanol on 35-S-TBPS binding to mouse brain membranes in the presence of chloride
International Nuclear Information System (INIS)
Liljequist, S.; Culp, S.; Tabakoff, B.
1989-01-01
The effect of in vitro and in vivo administration of ethanol on the binding of 35 S-t-butyl-bicyclophosphorothionate ( 35 S-TBPS) to cortical brain membranes of C57B1 mice was investigated using KCl (100 mM) containing assay media. The in vitro addition of ethanol produced a dose-dependent inhibition of basal 35 S-TBPS binding. In the presence of chloride ions, GABA and pentobarbital had a biphasic action (stimulation followed by inhibition) on 35 S-TBPS binding, whereas diazepam only stimulated the binding. Ethanol reduced the stimulatory effects of GABA and pentobarbital in a dose-dependent manner, but had no effect on the enhancement of 35 S-TBPS binding produced by diazepam. 35 S-TBPS binding to cortical brain membranes was inhibited by the putative Cl - channel blocking agent DIDS. This inhibitory action of DIDS was significantly, and dose-dependently reduced by ethanol (≤ 100 mM ethanol). Chronic ethanol ingestion in vivo, which produced tolerance to and physical dependence on ethanol in the animals, did not alter the stimulatory and inhibitory effects of GABA and pentobarbital on 35 S-TBPS binding. The enhancement of 35 S-TBPS binding produced by diazepam was slightly, but significantly, enhanced in brain membranes from animals which had undergone 24 hours of ethanol withdrawal. Chronic ethanol treatment did not change the potency of picrotoxin and of the peripheral BDZ-receptor ligand RO 5-4864 to competitively inhibit 35 S-TBPS binding. Our results suggest that in vitro addition of ethanol alters the activity of the activity of the GABA benzodiazepine (BDZ) receptor complex. Although there was no change in basal 35 S-TBPS binding following chronic in vivo ethanol administration, our curent data suggest that chronic ethanol ingestion may cause specific changes of the GABA BDZ receptor proteins, in this study revealed as an altered modulation of 35 S-TBPS binding by diazepam. (author)
Cakir, Evrim; Ozbek, Mustafa; Sahin, Mustafa; Cakal, Erman; Gungunes, Askin; Ginis, Zeynep; Demirci, Taner; Delibasi, Tuncay
2012-12-18
Women with polycystic ovary syndrome (PCOS) have higher risk for cardiovascular disease (CVD). Heart type fatty acid binding protein (HFABP) has been found to be predictive for myocardial ischemia.Wet ested whether HFABP is the predictor for CVD in PCOS patients, who have an increased risk of cardiovascular disease. This was a prospective, cross sectional controlled study conducted in a training and research hospital.The study population consisted of 46 reproductive-age PCOS women and 28 control subjects. We evaluated anthropometric and metabolic parameters, carotid intima media thickness and HFABP levels in both PCOS patients and control group. Mean fasting insulin, homeostasis model assessment insulin resistance index (HOMA-IR), triglyceride, total cholesterol, low density lipoprotein cholesterol, free testosterone, total testosterone, carotid intima media thickness (CIMT) levels were significantly higher in PCOS patients. Although HFABP levels were higher in PCOS patients, the difference did not reach statistically significant in early age groups. After adjustment for age and body mass index, HFABP level was positive correlated with hsCRP, free testosterone levels, CIMT and HOMA-IR. Heart type free fatty acid binding protein appeared to have an important role in metabolic response and subsequent development of atherosclerosis in insulin resistant, hyperandrogenemic PCOS patients.
Directory of Open Access Journals (Sweden)
Cakir Evrim
2012-12-01
Full Text Available Abstract Background Women with polycystic ovary syndrome (PCOS have higher risk for cardiovascular disease (CVD. Heart type fatty acid binding protein (HFABP has been found to be predictive for myocardial ischemia.Wet ested whether HFABP is the predictor for CVD in PCOS patients, who have an increased risk of cardiovascular disease. Methods This was a prospective, cross sectional controlled study conducted in a training and research hospital.The study population consisted of 46 reproductive-age PCOS women and 28 control subjects. We evaluated anthropometric and metabolic parameters, carotid intima media thickness and HFABP levels in both PCOS patients and control group. Results Mean fasting insulin, homeostasis model assessment insulin resistance index (HOMA-IR, triglyceride, total cholesterol, low density lipoprotein cholesterol, free testosterone, total testosterone, carotid intima media thickness (CIMT levels were significantly higher in PCOS patients. Although HFABP levels were higher in PCOS patients, the difference did not reach statistically significant in early age groups. After adjustment for age and body mass index, HFABP level was positive correlated with hsCRP, free testosterone levels, CIMT and HOMA-IR. Conclusions Heart type free fatty acid binding protein appeared to have an important role in metabolic response and subsequent development of atherosclerosis in insulin resistant, hyperandrogenemic PCOS patients.
Kuter-Luks, Theresa; Heuvelman, Ard; Peters, Oscar
2011-01-01
Despite clear European and Dutch policies about media education, there is currently no media education curriculum in Dutch schools. A survey among preadolescents (n = 257) in six primary schools in the Netherlands included questions regarding media access, fears, risks, parental mediation of television and the internet, and the need for media…
DEFF Research Database (Denmark)
This work consists of 12 essays on different aspects of Asian media by Japanese, European, and American scholars, many of whom have themselves been involved in the production of media forms. Working in the fields of anthropology, media and cultural studies, and on the basis of hands-on research, ......, they have written a book on the social practices and cultural attitudes of people producing, reading, watching and listening to different kinds of media in Japan, China, Taiwan, Indonesia, Vietnam, Singapore and India....
Dubose, Cheryl
2011-01-01
The growing popularity and use of social media tools such as Facebook, YouTube, Twitter, blogging, and wikis have led to a social media revolution. Given this widespread influence, it is important for educators, administrators, and technologists to understand the risks of using social media in the classroom and workplace. To investigate popular social media sites and their effect on radiologic technology education and business practices. A comprehensive search of literature was performed to examine social media and its applications in education, health care, and business. Social media use is on the rise, affecting all aspects of mainstream society. Leaders in the radiologic sciences should be familiar with social media and cognizant of its risks. Future studies regarding social media use in the radiologic sciences are necessary to determine its effect on the radiologic science community. ©2011 by the American Society of Radiologic Technologists.
Directory of Open Access Journals (Sweden)
Alexander Fedorov
2011-03-01
Full Text Available The author supposed that media education models can be divided into the following groups:- educational-information models (the study of the theory, history, language of media culture, etc., based on the cultural, aesthetic, semiotic, socio-cultural theories of media education;- educational-ethical models (the study of moral, religions, philosophical problems relying on the ethic, religious, ideological, ecological, protectionist theories of media education;- pragmatic models (practical media technology training, based on the uses and gratifications and ‘practical’ theories of media education;- aesthetical models (aimed above all at the development of the artistic taste and enriching the skills of analysis of the best media culture examples. Relies on the aesthetical (art and cultural studies theory; - socio-cultural models (socio-cultural development of a creative personality as to the perception, imagination, visual memory, interpretation analysis, autonomic critical thinking, relying on the cultural studies, semiotic, ethic models of media education.
To Trust or Not to Trust? What Drives Public Trust in Science in Social Media Engagement
Hwong, Y. L.; Oliver, C.; Van Kranendonk, M. J.
2017-12-01
social media science communication is more effective when scientists are aware of the nuances that characterise communications on virtual platforms. It may be that by being open, authentic and sensitive to the worldview of their audiences, scientists stand to get the most out of the opportunities offered by social media to improve public perception of science.
Directory of Open Access Journals (Sweden)
Ido Prijana Hadi
2011-07-01
Full Text Available My aim in writing this paper is to describe that in this fast-changing world, media in Indonesia has undergone a rapid transformation. Digital technology continues to reshape the mass media landscape using internet technology. Internet brings a technical communication revolution, a fundamental change takes place in the structure of connections, artificial memories and the reproduction of their content. Internet technology has made communication much easier and less expensive. It has attracted many people and has penetrated into people’s daily lives. The mass media also have accepted the internet. Almost all forms of traditional media (old media in local media, such as radio, television, and newspaper have extended their work into this new field. The internet and the World Wide Web have both significantly influenced modern journalism. In online media allows readers to enjoy browsing their product and service of contents, such as news feed, podcasts, desktop alert, news on mobile phones, PDA and others mobile devices. Online media offer not only text but also digital images , audio file, moving images (video, internet radio and internet t v. The interactive features of the internet seemingly imply that online media have more advantages than traditional media forms (old media. So, the internet have dramatically evolved become new media with characteristic multimedia, hypertext, interactivity, archives , and virtuality. The most important structural new media characteristic is the integration of telecommunications, data communications and mass communication in a single medium – it is the convergence. It should be pointed out that the trend toward digital is affecting the various media and brings the local media in East Java to become a global media, where breaking news from Surabaya or anywhere in East Java is transmitted to around the world in a matter of minutes . The research was carried out to find out how user reception on convergence media
Wilson, Patrick A; Cherenack, Emily M; Jadwin-Cakmak, Laura; Harper, Gary W
2018-01-01
Although a growing number of psychosocial health promotion interventions use the critical analysis of media to facilitate behavior change, no specific guidelines exist to assist researchers and practitioners in the selection and evaluation of culturally relevant media stimuli for intervention development. Mobilizing Our Voices for Empowerment is a critical consciousness-based health enhancement intervention for HIV-positive Black young gay/bisexual men that employs the critical analysis of popular media. In the process of developing and testing this intervention, feedback on media stimuli was collected from youth advisory board members (n = 8), focus group participants (n = 19), intervention participants (n = 40), and intervention facilitators (n = 6). A thematic analysis of qualitative data resulted in the identification of four key attributes of media stimuli and participants' responses to media stimuli that are important to consider when selecting and evaluating media stimuli for use in behavioral health interventions employing the critical analysis of media: comprehension, relevance, emotionality, and action. These four attributes are defined and presented as a framework for evaluating media, and adaptable tools are provided based on this framework to guide researchers and practitioners in the selection and evaluation of media for similar interventions.
Cross-media advertising: brand promotion in an age of media convergence
Voorveld, H.; Smit, E.; Neijens, P.; Diehl, S.; Karmasin, M.
2013-01-01
Cross-media advertising, in which more than one medium platform is used to communicate related brand content, has become widespread. Several reasons for cross-media strategies can be distinguished: target group extension, complementary effects, repetition, and synergy. Media synergy—the added value
The impacts of post-media networks on the traditional media
Directory of Open Access Journals (Sweden)
Dr. Francisco Campos Freire
2008-01-01
Full Text Available The fast and successful penetration in society of the so-called social networks in the past two or three years has alarmed the traditional media. The new phenomenon reaches a wider audience, enhances advertising, achieves customization, and breaches some of the barriers of traditional media. The new communication channel is used already by millions of Internet users as their main source of information and entertainment. This research paper analyses the structure of eleven global social networks, which feature contents in Spanish and other languages, in relation to the electronic version (e-version of the main Spanish newspapers. The aim is to prove if the so-called social networks are a new type of media, a new platform for social relationships and post-media contents, which look more like the audiovisual media than the traditional newspapers.
Comprehension of digital media
International Nuclear Information System (INIS)
Kim, Ju Hwan
2008-11-01
This book is divided four parts. The first part describes media and mark on sign and media, what is the sign?, interpretation of sign and semiotics. The second part is for production sign theory and origin of digital revolution such as the problem of origin of digital revolution, homogeneity of producing goods and sign : triple triangle model for production sign theory, triple triangle model for producing goods, triple triangle model of producing sign and triple triangle model of art works. The third parts deals with development of the media and meaning of digital revolution with four changes : invention of letter, appearance of printed media and establishment modernity, appearance electronic media and mess media and appearance of digital media. The last part mentions ontology of world wide web.
Comprehension of digital media
Energy Technology Data Exchange (ETDEWEB)
Kim, Ju Hwan
2008-11-15
This book is divided four parts. The first part describes media and mark on sign and media, what is the sign?, interpretation of sign and semiotics. The second part is for production sign theory and origin of digital revolution such as the problem of origin of digital revolution, homogeneity of producing goods and sign : triple triangle model for production sign theory, triple triangle model for producing goods, triple triangle model of producing sign and triple triangle model of art works. The third parts deals with development of the media and meaning of digital revolution with four changes : invention of letter, appearance of printed media and establishment modernity, appearance electronic media and mess media and appearance of digital media. The last part mentions ontology of world wide web.
Post Media Literacy: Menyaksikan Kuasa Media Bersama Michel Foucault
Iswandi Syahputra
2017-01-01
This article would like to present Michel Foucault’s idea concerning Knowledge and Power in media industry. As a contemporary intellectual, Foucault’s thought has a unique style of postmodernism. His thought had gone beyond traditional critical theory whose trying to disclose the relation of power and economic behind the ideology of media. Foucault’s thought had given new perspective in understanding how the media produce truth under tightly control process into something that seems normal. ...
The use dynamic avalanching and fractal analysis to characterise uranium oxide powders
International Nuclear Information System (INIS)
Hobbs, J.W.; Rhodes, D.
2000-01-01
Direct thermal denitration is an attractive method of co-converting mixed-metal nitrate solutions of plutonium and uranium into oxide because of its apparent simplicity. Such benefits are often marred by the relatively poor powder quality and handling characteristics, which can be overcome by modifications to the process chemistry. To ensure that powder synthesis routes under assessment require the minimal further processing it is necessary to be able to characterise the powder fully in term of the key fundamental properties. This paper will demonstrate the use of a dynamic avalanching technique, fractal analysis and morphology to assess processing behaviour. The use of dynamic avalanching to uniquely characterise the chaotic flow properties of urania powders has proved successful and results have shown that this technique is capable of detecting small differences in processing behaviour due changes in morphologies and particle size distribution. This technique has promise for being able to provide nearly instantaneous feedback to the powder generation process being monitored (e.g. calcination, milling, mixing). The use of fractals to describe powders is an interesting characterisation tool when combined with morphological shape factors and the flow index. (authors)
Five of Five VHHs Neutralizing Poliovirus Bind the Receptor-Binding Site.
Strauss, Mike; Schotte, Lise; Thys, Bert; Filman, David J; Hogle, James M
2016-01-13
Nanobodies, or VHHs, that recognize poliovirus type 1 have previously been selected and characterized as candidates for antiviral agents or reagents for standardization of vaccine quality control. In this study, we present high-resolution cryo-electron microscopy reconstructions of poliovirus with five neutralizing VHHs. All VHHs bind the capsid in the canyon at sites that extensively overlap the poliovirus receptor-binding site. In contrast, the interaction involves a unique (and surprisingly extensive) surface for each of the five VHHs. Five regions of the capsid were found to participate in binding with all five VHHs. Four of these five regions are known to alter during the expansion of the capsid associated with viral entry. Interestingly, binding of one of the VHHs, PVSS21E, resulted in significant changes of the capsid structure and thus seems to trap the virus in an early stage of expansion. We describe the cryo-electron microscopy structures of complexes of five neutralizing VHHs with the Mahoney strain of type 1 poliovirus at resolutions ranging from 3.8 to 6.3Å. All five VHHs bind deep in the virus canyon at similar sites that overlap extensively with the binding site for the receptor (CD155). The binding surfaces on the VHHs are surprisingly extensive, but despite the use of similar binding surfaces on the virus, the binding surface on the VHHs is unique for each VHH. In four of the five complexes, the virus remains essentially unchanged, but for the fifth there are significant changes reminiscent of but smaller in magnitude than the changes associated with cell entry, suggesting that this VHH traps the virus in a previously undescribed early intermediate state. The neutralizing mechanisms of the VHHs and their potential use as quality control agents for the end game of poliovirus eradication are discussed. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
AYTEN, Adem
2013-01-01
Social media, is one of the most researched facts today by the commications fellows. To get in use by Web 2.0 social media becomes common due to the rise of using mobile technologies. Instead of competing with traditional media and being an alternative media, social media is a new media that traditional media can transfer its content to it and can benefit its advantages. Indeed,the traditional media carried its content to the websites to access of their readers/listeners/watchers to compete ...
Quantitative frequency-domain fluorescence spectroscopy in tissues and tissue-like media
Cerussi, Albert Edward
1999-09-01
In the never-ending quest for improved medical technology at lower cost, modern near-infrared optical spectroscopy offers the possibility of inexpensive technology for quantitative and non-invasive diagnoses. Hemoglobin is the dominant chromophore in the 700-900 nm spectral region and as such it allows for the optical assessment of hemoglobin concentration and tissue oxygenation by absorption spectroscopy. However, there are many other important physiologically relevant compounds or physiological states that cannot be effectively sensed via optical methods because of poor optical contrast. In such cases, contrast enhancements are required. Fluorescence spectroscopy is an attractive component of optical tissue spectroscopy. Exogenous fluorophores, as well as some endogenous ones, may furnish the desperately needed sensitivity and specificity that is lacking in near-infrared optical tissue spectroscopy. The main focus of this thesis was to investigate the generation and propagation of fluorescence photons inside tissues and tissue-like media (i.e., scattering dominated media). The standard concepts of fluorescence spectroscopy have been incorporated into a diffusion-based picture that is sometimes referred to as photon migration. The novelty of this work lies in the successful quantitative recovery of fluorescence lifetimes, absolute fluorescence quantum yields, fluorophore concentrations, emission spectra, and both scattering and absorption coefficients at the emission wavelength from a tissue-like medium. All of these parameters are sensitive to the fluorophore local environment and hence are indicators of the tissue's physiological state. One application demonstrating the capabilities of frequency-domain lifetime spectroscopy in tissue-like media is a study of the binding of ethidium bromide to bovine leukocytes in fresh milk. Ethidium bromide is a fluorescent dye that is commonly used to label DNA, and hence visualize chromosomes in cells. The lifetime of
Characterisation of a novel Mannheimia sp from Australian feedlot cattle
DEFF Research Database (Denmark)
Blackall, P.J.; Angen, Øystein; Fegan, N.
2001-01-01
glucosida, M granulomatis, M ruminalis and M varigena - using a range of phenotypic and genotypic methods. Results Phenotypic characterisation indicated that the isolates belonged to the trehalose-negative [Pasteurella] haemolytica complex. This complex has recently been reorganised into five species within...
Microscopic characterisation of suspended graphene grown by chemical vapour deposition
Bignardi, L.; Dorp, W.F. van; Gottardi, S.; Ivashenko, O.; Dudin, P.; Barinov, A.; de Hosson, J.T.M.; Stöhr, M.; Rudolf, P.
2013-01-01
We present a multi-technique characterisation of graphene grown by chemical vapour deposition (CVD) and thereafter transferred to and suspended on a grid for transmission electron microscopy (TEM). The properties of the electronic band structure are investigated by angle-resolved photoelectron
Jordan, Amy B.
2008-01-01
Amy Jordan addresses the need to balance the media industry's potentially important contributions to the healthy development of America's children against the consequences of excessive and age-inappropriate media exposure. Much of the philosophical tension regarding how much say the government should have about media content and delivery stems…
van Kruistum, Claudia; Leseman, Paul Pm; de Haan, Mariëtte
2014-01-01
In this article, the concept of "media lifestyles" is adopted in order to develop a comprehensive approach toward youth engagement in communication media. We explore how 503 Dutch eighth grade students with full access to new technology combine a broad range of media by focusing on their engagement
The parental media mediation context of young children’s media use
Piotrowski, J.T.; Barr, R.; Linebarger, D.N.
2017-01-01
Researchers widely agree that how children spend their time is an important predictor of the development of their skills, relationships, attitudes, and behavior patterns. And while media estimates indicate that media play a considerable presence in the daily life of most youngsters today, media use
Understanding Social Media Logic
José van Dijck; Thomas Poell
2013-01-01
Over the past decade, social media platforms have penetrated deeply into the mechanics of everyday life, affecting people's informal interactions, as well as institutional structures and professional routines. Far from being neutral platforms for everyone, social media have changed the conditions and rules of social interaction. In this article, we examine the intricate dynamic between social media platforms, mass media, users, and social institutions by calling attention to social media log...
Characterisation of the Interaction between Toroidal Vortex Structures and Flame Front Propagation
International Nuclear Information System (INIS)
Long, E J; Hargrave, G K; Jarvis, S; Justham, T; Halliwell, N
2006-01-01
Experimental laser diagnostic data is presented for flame characterisation during interactions with toroidal vortices generated in the wake of an annular obstacle. A novel twin section combustion chamber has been utilised to allow the controlled formation of stable eddy structures into which a flame front can propagate. High speed laser sheet visualisation was employed to record the flow field and flame front temporal development and high-speed digital particle image velocimetry was used to quantify the velocity field of the unburnt mixture ahead of the flame front. Results provide characterisation of the toroidal vortex/flame front interaction for a range of vortex scales of and recirculation strengths
Characterisation of the Interaction between Toroidal Vortex Structures and Flame Front Propagation
Energy Technology Data Exchange (ETDEWEB)
Long, E J; Hargrave, G K; Jarvis, S; Justham, T; Halliwell, N [Wolfson School of Mechanical and Manufacturing Engineering, Loughborough University, Loughborough, Leicestershire, LE11 3TU (United Kingdom)
2006-07-15
Experimental laser diagnostic data is presented for flame characterisation during interactions with toroidal vortices generated in the wake of an annular obstacle. A novel twin section combustion chamber has been utilised to allow the controlled formation of stable eddy structures into which a flame front can propagate. High speed laser sheet visualisation was employed to record the flow field and flame front temporal development and high-speed digital particle image velocimetry was used to quantify the velocity field of the unburnt mixture ahead of the flame front. Results provide characterisation of the toroidal vortex/flame front interaction for a range of vortex scales of and recirculation strengths.
Characterisation of the Interaction between Toroidal Vortex Structures and Flame Front Propagation
Long, E. J.; Hargrave, G. K.; Jarvis, S.; Justham, T.; Halliwell, N.
2006-07-01
Experimental laser diagnostic data is presented for flame characterisation during interactions with toroidal vortices generated in the wake of an annular obstacle. A novel twin section combustion chamber has been utilised to allow the controlled formation of stable eddy structures into which a flame front can propagate. High speed laser sheet visualisation was employed to record the flow field and flame front temporal development and high-speed digital particle image velocimetry was used to quantify the velocity field of the unburnt mixture ahead of the flame front. Results provide characterisation of the toroidal vortex/flame front interaction for a range of vortex scales of and recirculation strengths.
Energy Technology Data Exchange (ETDEWEB)
Sandoval, D. M. (Dana M.); Strittmatter, R. B. (Richard B.); Abeyta, J. D. (Joline D.); Brown, J. (John); Marks, T. (Thomas), Jr.; Martinez, B. J. (Benny J.); Jones, D. B. (Dana Benelli); Hsue, W.
2004-01-01
The initial objectives of this effort were to provide a hardware and software platform that can address the requirements for the accountability of classified removable electronic media and vault access logging. The Media Tracker system software assists classified media custodian in managing vault access logging and Media Tracking to prevent the inadvertent violation of rules or policies for the access to a restricted area and the movement and use of tracked items. The MediaTracker system includes the software tools to track and account for high consequence security assets and high value items. The overall benefits include: (1) real-time access to the disposition of all Classified Removable Electronic Media (CREM), (2) streamlined security procedures and requirements, (3) removal of ambiguity and managerial inconsistencies, (4) prevention of incidents that can and should be prevented, (5) alignment with the DOE's initiative to achieve improvements in security and facility operations through technology deployment, and (6) enhanced individual responsibility by providing a consistent method of dealing with daily responsibilities. In response to initiatives to enhance the control of classified removable electronic media (CREM), the Media Tracker software suite was developed, piloted and implemented at the Los Alamos National Laboratory beginning in July 2000. The Media Tracker software suite assists in the accountability and tracking of CREM and other high-value assets. One component of the MediaTracker software suite provides a Laboratory-approved media tracking system. Using commercial touch screen and bar code technology, the MediaTracker (MT) component of the MediaTracker software suite provides an efficient and effective means to meet current Laboratory requirements and provides new-engineered controls to help assure compliance with those requirements. It also establishes a computer infrastructure at vault entrances for vault access logging, and can
International Nuclear Information System (INIS)
Sandoval, D.M.; Strittmatter, R.B.; Abeyta, J.D.; Brown, J.; Marks, T. Jr.; Martinez, B.J.; Jones, D.B.; Hsue, W.
2004-01-01
The initial objectives of this effort were to provide a hardware and software platform that can address the requirements for the accountability of classified removable electronic media and vault access logging. The Media Tracker system software assists classified media custodian in managing vault access logging and Media Tracking to prevent the inadvertent violation of rules or policies for the access to a restricted area and the movement and use of tracked items. The MediaTracker system includes the software tools to track and account for high consequence security assets and high value items. The overall benefits include: (1) real-time access to the disposition of all Classified Removable Electronic Media (CREM), (2) streamlined security procedures and requirements, (3) removal of ambiguity and managerial inconsistencies, (4) prevention of incidents that can and should be prevented, (5) alignment with the DOE's initiative to achieve improvements in security and facility operations through technology deployment, and (6) enhanced individual responsibility by providing a consistent method of dealing with daily responsibilities. In response to initiatives to enhance the control of classified removable electronic media (CREM), the Media Tracker software suite was developed, piloted and implemented at the Los Alamos National Laboratory beginning in July 2000. The Media Tracker software suite assists in the accountability and tracking of CREM and other high-value assets. One component of the MediaTracker software suite provides a Laboratory-approved media tracking system. Using commercial touch screen and bar code technology, the MediaTracker (MT) component of the MediaTracker software suite provides an efficient and effective means to meet current Laboratory requirements and provides new-engineered controls to help assure compliance with those requirements. It also establishes a computer infrastructure at vault entrances for vault access logging, and can accommodate
Solution of Media Risk and Social Responsibility Governance of Social Media
Zhang Yuan; Li Ming-De; Zhang Hong-Bang
2017-01-01
The rapid development of media technology makes the modern society become a “social media” or even “over social media”, the rise of social media makes it beyond the tool attribute, and become an important force in the reconstruction of contemporary society, the risk of concomitant. The anomie and breach of Social media regularly staged, weakened its positive social function, forcing us to think about the social responsibility of social media,which are reflections on the lack of responsibility...
Understanding Social Media Logic
Directory of Open Access Journals (Sweden)
José van Dijck
2013-08-01
Full Text Available Over the past decade, social media platforms have penetrated deeply into the mechanics of everyday life, affecting people's informal interactions, as well as institutional structures and professional routines. Far from being neutral platforms for everyone, social media have changed the conditions and rules of social interaction. In this article, we examine the intricate dynamic between social media platforms, mass media, users, and social institutions by calling attention to social media logic—the norms, strategies, mechanisms, and economies—underpinning its dynamics. This logic will be considered in light of what has been identified as mass media logic, which has helped spread the media's powerful discourse outside its institutional boundaries. Theorizing social media logic, we identify four grounding principles—programmability, popularity, connectivity, and datafication—and argue that these principles become increasingly entangled with mass media logic. The logic of social media, rooted in these grounding principles and strategies, is gradually invading all areas of public life. Besides print news and broadcasting, it also affects law and order, social activism, politics, and so forth. Therefore, its sustaining logic and widespread dissemination deserve to be scrutinized in detail in order to better understand its impact in various domains. Concentrating on the tactics and strategies at work in social media logic, we reassess the constellation of power relationships in which social practices unfold, raising questions such as: How does social media logic modify or enhance existing mass media logic? And how is this new media logic exported beyond the boundaries of (social or mass media proper? The underlying principles, tactics, and strategies may be relatively simple to identify, but it is much harder to map the complex connections between platforms that distribute this logic: users that employ them, technologies that
X-ray characterisation of nanostructured materials
DEFF Research Database (Denmark)
Oddershede, Jette
X-ray powder di®raction (XRPD) is an excellent tool for characterising the bulk structure of crystalline materials. Along with the growing interest in exploiting materials with decreasing particle sizes and increasing number of defects, factors that complicate the traditional interpretation...... of the experi- mental XRPD patterns, the need for new interpretation methods has arisen. The method described in the present thesis is by no means new, in fact it was developed by Debye in 1915. However, the Debye method it is rather computationally heavy, so in practise it is only applicable to the X-ray char...