Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

A SSVEP Stimuli Encoding Method Using Trinary Frequency-Shift Keying Encoded SSVEP (TFSK-SSVEP

Directory of Open Access Journals (Sweden)

Xing Zhao

2017-06-01

Full Text Available SSVEP is a kind of BCI technology with advantage of high information transfer rate. However, due to its nature, frequencies could be used as stimuli are scarce. To solve such problem, a stimuli encoding method which encodes SSVEP signal using Frequency Shift–Keying (FSK method is developed. In this method, each stimulus is controlled by a FSK signal which contains three different frequencies that represent “Bit 0,” “Bit 1” and “Bit 2” respectively. Different to common BFSK in digital communication, “Bit 0” and “Bit 1” composited the unique identifier of stimuli in binary bit stream form, while “Bit 2” indicates the ending of a stimuli encoding. EEG signal is acquired on channel Oz, O1, O2, Pz, P3, and P4, using ADS1299 at the sample rate of 250 SPS. Before original EEG signal is quadrature demodulated, it is detrended and then band-pass filtered using FFT-based FIR filtering to remove interference. Valid peak of the processed signal is acquired by calculating its derivative and converted into bit stream using window method. Theoretically, this coding method could implement at least 2n−1 (n is the length of bit command stimulus while keeping the ITR the same. This method is suitable to implement stimuli on a monitor and where the frequency and phase could be used to code stimuli is limited as well as implementing portable BCI devices which is not capable of performing complex calculations.

Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity.

Directory of Open Access Journals (Sweden)

Céline M Bourdin

Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be

Experimental quantum key distribution at 1.3 gigabit-per-second secret-key rate over a 10 dB loss channel

Science.gov (United States)

Zhang, Zheshen; Chen, Changchen; Zhuang, Quntao; Wong, Franco N. C.; Shapiro, Jeffrey H.

2018-04-01

Quantum key distribution (QKD) enables unconditionally secure communication ensured by the laws of physics, opening a promising route to security infrastructure for the coming age of quantum computers. QKD’s demonstrated secret-key rates (SKRs), however, fall far short of the gigabit-per-second rates of classical communication, hindering QKD’s widespread deployment. QKD’s low SKRs are largely due to existing single-photon-based protocols’ vulnerability to channel loss. Floodlight QKD (FL-QKD) boosts SKR by transmitting many photons per encoding, while offering security against collective attacks. Here, we report an FL-QKD experiment operating at a 1.3 Gbit s‑1 SKR over a 10 dB loss channel. To the best of our knowledge, this is the first QKD demonstration that achieves a gigabit-per-second-class SKR, representing a critical advance toward high-rate QKD at metropolitan-area distances.

Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

Directory of Open Access Journals (Sweden)

Baiquan Ma

2015-11-01

Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

Genome-wide identification of key modulators of gene-gene interaction networks in breast cancer.

Science.gov (United States)

Chiu, Yu-Chiao; Wang, Li-Ju; Hsiao, Tzu-Hung; Chuang, Eric Y; Chen, Yidong

2017-10-03

With the advances in high-throughput gene profiling technologies, a large volume of gene interaction maps has been constructed. A higher-level layer of gene-gene interaction, namely modulate gene interaction, is composed of gene pairs of which interaction strengths are modulated by (i.e., dependent on) the expression level of a key modulator gene. Systematic investigations into the modulation by estrogen receptor (ER), the best-known modulator gene, have revealed the functional and prognostic significance in breast cancer. However, a genome-wide identification of key modulator genes that may further unveil the landscape of modulated gene interaction is still lacking. We proposed a systematic workflow to screen for key modulators based on genome-wide gene expression profiles. We designed four modularity parameters to measure the ability of a putative modulator to perturb gene interaction networks. Applying the method to a dataset of 286 breast tumors, we comprehensively characterized the modularity parameters and identified a total of 973 key modulator genes. The modularity of these modulators was verified in three independent breast cancer datasets. ESR1, the encoding gene of ER, appeared in the list, and abundant novel modulators were illuminated. For instance, a prognostic predictor of breast cancer, SFRP1, was found the second modulator. Functional annotation analysis of the 973 modulators revealed involvements in ER-related cellular processes as well as immune- and tumor-associated functions. Here we present, as far as we know, the first comprehensive analysis of key modulator genes on a genome-wide scale. The validity of filtering parameters as well as the conservativity of modulators among cohorts were corroborated. Our data bring new insights into the modulated layer of gene-gene interaction and provide candidates for further biological investigations.

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Support for calcium channel gene defects in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Lu Ake Tzu-Hui

2012-12-01

Full Text Available Abstract Background Alternation of synaptic homeostasis is a biological process whose disruption might predispose children to autism spectrum disorders (ASD. Calcium channel genes (CCG contribute to modulating neuronal function and evidence implicating CCG in ASD has been accumulating. We conducted a targeted association analysis of CCG using existing genome-wide association study (GWAS data and imputation methods in a combined sample of parent/affected child trios from two ASD family collections to explore this hypothesis. Methods A total of 2,176 single-nucleotide polymorphisms (SNP (703 genotyped and 1,473 imputed covering the genes that encode the α1 subunit proteins of 10 calcium channels were tested for association with ASD in a combined sample of 2,781 parent/affected child trios from 543 multiplex Caucasian ASD families from the Autism Genetics Resource Exchange (AGRE and 1,651 multiplex and simplex Caucasian ASD families from the Autism Genome Project (AGP. SNP imputation using IMPUTE2 and a combined reference panel from the HapMap3 and the 1,000 Genomes Project increased coverage density of the CCG. Family-based association was tested using the FBAT software which controls for population stratification and accounts for the non-independence of siblings within multiplex families. The level of significance for association was set at 2.3E-05, providing a Bonferroni correction for this targeted 10-gene panel. Results Four SNPs in three CCGs were associated with ASD. One, rs10848653, is located in CACNA1C, a gene in which rare de novo mutations are responsible for Timothy syndrome, a Mendelian disorder that features ASD. Two others, rs198538 and rs198545, located in CACN1G, and a fourth, rs5750860, located in CACNA1I, are in CCGs that encode T-type calcium channels, genes with previous ASD associations. Conclusions These associations support a role for common CCG SNPs in ASD.

Expanded functional diversity of shaker K(+ channels in cnidarians is driven by gene expansion.

Directory of Open Access Journals (Sweden)

Timothy Jegla

Full Text Available The genome of the cnidarian Nematostella vectensis (starlet sea anemone provides a molecular genetic view into the first nervous systems, which appeared in a late common ancestor of cnidarians and bilaterians. Nematostella has a surprisingly large and diverse set of neuronal signaling genes including paralogs of most neuronal signaling molecules found in higher metazoans. Several ion channel gene families are highly expanded in the sea anemone, including three subfamilies of the Shaker K(+ channel gene family: Shaker (Kv1, Shaw (Kv3 and Shal (Kv4. In order to better understand the physiological significance of these voltage-gated K(+ channel expansions, we analyzed the function of 18 members of the 20 gene Shaker subfamily in Nematostella. Six of the Nematostella Shaker genes express functional homotetrameric K(+ channels in vitro. These include functional orthologs of bilaterian Shakers and channels with an unusually high threshold for voltage activation. We identified 11 Nematostella Shaker genes with a distinct "silent" or "regulatory" phenotype; these encode subunits that function only in heteromeric channels and serve to further diversify Nematostella Shaker channel gating properties. Subunits with the regulatory phenotype have not previously been found in the Shaker subfamily, but have evolved independently in the Shab (Kv2 family in vertebrates and the Shal family in a cnidarian. Phylogenetic analysis indicates that regulatory subunits were present in ancestral cnidarians, but have continued to diversity at a high rate after the split between anthozoans and hydrozoans. Comparison of Shaker family gene complements from diverse metazoan species reveals frequent, large scale duplication has produced highly unique sets of Shaker channels in the major metazoan lineages.

Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

Science.gov (United States)

Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

2012-09-01

It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method.

Encoding plaintext by Fourier transform hologram in double random phase encoding using fingerprint keys

International Nuclear Information System (INIS)

Takeda, Masafumi; Nakano, Kazuya; Suzuki, Hiroyuki; Yamaguchi, Masahiro

2012-01-01

It has been shown that biometric information can be used as a cipher key for binary data encryption by applying double random phase encoding. In such methods, binary data are encoded in a bit pattern image, and the decrypted image becomes a plain image when the key is genuine; otherwise, decrypted images become random images. In some cases, images decrypted by imposters may not be fully random, such that the blurred bit pattern can be partially observed. In this paper, we propose a novel bit coding method based on a Fourier transform hologram, which makes images decrypted by imposters more random. Computer experiments confirm that the method increases the randomness of images decrypted by imposters while keeping the false rejection rate as low as in the conventional method. (paper)

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

Directory of Open Access Journals (Sweden)

Zhong Tao P

2007-07-01

Full Text Available Abstract Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish. Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3 and duplicate genes for beta4 (zbeta4.1, zbeta4.2. Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The

W-band radio-over-fiber propagation of two optically encoded wavelength channels

Science.gov (United States)

Eghbal, Morad Khosravi; Shadaram, Mehdi

2018-01-01

We propose a W-band wavelength-division multiplexing (WDM)-over-optical code-division multiple access radio-over-fiber system. This system offers capacity expansion by increasing the working frequency to millimeter wave region and by introducing optical encoding and multiwavelength multiplexing. The system's functionality is investigated by software modeling, and the results are presented. The generated signals are data modulated at 10 Gb/s and optically encoded for two wavelength channels and transmitted with a 20-km length of fiber. The received signals are optically decoded and detected. Also, encoding has improved the bit error rate (BER) versus the received optical power margin for the WDM setting by about 4 dB. In addition, the eye-diagram shows that the difference between received optical power levels at the BER of 10-12 to 10-3 is about 1.3% between two encoded channels. This method of capacity improvement is significantly important for the next generation of mobile communication, where millimeter wave signals will be widely used to deliver data to small cells.

Mitigation of Control Channel Jamming via Combinatorial Key Distribution

Science.gov (United States)

Falahati, Abolfazl; Azarafrooz, Mahdi

The problem of countering control channel jamming against internal adversaries in wireless ad hoc networks is addressed. Using combinatorial key distribution, a new method to secure the control channel access is introduced. This method, utilizes the established keys in the key establishment phase to hide the location of control channels without the need for a secure BS. This is in obtained by combination of a collision free one-way function and a combinatorial key establishment method. The proposed scheme can be considered as a special case of the ALOHA random access schemes which uses the common established keys as its seeds to generate the pattern of transmission.

Biometrics based key management of double random phase encoding scheme using error control codes

Science.gov (United States)

Saini, Nirmala; Sinha, Aloka

2013-08-01

In this paper, an optical security system has been proposed in which key of the double random phase encoding technique is linked to the biometrics of the user to make it user specific. The error in recognition due to the biometric variation is corrected by encoding the key using the BCH code. A user specific shuffling key is used to increase the separation between genuine and impostor Hamming distance distribution. This shuffling key is then further secured using the RSA public key encryption to enhance the security of the system. XOR operation is performed between the encoded key and the feature vector obtained from the biometrics. The RSA encoded shuffling key and the data obtained from the XOR operation are stored into a token. The main advantage of the present technique is that the key retrieval is possible only in the simultaneous presence of the token and the biometrics of the user which not only authenticates the presence of the original input but also secures the key of the system. Computational experiments showed the effectiveness of the proposed technique for key retrieval in the decryption process by using the live biometrics of the user.

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Anion channels: master switches of stress responses.

Science.gov (United States)

Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar

2012-04-01

During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

A remarkably stable TipE gene cluster: evolution of insect Para sodium channel auxiliary subunits

Directory of Open Access Journals (Sweden)

Li Jia

2011-11-01

Full Text Available Abstract Background First identified in fruit flies with temperature-sensitive paralysis phenotypes, the Drosophila melanogaster TipE locus encodes four voltage-gated sodium (NaV channel auxiliary subunits. This cluster of TipE-like genes on chromosome 3L, and a fifth family member on chromosome 3R, are important for the optional expression and functionality of the Para NaV channel but appear quite distinct from auxiliary subunits in vertebrates. Here, we exploited available arthropod genomic resources to trace the origin of TipE-like genes by mapping their evolutionary histories and examining their genomic architectures. Results We identified a remarkably conserved synteny block of TipE-like orthologues with well-maintained local gene arrangements from 21 insect species. Homologues in the water flea, Daphnia pulex, suggest an ancestral pancrustacean repertoire of four TipE-like genes; a subsequent gene duplication may have generated functional redundancy allowing gene losses in the silk moth and mosquitoes. Intronic nesting of the insect TipE gene cluster probably occurred following the divergence from crustaceans, but in the flour beetle and silk moth genomes the clusters apparently escaped from nesting. Across Pancrustacea, TipE gene family members have experienced intronic nesting, escape from nesting, retrotransposition, translocation, and gene loss events while generally maintaining their local gene neighbourhoods. D. melanogaster TipE-like genes exhibit coordinated spatial and temporal regulation of expression distinct from their host gene but well-correlated with their regulatory target, the Para NaV channel, suggesting that functional constraints may preserve the TipE gene cluster. We identified homology between TipE-like NaV channel regulators and vertebrate Slo-beta auxiliary subunits of big-conductance calcium-activated potassium (BKCa channels, which suggests that ion channel regulatory partners have evolved distinct lineage

Ion channels in plants.

Science.gov (United States)

Hedrich, Rainer

2012-10-01

Since the first recordings of single potassium channel activities in the plasma membrane of guard cells more than 25 years ago, patch-clamp studies discovered a variety of ion channels in all cell types and plant species under inspection. Their properties differed in a cell type- and cell membrane-dependent manner. Guard cells, for which the existence of plant potassium channels was initially documented, advanced to a versatile model system for studying plant ion channel structure, function, and physiology. Interestingly, one of the first identified potassium-channel genes encoding the Shaker-type channel KAT1 was shown to be highly expressed in guard cells. KAT1-type channels from Arabidopsis thaliana and its homologs from other species were found to encode the K(+)-selective inward rectifiers that had already been recorded in early patch-clamp studies with guard cells. Within the genome era, additional Arabidopsis Shaker-type channels appeared. All nine members of the Arabidopsis Shaker family are localized at the plasma membrane, where they either operate as inward rectifiers, outward rectifiers, weak voltage-dependent channels, or electrically silent, but modulatory subunits. The vacuole membrane, in contrast, harbors a set of two-pore K(+) channels. Just very recently, two plant anion channel families of the SLAC/SLAH and ALMT/QUAC type were identified. SLAC1/SLAH3 and QUAC1 are expressed in guard cells and mediate Slow- and Rapid-type anion currents, respectively, that are involved in volume and turgor regulation. Anion channels in guard cells and other plant cells are key targets within often complex signaling networks. Here, the present knowledge is reviewed for the plant ion channel biology. Special emphasis is drawn to the molecular mechanisms of channel regulation, in the context of model systems and in the light of evolution.

Topology of transmembrane channel-like gene 1 protein.

Science.gov (United States)

Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J

2010-10-05

Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.

Novel transcripts of the estrogen receptor α gene in channel catfish

Science.gov (United States)

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Low Complexity Encoder of High Rate Irregular QC-LDPC Codes for Partial Response Channels

Directory of Open Access Journals (Sweden)

IMTAWIL, V.

2011-11-01

Full Text Available High rate irregular QC-LDPC codes based on circulant permutation matrices, for efficient encoder implementation, are proposed in this article. The structure of the code is an approximate lower triangular matrix. In addition, we present two novel efficient encoding techniques for generating redundant bits. The complexity of the encoder implementation depends on the number of parity bits of the code for the one-stage encoding and the length of the code for the two-stage encoding. The advantage of both encoding techniques is that few XOR-gates are used in the encoder implementation. Simulation results on partial response channels also show that the BER performance of the proposed code has gain over other QC-LDPC codes.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

The Diversity-Multiplexing Tradeoff of Secret-Key Agreement over Multiple-Antenna Channels

KAUST Repository

Zorgui, Marwen; Rezki, Zouheir; Alomair, Basel; Alouini, Mohamed-Slim

2015-01-01

We study the problem of secret-key agreement between two legitimate parties, Alice and Bob, in presence an of eavesdropper Eve. There is a public channel with unlimited capacity that is available to the legitimate parties and is also observed by Eve. Our focus is on Rayleigh fading quasi-static channels. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge of their channels. We study the system in the high-power regime. First, we define the secret-key diversity gain and the secret-key multiplexing gain. Second, we establish the secret-key diversity multiplexing tradeoff (DMT) under no channel state information (CSI) at the transmitter (CSI-T). The eavesdropper is shown to “steal” only transmit antennas. We show that, likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information at the transmitter. This insensitivity of secret-key DMT toward CSI-T features a fundamental difference between secret-key agreement and the wiretap channel, in which secret DMT depends heavily on CSI-T. Finally, we present several secret-key DMT-achieving schemes in case of full CSI-T. We argue that secret DMT-achieving schemes are also key DMT-achieving. Moreover, we show formally that artificial noise (AN), likewise zero-forcing (ZF), is DMT-achieving. We also show that the public feedback channel improves the outage performance without having any effect on the DMT.

The Diversity-Multiplexing Tradeoff of Secret-Key Agreement over Multiple-Antenna Channels

KAUST Repository

Zorgui, Marwen

2015-10-26

We study the problem of secret-key agreement between two legitimate parties, Alice and Bob, in presence an of eavesdropper Eve. There is a public channel with unlimited capacity that is available to the legitimate parties and is also observed by Eve. Our focus is on Rayleigh fading quasi-static channels. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge of their channels. We study the system in the high-power regime. First, we define the secret-key diversity gain and the secret-key multiplexing gain. Second, we establish the secret-key diversity multiplexing tradeoff (DMT) under no channel state information (CSI) at the transmitter (CSI-T). The eavesdropper is shown to “steal” only transmit antennas. We show that, likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information at the transmitter. This insensitivity of secret-key DMT toward CSI-T features a fundamental difference between secret-key agreement and the wiretap channel, in which secret DMT depends heavily on CSI-T. Finally, we present several secret-key DMT-achieving schemes in case of full CSI-T. We argue that secret DMT-achieving schemes are also key DMT-achieving. Moreover, we show formally that artificial noise (AN), likewise zero-forcing (ZF), is DMT-achieving. We also show that the public feedback channel improves the outage performance without having any effect on the DMT.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

Analysis of Secret Key Randomness Exploiting the Radio Channel Variability

Directory of Open Access Journals (Sweden)

Taghrid Mazloum

2015-01-01

Full Text Available A few years ago, physical layer based techniques have started to be considered as a way to improve security in wireless communications. A well known problem is the management of ciphering keys, both regarding the generation and distribution of these keys. A way to alleviate such difficulties is to use a common source of randomness for the legitimate terminals, not accessible to an eavesdropper. This is the case of the fading propagation channel, when exact or approximate reciprocity applies. Although this principle has been known for long, not so many works have evaluated the effect of radio channel properties in practical environments on the degree of randomness of the generated keys. To this end, we here investigate indoor radio channel measurements in different environments and settings at either 2.4625 GHz or 5.4 GHz band, of particular interest for WIFI related standards. Key bits are extracted by quantizing the complex channel coefficients and their randomness is evaluated using the NIST test suite. We then look at the impact of the carrier frequency, the channel variability in the space, time, and frequency degrees of freedom used to construct a long secret key, in relation to the nature of the radio environment such as the LOS/NLOS character.

The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

Science.gov (United States)

Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

2016-10-01

Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

ATP sensitive potassium channels in the skeletal muscle functions : involvement of the KCNJ11(Kir6.2 gene in the determination of Warner Bratzer shear force

Directory of Open Access Journals (Sweden)

Domenico eTricarico

2016-05-01

Full Text Available The ATP-sensitive K+-channels (KATP are distributed in the tissues coupling metabolism with K+ ions efflux. KATP subunits are encoded by KCNJ8 (Kir6.1, KCNJ11 (Kir6.2, ABCC8 (SUR1 and ABCC9 (SUR2 genes, alternative RNA splicing give rise to SUR variants that confer distinct physiological properties on the channel. An high expression/activity of the sarco-KATP channel is observed in various rat fast-twitch muscles, characterized by elevated muscle strength, while a low expression/activity is observed in the slow-twitch muscles characterized by reduced strength and frailty. Down-regulation of the KATP subunits of fast-twitch fibres is found in conditions characterized by weakness and frailty. KCNJ11 gene knockout mice have reduced glycogen, lean phenotype, lower body fat, and weakness. KATP channel is also a sensor of muscle atrophy. The KCNJ11 gene is located on BTA15, close to a QTL for meat tenderness, it has also a role in glycogen storage, a key mechanism of the postmortem transformation of muscle into meat. The role of KCNJ11 gene in muscle function may underlie an effect of KCNJ11 genotypes on meat tenderness, as recently reported. The fiber phenotype and genotype are important in livestock production science. Quantitative traits including meat production and quality are influenced both by environment and genes. Molecular markers can play an important role in the genetic improvement of animals through breeding strategies. Many factors influence the muscle Warner-Bratzler shear force including breed, age, feeding, the biochemical and functional parameters. The role of KCNJ11gene and related genes on muscle tenderness will be discussed in the present review.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

International Nuclear Information System (INIS)

Hayat, S.; Cheng, Z.; Chen, X.

2016-01-01

The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

A new sodium channel {alpha}-subunit gene (Scn9a) from Schwann cells maps to the Scn1a, Scn2a, Scn3a cluster of mouse chromosome 2

Energy Technology Data Exchange (ETDEWEB)

Beckers, M.C.; Ernst, E.; Gros, P. [McGill Univ., Montreal (Canada)

1996-08-15

We have used a total of 27 AXB/BXA recombinant inbred mouse strains to determine the chromosomal location of a newly identified gene encoding an {alpha}-subunit isoform of the sodium channel from Schwann cells, Scn9a. Linkage analysis established that Scn9a mapped to the proximal segment of mouse chromosome 2. The segregation of restriction fragment length polymorphisms in 145 progeny from a Mus spretus x C57BL/6J backcross indicates that Scn9a is very tightly linked to Scn1a (gene encoding the type I sodium channel {alpha}-subunit of the brain) and forms part of a cluster of four Scna genes located on mouse chromosome 2. 17 refs., 1 fig., 3 tabs.

The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study

DEFF Research Database (Denmark)

Hedley, Paula L; Haundrup, Ole; Andersen, Paal S

2011-01-01

The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a genetic...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

The generation of shared cryptographic keys through channel impulse response estimation at 60 GHz.

Energy Technology Data Exchange (ETDEWEB)

Young, Derek P.; Forman, Michael A.; Dowdle, Donald Ryan

2010-09-01

Methods to generate private keys based on wireless channel characteristics have been proposed as an alternative to standard key-management schemes. In this work, we discuss past work in the field and offer a generalized scheme for the generation of private keys using uncorrelated channels in multiple domains. Proposed cognitive enhancements measure channel characteristics, to dynamically change transmission and reception parameters as well as estimate private key randomness and expiration times. Finally, results are presented on the implementation of a system for the generation of private keys for cryptographic communications using channel impulse-response estimation at 60 GHz. The testbed is composed of commercial millimeter-wave VubIQ transceivers, laboratory equipment, and software implemented in MATLAB. Novel cognitive enhancements are demonstrated, using channel estimation to dynamically change system parameters and estimate cryptographic key strength. We show for a complex channel that secret key generation can be accomplished on the order of 100 kb/s.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

KCNMA1 encoded cardiac BK channels afford protection against ischemia-reperfusion injury.

Directory of Open Access Journals (Sweden)

Ewa Soltysinska

Full Text Available Mitochondrial potassium channels have been implicated in myocardial protection mediated through pre-/postconditioning. Compounds that open the Ca2+- and voltage-activated potassium channel of big-conductance (BK have a pre-conditioning-like effect on survival of cardiomyocytes after ischemia/reperfusion injury. Recently, mitochondrial BK channels (mitoBKs in cardiomyocytes were implicated as infarct-limiting factors that derive directly from the KCNMA1 gene encoding for canonical BKs usually present at the plasma membrane of cells. However, some studies challenged these cardio-protective roles of mitoBKs. Herein, we present electrophysiological evidence for paxilline- and NS11021-sensitive BK-mediated currents of 190 pS conductance in mitoplasts from wild-type but not BK-/- cardiomyocytes. Transmission electron microscopy of BK-/- ventricular muscles fibres showed normal ultra-structures and matrix dimension, but oxidative phosphorylation capacities at normoxia and upon re-oxygenation after anoxia were significantly attenuated in BK-/- permeabilized cardiomyocytes. In the absence of BK, post-anoxic reactive oxygen species (ROS production from cardiomyocyte mitochondria was elevated indicating that mitoBK fine-tune the oxidative state at hypoxia and re-oxygenation. Because ROS and the capacity of the myocardium for oxidative metabolism are important determinants of cellular survival, we tested BK-/- hearts for their response in an ex-vivo model of ischemia/reperfusion (I/R injury. Infarct areas, coronary flow and heart rates were not different between wild-type and BK-/- hearts upon I/R injury in the absence of ischemic pre-conditioning (IP, but differed upon IP. While the area of infarction comprised 28±3% of the area at risk in wild-type, it was increased to 58±5% in BK-/- hearts suggesting that BK mediates the beneficial effects of IP. These findings suggest that cardiac BK channels are important for proper oxidative energy supply of

Plant ion channels: gene families, physiology, and functional genomics analyses.

Science.gov (United States)

Ward, John M; Mäser, Pascal; Schroeder, Julian I

2009-01-01

Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

On the diversity-multiplexing tradeoff of secret-key agreement over multiple-antenna channels

KAUST Repository

Zorgui, Marwen

2014-09-01

We consider secret-key agreement with public discussion over Rayleigh fading quasi-static channels. First, the secret-key diversity gain and the secret-key multiplexing gain are defined. Then, the secret-key diversity multiplexing tradeoff (DMT) is established. The eavesdropper is shown to \\'steal\\' only transmit antennas. We show that likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information (CSI) at the transmitter (CSI-T). This insensitivity of secret-key DMT toward CSI-T highlights a fundamental difference between secret-key agreement and the wiretap channel whose secret DMT depends crucially on CSI-T. Several secret-key DMT-achieving schemes are presented in case of full CSI-T.

On the diversity-multiplexing tradeoff of secret-key agreement over multiple-antenna channels

KAUST Repository

Zorgui, Marwen; Rezki, Zouheir; Alomair, Basel; Alouini, Mohamed-Slim

2014-01-01

We consider secret-key agreement with public discussion over Rayleigh fading quasi-static channels. First, the secret-key diversity gain and the secret-key multiplexing gain are defined. Then, the secret-key diversity multiplexing tradeoff (DMT) is established. The eavesdropper is shown to 'steal' only transmit antennas. We show that likewise the DMT without secrecy constraint, the secret-key DMT is the same either with or without full channel state information (CSI) at the transmitter (CSI-T). This insensitivity of secret-key DMT toward CSI-T highlights a fundamental difference between secret-key agreement and the wiretap channel whose secret DMT depends crucially on CSI-T. Several secret-key DMT-achieving schemes are presented in case of full CSI-T.

The Drosophila gene CheB42a is a novel modifier of Deg/ENaC channel function.

Directory of Open Access Journals (Sweden)

Yehuda Ben-Shahar

2010-02-01

Full Text Available Degenerin/epithelial Na(+ channels (DEG/ENaC represent a diverse family of voltage-insensitive cation channels whose functions include Na(+ transport across epithelia, mechanosensation, nociception, salt sensing, modification of neurotransmission, and detecting the neurotransmitter FMRFamide. We previously showed that the Drosophila melanogaster Deg/ENaC gene lounge lizard (llz is co-transcribed in an operon-like locus with another gene of unknown function, CheB42a. Because operons often encode proteins in the same biochemical or physiological pathway, we hypothesized that CHEB42A and LLZ might function together. Consistent with this hypothesis, we found both genes expressed in cells previously implicated in sensory functions during male courtship. Furthermore, when coexpressed, LLZ coprecipitated with CHEB42A, suggesting that the two proteins form a complex. Although LLZ expressed either alone or with CHEB42A did not generate ion channel currents, CHEB42A increased current amplitude of another DEG/ENaC protein whose ligand (protons is known, acid-sensing ion channel 1a (ASIC1a. We also found that CHEB42A was cleaved to generate a secreted protein, suggesting that CHEB42A may play an important role in the extracellular space. These data suggest that CHEB42A is a modulatory subunit for sensory-related Deg/ENaC signaling. These results are consistent with operon-like transcription of CheB42a and llz and explain the similar contributions of these genes to courtship behavior.

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Study on the security of discrete-variable quantum key distribution over non-Markovian channels

International Nuclear Information System (INIS)

Huang Peng; Zhu Jun; He Guangqiang; Zeng Guihua

2012-01-01

The dynamic of the secret key rate of the discrete-variable quantum key distribution (QKD) protocol over the non-Markovian quantum channel is investigated. In particular, we calculate the secret key rate for the six-state protocol over non-Markovian depolarizing channels with coloured noise and Markovian depolarizing channels with Gaussian white noise, respectively. We find that the secure secret key rate for the non-Markovian depolarizing channel will be larger than the Markovian one under the same conditions even when their upper bounds of tolerable quantum bit error rate are equal. This indicates that this coloured noise in the non-Markovian depolarizing channel can enhance the security of communication. Moreover, we show that the secret key rate fluctuates near the secure point when the coupling strength of the system with the environment is high. The results demonstrate that the non-Markovian effects of the transmission channel can have a positive impact on the security of discrete-variable QKD. (paper)

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Voltage-gated sodium channels: action players with many faces

NARCIS (Netherlands)

Koopmann, Tamara T.; Bezzina, Connie R.; Wilde, Arthur A. M.

2006-01-01

Voltage-gated sodium channels are responsible for the upstroke of the action potential and thereby play an important role in propagation of the electrical impulse in excitable tissues like muscle, nerve and the heart. Duplication of the sodium channels encoding genes during evolution generated the

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Phycodnavirus potassium ion channel proteins question the virus molecular piracy hypothesis.

Directory of Open Access Journals (Sweden)

Kay Hamacher

Full Text Available Phycodnaviruses are large dsDNA, algal-infecting viruses that encode many genes with homologs in prokaryotes and eukaryotes. Among the viral gene products are the smallest proteins known to form functional K(+ channels. To determine if these viral K(+ channels are the product of molecular piracy from their hosts, we compared the sequences of the K(+ channel pore modules from seven phycodnaviruses to the K(+ channels from Chlorella variabilis and Ectocarpus siliculosus, whose genomes have recently been sequenced. C. variabilis is the host for two of the viruses PBCV-1 and NY-2A and E. siliculosus is the host for the virus EsV-1. Systematic phylogenetic analyses consistently indicate that the viral K(+ channels are not related to any lineage of the host channel homologs and that they are more closely related to each other than to their host homologs. A consensus sequence of the viral channels resembles a protein of unknown function from a proteobacterium. However, the bacterial protein lacks the consensus motif of all K(+ channels and it does not form a functional channel in yeast, suggesting that the viral channels did not come from a proteobacterium. Collectively, our results indicate that the viruses did not acquire their K(+ channel-encoding genes from their current algal hosts by gene transfer; thus alternative explanations are required. One possibility is that the viral genes arose from ancient organisms, which served as their hosts before the viruses developed their current host specificity. Alternatively the viral proteins could be the origin of K(+ channels in algae and perhaps even all cellular organisms.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

DEFF Research Database (Denmark)

Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Information verification cryptosystem using one-time keys based on double random phase encoding and public-key cryptography

Science.gov (United States)

Zhao, Tieyu; Ran, Qiwen; Yuan, Lin; Chi, Yingying; Ma, Jing

2016-08-01

A novel image encryption system based on double random phase encoding (DRPE) and RSA public-key algorithm is proposed. The main characteristic of the system is that each encryption process produces a new decryption key (even for the same plaintext), thus the encryption system conforms to the feature of the one-time pad (OTP) cryptography. The other characteristic of the system is the use of fingerprint key. Only with the rightful authorization will the true decryption be obtained, otherwise the decryption will result in noisy images. So the proposed system can be used to determine whether the ciphertext is falsified by attackers. In addition, the system conforms to the basic agreement of asymmetric cryptosystem (ACS) due to the combination with the RSA public-key algorithm. The simulation results show that the encryption scheme has high robustness against the existing attacks.

Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits.

Science.gov (United States)

Zhang, Mei; Leng, Ping; Zhang, Guanglian; Li, Xiangxin

2009-08-15

Ripening and senescence are generally controlled by ethylene in climacteric fruits like peaches, and the ripening process of grape, a non-climacteric fruit, may have some relationship to abscisic acid (ABA) function. In order to better understand the role of ABA in ripening and senescence of these two types of fruits, we cloned the 9-cis-epoxycarotenoid dioxygenase (NCED) gene that encodes a key enzyme in ABA biosynthesis from peaches and grapes using an RT-PCR approach. The NCED gene fragments were cloned from peaches (PpNCED1and PpNCED2, each 740bp) and grapes (VVNCED1, 741bp) using degenerate primers designed based on the conserved amino acids sequence of NCEDs in other plants. PpNCED1 showed 78.54% homology with PpNCED2, 74.90% homology with VVNCED1, and both showed high homology to NCEDs from other plants. The expression patterns of PpNCED1 and VVNCED1 were very similar. Both were highly expressed at the beginning of ripening when ABA content becomes high. The maximum ABA preceded ethylene production in peach fruit. ABA in the grape gradually increased from the beginning of ripening and reached the highest level at 20d before the harvest stage. However, ethylene remained at low levels during the entire process of fruit development, including ripening and senescence. ABA content, and ripening and softening of both types of fruits, were promoted or delayed by exogenous ABA or Fluridone (or NDGA) treatment. The roles of ABA and ethylene in the later ripening of fruit are complex. Based on results obtained in this study, we concluded that PpNCED1 and VVNCED1 initiate ABA biosynthesis at the beginning of fruit ripening, and that ABA accumulation might play a key role in the regulation of ripeness and senescence of both peach and grape fruits.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Skeletal Muscle Na+ Channel Disorders

Directory of Open Access Journals (Sweden)

Dina eSimkin

2011-10-01

Full Text Available Five inherited human disorders affecting skeletal muscle contraction have been traced to mutations in the gene encoding the voltage-gated sodium channel Nav1.4. The main symptoms of these disorders are myotonia or periodic paralysis caused by changes in skeletal muscle fiber excitability. Symptoms of these disorders vary from mild or latent disease to incapacitating or even death in severe cases. As new human sodium channel mutations corresponding to disease states become discovered, the importance of understanding the role of the sodium channel in skeletal muscle function and disease state grows.

Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

Science.gov (United States)

Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

2015-12-08

This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Cross-Layer Framework for Multiuser Real Time H.264/AVC Video Encoding and Transmission over Block Fading MIMO Channels Using Outage Probability

Directory of Open Access Journals (Sweden)

Slavche Pejoski

2014-01-01

Full Text Available We present a framework for cross-layer optimized real time multiuser encoding of video using a single layer H.264/AVC and transmission over MIMO wireless channels. In the proposed cross-layer adaptation, the channel of every user is characterized by the probability density function of its channel mutual information and the performance of the H.264/AVC encoder is modeled by a rate distortion model that takes into account the channel errors. These models are used during the resource allocation of the available slots in a TDMA MIMO communication system with capacity achieving channel codes. This framework allows for adaptation to the statistics of the wireless channel and to the available resources in the system and utilization of the multiuser diversity of the transmitted video sequences. We show the effectiveness of the proposed framework for video transmission over Rayleigh MIMO block fading channels, when channel distribution information is available at the transmitter.

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Spatially multiplexed orbital-angular-momentum-encoded single photon and classical channels in a free-space optical communication link.

Science.gov (United States)

Ren, Yongxiong; Liu, Cong; Pang, Kai; Zhao, Jiapeng; Cao, Yinwen; Xie, Guodong; Li, Long; Liao, Peicheng; Zhao, Zhe; Tur, Moshe; Boyd, Robert W; Willner, Alan E

2017-12-01

We experimentally demonstrate spatial multiplexing of an orbital angular momentum (OAM)-encoded quantum channel and a classical Gaussian beam with a different wavelength and orthogonal polarization. Data rates as large as 100 MHz are achieved by encoding on two different OAM states by employing a combination of independently modulated laser diodes and helical phase holograms. The influence of OAM mode spacing, encoding bandwidth, and interference from the co-propagating Gaussian beam on registered photon count rates and quantum bit error rates is investigated. Our results show that the deleterious effects of intermodal crosstalk effects on system performance become less important for OAM mode spacing Δ≥2 (corresponding to a crosstalk value of less than -18.5  dB). The use of OAM domain can additionally offer at least 10.4 dB isolation besides that provided by wavelength and polarization, leading to a further suppression of interference from the classical channel.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Quantum Enigma Machines and the Locking Capacity of a Quantum Channel

Directory of Open Access Journals (Sweden)

Saikat Guha

2014-01-01

Full Text Available The locking effect is a phenomenon that is unique to quantum information theory and represents one of the strongest separations between the classical and quantum theories of information. The Fawzi-Hayden-Sen locking protocol harnesses this effect in a cryptographic context, whereby one party can encode n bits into n qubits while using only a constant-size secret key. The encoded message is then secure against any measurement that an eavesdropper could perform in an attempt to recover the message, but the protocol does not necessarily meet the composability requirements needed in quantum key distribution applications. In any case, the locking effect represents an extreme violation of Shannon’s classical theorem, which states that information-theoretic security holds in the classical case if and only if the secret key is the same size as the message. Given this intriguing phenomenon, it is of practical interest to study the effect in the presence of noise, which can occur in the systems of both the legitimate receiver and the eavesdropper. This paper formally defines the locking capacity of a quantum channel as the maximum amount of locked information that can be reliably transmitted to a legitimate receiver by exploiting many independent uses of a quantum channel and an amount of secret key sublinear in the number of channel uses. We provide general operational bounds on the locking capacity in terms of other well-known capacities from quantum Shannon theory. We also study the important case of bosonic channels, finding limitations on these channels’ locking capacity when coherent-state encodings are employed and particular locking protocols for these channels that might be physically implementable.

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

Science.gov (United States)

Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

2009-05-01

Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

Science.gov (United States)

Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

2012-08-01

The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Optimal attacks on qubit-based Quantum Key Recycling

Science.gov (United States)

Leermakers, Daan; Škorić, Boris

2018-03-01

Quantum Key Recycling (QKR) is a quantum cryptographic primitive that allows one to reuse keys in an unconditionally secure way. By removing the need to repeatedly generate new keys, it improves communication efficiency. Škorić and de Vries recently proposed a QKR scheme based on 8-state encoding (four bases). It does not require quantum computers for encryption/decryption but only single-qubit operations. We provide a missing ingredient in the security analysis of this scheme in the case of noisy channels: accurate upper bounds on the required amount of privacy amplification. We determine optimal attacks against the message and against the key, for 8-state encoding as well as 4-state and 6-state conjugate coding. We provide results in terms of min-entropy loss as well as accessible (Shannon) information. We show that the Shannon entropy analysis for 8-state encoding reduces to the analysis of quantum key distribution, whereas 4-state and 6-state suffer from additional leaks that make them less effective. From the optimal attacks we compute the required amount of privacy amplification and hence the achievable communication rate (useful information per qubit) of qubit-based QKR. Overall, 8-state encoding yields the highest communication rates.

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

Suppression of 9-cis-epoxycarotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, alters fruit texture in transgenic tomato.

Science.gov (United States)

Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

2012-01-01

Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp).

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

Microarray analysis reveals key genes and pathways in Tetralogy of Fallot

Science.gov (United States)

He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai

2017-01-01

The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF

Multicomponent reactions provide key molecules for secret communication.

Science.gov (United States)

Boukis, Andreas C; Reiter, Kevin; Frölich, Maximiliane; Hofheinz, Dennis; Meier, Michael A R

2018-04-12

A convenient and inherently more secure communication channel for encoding messages via specifically designed molecular keys is introduced by combining advanced encryption standard cryptography with molecular steganography. The necessary molecular keys require large structural diversity, thus suggesting the application of multicomponent reactions. Herein, the Ugi four-component reaction of perfluorinated acids is utilized to establish an exemplary database consisting of 130 commercially available components. Considering all permutations, this combinatorial approach can unambiguously provide 500,000 molecular keys in only one synthetic procedure per key. The molecular keys are transferred nondigitally and concealed by either adsorption onto paper, coffee, tea or sugar as well as by dissolution in a perfume or in blood. Re-isolation and purification from these disguises is simplified by the perfluorinated sidechains of the molecular keys. High resolution tandem mass spectrometry can unequivocally determine the molecular structure and thus the identity of the key for a subsequent decryption of an encoded message.

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

Science.gov (United States)

Lin, J W; Lu, H C; Chen, H Y; Weng, S F

1997-10-09

Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

Proof-of-concept of real-world quantum key distribution with quantum frames

International Nuclear Information System (INIS)

Lucio-Martinez, I; Mo, X; Tittel, W; Chan, P; Hosier, S

2009-01-01

We propose a fibre-based quantum key distribution system, which employs polarization qubits encoded into faint laser pulses. As a novel feature, it allows sending of classical framing information via sequences of strong laser pulses that precede the quantum data. This allows synchronization, sender and receiver identification and compensation of time-varying birefringence in the communication channel. In addition, this method also provides a platform to communicate implementation specific information such as encoding and protocol in view of future optical quantum networks. We demonstrate in a long-term (37 h) proof-of-principle study that polarization information encoded in the classical control frames can indeed be used to stabilize unwanted qubit transformation in the quantum channel. All optical elements in our setup can be operated at Gbps rates, which is a first requirement for a future system delivering secret keys at Mbps. In order to remove another bottleneck towards a high rate system, we investigate forward error correction based on low-density parity-check codes.

α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

International Nuclear Information System (INIS)

Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

1988-01-01

cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Information hiding based on double random-phase encoding and public-key cryptography.

Science.gov (United States)

Sheng, Yuan; Xin, Zhou; Alam, Mohammed S; Xi, Lu; Xiao-Feng, Li

2009-03-02

A novel information hiding method based on double random-phase encoding (DRPE) and Rivest-Shamir-Adleman (RSA) public-key cryptosystem is proposed. In the proposed technique, the inherent diffusion property of DRPE is cleverly utilized to make up the diffusion insufficiency of RSA public-key cryptography, while the RSA cryptosystem is utilized for simultaneous transmission of the cipher text and the two phase-masks, which is not possible under the DRPE technique. This technique combines the complementary advantages of the DPRE and RSA encryption techniques and brings security and convenience for efficient information transmission. Extensive numerical simulation results are presented to verify the performance of the proposed technique.

Quantum deterministic key distribution protocols based on the authenticated entanglement channel

International Nuclear Information System (INIS)

Zhou Nanrun; Wang Lijun; Ding Jie; Gong Lihua

2010-01-01

Based on the quantum entanglement channel, two secure quantum deterministic key distribution (QDKD) protocols are proposed. Unlike quantum random key distribution (QRKD) protocols, the proposed QDKD protocols can distribute the deterministic key securely, which is of significant importance in the field of key management. The security of the proposed QDKD protocols is analyzed in detail using information theory. It is shown that the proposed QDKD protocols can safely and effectively hand over the deterministic key to the specific receiver and their physical implementation is feasible with current technology.

Quantum deterministic key distribution protocols based on the authenticated entanglement channel

Energy Technology Data Exchange (ETDEWEB)

Zhou Nanrun; Wang Lijun; Ding Jie; Gong Lihua [Department of Electronic Information Engineering, Nanchang University, Nanchang 330031 (China)], E-mail: znr21@163.com, E-mail: znr21@hotmail.com

2010-04-15

Based on the quantum entanglement channel, two secure quantum deterministic key distribution (QDKD) protocols are proposed. Unlike quantum random key distribution (QRKD) protocols, the proposed QDKD protocols can distribute the deterministic key securely, which is of significant importance in the field of key management. The security of the proposed QDKD protocols is analyzed in detail using information theory. It is shown that the proposed QDKD protocols can safely and effectively hand over the deterministic key to the specific receiver and their physical implementation is feasible with current technology.

Molecular and functional characterization of Anopheles gambiae inward rectifier potassium (Kir1) channels: a novel role in egg production.

Science.gov (United States)

Raphemot, Rene; Estévez-Lao, Tania Y; Rouhier, Matthew F; Piermarini, Peter M; Denton, Jerod S; Hillyer, Julián F

2014-08-01

Inward rectifier potassium (Kir) channels play essential roles in regulating diverse physiological processes. Although Kir channels are encoded in mosquito genomes, their functions remain largely unknown. In this study, we identified the members of the Anopheles gambiae Kir gene family and began to investigate their function. Notably, we sequenced the A. gambiae Kir1 (AgKir1) gene and showed that it encodes all the canonical features of a Kir channel: an ion pore that is composed of a pore helix and a selectivity filter, two transmembrane domains that flank the ion pore, and the so-called G-loop. Heterologous expression of AgKir1 in Xenopus oocytes revealed that this gene encodes a functional, barium-sensitive Kir channel. Quantitative RT-PCR experiments then showed that relative AgKir1 mRNA levels are highest in the pupal stage, and that AgKir1 mRNA is enriched in the adult ovaries. Gene silencing of AgKir1 by RNA interference did not affect the survival of female mosquitoes following a blood meal, but decreased their egg output. These data provide evidence for a new role of Kir channels in mosquito fecundity, and further validates them as promising molecular targets for the development of a new class of mosquitocides to be used in vector control. Copyright © 2014 Elsevier Ltd. All rights reserved.

Secure quantum key distribution using squeezed states

International Nuclear Information System (INIS)

Gottesman, Daniel; Preskill, John

2001-01-01

We prove the security of a quantum key distribution scheme based on transmission of squeezed quantum states of a harmonic oscillator. Our proof employs quantum error-correcting codes that encode a finite-dimensional quantum system in the infinite-dimensional Hilbert space of an oscillator, and protect against errors that shift the canonical variables p and q. If the noise in the quantum channel is weak, squeezing signal states by 2.51 dB (a squeeze factor e r =1.34) is sufficient in principle to ensure the security of a protocol that is suitably enhanced by classical error correction and privacy amplification. Secure key distribution can be achieved over distances comparable to the attenuation length of the quantum channel

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

Science.gov (United States)

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

Functional characterization of a prokaryotic Kir channel.

Science.gov (United States)

Enkvetchakul, Decha; Bhattacharyya, Jaya; Jeliazkova, Iana; Groesbeck, Darcy K; Cukras, Catherine A; Nichols, Colin G

2004-11-05

The Kir gene family encodes inward rectifying K+ (Kir) channels that are widespread and critical regulators of excitability in eukaryotic cells. A related gene family (KirBac) has recently been identified in prokaryotes. While a crystal structure of one member, Kir-Bac1.1, has been solved, there has been no functional characterization of any KirBac gene products. Here we present functional characterization of KirBac1.1 reconstituted in liposomes. Utilizing a 86Rb+ uptake assay, we demonstrate that KirBac1.1 generates a K+ -selective permeation path that is inhibited by extraliposomal Ba2+ and Ca2+ ions. In contrast to KcsA (an acid-activated bacterial potassium channel), KirBac1.1 is inhibited by extraliposomal acid (pKa approximately 6). This characterization of KirBac1.1 activity now paves the way for further correlation of structure and function in this model Kir channel.

A new two-code keying scheme for SAC-OCDMA systems enabling bipolar encoding

Science.gov (United States)

Al-Khafaji, Hamza M. R.; Ngah, Razali; Aljunid, S. A.; Rahman, T. A.

2015-03-01

In this paper, we propose a new two-code keying scheme for enabling bipolar encoding in a high-rate spectral-amplitude coding optical code-division multiple-access (SAC-OCDMA) system. The mathematical formulations are derived for the signal-to-noise ratio and bit-error rate (BER) of SAC-OCDMA system based on the suggested scheme using multi-diagonal (MD) code. Performance analyses are assessed considering the effects of phase-induced intensity noise, as well as shot and thermal noises in photodetectors. The numerical results demonstrated that the proposed scheme exhibits an enhanced BER performance compared to the existing unipolar encoding with direct detection technique. Furthermore, the performance improvement afforded by this scheme is verified using simulation experiments.

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Secret-key agreement over spatially correlated fast-fading multiple-antenna channels with public discussion

KAUST Repository

Zorgui, Marwen

2015-06-14

We consider secret-key agreement with public discussion over multiple-input multiple-output (MIMO) Rayleigh fast-fading channels under correlated environment. We assume that transmit, legitimate receiver and eavesdropper antennas are correlated. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge while the transmitter has only knowledge of the correlation matrices. First, we derive the expression of the secret-key capacity under the considered setup. Then, we prove that the optimal transmit strategy achieving the secret-key capacity consists in transmitting independent Gaussian signals along the eingenvectors of the transmit correlation matrix. The powers allocated to each channel mode are determined as the solution to a numerical optimization problem that we derive. A necessary and sufficient condition for beamforming (i.e., transmitting along the strongest channel mode) to be capacity-achieving is derived. Finally, we analyze the impact of correlation matrices on the system performance and provide closed-form expressions of the gain/loss due to correlation in the high power regime.

Slack, Slick, and Sodium-Activated Potassium Channels

Science.gov (United States)

Kaczmarek, Leonard K.

2013-01-01

The Slack and Slick genes encode potassium channels that are very widely expressed in the central nervous system. These channels are activated by elevations in intracellular sodium, such as those that occur during trains of one or more action potentials, or following activation of nonselective cationic neurotransmitter receptors such as AMPA receptors. This review covers the cellular and molecular properties of Slack and Slick channels and compares them with findings on the properties of sodium-activated potassium currents (termed KNa currents) in native neurons. Human mutations in Slack channels produce extremely severe defects in learning and development, suggesting that KNa channels play a central role in neuronal plasticity and intellectual function. PMID:24319675

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Key distillation in quantum cryptography

Science.gov (United States)

Slutsky, Boris Aron

1998-11-01

Quantum cryptography is a technique which permits two parties to communicate over an open channel and establish a shared sequence of bits known only to themselves. This task, provably impossible in classical cryptography, is accomplished by encoding the data on quantum particles and harnessing their unique properties. It is believed that no eavesdropping attack consistent with the laws of quantum theory can compromise the secret data unknowingly to the legitimate users of the channel. Any attempt by a hostile actor to monitor the data carrying particles while in transit reveals itself through transmission errors it must inevitably introduce. Unfortunately, in practice a communication is not free of errors even when no eavesdropping is present. Key distillation is a technique that permits the parties to overcome this difficulty and establish a secret key despite channel defects, under the assumption that every particle is handled independently from other particles by the enemy. In the present work, key distillation is described and its various aspects are studied. A relationship is derived between the average error rate resulting from an eavesdropping attack and the amount of information obtained by the attacker. Formal definition is developed of the security of the final key. The net throughput of secret bits in a quantum cryptosystem employing key distillation is assessed. An overview of quantum cryptographic protocols and related information theoretical results is also given.

Association analysis of a highly polymorphic CAG Repeat in the human potassium channel gene KCNN3 and migraine susceptibility

Directory of Open Access Journals (Sweden)

Ovcaric Mick

2005-09-01

Full Text Available Abstract Background Migraine is a polygenic multifactorial disease, possessing environmental and genetic causative factors with multiple involved genes. Mutations in various ion channel genes are responsible for a number of neurological disorders. KCNN3 is a neuronal small conductance calcium-activated potassium channel gene that contains two polyglutamine tracts, encoded by polymorphic CAG repeats in the gene. This gene plays a critical role in determining the firing pattern of neurons and acts to regulate intracellular calcium channels. Methods The present association study tested whether length variations in the second (more 3' polymorphic CAG repeat in exon 1 of the KCNN3 gene, are involved in susceptibility to migraine with and without aura (MA and MO. In total 423 DNA samples from unrelated individuals, of which 202 consisted of migraine patients and 221 non-migraine controls, were genotyped and analysed using a fluorescence labelled primer set on an ABI310 Genetic Analyzer. Allele frequencies were calculated from observed genotype counts for the KCNN3 polymorphism. Analysis was performed using standard contingency table analysis, incorporating the chi-squared test of independence and CLUMP analysis. Results Overall, there was no convincing evidence that KCNN3 CAG lengths differ between Caucasian migraineurs and controls, with no significant difference in the allelic length distribution of CAG repeats between the population groups (P = 0.090. Also the MA and MO subtypes did not differ significantly between control allelic distributions (P > 0.05. The prevalence of the long CAG repeat (>19 repeats did not reach statistical significance in migraineurs (P = 0.15, nor was there a significant difference between the MA and MO subgroups observed compared to controls (P = 0.46 and P = 0.09, respectively, or between MA vs MO (P = 0.40. Conclusion This association study provides no evidence that length variations of the second polyglutamine array in

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

Science.gov (United States)

Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

2015-12-01

In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

A sodium-channel mutation causes isolated cardiac conduction disease

NARCIS (Netherlands)

Tan, H. L.; Bink-Boelkens, M. T.; Bezzina, C. R.; Viswanathan, P. C.; Beaufort-Krol, G. C.; van Tintelen, P. J.; van den Berg, M. P.; Wilde, A. A.; Balser, J. R.

2001-01-01

Cardiac conduction disorders slow the heart rhythm and cause disability in millions of people worldwide. Inherited mutations in SCN5A, the gene encoding the human cardiac sodium (Na+) channel, have been associated with rapid heart rhythms that occur suddenly and are life-threatening; however, a

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

Science.gov (United States)

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

Ion channel gene expressions in infertile men: A case-control study

Directory of Open Access Journals (Sweden)

Serkan Carkci

2017-12-01

Full Text Available Background: Infertility is described as not receiving pregnancy despite unprotected and regular sexual intercourse in a 1 yr period. It is detected by 15% of the couples. Male and female factor in the etiology may be detected in similar rates. Objective: The present study aims to investigate ion channel gene expression in semen samples of infertile male compared with fertile men. Materials and Methods: A total of 150 men who applied to the urology clinic due to infertility were divided into five equal groups: asthenozoospermia, oligozoospermia, oligoasthenoteratozoospermia, teratozoospermia, and normozoospermia (control. All paticipants were evaluated with Cation Channel Spermia (CatSper 1, 2, 3, 4, Proton Voltage Gated Ion Channel1 (Hv1, Potassium Channel Subfamily U1 (KCNU1, and transmembrane protein (TMEM16A gene expression in semen samples. Results: “CatSper1, 4, HV1, KCNU1, and TMEM16A gene expression were detected higher in the oligozoospermia group compared to the controls. CatSper1, 2, 3, 4, KCNU1, and TMEM16A gene expression in the asthenozoospermia group and CatSper1, 2, 3, 4, KCNU1, and TMEM16A gene expression in the teratozoospermia group were detected lower compared to the controls. CatSper1, 4, HV1, and TMEM16A gen expression were higher in the oligoasthenoteratozoospermia men than the controls while CatSper3 gen expression was detected as lower.” Conclusion: It was detected that these ion channels have an effect on sperm progressive motility and morphology. It may be considered that mutations in these ion channels may result in infertility

Localisation of SCN10A gene product Na(v)1.8 and novel pain-related ion channels in human heart.

Science.gov (United States)

Facer, Paul; Punjabi, Prakash P; Abrari, Andleeb; Kaba, Riyaz A; Severs, Nicholas J; Chambers, John; Kooner, Jaspal S; Anand, Praveen

2011-01-01

We have shown that the gene SCN10A encoding the sodium channel Na(v)1.8 is a susceptibility factor for heart block and serious ventricular arrhythmia. Since Na(v)1.8 is known to be present in nerve fibres that mediate pain, it may be related to both cardiac pain and dysrhythmia. The localisation of Na(v)1.8 and other key nociceptive ion channels, including Na(v)1.7, Na(v)1.9, capsaicin receptor TRPV1, and purinergic receptor P2X(3), have not been reported in human heart. The aim of this study was to determine the distribution of Na(v)1.8, related sodium and other sensory channels in human cardiac tissue, and correlate their density with sympathetic nerves, regenerating nerves (GAP-43), and vascularity. Human heart atrial appendage tissues (n = 13) were collected during surgery for valve disease. Tissues were investigated by immunohistology using specific antibodies to Na(v)1.8 and other markers. Na(v)1.8 immunoreactivity was detected in nerve fibres and fascicles in the myocardium, often closely associated with small capillaries. Na(v)1.8 nerve fibres per mm(2) correlated significantly with vascular markers. Na(v)1.8-immunoreactivity was present also in cardiomyocytes with a similar distribution pattern to that seen with connexins, the specialised gap junction proteins of myocardial intercalated discs. Na(v)1.5-immunoreactivity was detected in cardiomyocytes but not in nerve fibres. Na(v)1.7, Na(v)1.9, TRPV1, P2X(3)/P2X(2), and GAP43 positive nerve fibres were relatively sparse, whereas sympathetic innervation and connexin43 were abundant. We conclude that sodium channel Na(v)1.8 is present in sensory nerves and cardiomyocytes of human heart. Na(v)1.8 and other pain channels provide new targets for the understanding and treatment of cardiac pain and dysrhythmia.

Translational control and differential RNA decay are key elements regulating postsegregational expression of the killer protein encoded by the parB locus of plasmid R1

DEFF Research Database (Denmark)

Gerdes, K; Helin, K; Christensen, O W

1988-01-01

The parB locus of plasmid R1, which mediates plasmid stability via postsegregational killing of plasmid-free cells, encodes two genes, hok and sok. The hok gene product is a potent cell-killing protein. The hok gene is regulated at the translational level by the sok gene-encoded repressor, a small...

A sodium-channel mutation causes isolated cardiac conduction disease

NARCIS (Netherlands)

Tan, HL; Bink-Boelkens, MTE; Bezzina, CR; Viswanathan, PC; Beaufort-Krol, GCM; van Tintelen, PJ; van den Berg, MP; Wilde, AAM; Balser, [No Value

2001-01-01

Cardiac conduction disorders slow the heart rhythm and cause disability in millions of people worldwide. Inherited mutations in SCN5A, the gene encoding the human cardiac sodium (Na+) channel, have been associated with rapid heart rhythms that occur suddenly and are life-threatening(1-3); however, a

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

Science.gov (United States)

Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

2010-07-01

WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

Science.gov (United States)

Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

2010-01-01

WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

Rab11-dependent Recycling of the Human Ether-a-go-go-related Gene (hERG) Channel*

Science.gov (United States)

Chen, Jeffery; Guo, Jun; Yang, Tonghua; Li, Wentao; Lamothe, Shawn M.; Kang, Yudi; Szendrey, John A.; Zhang, Shetuan

2015-01-01

The human ether-a-go-go-related gene (hERG) encodes the pore-forming subunit of the rapidly activating delayed rectifier potassium channel (IKr). A reduction in the hERG current causes long QT syndrome, which predisposes affected individuals to ventricular arrhythmias and sudden death. We reported previously that hERG channels in the plasma membrane undergo vigorous internalization under low K+ conditions. In the present study, we addressed whether hERG internalization occurs under normal K+ conditions and whether/how internalized channels are recycled back to the plasma membrane. Using patch clamp, Western blot, and confocal imaging analyses, we demonstrated that internalized hERG channels can effectively recycle back to the plasma membrane. Low K+-enhanced hERG internalization is accompanied by an increased rate of hERG recovery in the plasma membrane upon reculture following proteinase K-mediated clearance of cell-surface proteins. The increased recovery rate is not due to enhanced protein synthesis, as hERG mRNA expression was not altered by low K+ exposure, and the increased recovery was observed in the presence of the protein biosynthesis inhibitor cycloheximide. GTPase Rab11, but not Rab4, is involved in the recycling of hERG channels. Interfering with Rab11 function not only delayed hERG recovery in cells after exposure to low K+ medium but also decreased hERG expression and function in cells under normal culture conditions. We concluded that the recycling pathway plays an important role in the homeostasis of plasma membrane-bound hERG channels. PMID:26152716

The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Gutiérrez Rodrigo A

2008-09-01

Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Suppression of 9-cis-Epoxycarotenoid Dioxygenase, Which Encodes a Key Enzyme in Abscisic Acid Biosynthesis, Alters Fruit Texture in Transgenic Tomato1[W][OA

Science.gov (United States)

Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping

2012-01-01

Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Sequence Alterations of I(Ks Potassium Channel Genes in Kazakhstani Patients with Atrial Fibrillation

Directory of Open Access Journals (Sweden)

Ainur Akilzhanova

2014-12-01

56.5 % of the referred patients. Further screening of mutations in other genes encoding cardiac ion channels is needed to clarify possible disease causing and founder mutations in Kazakhstani atrial fibrillation patients.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Cardiac Delayed Rectifier Potassium Channels in Health and Disease

Science.gov (United States)

Chen, Lei; Sampson, Kevin J.; Kass, Robert S.

2016-01-01

Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this chapter, we will review the molecular identities and biophysical properties of these channels. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the possibility and prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. PMID:27261823

Security bound of continuous-variable quantum key distribution with noisy coherent states and channel

International Nuclear Information System (INIS)

Shen Yong; Yang Jian; Guo Hong

2009-01-01

Security of a continuous-variable quantum key distribution protocol based on noisy coherent states and channel is analysed. Assuming that the noise of coherent states is induced by Fred, a neutral party relative to others, we prove that the prepare-and-measurement scheme (P and M) and entanglement-based scheme (E-B) are equivalent. Then, we show that this protocol is secure against Gaussian collective attacks even if the channel is lossy and noisy, and, further, a lower bound to the secure key rate is derived.

Security bound of continuous-variable quantum key distribution with noisy coherent states and channel

Energy Technology Data Exchange (ETDEWEB)

Shen Yong; Yang Jian; Guo Hong, E-mail: hongguo@pku.edu.c [CREAM Group, State Key Laboratory of Advanced Optical Communication Systems and Networks (Peking University) and Institute of Quantum Electronics, School of Electronics Engineering and Computer Science, Peking University, Beijing 100871 (China)

2009-12-14

Security of a continuous-variable quantum key distribution protocol based on noisy coherent states and channel is analysed. Assuming that the noise of coherent states is induced by Fred, a neutral party relative to others, we prove that the prepare-and-measurement scheme (P and M) and entanglement-based scheme (E-B) are equivalent. Then, we show that this protocol is secure against Gaussian collective attacks even if the channel is lossy and noisy, and, further, a lower bound to the secure key rate is derived.

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

Science.gov (United States)

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

On the Ergodic Secret-Key Agreement over Spatially Correlated Multiple-Antenna Channels with Public Discussion

KAUST Repository

Zorgui, Marwen

2015-09-28

We consider secret-key agreement with public discussion over multiple-input multiple-output (MIMO) Rayleigh fast-fading channels under correlated environment. We assume that transmit, legitimate receiver and eavesdropper antennas are correlated. The legitimate receiver and the eavesdropper are assumed to have perfect channel knowledge while the transmitter has only knowledge of the correlation matrices. First, we derive the expression of the secret-key capacity under the considered setup. We prove that the optimal transmit strategy achieving the secret-key capacity consists in transmitting independent Gaussian signals along the eingenvectors of the transmit correlation matrix. The powers allocated to each channel mode are determined as the solution to a numerical optimization problem. A necessary and sufficient condition for beamforming (i.e., transmitting along the strongest channel mode) to be capacity-achieving is derived. Moreover, we analyze the impact of correlation matrices on the system performance. Finally, we study the system’s performance in the two extreme power regimes. In the high-power regime, we provide closed-form expressions of the gain/loss due to correlation. In the low signal-to-noise ratio (SNR) regime, we investigate the energy efficiency of the system by determining the minimum energy required for sharing a secret-key bit and the wideband slope while highlighting the impact of correlation matrices.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Differential gene expression of cardiac ion channels in human dilated cardiomyopathy.

Directory of Open Access Journals (Sweden)

Maria Micaela Molina-Navarro

Full Text Available BACKGROUND: Dilated cardiomyopathy (DCM is characterized by idiopathic dilation and systolic contractile dysfunction of the cardiac chambers. The present work aimed to study the alterations in gene expression of ion channels involved in cardiomyocyte function. METHODS AND RESULTS: Microarray profiling using the Affymetrix Human Gene® 1.0 ST array was performed using 17 RNA samples, 12 from DCM patients undergoing cardiac transplantation and 5 control donors (CNT. The analysis focused on 7 cardiac ion channel genes, since this category has not been previously studied in human DCM. SCN2B was upregulated, while KCNJ5, KCNJ8, CLIC2, CLCN3, CACNB2, and CACNA1C were downregulated. The RT-qPCR (21 DCM and 8 CNT samples validated the gene expression of SCN2B (p < 0.0001, KCNJ5 (p < 0.05, KCNJ8 (p < 0.05, CLIC2 (p < 0.05, and CACNB2 (p < 0.05. Furthermore, we performed an IPA analysis and we found a functional relationship between the different ion channels studied in this work. CONCLUSION: This study shows a differential expression of ion channel genes involved in cardiac contraction in DCM that might partly underlie the changes in left ventricular function observed in these patients. These results could be the basis for new genetic therapeutic approaches.

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

[Elucidation of key genes in sex determination in genetics teaching].

Science.gov (United States)

Li, Meng; He, Zhumei

2014-06-01

Sex is an important and complex feature of organisms, which is controlled by the genetic and environmental factors. The genetic factors, i.e., genes, are vital in sex determination. However, not all the related genes play the same roles, and some key genes play a vital role in the sex determination and differentiation. With the development of the modern genetics, a great progress on the key genes has been made in sex determination. In this review, we summarize the mechanism of sex determination and the strategy of how to study the key genes in sex determination. It will help us to understand the mechanism of sex determination better in the teaching of genetics.

Characterizing ligand-gated ion channel receptors with genetically encoded Ca2++ sensors.

Directory of Open Access Journals (Sweden)

John G Yamauchi

2011-01-01

Full Text Available We present a cell based system and experimental approach to characterize agonist and antagonist selectivity for ligand-gated ion channels (LGIC by developing sensor cells stably expressing a Ca(2+ permeable LGIC and a genetically encoded Förster (or fluorescence resonance energy transfer (FRET-based calcium sensor. In particular, we describe separate lines with human α7 and human α4β2 nicotinic acetylcholine receptors, mouse 5-HT(3A serotonin receptors and a chimera of human α7/mouse 5-HT(3A receptors. Complete concentration-response curves for agonists and Schild plots of antagonists were generated from these sensors and the results validate known pharmacology of the receptors tested. Concentration-response relations can be generated from either the initial rate or maximal amplitudes of FRET-signal. Although assaying at a medium throughput level, this pharmacological fluorescence detection technique employs a clonal line for stability and has versatility for screening laboratory generated congeners as agonists or antagonists on multiple subtypes of ligand-gated ion channels. The clonal sensor lines are also compatible with in vivo usage to measure indirectly receptor activation by endogenous neurotransmitters.

Fast and Memory-Efficient Key Recovery in Side-Channel Attacks

DEFF Research Database (Denmark)

Bogdanov, Andrey; Kizhvatov, Ilya; Manzoor, Kamran

2016-01-01

, this algorithm outputs the full combined keys in the optimal order – from more likely to less likely ones. OKEA uses plenty of memory by its nature though, which limits its practical efficiency. Especially in the cases where the side-channel traces are noisy, the memory and running time requirements to find...... the right key can be prohibitively high. To tackle this problem, we propose a score-based key enumeration algorithm (SKEA). Though it is suboptimal in terms of the output order of candidate combined keys, SKEA’s memory and running time requirements are more practical than those of OKEA. We verify...... the advantage at the example of a DPA attack on an 8-bit embedded software implementation of AES-128. We vary the number of traces available to the adversary and report a significant increase in the success rate of the key recovery due to SKEA when compared to OKEA, within practical limitations on time...

Entanglement of Gaussian states and the applicability to quantum key distribution over fading channels

International Nuclear Information System (INIS)

Usenko, Vladyslav C; Filip, Radim; Heim, Bettina; Peuntinger, Christian; Wittmann, Christoffer; Marquardt, Christoph; Leuchs, Gerd

2012-01-01

Entanglement properties of Gaussian states of light as well as the security of continuous variable quantum key distribution with Gaussian states in free-space fading channels are studied. These qualities are shown to be sensitive to the statistical properties of the transmittance distribution in the cases when entanglement is strong or when channel excess noise is present. Fading, i.e. transmission fluctuations, caused by beam wandering due to atmospheric turbulence, is a frequent challenge in free-space communication. We introduce a method of fading discrimination and subsequent post-selection of the corresponding sub-states and show that it can improve the entanglement resource and restore the security of the key distribution over a realistic fading link. Furthermore, the optimal post-selection strategy in combination with an optimized entangled resource is shown to drastically increase the protocol's robustness to excess noise, which is confirmed for experimentally measured fading channel characteristics. The stability of the result against finite data ensemble size and imperfect channel estimation is also addressed. (paper)

WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

Science.gov (United States)

Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

2016-06-01

The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Effect of nutrient restriction and re-feeding on calpain family genes in skeletal muscle of channel catfish (Ictalurus punctatus.

Directory of Open Access Journals (Sweden)

Elena Preziosa

Full Text Available BACKGROUND: Calpains, a superfamily of intracellular calcium-dependent cysteine proteases, are involved in the cytoskeletal remodeling and wasting of skeletal muscle. Calpains are generated as inactive proenzymes which are activated by N-terminal autolysis induced by calcium-ions. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we characterized the full-length cDNA sequences of three calpain genes, clpn1, clpn2, and clpn3 in channel catfish, and assessed the effect of nutrient restriction and subsequent re-feeding on the expression of these genes in skeletal muscle. The clpn1 cDNA sequence encodes a protein of 704 amino acids, Clpn2 of 696 amino acids, and Clpn3 of 741 amino acids. Phylogenetic analysis of deduced amino acid sequences indicate that catfish Clpn1 and Clpn2 share a sequence similarity of 61%; catfish Clpn1 and Clpn3 of 48%, and Clpn2 and Clpn3 of only 45%. The domain structure architectures of all three calpain genes in channel catfish are similar to those of other vertebrates, further supported by strong bootstrap values during phylogenetic analyses. Starvation of channel catfish (average weight, 15-20 g for 35 days influenced the expression of clpn1 (2.3-fold decrease, P<0.05, clpn2 (1.3-fold increase, P<0.05, and clpn3 (13.0-fold decrease, P<0.05, whereas the subsequent refeeding did not change the expression of these genes as measured by quantitative real-time PCR analysis. Calpain catalytic activity in channel catfish skeletal muscle showed significant differences only during the starvation period, with a 1.2- and 1.4- fold increase (P<0.01 after 17 and 35 days of starvation, respectively. CONCLUSION/SIGNIFICANCE: We have assessed that fasting and refeeding may provide a suitable experimental model to provide us insight into the role of calpains during fish muscle atrophy and how they respond to changes in nutrient supply.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

Displacement encoder

International Nuclear Information System (INIS)

Hesketh, T.G.

1983-01-01

In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Robust Multiparty Quantum Secret Key Sharing Over Two Collective-Noise Channels via Three-Photon Mixed States

International Nuclear Information System (INIS)

Wang Zhangyin; Yuan Hao; Gao Gan; Shi Shouhua

2006-01-01

We present a robust (n,n)-threshold scheme for multiparty quantum secret sharing of key over two collective-noise channels (i.e., the collective dephasing channel and the collective rotating channel) via three-photon mixed states. In our scheme, only if all the sharers collaborate together can they establish a joint key with the message sender and extract the secret message from the sender's encrypted message. This scheme can be implemented using only a Bell singlet, a one-qubit state and polarization identification of single photon, so it is completely feasible according to the present-day technique.

Experimental aspects of deterministic secure quantum key distribution

Energy Technology Data Exchange (ETDEWEB)

Walenta, Nino; Korn, Dietmar; Puhlmann, Dirk; Felbinger, Timo; Hoffmann, Holger; Ostermeyer, Martin [Universitaet Potsdam (Germany). Institut fuer Physik; Bostroem, Kim [Universitaet Muenster (Germany)

2008-07-01

Most common protocols for quantum key distribution (QKD) use non-deterministic algorithms to establish a shared key. But deterministic implementations can allow for higher net key transfer rates and eavesdropping detection rates. The Ping-Pong coding scheme by Bostroem and Felbinger[1] employs deterministic information encoding in entangled states with its characteristic quantum channel from Bob to Alice and back to Bob. Based on a table-top implementation of this protocol with polarization-entangled photons fundamental advantages as well as practical issues like transmission losses, photon storage and requirements for progress towards longer transmission distances are discussed and compared to non-deterministic protocols. Modifications of common protocols towards a deterministic quantum key distribution are addressed.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

Science.gov (United States)

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Directory of Open Access Journals (Sweden)

Bertin Stéphane

2011-10-01

Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

Science.gov (United States)

Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

2011-03-01

Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

Arrhythmogenic KCNE gene variants: current knowledge and future challenges

Directory of Open Access Journals (Sweden)

Shawn M Crump

2014-01-01

Full Text Available There are twenty-five known inherited cardiac arrhythmia susceptibility genes, all of which encode either ion channel pore-forming subunits or proteins that regulate aspects of ion channel biology such as function, trafficking and localization. The human KCNE gene family comprises five potassium channel regulatory subunits, sequence variants in each of which are associated with cardiac arrhythmias. KCNE gene products exhibit promiscuous partnering and in some cases ubiquitous expression, hampering efforts to unequivocally correlate each gene to specific native potassium currents. Likewise, deducing the molecular etiology of cardiac arrhythmias in individuals harboring rare KCNE gene variants, or more common KCNE polymorphisms, can be challenging. In this review we provide an update on putative arrhythmia-causing KCNE gene variants, and discuss current thinking and future challenges in the study of molecular mechanisms of KCNE-associated cardiac rhythm disturbances.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

Science.gov (United States)

This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

DEFF Research Database (Denmark)

Christensen, P U; Davey, William John; Nielsen, O

1997-01-01

In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

The effect of structural design parameters on FPGA-based feed-forward space-time trellis coding-orthogonal frequency division multiplexing channel encoders

Science.gov (United States)

Passas, Georgios; Freear, Steven; Fawcett, Darren

2010-08-01

Orthogonal frequency division multiplexing (OFDM)-based feed-forward space-time trellis code (FFSTTC) encoders can be synthesised as very high speed integrated circuit hardware description language (VHDL) designs. Evaluation of their FPGA implementation can lead to conclusions that help a designer to decide the optimum implementation, given the encoder structural parameters. VLSI architectures based on 1-bit multipliers and look-up tables (LUTs) are compared in terms of FPGA slices and block RAMs (area), as well as in terms of minimum clock period (speed). Area and speed graphs versus encoder memory order are provided for quadrature phase shift keying (QPSK) and 8 phase shift keying (8-PSK) modulation and two transmit antennas, revealing best implementation under these conditions. The effect of number of modulation bits and transmit antennas on the encoder implementation complexity is also investigated.

An adaptation method to improve secret key rates of time-frequency QKD in atmospheric turbulence channels

Science.gov (United States)

Sun, Xiaole; Djordjevic, Ivan B.; Neifeld, Mark A.

2016-03-01

Free-space optical (FSO) channels can be characterized by random power fluctuations due to atmospheric turbulence, which is known as scintillation. Weak coherent source based FSO quantum key distribution (QKD) systems suffer from the scintillation effect because during the deep channel fading the expected detection rate drops, which then gives an eavesdropper opportunity to get additional information about protocol by performing photon number splitting (PNS) attack and blocking single-photon pulses without changing QBER. To overcome this problem, in this paper, we study a large-alphabet QKD protocol, which is achieved by using pulse-position modulation (PPM)-like approach that utilizes the time-frequency uncertainty relation of the weak coherent photon state, called here TF-PPM-QKD protocol. We first complete finite size analysis for TF-PPM-QKD protocol to give practical bounds against non-negligible statistical fluctuation due to finite resources in practical implementations. The impact of scintillation under strong atmospheric turbulence regime is studied then. To overcome the secure key rate performance degradation of TF-PPM-QKD caused by scintillation, we propose an adaptation method for compensating the scintillation impact. By changing source intensity according to the channel state information (CSI), obtained by classical channel, the adaptation method improves the performance of QKD system with respect to the secret key rate. The CSI of a time-varying channel can be predicted using stochastic models, such as autoregressive (AR) models. Based on the channel state predictions, we change the source intensity to the optimal value to achieve a higher secret key rate. We demonstrate that the improvement of the adaptation method is dependent on the prediction accuracy.

Optimal super dense coding over memory channels

OpenAIRE

Shadman, Zahra; Kampermann, Hermann; Macchiavello, Chiara; Bruß, Dagmar

2011-01-01

We study the super dense coding capacity in the presence of quantum channels with correlated noise. We investigate both the cases of unitary and non-unitary encoding. Pauli channels for arbitrary dimensions are treated explicitly. The super dense coding capacity for some special channels and resource states is derived for unitary encoding. We also provide an example of a memory channel where non-unitary encoding leads to an improvement in the super dense coding capacity.

Cardiac Delayed Rectifier Potassium Channels in Health and Disease.

Science.gov (United States)

Chen, Lei; Sampson, Kevin J; Kass, Robert S

2016-06-01

Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this article, we will review their molecular identities and biophysical properties. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. Copyright © 2016 Elsevier Inc. All rights reserved.

[Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

Science.gov (United States)

Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

2016-12-04

Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

Molecular cloning of a K+ channel from the malaria parasite Plasmodium falciparum

DEFF Research Database (Denmark)

Ellekvist, Peter; Ricke, Christina Høier; Litman, Thomas

2004-01-01

In most living cells, K(+) channels are important for the generation of the membrane potential and for volume regulation. The parasite Plasmodium falciparum, which causes malignant malaria, must be able to deal with large variations in the ambient K(+) concentration: it is exposed to high...... concentrations of K(+) when inside the erythrocyte and low concentrations when in plasma. In the recently published genome of P. falciparum, we have identified a gene, pfkch1, encoding a potential K(+) channel, which to some extent resembles the big-conductance (BK) K(+) channel. We have cloned the approximately...

[Channels: a new way to revisit pathology].

Science.gov (United States)

Fournier, Emmanuel

2014-02-01

Many "essential" diseases that manifest themselves in the form of crises or fits (epilepsies, episodic ataxia, periodic paralyses, myotonia, heart rhythm disorders, etc.) are due to ionic channel dysfunction and are thus referred to as "channelopathies". Some of these disorders are congenital, due to mutations of genes encoding channel subunits, while others result from toxic, immune or hormonal disturbances affecting channelfunction. Channelopathies take on a wide variety of clinical forms, depending on the type of channel (sodium, potassium, calcium, chloride...) and the type of dysfunction (loss or gain of function). Some apparently unrelated diseases affecting distinct organs are due to a similar dysfunction of the same channel, revealing unsuspected relationships between organs and between medical specialties. In addition, a given syndrome can be caused by distinct channel dysfunctions. This provides new opportunities for diferential diagnosis and specific correction of the causal defects, although some treatments find applications across multiple medical specialties.

Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

Directory of Open Access Journals (Sweden)

Ricardo Harakava

2005-01-01

Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Shal/K(v4 channels are required for maintaining excitability during repetitive firing and normal locomotion in Drosophila.

Directory of Open Access Journals (Sweden)

Yong Ping

2011-01-01

Full Text Available Rhythmic behaviors, such as walking and breathing, involve the coordinated activity of central pattern generators in the CNS, sensory feedback from the PNS, to motoneuron output to muscles. Unraveling the intrinsic electrical properties of these cellular components is essential to understanding this coordinated activity. Here, we examine the significance of the transient A-type K(+ current (I(A, encoded by the highly conserved Shal/K(v4 gene, in neuronal firing patterns and repetitive behaviors. While I(A is present in nearly all neurons across species, elimination of I(A has been complicated in mammals because of multiple genes underlying I(A, and/or electrical remodeling that occurs in response to affecting one gene.In Drosophila, the single Shal/K(v4 gene encodes the predominant I(A current in many neuronal cell bodies. Using a transgenically expressed dominant-negative subunit (DNK(v4, we show that I(A is completely eliminated from cell bodies, with no effect on other currents. Most notably, DNK(v4 neurons display multiple defects during prolonged stimuli. DNK(v4 neurons display shortened latency to firing, a lower threshold for repetitive firing, and a progressive decrement in AP amplitude to an adapted state. We record from identified motoneurons and show that Shal/K(v4 channels are similarly required for maintaining excitability during repetitive firing. We then examine larval crawling, and adult climbing and grooming, all behaviors that rely on repetitive firing. We show that all are defective in the absence of Shal/K(v4 function. Further, knock-out of Shal/K(v4 function specifically in motoneurons significantly affects the locomotion behaviors tested.Based on our results, Shal/K(v4 channels regulate the initiation of firing, enable neurons to continuously fire throughout a prolonged stimulus, and also influence firing frequency. This study shows that Shal/K(v4 channels play a key role in repetitively firing neurons during prolonged

Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

Science.gov (United States)

Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

2012-07-10

The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

Science.gov (United States)

Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

1997-06-01

Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

Science.gov (United States)

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

Encoding of rat working memory by power of multi-channel local field potentials via sparse non-negative matrix factorization

Institute of Scientific and Technical Information of China (English)

Xu Liu; Tiao-Tiao Liu; Wen-Wen Bai; Hu Yi; Shuang-Yan Li; Xin Tian

2013-01-01

Working memory plays an important role in human cognition.This study investigated how working memory was encoded by the power of multi-channel local field potentials (LFPs) based on sparse nonnegative matrix factorization (SNMF).SNMF was used to extract features from LFPs recorded from the prefrontal cortex of four Sprague-Dawley rats during a memory task in a Y maze,with 10 trials for each rat.Then the power-increased LFP components were selected as working memory-related features and the other components were removed.After that,the inverse operation of SNMF was used to study the encoding of working memory in the timefrequency domain.We demonstrated that theta and gamma power increased significantly during the working memory task.The results suggested that postsynaptic activity was simulated well by the sparse activity model.The theta and gamma bands were meaningful for encoding working memory.

Secret-key agreement over spatially correlated multiple-antenna channels in the low-SNR regime

KAUST Repository

Zorgui, Marwen; Rezki, Zouheir; Alomair, Basel; Jorswieck, Eduard A.; Alouini, Mohamed-Slim

2015-01-01

We consider secret-key agreement with public discussion over Rayleigh fast-fading channels with transmit, receive and eavesdropper correlation. The legitimate receiver along with the eavesdropper are assumed to have perfect channel knowledge while the transmitter has only knowledge of the correlation matrices. We analyze the secret-key capacity in the low signal-to-noise ratio (SNR) regime. We derive closed-form expressions for the first and the second derivatives of the secret-key capacity with respect to SNR at SNR= 0, for arbitrary correlation matrices and number of transmit, receive and eavesdropper antennas. Moreover, we identify optimal transmission strategies achieving these derivatives. For instance, we prove that achieving the first and the second derivatives requires a uniform power distribution between the eigenvectors spanning the maximal-eigenvalue eigenspace of the transmit correlation matrix. We also compare the optimal transmission scheme to a simple uniform power allocation. Finally, we express the minimum energy required for sharing a secret-key bit as well as the wideband slope in terms of the system parameters.

Secret-key agreement over spatially correlated multiple-antenna channels in the low-SNR regime

KAUST Repository

Zorgui, Marwen

2015-09-28

We consider secret-key agreement with public discussion over Rayleigh fast-fading channels with transmit, receive and eavesdropper correlation. The legitimate receiver along with the eavesdropper are assumed to have perfect channel knowledge while the transmitter has only knowledge of the correlation matrices. We analyze the secret-key capacity in the low signal-to-noise ratio (SNR) regime. We derive closed-form expressions for the first and the second derivatives of the secret-key capacity with respect to SNR at SNR= 0, for arbitrary correlation matrices and number of transmit, receive and eavesdropper antennas. Moreover, we identify optimal transmission strategies achieving these derivatives. For instance, we prove that achieving the first and the second derivatives requires a uniform power distribution between the eigenvectors spanning the maximal-eigenvalue eigenspace of the transmit correlation matrix. We also compare the optimal transmission scheme to a simple uniform power allocation. Finally, we express the minimum energy required for sharing a secret-key bit as well as the wideband slope in terms of the system parameters.

Continuous-variable quantum key distribution in uniform fast-fading channels

Science.gov (United States)

Papanastasiou, Panagiotis; Weedbrook, Christian; Pirandola, Stefano

2018-03-01

We investigate the performance of several continuous-variable quantum key distribution protocols in the presence of uniform fading channels. These are lossy channels whose transmissivity changes according to a uniform probability distribution. We assume the worst-case scenario where an eavesdropper induces a fast-fading process, where she chooses the instantaneous transmissivity while the remote parties may only detect the mean statistical effect. We analyze coherent-state protocols in various configurations, including the one-way switching protocol in reverse reconciliation, the measurement-device-independent protocol in the symmetric configuration, and its extension to a three-party network. We show that, regardless of the advantage given to the eavesdropper (control of the fading), these protocols can still achieve high rates under realistic attacks, within reasonable values for the variance of the probability distribution associated with the fading process.

Plant adaptation to fluctuating environment and biomass production are strongly dependent on guard cell potassium channels

Science.gov (United States)

Lebaudy, Anne; Vavasseur, Alain; Hosy, Eric; Dreyer, Ingo; Leonhardt, Nathalie; Thibaud, Jean-Baptiste; Véry, Anne-Aliénor; Simonneau, Thierry; Sentenac, Hervé

2008-01-01

At least four genes encoding plasma membrane inward K+ channels (Kin channels) are expressed in Arabidopsis guard cells. A double mutant plant was engineered by disruption of a major Kin channel gene and expression of a dominant negative channel construct. Using the patch-clamp technique revealed that this mutant was totally deprived of guard cell Kin channel (GCKin) activity, providing a model to investigate the roles of this activity in the plant. GCKin activity was found to be an essential effector of stomatal opening triggered by membrane hyperpolarization and thereby of blue light-induced stomatal opening at dawn. It improved stomatal reactivity to external or internal signals (light, CO2 availability, and evaporative demand). It protected stomatal function against detrimental effects of Na+ when plants were grown in the presence of physiological concentrations of this cation, probably by enabling guard cells to selectively and rapidly take up K+ instead of Na+ during stomatal opening, thereby preventing deleterious effects of Na+ on stomatal closure. It was also shown to be a key component of the mechanisms that underlie the circadian rhythm of stomatal opening, which is known to gate stomatal responses to extracellular and intracellular signals. Finally, in a meteorological scenario with higher light intensity during the first hours of the photophase, GCKin activity was found to allow a strong increase (35%) in plant biomass production. Thus, a large diversity of approaches indicates that GCKin activity plays pleiotropic roles that crucially contribute to plant adaptation to fluctuating and stressing natural environments. PMID:18367672

On The Designed And Constructed Feedback Shift-Register Encoder

African Journals Online (AJOL)

Information transmission in noisy channels can be achieved with vanishingly small probability of error by proper coding of the information as long as the encoding rate is less than the channel capacity. An encoder capable of cyclical shifting of data, and which can therefore be used for Bose-Chaudhuri and Hocquenghem ...

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

Science.gov (United States)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

Directory of Open Access Journals (Sweden)

Nadja Knoll

Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

An Orbital Angular Momentum (OAM) Mode Reconfigurable Antenna for Channel Capacity Improvement and Digital Data Encoding.

Science.gov (United States)

Liu, Baiyang; Lin, Guoying; Cui, Yuehui; Li, RongLin

2017-08-29

For purpose of utilizing orbital angular momentum (OAM) mode diversity, multiple OAM beams should be generated preferably by a single antenna. In this paper, an OAM mode reconfigurable antenna is proposed. Different from the existed OAM antennas with multiple ports for multiple OAM modes transmitting, the proposed antenna with only a single port, but it can be used to transmit mode 1 or mode -1 OAM beams arbitrary by controlling the PIN diodes on the feeding network through a programmable microcontroller which control by a remote controller. Simulation and measurement results such as return loss, near-field and far-field radiation patterns of two operating states for mode 1 and mode -1, and OAM mode orthogonality are given. The proposed antenna can serve as a candidate for utilizing OAM diversity, namely phase diversity to increase channel capacity at 2.4 GHz. Moreover, an OAM-mode based encoding method is experimentally carried out by the proposed OAM mode reconfigurable antenna, the digital data are encoded and decoded by different OAM modes. At the transmitter, the proposed OAM mode reconfigurable antenna is used to encode the digital data, data symbol 0 and 1 are mapped to OAM mode 1 and mode -1, respectively. At the receiver, the data symbols are decoded by phase gradient method.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

Practical scheme to share a secret key through a quantum channel with a 27.6% bit error rate

International Nuclear Information System (INIS)

Chau, H.F.

2002-01-01

A secret key shared through quantum key distribution between two cooperative players is secure against any eavesdropping attack allowed by the laws of physics. Yet, such a key can be established only when the quantum channel error rate due to eavesdropping or imperfect apparatus is low. Here, a practical quantum key distribution scheme by making use of an adaptive privacy amplification procedure with two-way classical communication is reported. Then, it is proven that the scheme generates a secret key whenever the bit error rate of the quantum channel is less than 0.5-0.1√(5)≅27.6%, thereby making it the most error resistant scheme known to date

Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

Directory of Open Access Journals (Sweden)

Muscariello Lidia

2006-05-01

Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

Joint Source-Channel Decoding of Variable-Length Codes with Soft Information: A Survey

Directory of Open Access Journals (Sweden)

Pierre Siohan

2005-05-01

Full Text Available Multimedia transmission over time-varying wireless channels presents a number of challenges beyond existing capabilities conceived so far for third-generation networks. Efficient quality-of-service (QoS provisioning for multimedia on these channels may in particular require a loosening and a rethinking of the layer separation principle. In that context, joint source-channel decoding (JSCD strategies have gained attention as viable alternatives to separate decoding of source and channel codes. A statistical framework based on hidden Markov models (HMM capturing dependencies between the source and channel coding components sets the foundation for optimal design of techniques of joint decoding of source and channel codes. The problem has been largely addressed in the research community, by considering both fixed-length codes (FLC and variable-length source codes (VLC widely used in compression standards. Joint source-channel decoding of VLC raises specific difficulties due to the fact that the segmentation of the received bitstream into source symbols is random. This paper makes a survey of recent theoretical and practical advances in the area of JSCD with soft information of VLC-encoded sources. It first describes the main paths followed for designing efficient estimators for VLC-encoded sources, the key component of the JSCD iterative structure. It then presents the main issues involved in the application of the turbo principle to JSCD of VLC-encoded sources as well as the main approaches to source-controlled channel decoding. This survey terminates by performance illustrations with real image and video decoding systems.

Joint Source-Channel Decoding of Variable-Length Codes with Soft Information: A Survey

Science.gov (United States)

Guillemot, Christine; Siohan, Pierre

2005-12-01

Multimedia transmission over time-varying wireless channels presents a number of challenges beyond existing capabilities conceived so far for third-generation networks. Efficient quality-of-service (QoS) provisioning for multimedia on these channels may in particular require a loosening and a rethinking of the layer separation principle. In that context, joint source-channel decoding (JSCD) strategies have gained attention as viable alternatives to separate decoding of source and channel codes. A statistical framework based on hidden Markov models (HMM) capturing dependencies between the source and channel coding components sets the foundation for optimal design of techniques of joint decoding of source and channel codes. The problem has been largely addressed in the research community, by considering both fixed-length codes (FLC) and variable-length source codes (VLC) widely used in compression standards. Joint source-channel decoding of VLC raises specific difficulties due to the fact that the segmentation of the received bitstream into source symbols is random. This paper makes a survey of recent theoretical and practical advances in the area of JSCD with soft information of VLC-encoded sources. It first describes the main paths followed for designing efficient estimators for VLC-encoded sources, the key component of the JSCD iterative structure. It then presents the main issues involved in the application of the turbo principle to JSCD of VLC-encoded sources as well as the main approaches to source-controlled channel decoding. This survey terminates by performance illustrations with real image and video decoding systems.

Shared origins of a key enzyme during the evolution of C4 and CAM metabolism

Science.gov (United States)

Christin, Pascal-Antoine; Arakaki, Monica; Osborne, Colin P.; Bräutigam, Andrea; Sage, Rowan F.; Hibberd, Julian M.; Kelly, Steven; Covshoff, Sarah; Wong, Gane Ka-Shu; Hancock, Lillian; Edwards, Erika J.

2014-01-01

CAM and C4 photosynthesis are two key plant adaptations that have evolved independently multiple times, and are especially prevalent in particular groups of plants, including the Caryophyllales. We investigate the origin of photosynthetic PEPC, a key enzyme of both the CAM and C4 pathways. We combine phylogenetic analyses of genes encoding PEPC with analyses of RNA sequence data of Portulaca, the only plants known to perform both CAM and C4 photosynthesis. Three distinct gene lineages encoding PEPC exist in eudicots (namely ppc-1E1, ppc-1E2 and ppc-2), one of which (ppc-1E1) was recurrently recruited for use in both CAM and C4 photosynthesis within the Caryophyllales. This gene is present in multiple copies in the cacti and relatives, including Portulaca. The PEPC involved in the CAM and C4 cycles of Portulaca are encoded by closely related yet distinct genes. The CAM-specific gene is similar to genes from related CAM taxa, suggesting that CAM has evolved before C4 in these species. The similar origin of PEPC and other genes involved in the CAM and C4 cycles highlights the shared early steps of evolutionary trajectories towards CAM and C4, which probably diverged irreversibly only during the optimization of CAM and C4 phenotypes. PMID:24638902

Entanglement-distillation attack on continuous-variable quantum key distribution in a turbulent atmospheric channel

Science.gov (United States)

Guo, Ying; Xie, Cailang; Liao, Qin; Zhao, Wei; Zeng, Guihua; Huang, Duan

2017-08-01

The survival of Gaussian quantum states in a turbulent atmospheric channel is of crucial importance in free-space continuous-variable (CV) quantum key distribution (QKD), in which the transmission coefficient will fluctuate in time, thus resulting in non-Gaussian quantum states. Different from quantum hacking of the imperfections of practical devices, here we propose a different type of attack by exploiting the security loopholes that occur in a real lossy channel. Under a turbulent atmospheric environment, the Gaussian states are inevitably afflicted by decoherence, which would cause a degradation of the transmitted entanglement. Therefore, an eavesdropper can perform an intercept-resend attack by applying an entanglement-distillation operation on the transmitted non-Gaussian mixed states, which allows the eavesdropper to bias the estimation of the parameters and renders the final keys shared between the legitimate parties insecure. Our proposal highlights the practical CV QKD vulnerabilities with free-space quantum channels, including the satellite-to-earth links, ground-to-ground links, and a link from moving objects to ground stations.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Ion Channel Genes and Epilepsy: Functional Alteration, Pathogenic Potential, and Mechanism of Epilepsy.

Science.gov (United States)

Wei, Feng; Yan, Li-Min; Su, Tao; He, Na; Lin, Zhi-Jian; Wang, Jie; Shi, Yi-Wu; Yi, Yong-Hong; Liao, Wei-Ping

2017-08-01

Ion channels are crucial in the generation and modulation of excitability in the nervous system and have been implicated in human epilepsy. Forty-one epilepsy-associated ion channel genes and their mutations are systematically reviewed. In this paper, we analyzed the genotypes, functional alterations (funotypes), and phenotypes of these mutations. Eleven genes featured loss-of-function mutations and six had gain-of-function mutations. Nine genes displayed diversified funotypes, among which a distinct funotype-phenotype correlation was found in SCN1A. These data suggest that the funotype is an essential consideration in evaluating the pathogenicity of mutations and a distinct funotype or funotype-phenotype correlation helps to define the pathogenic potential of a gene.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

Directory of Open Access Journals (Sweden)

Borchardt Stephanie M

2006-07-01

Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

[Key effect genes responding to nerve injury identified by gene ontology and computer pattern recognition].

Science.gov (United States)

Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei

2012-07-01

In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.

One-sided measurement-device-independent quantum key distribution

Science.gov (United States)

Cao, Wen-Fei; Zhen, Yi-Zheng; Zheng, Yu-Lin; Li, Li; Chen, Zeng-Bing; Liu, Nai-Le; Chen, Kai

2018-01-01

Measurement-device-independent quantum key distribution (MDI-QKD) protocol was proposed to remove all the detector side channel attacks, while its security relies on the trusted encoding systems. Here we propose a one-sided MDI-QKD (1SMDI-QKD) protocol, which enjoys detection loophole-free advantage, and at the same time weakens the state preparation assumption in MDI-QKD. The 1SMDI-QKD can be regarded as a modified MDI-QKD, in which Bob's encoding system is trusted, while Alice's is uncharacterized. For the practical implementation, we also provide a scheme by utilizing coherent light source with an analytical two decoy state estimation method. Simulation with realistic experimental parameters shows that the protocol has a promising performance, and thus can be applied to practical QKD applications.

Transcriptomic analysis reveals key genes related to betalain biosynthesis in pulp coloration of Hylocereus polyrhizus

Directory of Open Access Journals (Sweden)

Hua eQingzhu

2016-01-01

Full Text Available Betalains have high nutritional value and bioactivities. Red pulp pitaya (Hylocereus polyrhizus is the only fruit containing abundant betalains for consumer. However, no information is available about genes involved in betalain biosynthesis in H. polyrhizus. Herein, two cDNA libraries of pitaya pulps with two different coloration stages (white and red pulp stages of Guanhuahong (H. polyrhizus were constructed. A total of about 12 Gb raw RNA-Seq data was generated and was de novo assembled into 122,677 transcripts with an average length of 1,183 bp and an N50 value of 2008. Approximately 99.99% of all transcripts were annotated based on seven public databases. A total of 8,871 transcripts were significantly regulated. Thirty-three candidate transcripts related to betalain biosynthesis were obtained from the transcriptome data. Transcripts encoding enzymes involved in betalain biosynthesis were analyzed using RT-qPCR at the whole pulp coloration stages of H. Polyrhizus (7-1 and H. Undatus (132-4. Nine key transcripts of betalain biosynthesis were identified. They were assigned to four kinds of genes in betalain biosynthetic pathway, including tyrosinase, 4, 5-DOPA dioxygenase extradiol, cytochrome P450 and glucosyltransferase. Ultimately, a preliminary betalain biosynthetic pathway for pitaya was proposed based on betalain analyses and gene expression profiles.

Integration of quantum key distribution and private classical communication through continuous variable

Science.gov (United States)

Wang, Tianyi; Gong, Feng; Lu, Anjiang; Zhang, Damin; Zhang, Zhengping

2017-12-01

In this paper, we propose a scheme that integrates quantum key distribution and private classical communication via continuous variables. The integrated scheme employs both quadratures of a weak coherent state, with encrypted bits encoded on the signs and Gaussian random numbers encoded on the values of the quadratures. The integration enables quantum and classical data to share the same physical and logical channel. Simulation results based on practical system parameters demonstrate that both classical communication and quantum communication can be implemented over distance of tens of kilometers, thus providing a potential solution for simultaneous transmission of quantum communication and classical communication.

Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

International Nuclear Information System (INIS)

Woloschak, G.E.; Chang-Liu, Chin-Mei

1994-01-01

Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Area, speed and power measurements of FPGA-based complex orthogonal space-time block code channel encoders

Science.gov (United States)

Passas, Georgios; Freear, Steven; Fawcett, Darren

2010-01-01

Space-time coding (STC) is an important milestone in modern wireless communications. In this technique, more copies of the same signal are transmitted through different antennas (space) and different symbol periods (time), to improve the robustness of a wireless system by increasing its diversity gain. STCs are channel coding algorithms that can be readily implemented on a field programmable gate array (FPGA) device. This work provides some figures for the amount of required FPGA hardware resources, the speed that the algorithms can operate and the power consumption requirements of a space-time block code (STBC) encoder. Seven encoder very high-speed integrated circuit hardware description language (VHDL) designs have been coded, synthesised and tested. Each design realises a complex orthogonal space-time block code with a different transmission matrix. All VHDL designs are parameterisable in terms of sample precision. Precisions ranging from 4 bits to 32 bits have been synthesised. Alamouti's STBC encoder design [Alamouti, S.M. (1998), 'A Simple Transmit Diversity Technique for Wireless Communications', IEEE Journal on Selected Areas in Communications, 16:55-108.] proved to be the best trade-off, since it is on average 3.2 times smaller, 1.5 times faster and requires slightly less power than the next best trade-off in the comparison, which is a 3/4-rate full-diversity 3Tx-antenna STBC.

Performance study of large area encoding readout MRPC

Science.gov (United States)

Chen, X. L.; Wang, Y.; Chen, G.; Han, D.; Wang, X.; Zeng, M.; Zeng, Z.; Zhao, Z.; Guo, B.

2018-02-01

Muon tomography system built by the 2-D readout high spatial resolution Multi-gap Resistive Plate Chamber (MRPC) detector is a project of Tsinghua University. An encoding readout method based on the fine-fine configuration has been used to minimize the number of the readout electronic channels resulting in reducing the complexity and the cost of the system. In this paper, we provide a systematic comparison of the MRPC detector performance with and without fine-fine encoding readout. Our results suggest that the application of the fine-fine encoding readout leads us to achieve a detecting system with slightly worse spatial resolution but dramatically reduce the number of electronic channels.

Expression of acid-sensing ion channels and selection of reference genes in mouse and naked mole rat.

Science.gov (United States)

Schuhmacher, Laura-Nadine; Smith, Ewan St John

2016-12-13

Acid-sensing ion channels (ASICs) are a family of ion channels comprised of six subunits encoded by four genes and they are expressed throughout the peripheral and central nervous systems. ASICs have been implicated in a wide range of physiological and pathophysiological processes: pain, breathing, synaptic plasticity and excitotoxicity. Unlike mice and humans, naked mole-rats do not perceive acid as a noxious stimulus, even though their sensory neurons express functional ASICs, likely an adaptation to living in a hypercapnic subterranean environment. Previous studies of ASIC expression in the mammalian nervous system have often not examined all subunits, or have failed to adequately quantify expression between tissues; to date there has been no attempt to determine ASIC expression in the central nervous system of the naked mole-rat. Here we perform a geNorm study to identify reliable housekeeping genes in both mouse and naked mole-rat and then use quantitative real-time PCR to estimate the relative amounts of ASIC transcripts in different tissues of both species. We identify RPL13A (ribosomal protein L13A) and CANX (calnexin), and β-ACTIN and EIF4A (eukaryotic initiation factor 4a) as being the most stably expressed housekeeping genes in mouse and naked mole-rat, respectively. In both species, ASIC3 was most highly expressed in dorsal root ganglia (DRG), and ASIC1a, ASIC2b and ASIC3 were more highly expressed across all brain regions compared to the other subunits. We also show that ASIC4, a proton-insensitive subunit of relatively unknown function, was highly expressed in all mouse tissues apart from DRG and hippocampus, but was by contrast the lowliest expressed ASIC in all naked mole-rat tissues.

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

Directory of Open Access Journals (Sweden)

Berkhout Ben

2006-12-01

Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Mechanisms underlying probucol-induced hERG-channel deficiency

Directory of Open Access Journals (Sweden)

Shi YQ

2015-07-01

Full Text Available Yuan-Qi Shi,1,* Cai-Chuan Yan,1,* Xiao Zhang,1 Meng Yan,1 Li-Rong Liu,1 Huai-Ze Geng,1 Lin Lv,1 Bao-Xin Li1,21Department of Pharmacology, Harbin Medical University, 2State-Province Key Laboratory of Biopharmaceutical Engineering, Harbin, Heilongjiang, People’s Republic of China*These authors contributed equally to this workAbstract: The hERG gene encodes the pore-forming α-subunit of the rapidly activating delayed rectifier potassium channel (IKr, which is important for cardiac repolarization. Reduction of IhERG due to genetic mutations or drug interferences causes long QT syndrome, leading to life-threatening cardiac arrhythmias (torsades de pointes or sudden death. Probucol is a cholesterol-lowering drug that could reduce hERG current by decreasing plasma membrane hERG protein expression and eventually cause long QT syndrome. Here, we investigated the mechanisms of probucol effects on IhERG and hERG-channel expression. Our data demonstrated that probucol reduces SGK1 expression, known as SGK isoform, in a concentration-dependent manner, resulting in downregulation of phosphorylated E3 ubiquitin ligase Nedd4-2 expression, but not the total level of Nedd4-2. As a result, the hERG protein reduces, due to the enhanced ubiquitination level. On the contrary, carbachol could enhance the phosphorylation level of Nedd4-2 as an alternative to SGK1, and thus rescue the ubiquitin-mediated degradation of hERG channels caused by probucol. These discoveries provide a novel mechanism of probucol-induced hERG-channel deficiency, and imply that carbachol or its analog may serve as potential therapeutic compounds for the handling of probucol cardiotoxicity.Keywords: long QT, hERG potassium channels, probucol, SGK1, Nedd4-2

BK channels regulate spontaneous action potential rhythmicity in the suprachiasmatic nucleus.

Directory of Open Access Journals (Sweden)

Jack Kent

Full Text Available BACKGROUND: Circadian ( approximately 24 hr rhythms are generated by the central pacemaker localized to the suprachiasmatic nucleus (SCN of the hypothalamus. Although the basis for intrinsic rhythmicity is generally understood to rely on transcription factors encoded by "clock genes", less is known about the daily regulation of SCN neuronal activity patterns that communicate a circadian time signal to downstream behaviors and physiological systems. Action potentials in the SCN are necessary for the circadian timing of behavior, and individual SCN neurons modulate their spontaneous firing rate (SFR over the daily cycle, suggesting that the circadian patterning of neuronal activity is necessary for normal behavioral rhythm expression. The BK K(+ channel plays an important role in suppressing spontaneous firing at night in SCN neurons. Deletion of the Kcnma1 gene, encoding the BK channel, causes degradation of circadian behavioral and physiological rhythms. METHODOLOGY/PRINCIPAL FINDINGS: To test the hypothesis that loss of robust behavioral rhythmicity in Kcnma1(-/- mice is due to the disruption of SFR rhythms in the SCN, we used multi-electrode arrays to record extracellular action potentials from acute wild-type (WT and Kcnma1(-/- slices. Patterns of activity in the SCN were tracked simultaneously for up to 3 days, and the phase, period, and synchronization of SFR rhythms were examined. Loss of BK channels increased arrhythmicity but also altered the amplitude and period of rhythmic activity. Unexpectedly, Kcnma1(-/- SCNs showed increased variability in the timing of the daily SFR peak. CONCLUSIONS/SIGNIFICANCE: These results suggest that BK channels regulate multiple aspects of the circadian patterning of neuronal activity in the SCN. In addition, these data illustrate the characteristics of a disrupted SCN rhythm downstream of clock gene-mediated timekeeping and its relationship to behavioral rhythms.

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

Eye movements of the murine P/Q calcium channel mutant Tottering, and the impact of aging

NARCIS (Netherlands)

J.S. Stahl (J.); R.A. James (Robert); B.S. Oommen (Brian); F.E. Hoebeek (Freek); C.I. de Zeeuw (Chris)

2006-01-01

textabstractMice carrying mutations of the gene encoding the ion pore of the P/Q calcium channel (Cacna1a) are an instance in which cerebellar dysfunction may be attributable to altered electrophysiology and thus provide an opportunity to study how neuronal intrinsic properties dictate signal

Unconstrained Capacities of Quantum Key Distribution and Entanglement Distillation for Pure-Loss Bosonic Broadcast Channels.

Science.gov (United States)

Takeoka, Masahiro; Seshadreesan, Kaushik P; Wilde, Mark M

2017-10-13

We consider quantum key distribution (QKD) and entanglement distribution using a single-sender multiple-receiver pure-loss bosonic broadcast channel. We determine the unconstrained capacity region for the distillation of bipartite entanglement and secret key between the sender and each receiver, whenever they are allowed arbitrary public classical communication. A practical implication of our result is that the capacity region demonstrated drastically improves upon rates achievable using a naive time-sharing strategy, which has been employed in previously demonstrated network QKD systems. We show a simple example of a broadcast QKD protocol overcoming the limit of the point-to-point strategy. Our result is thus an important step toward opening a new framework of network channel-based quantum communication technology.

Unconstrained Capacities of Quantum Key Distribution and Entanglement Distillation for Pure-Loss Bosonic Broadcast Channels

Science.gov (United States)

Takeoka, Masahiro; Seshadreesan, Kaushik P.; Wilde, Mark M.

2017-10-01

We consider quantum key distribution (QKD) and entanglement distribution using a single-sender multiple-receiver pure-loss bosonic broadcast channel. We determine the unconstrained capacity region for the distillation of bipartite entanglement and secret key between the sender and each receiver, whenever they are allowed arbitrary public classical communication. A practical implication of our result is that the capacity region demonstrated drastically improves upon rates achievable using a naive time-sharing strategy, which has been employed in previously demonstrated network QKD systems. We show a simple example of a broadcast QKD protocol overcoming the limit of the point-to-point strategy. Our result is thus an important step toward opening a new framework of network channel-based quantum communication technology.

Over-expression of zmarg encoding an arginase improves grain production in maize

International Nuclear Information System (INIS)

Hong, D.; Tian, Y.; Meng, X.; Zhang, P.

2016-01-01

Arginase, as one of the three key enzymes in nitrogen catabolism, the physiological role of Arg catabolism in cereal crops has not been fully clarified. Studies have shown that arginase-encoding genes play a key role in providing nitrogen to developing seedlings in many plant species.Yield is a primary trait in many crop breeding programs, which can be increased by modification of genes related to photosynthesis, nitrogen assimilation, carbon distribution, plant architecture, and transcriptional networks controlling plant development. In the present study, a maize arginase gene ZmARG was cloned and introduced into maize inbred lines by Agrobacterium tumefaciens- mediated transformation. Putative transgenic plants were confirmed by PCR, Southern blotting RT-PCR analysis. The expression of the ZmARG gene increased arginase activity in several tissues in transgenic lines. Transgenic maize plants had significantly higher ear weight and 100-seed weight as compared with wild-type control. Our results suggested that ZmARG was a potential target gene for crop yield improvement. (author)

The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

Directory of Open Access Journals (Sweden)

Ghaffari Novin M.

2015-06-01

Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

Directory of Open Access Journals (Sweden)

Jacqueline Schmuckli-Maurer

Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

Encoding model of temporal processing in human visual cortex.

Science.gov (United States)

Stigliani, Anthony; Jeska, Brianna; Grill-Spector, Kalanit

2017-12-19

How is temporal information processed in human visual cortex? Visual input is relayed to V1 through segregated transient and sustained channels in the retina and lateral geniculate nucleus (LGN). However, there is intense debate as to how sustained and transient temporal channels contribute to visual processing beyond V1. The prevailing view associates transient processing predominately with motion-sensitive regions and sustained processing with ventral stream regions, while the opposing view suggests that both temporal channels contribute to neural processing beyond V1. Using fMRI, we measured cortical responses to time-varying stimuli and then implemented a two temporal channel-encoding model to evaluate the contributions of each channel. Different from the general linear model of fMRI that predicts responses directly from the stimulus, the encoding approach first models neural responses to the stimulus from which fMRI responses are derived. This encoding approach not only predicts cortical responses to time-varying stimuli from milliseconds to seconds but also, reveals differential contributions of temporal channels across visual cortex. Consistent with the prevailing view, motion-sensitive regions and adjacent lateral occipitotemporal regions are dominated by transient responses. However, ventral occipitotemporal regions are driven by both sustained and transient channels, with transient responses exceeding the sustained. These findings propose a rethinking of temporal processing in the ventral stream and suggest that transient processing may contribute to rapid extraction of the content of the visual input. Importantly, our encoding approach has vast implications, because it can be applied with fMRI to decipher neural computations in millisecond resolution in any part of the brain. Copyright © 2017 the Author(s). Published by PNAS.

Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

2017-01-01

The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

Stochastic algorithm for channel optimized vector quantization: application to robust narrow-band speech coding

International Nuclear Information System (INIS)

Bouzid, M.; Benkherouf, H.; Benzadi, K.

2011-01-01

In this paper, we propose a stochastic joint source-channel scheme developed for efficient and robust encoding of spectral speech LSF parameters. The encoding system, named LSF-SSCOVQ-RC, is an LSF encoding scheme based on a reduced complexity stochastic split vector quantizer optimized for noisy channel. For transmissions over noisy channel, we will show first that our LSF-SSCOVQ-RC encoder outperforms the conventional LSF encoder designed by the split vector quantizer. After that, we applied the LSF-SSCOVQ-RC encoder (with weighted distance) for the robust encoding of LSF parameters of the 2.4 Kbits/s MELP speech coder operating over a noisy/noiseless channel. The simulation results will show that the proposed LSF encoder, incorporated in the MELP, ensure better performances than the original MELP MSVQ of 25 bits/frame; especially when the transmission channel is highly disturbed. Indeed, we will show that the LSF-SSCOVQ-RC yields significant improvement to the LSFs encoding performances by ensuring reliable transmissions over noisy channel.

Molecular cloning, functional expression and subcellular localization of two putative vacuolar voltage-gated chloride channels in rice (Oryza sativa L.).

Science.gov (United States)

Nakamura, Atsuko; Fukuda, Atsunori; Sakai, Shingo; Tanaka, Yoshiyuki

2006-01-01

We isolated two cDNA clones (OsCLC-1 and OsCLC-2) homologous to tobacco CLC-Nt1, which encodes a voltage-gated chloride channel, from rice (Oryza sativa L. ssp. japonica, cv. Nipponbare). The deduced amino acid sequences were highly conserved (87.9% identity with each other). Southern blot analysis of the rice genomic DNA revealed that OsCLC-1 and OsCLC-2 were single-copy genes on chromosomes 4 and 2, respectively. OsCLC-1 was expressed in most tissues, whereas OsCLC-2 was expressed only in the roots, nodes, internodes and leaf sheaths. The level of expression of OsCLC-1, but not of OsCLC-2, was increased by treatment with NaCl. Both genes could partly substitute for GEF1, which encodes the sole chloride channel in yeast, by restoring growth under ionic stress. These results indicate that both genes are chloride channel genes. The proteins from both genes were immunochemically detected in the tonoplast fraction. Tagged synthetic green fluorescent protein which was fused to OsCLC-1 or OsCLC-2 localized in the vacuolar membranes. These results indicate that the proteins may play a role in the transport of chloride ions across the vacuolar membrane. We isolated loss-of-function mutants of both genes from a panel of rice mutants produced by the insertion of a retrotransposon, Tos17, in the exon region, and found inhibition of growth at all life stages.

Amino-termini isoforms of the Slack K+ channel, regulated by alternative promoters, differentially modulate rhythmic firing and adaptation.

Science.gov (United States)

Brown, Maile R; Kronengold, Jack; Gazula, Valeswara-Rao; Spilianakis, Charalampos G; Flavell, Richard A; von Hehn, Christian A A; Bhattacharjee, Arin; Kaczmarek, Leonard K

2008-11-01

The rates of activation and unitary properties of Na+-activated K+ (K(Na)) currents have been found to vary substantially in different types of neurones. One class of K(Na) channels is encoded by the Slack gene. We have now determined that alternative RNA splicing gives rise to at least five different transcripts for Slack, which produce Slack channels that differ in their predicted cytoplasmic amino-termini and in their kinetic properties. Two of these, termed Slack-A channels, contain an amino-terminus domain closely resembling that of another class of K(Na) channels encoded by the Slick gene. Neuronal expression of Slack-A channels and of the previously described Slack isoform, now called Slack-B, are driven by independent promoters. Slack-A mRNAs were enriched in the brainstem and olfactory bulb and detected at significant levels in four different brain regions. When expressed in CHO cells, Slack-A channels activate rapidly upon depolarization and, in single channel recordings in Xenopus oocytes, are characterized by multiple subconductance states with only brief transient openings to the fully open state. In contrast, Slack-B channels activate slowly over hundreds of milliseconds, with openings to the fully open state that are approximately 6-fold longer than those for Slack-A channels. In numerical simulations, neurones in which outward currents are dominated by a Slack-A-like conductance adapt very rapidly to repeated or maintained stimulation over a wide range of stimulus strengths. In contrast, Slack-B currents promote rhythmic firing during maintained stimulation, and allow adaptation rate to vary with stimulus strength. Using an antibody that recognizes all amino-termini isoforms of Slack, Slack immunoreactivity is present at locations that have no Slack-B-specific staining, including olfactory bulb glomeruli and the dendrites of hippocampal neurones, suggesting that Slack channels with alternate amino-termini such as Slack-A channels are present at

Network-Guided Key Gene Discovery for a Given Cellular Process

DEFF Research Database (Denmark)

He, Feng Q; Ollert, Markus

2018-01-01

Identification of key genes for a given physiological or pathological process is an essential but still very challenging task for the entire biomedical research community. Statistics-based approaches, such as genome-wide association study (GWAS)- or quantitative trait locus (QTL)-related analysis...... have already made enormous contributions to identifying key genes associated with a given disease or phenotype, the success of which is however very much dependent on a huge number of samples. Recent advances in network biology, especially network inference directly from genome-scale data...

Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

Science.gov (United States)

Pyne, C; Bognar, A L

1992-03-01

The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

A mutation in the gene encoding mitochondrial Mg²+ channel MRS2 results in demyelination in the rat.

Directory of Open Access Journals (Sweden)

Takashi Kuramoto

2011-01-01

Full Text Available The rat demyelination (dmy mutation serves as a unique model system to investigate the maintenance of myelin, because it provokes severe myelin breakdown in the central nervous system (CNS after normal postnatal completion of myelination. Here, we report the molecular characterization of this mutation and discuss the possible pathomechanisms underlying demyelination. By positional cloning, we found that a G-to-A transition, 177 bp downstream of exon 3 of the Mrs2 (MRS2 magnesium homeostasis factor (Saccharomyces cerevisiae gene, generated a novel splice acceptor site which resulted in functional inactivation of the mutant allele. Transgenic rescue with wild-type Mrs2-cDNA validated our findings. Mrs2 encodes an essential component of the major Mg²+ influx system in mitochondria of yeast as well as human cells. We showed that the dmy/dmy rats have major mitochondrial deficits with a markedly elevated lactic acid concentration in the cerebrospinal fluid, a 60% reduction in ATP, and increased numbers of mitochondria in the swollen cytoplasm of oligodendrocytes. MRS2-GFP recombinant BAC transgenic rats showed that MRS2 was dominantly expressed in neurons rather than oligodendrocytes and was ultrastructurally observed in the inner membrane of mitochondria. Our observations led to the conclusion that dmy/dmy rats suffer from a mitochondrial disease and that the maintenance of myelin has a different mechanism from its initial production. They also established that Mg²+ homeostasis in CNS mitochondria is essential for the maintenance of myelin.

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Science.gov (United States)

Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

2013-01-01

The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

Directory of Open Access Journals (Sweden)

Linda J Savage

Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

NARCIS (Netherlands)

Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

2015-01-01

Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Encoding methods for B1+ mapping in parallel transmit systems at ultra high field

Science.gov (United States)

Tse, Desmond H. Y.; Poole, Michael S.; Magill, Arthur W.; Felder, Jörg; Brenner, Daniel; Jon Shah, N.

2014-08-01

Parallel radiofrequency (RF) transmission, either in the form of RF shimming or pulse design, has been proposed as a solution to the B1+ inhomogeneity problem in ultra high field magnetic resonance imaging. As a prerequisite, accurate B1+ maps from each of the available transmit channels are required. In this work, four different encoding methods for B1+ mapping, namely 1-channel-on, all-channels-on-except-1, all-channels-on-1-inverted and Fourier phase encoding, were evaluated using dual refocusing acquisition mode (DREAM) at 9.4 T. Fourier phase encoding was demonstrated in both phantom and in vivo to be the least susceptible to artefacts caused by destructive RF interference at 9.4 T. Unlike the other two interferometric encoding schemes, Fourier phase encoding showed negligible dependency on the initial RF phase setting and therefore no prior B1+ knowledge is required. Fourier phase encoding also provides a flexible way to increase the number of measurements to increase SNR, and to allow further reduction of artefacts by weighted decoding. These advantages of Fourier phase encoding suggest that it is a good choice for B1+ mapping in parallel transmit systems at ultra high field.

Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

Science.gov (United States)

Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

2005-01-01

Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

Science.gov (United States)

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

DEFF Research Database (Denmark)

Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

2016-01-01

genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

Color Image Authentication and Recovery via Adaptive Encoding

Directory of Open Access Journals (Sweden)

Chun-Hung Chen

2014-01-01

Full Text Available We describe an authentication and recovery scheme for color image protection based on adaptive encoding. The image blocks are categorized based on their contents and different encoding schemes are applied according to their types. Such adaptive encoding results in better image quality and more robust image authentication. The approximations of the luminance and chromatic channels are carefully calculated, and for the purpose of reducing the data size, differential coding is used to encode the channels with variable size according to the characteristic of the block. The recovery data which represents the approximation and the detail of the image is embedded for data protection. The necessary data is well protected by using error correcting coding and duplication. The experimental results demonstrate that our technique is able to identify and localize image tampering, while preserving high quality for both watermarked and recovered images.

Quantum key distribution with several intercept-resend attacks via a depolarizing channel

International Nuclear Information System (INIS)

Dehmani, Mustapha; Errahmani, Mohamed; Ez-Zahraouy, Hamid; Benyoussef, Abdelilah

2012-01-01

The disturbance effect of a depolarizing channel on the security of the quantum key distribution of the four-state BB84 protocol, with multiple sequential intercept-resend attacks of many eavesdroppers, has been studied. The quantum bit error rate and the mutual information are computed for an arbitrary number N of eavesdroppers. It is found that the quantum error rate decreases with increasing the depolarizing parameter p characterizing the noise of the channel. For p tr of p below which the information is secure and otherwise the information is not secure. The value of p tr decreases with increasing the number of attacks. In contrast, for p ⩾ 0.165, the information is not secure independently of the number of eavesdroppers. Phase diagrams corresponding to the secure—unsecure information are also established. (paper)

Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

Directory of Open Access Journals (Sweden)

Wernegreen Jennifer J

2010-12-01

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana

Directory of Open Access Journals (Sweden)

Ming Li

2016-01-01

Full Text Available Background. Water channel proteins, also called aquaporins, are integral membrane proteins from major intrinsic protein (MIP family and involved in several pathways including not only water transport but also cell signaling, reproduction, and photosynthesis. The full cDNA and protein sequences of aquaporin in Chorispora bungeana Fisch. & C.A. Mey (C. bungeana are still unknown. Results. In this study, PCR and rapid amplification of cDNA ends approaches were used to clone the full cDNA of LRB7 (GenBank accession number: EU636988 of C. bungeana. Sequence analysis indicated that it was 1235 bp, which had two introns and encoded a protein of 250 amino acids. Structure analysis revealed that the protein had two conserved NPA motifs, one of which is MIP signature sequence (SGxHxNPAVT, six membrane helix regions, and additional membrane-embedded domains. Phylogenetic analysis suggested that the protein was from TIP2 subgroup. Surprisingly, semiquantitative RT-PCR experiment and western blot analysis showed that LRB7 and TIP2 were only detectable in roots, unlike Arabidopsis and Raphanus. Connecting with our previous studies, LRB7 was supported to associate with chilling-tolerance in C. bungeana. Conclusion. This is the first time to characterize the full sequences of LRB7 gene and water channel protein in C. bungeana. Our findings contribute to understanding the water transports in plants under low temperatures.

A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

Science.gov (United States)

Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

2015-01-01

This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

Science.gov (United States)

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-12-12

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Meng Sun

2014-12-01

Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

OpenAIRE

Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

2014-01-01

The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

Identification of the Key Genes and Pathways in Esophageal Carcinoma.

Science.gov (United States)

Su, Peng; Wen, Shiwang; Zhang, Yuefeng; Li, Yong; Xu, Yanzhao; Zhu, Yonggang; Lv, Huilai; Zhang, Fan; Wang, Mingbo; Tian, Ziqiang

2016-01-01

Objective . Esophageal carcinoma (EC) is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods . 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs) were screened by bioinformatics analysis. Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and protein-protein interaction (PPI) network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to verify the expression level of DEGs in EC. Results . A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion . The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.

Identification of the Key Genes and Pathways in Esophageal Carcinoma

Directory of Open Access Journals (Sweden)

Peng Su

2016-01-01

Full Text Available Objective. Esophageal carcinoma (EC is a frequently common malignancy of gastrointestinal cancer in the world. This study aims to screen key genes and pathways in EC and elucidate the mechanism of it. Methods. 5 microarray datasets of EC were downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs were screened by bioinformatics analysis. Gene Ontology (GO enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG enrichment, and protein-protein interaction (PPI network construction were performed to obtain the biological roles of DEGs in EC. Quantitative real-time polymerase chain reaction (qRT-PCR was used to verify the expression level of DEGs in EC. Results. A total of 1955 genes were filtered as DEGs in EC. The upregulated genes were significantly enriched in cell cycle and the downregulated genes significantly enriched in Endocytosis. PPI network displayed CDK4 and CCT3 were hub proteins in the network. The expression level of 8 dysregulated DEGs including CDK4, CCT3, THSD4, SIM2, MYBL2, CENPF, CDCA3, and CDKN3 was validated in EC compared to adjacent nontumor tissues and the results were matched with the microarray analysis. Conclusion. The significantly DEGs including CDK4, CCT3, THSD4, and SIM2 may play key roles in tumorigenesis and development of EC involved in cell cycle and Endocytosis.

Smooth-muscle-specific gene transfer with the human maxi-k channel improves erectile function and enhances sexual behavior in atherosclerotic cynomolgus monkeys.

Science.gov (United States)

Christ, George J; Andersson, Karl-Erik; Williams, Koudy; Zhao, Weixin; D'Agostino, Ralph; Kaplan, Jay; Aboushwareb, Tamer; Yoo, James; Calenda, Giulia; Davies, Kelvin P; Sellers, Rani S; Melman, Arnold

2009-12-01

Despite the advent of effective oral therapies for erectile dysfunction (ED), many patients are not successfully treated, and side effects have been documented. To further evaluate the potential utility of naked DNA-based gene transfer as an attractive treatment option for ED. The effects of gene transfer on erectile function and sexual behavior were evaluated in eight male cynomolgus monkeys with ED secondary to moderately severe, diet-induced atherosclerosis. Following establishment of baseline characteristics, animals were subjected to intracavernous injection of a smooth-muscle-specific gene transfer vector (pSMAA-hSlo) encoding the pore-forming subunit of the human large-conductance, calcium-sensitive potassium channel (Maxi-K). For the sexual behavior studies, 2 wk of baseline data were obtained, and then animals were placed in the presence of estrogen-implanted females (n=2) three times per week for 30 min, and sexual behavior was recorded. The intracavernous pressure response to papaverine injection was also monitored. Dramatic changes in erectile function and sexual behavior were observed after intracorporal gene transfer. The frequency of partial (6±2 to 10±2) and full (2±1.5 to 5±1.4) erections were significantly increased, with a parallel 2-3-fold increase in the duration of the observed erections. The frequency and latency of ejaculation were increased and decreased, respectively. Frequency and duration of grooming by the female were increased, and the latency decreased. Increased latency and decreased frequency of body contact was also observed, and this is characteristic of the typical drop in consort intimacy that occurs after mating in most macaque species. In addition, an increased responsiveness to intracavernous papaverine injection was observed. The data indicate that intracorporal Maxi-K-channel gene transfer enhances erectile capacity and sexual behavior; the data imply that increased erectile function per se may lead to increased sexual

A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

Directory of Open Access Journals (Sweden)

Ashley L Waldron

Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

Pmr, a histone-like protein H1 (H-NS) family protein encoded by the IncP-7 plasmid pCAR1, is a key global regulator that alters host function.

Science.gov (United States)

Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki

2010-09-01

Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.

Channel Power in Multi-Channel Environments

NARCIS (Netherlands)

M.G. Dekimpe (Marnik); B. Skiera (Bernd)

2004-01-01

textabstractIn the literature, little attention has been paid to instances where companies add an Internet channel to their direct channel portfolio. However, actively managing multiple sales channels requires knowing the customers’ channel preferences and the resulting channel power. Two key

Low-complexity video encoding method for wireless image transmission in capsule endoscope.

Science.gov (United States)

Takizawa, Kenichi; Hamaguchi, Kiyoshi

2010-01-01

This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

An Efficient and Secure Arbitrary N-Party Quantum Key Agreement Protocol Using Bell States

Science.gov (United States)

Liu, Wen-Jie; Xu, Yong; Yang, Ching-Nung; Gao, Pei-Pei; Yu, Wen-Bin

2018-01-01

Two quantum key agreement protocols using Bell states and Bell measurement were recently proposed by Shukla et al. (Quantum Inf. Process. 13(11), 2391-2405, 2014). However, Zhu et al. pointed out that there are some security flaws and proposed an improved version (Quantum Inf. Process. 14(11), 4245-4254, 2015). In this study, we will show Zhu et al.'s improvement still exists some security problems, and its efficiency is not high enough. For solving these problems, we utilize four Pauli operations { I, Z, X, Y} to encode two bits instead of the original two operations { I, X} to encode one bit, and then propose an efficient and secure arbitrary N-party quantum key agreement protocol. In the protocol, the channel checking with decoy single photons is introduced to avoid the eavesdropper's flip attack, and a post-measurement mechanism is used to prevent against the collusion attack. The security analysis shows the present protocol can guarantee the correctness, security, privacy and fairness of quantum key agreement.

Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

Directory of Open Access Journals (Sweden)

Yuepeng eHan

2015-04-01

Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

Information transfer via implicit encoding with delay time modulation in a time-delay system

Energy Technology Data Exchange (ETDEWEB)

Kye, Won-Ho, E-mail: whkye@kipo.go.kr [Korean Intellectual Property Office, Government Complex Daejeon Building 4, 189, Cheongsa-ro, Seo-gu, Daejeon 302-701 (Korea, Republic of)

2012-08-20

A new encoding scheme for information transfer with modulated delay time in a time-delay system is proposed. In the scheme, the message is implicitly encoded into the modulated delay time. The information transfer rate as a function of encoding redundancy in various noise scales is presented and it is analyzed that the implicit encoding scheme (IES) has stronger resistance against channel noise than the explicit encoding scheme (EES). In addition, its advantages in terms of secure communication and feasible applications are discussed. -- Highlights: ► We propose new encoding scheme with delay time modulation. ► The message is implicitly encoded with modulated delay time. ► The proposed scheme shows stronger resistance against channel noise.

Epstein-Barr Virus-Encoded RNAs: Key Molecules in Viral Pathogenesis

Energy Technology Data Exchange (ETDEWEB)

Iwakiri, Dai [Institute for Genetic Medicine, Hokkaido University, N15 W7 Kita-Ku, Sapporo 060-0815 (Japan)

2014-08-06

The Epstein-Barr virus (EBV) is known as an oncogenic herpesvirus that has been implicated in the pathogenesis of various malignancies. EBV-encoded RNAs (EBERs) are non-coding RNAs expressed abundantly in latently EBV-infected cells. Herein, I summarize the current understanding of the functions of EBERs, including the interactions with cellular factors through which EBERs contribute to EBV-mediated pathogenesis. Previous studies have demonstrated that EBERs are responsible for malignant phenotypes in lymphoid cells, and can induce several cytokines that can promote the growth of various EBV-infected cancer cells. EBERs were also found to bind retinoic acid-inducible gene I (RIG-I) and thus activate its downstream signaling. Furthermore, EBERs induce interleukin-10, an autocrine growth factor for Burkitt’s lymphoma cells, by activating RIG-I/interferon regulatory factor 3 pathway, suggesting that EBER-mediated innate immune signaling modulation contributes to EBV-mediated oncogenesis. Recently, EBV-infected cells were reported to secret EBERs, which were then recognized by toll-like receptor 3 (TLR3), leading to the induction of type I interferon and inflammatory cytokines, and subsequent immune activation. Furthermore, EBER1 was detected in the sera of patients with active EBV-infectious diseases, suggesting that EBER1-meidated TLR3 signaling activation could account for the pathogenesis of active EBV-infectious diseases.

Epstein-Barr Virus-Encoded RNAs: Key Molecules in Viral Pathogenesis

International Nuclear Information System (INIS)

Iwakiri, Dai

2014-01-01

The Epstein-Barr virus (EBV) is known as an oncogenic herpesvirus that has been implicated in the pathogenesis of various malignancies. EBV-encoded RNAs (EBERs) are non-coding RNAs expressed abundantly in latently EBV-infected cells. Herein, I summarize the current understanding of the functions of EBERs, including the interactions with cellular factors through which EBERs contribute to EBV-mediated pathogenesis. Previous studies have demonstrated that EBERs are responsible for malignant phenotypes in lymphoid cells, and can induce several cytokines that can promote the growth of various EBV-infected cancer cells. EBERs were also found to bind retinoic acid-inducible gene I (RIG-I) and thus activate its downstream signaling. Furthermore, EBERs induce interleukin-10, an autocrine growth factor for Burkitt’s lymphoma cells, by activating RIG-I/interferon regulatory factor 3 pathway, suggesting that EBER-mediated innate immune signaling modulation contributes to EBV-mediated oncogenesis. Recently, EBV-infected cells were reported to secret EBERs, which were then recognized by toll-like receptor 3 (TLR3), leading to the induction of type I interferon and inflammatory cytokines, and subsequent immune activation. Furthermore, EBER1 was detected in the sera of patients with active EBV-infectious diseases, suggesting that EBER1-meidated TLR3 signaling activation could account for the pathogenesis of active EBV-infectious diseases

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

A multihop key agreement scheme for wireless ad hoc networks based on channel characteristics.

Science.gov (United States)

Hao, Zhuo; Zhong, Sheng; Yu, Nenghai

2013-01-01

A number of key agreement schemes based on wireless channel characteristics have been proposed recently. However, previous key agreement schemes require that two nodes which need to agree on a key are within the communication range of each other. Hence, they are not suitable for multihop wireless networks, in which nodes do not always have direct connections with each other. In this paper, we first propose a basic multihop key agreement scheme for wireless ad hoc networks. The proposed basic scheme is resistant to external eavesdroppers. Nevertheless, this basic scheme is not secure when there exist internal eavesdroppers or Man-in-the-Middle (MITM) adversaries. In order to cope with these adversaries, we propose an improved multihop key agreement scheme. We show that the improved scheme is secure against internal eavesdroppers and MITM adversaries in a single path. Both performance analysis and simulation results demonstrate that the improved scheme is efficient. Consequently, the improved key agreement scheme is suitable for multihop wireless ad hoc networks.

Properties of the intracellular transient receptor potential (TRP) channel in yeast, Yvc1.

Science.gov (United States)

Chang, Yiming; Schlenstedt, Gabriel; Flockerzi, Veit; Beck, Andreas

2010-05-17

Transient receptor potential (TRP) channels are found among mammals, flies, worms, ciliates, Chlamydomonas, and yeast but are absent in plants. These channels are believed to be tetramers of proteins containing six transmembrane domains (TMs). Their primary structures are diverse with sequence similarities only in some short amino acid sequence motifs mainly within sequences covering TM5, TM6, and adjacent domains. In the yeast genome, there is one gene encoding a TRP-like sequence. This protein forms an ion channel in the vacuolar membrane and is therefore called Yvc1 for yeast vacuolar conductance 1. In the following we summarize its prominent features. Copyright 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

DEFF Research Database (Denmark)

Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

2004-01-01

Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

Science.gov (United States)

Lu, Y P; Li, Z S; Rea, P A

1997-07-22

Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

Science.gov (United States)

Kim, K S; Farrand, S K

1996-06-01

Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

Directory of Open Access Journals (Sweden)

Elías Trujillo-Esquivel

2017-09-01

Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

DEFF Research Database (Denmark)

Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

2015-01-01

at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

Science.gov (United States)

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

Science.gov (United States)

Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

2012-01-01

We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

Search after new agents for hyperpolarization-activated and cyclic nucleotide-gated ion channels; Suche nach neuen Wirkstoffen fuer Hyperpolarisationsaktivierte und zyklisch Nukleotid-gesteuerte Ionenkanaele

Energy Technology Data Exchange (ETDEWEB)

Struenker, T.

2005-12-01

Rhythmic activity of single cells or cellular networks is a common feature of most organisms. Cellular rhythms govern the beating of the heart, cycles of sleep and wakefulness, breathing, and the release of hormones. The endogenous rhythmic activity of many neurons and cardiac relies on a complex interplay between several distinct ion channels. In particular, one type of ion channel plays a prominent role in the control of rhythmic electrical activity because it determines the frequency of the oscillations. The activity of the channels is thus setting the ''pace'' of the activity; therefore, these channels are often referred to as ''pacemaker'' channels. Despite their obvious physiological importance it hasn't been until a few years ago that the genes encoding pacemaker channels have been identified. Because both hyperpolarization and cyclic nucleotides are key elements that control their activity, pacemaker channels have now been designated hyperpolarization-activated and cyclic nucleotide-gated (HCN) channels. From a scientific as well as medical point of view, HCN channels are interesting drug targets. Only a few substances are known that specifically affect HCN channels. In the present study, a microtiter plate-based high throughput screening assay for HCN1 and HCN4 channels was developed. With this assay, known drugs for HCN channels were characterized. Subsequently, venoms of snails, spiders, scorpions, and snakes were screened for toxins affecting HCN channel activity. A few venoms were identified that possibly contain drugs that act on HCN channels. (orig.)

Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

NARCIS (Netherlands)

Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

2008-01-01

The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

Directory of Open Access Journals (Sweden)

Aris Haryanto

2016-01-01

Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

Gene Network Construction from Microarray Data Identifies a Key Network Module and Several Candidate Hub Genes in Age-Associated Spatial Learning Impairment.

Science.gov (United States)

Uddin, Raihan; Singh, Shiva M

2017-01-01

As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they

MITOCHONDRIAL BKCa CHANNEL

Directory of Open Access Journals (Sweden)

Enrique eBalderas

2015-03-01

Full Text Available Since its discovery in a glioma cell line 15 years ago, mitochondrial BKCa channel (mitoBKCa has been studied in brain cells and cardiomyocytes sharing general biophysical properties such as high K+ conductance (~300 pS, voltage-dependency and Ca2+-sensitivity. Main advances in deciphering the molecular composition of mitoBKCa have included establishing that it is encoded by the Kcnma1 gene, that a C-terminal splice insert confers mitoBKCa ability to be targeted to cardiac mitochondria, and evidence for its potential coassembly with β subunits. Notoriously, β1 subunit directly interacts with cytochrome c oxidase and mitoBKCa can be modulated by substrates of the respiratory chain. mitoBKCa channel has a central role in protecting the heart from ischemia, where pharmacological activation of the channel impacts the generation of reactive oxygen species and mitochondrial Ca2+ preventing cell death likely by impeding uncontrolled opening of the mitochondrial transition pore. Supporting this view, inhibition of mitoBKCa with Iberiotoxin, enhances cytochrome c release from glioma mitochondria. Many tantalizing questions remain. Some of them are: how is mitoBKCa coupled to the respiratory chain? Does mitoBKCa play non-conduction roles in mitochondria physiology? Which are the functional partners of mitoBKCa? What are the roles of mitoBKCa in other cell types? Answers to these questions are essential to define the impact of mitoBKCa channel in mitochondria biology and disease.

TRPV6 channels.

Science.gov (United States)

Fecher-Trost, Claudia; Weissgerber, Petra; Wissenbach, Ulrich

2014-01-01

TRPV6 (former synonyms ECAC2, CaT1, CaT-like) displays several specific features which makes it unique among the members of the mammalian Trp gene family (1) TRPV6 (and its closest relative, TRPV5) are the only highly Ca(2+)-selective channels of the entire TRP superfamily (Peng et al. 1999; Wissenbach et al. 2001; Voets et al. 2004). (2) Translation of Trpv6 initiates at a non-AUG codon, at ACG, located upstream of the annotated AUG, which is not used for initiation (Fecher-Trost et al. 2013). The ACG codon is nevertheless decoded by methionine. Not only a very rare event in eukaryotic biology, the full-length TRPV6 protein existing in vivo comprises an amino terminus extended by 40 amino acid residues compared to the annotated truncated TRPV6 protein which has been used in most studies on TRPV6 channel activity so far. (In the following numbering occurs according to this full-length protein, with the numbers of the so far annotated truncated protein in brackets). (3) Only in humans a coupled polymorphism of Trpv6 exists causing three amino acid exchanges and resulting in an ancestral Trpv6 haplotype and a so-called derived Trpv6 haplotype (Wissenbach et al. 2001). The ancestral allele encodes the amino acid residues C197(157), M418(378) and M721(681) and the derived alleles R197(157), V418(378) and T721(681). The ancestral haplotype is found in all species, the derived Trpv6 haplotype has only been identified in humans, and its frequency increases with the distance to the African continent. Apparently the Trpv6 gene has been a strong target for selection in humans, and its derived variant is one of the few examples showing consistently differences to the orthologues genes of other primates (Akey et al. 2004, 2006; Stajich and Hahn 2005; Hughes et al. 2008). (4) The Trpv6 gene expression is significantly upregulated in several human malignancies including the most common cancers, prostate and breast cancer (Wissenbach et al. 2001; Zhuang et al. 2002; Fixemer et al

Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

Directory of Open Access Journals (Sweden)

Yonglong Yu

2016-04-01

Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

Directory of Open Access Journals (Sweden)

Kang Zhang

2018-05-01

Full Text Available A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO, was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO were similar to those of the wild-type (WT strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP and mitogen-activated protein kinase (MAPK signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea.

The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

Science.gov (United States)

Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

2018-01-01

A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

Directory of Open Access Journals (Sweden)

Lukasz Michal Szafron

Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

Identification of a Key Gene Involved in Branched-Chain Short Fatty Acids Formation in Natto by Transcriptional Analysis and Enzymatic Characterization in Bacillus subtilis.

Science.gov (United States)

Hong, Chenlu; Chen, Yangyang; Li, Lu; Chen, Shouwen; Wei, Xuetuan

2017-03-01

Natto as a fermented soybean product has many health benefits for human due to its rich nutritional and functional components. However, the unpleasant odor of natto, caused by the formation of branched-chain short fatty acids (BCFAs), prohibits the wide acceptance of natto products. This work is to identify the key gene of BCFAs formation and develop the guidance to reduce natto odor. Transcriptional analysis of BCFAs synthesis pathway genes was conducted in two Bacillus subtilis strains with obvious different BCFAs synthesis abilities. The transcriptional levels of bcd, bkdAA, and ptb in B. subtilis H-9 were 2.7-fold, 0.7-fold, and 8.9-fold higher than that of B. subtilis H-4, respectively. Therefore, the ptb gene with the highest transcriptional change was considered as the key gene in BCFAs synthesis. The ptb encoded enzyme Ptb was further characterized by inducible expression in Escherichia coli. The recombinant Ptb protein (about 32 kDa) was verified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. The catalysis functions of Ptb were confirmed on substrates of isovaleryl-CoA and isobutyryl-CoA, and the higher catalysis efficiency of Ptb on isovaleryl-CoA explained the higher level of isovaleric acid in natto. The optimal activities of Ptb were observed at 50 °C and pH 8.0, and the enzymatic activity was inhibited by Ca 2+ , Zn 2+ , Ba 2+ , Mn 2+ , Cu 2+ , SDS, and EDTA. Collectively, this study reports a key gene responsible for BCFAs formation in natto fermentation and provides potential strategies to solve the odor problem.

Implementation of continuous-variable quantum key distribution with composable and one-sided-device-independent security against coherent attacks.

Science.gov (United States)

Gehring, Tobias; Händchen, Vitus; Duhme, Jörg; Furrer, Fabian; Franz, Torsten; Pacher, Christoph; Werner, Reinhard F; Schnabel, Roman

2015-10-30

Secret communication over public channels is one of the central pillars of a modern information society. Using quantum key distribution this is achieved without relying on the hardness of mathematical problems, which might be compromised by improved algorithms or by future quantum computers. State-of-the-art quantum key distribution requires composable security against coherent attacks for a finite number of distributed quantum states as well as robustness against implementation side channels. Here we present an implementation of continuous-variable quantum key distribution satisfying these requirements. Our implementation is based on the distribution of continuous-variable Einstein-Podolsky-Rosen entangled light. It is one-sided device independent, which means the security of the generated key is independent of any memoryfree attacks on the remote detector. Since continuous-variable encoding is compatible with conventional optical communication technology, our work is a step towards practical implementations of quantum key distribution with state-of-the-art security based solely on telecom components.

Implementation of continuous-variable quantum key distribution with composable and one-sided-device-independent security against coherent attacks

Science.gov (United States)

Gehring, Tobias; Händchen, Vitus; Duhme, Jörg; Furrer, Fabian; Franz, Torsten; Pacher, Christoph; Werner, Reinhard F.; Schnabel, Roman

2015-10-01

Secret communication over public channels is one of the central pillars of a modern information society. Using quantum key distribution this is achieved without relying on the hardness of mathematical problems, which might be compromised by improved algorithms or by future quantum computers. State-of-the-art quantum key distribution requires composable security against coherent attacks for a finite number of distributed quantum states as well as robustness against implementation side channels. Here we present an implementation of continuous-variable quantum key distribution satisfying these requirements. Our implementation is based on the distribution of continuous-variable Einstein-Podolsky-Rosen entangled light. It is one-sided device independent, which means the security of the generated key is independent of any memoryfree attacks on the remote detector. Since continuous-variable encoding is compatible with conventional optical communication technology, our work is a step towards practical implementations of quantum key distribution with state-of-the-art security based solely on telecom components.

Ca2+ Channel Re-localization to Plasma-Membrane Microdomains Strengthens Activation of Ca2+-Dependent Nuclear Gene Expression

Directory of Open Access Journals (Sweden)

Krishna Samanta

2015-07-01

Full Text Available In polarized cells or cells with complex geometry, clustering of plasma-membrane (PM ion channels is an effective mechanism for eliciting spatially restricted signals. However, channel clustering is also seen in cells with relatively simple topology, suggesting it fulfills a more fundamental role in cell biology than simply orchestrating compartmentalized responses. Here, we have compared the ability of store-operated Ca2+ release-activated Ca2+ (CRAC channels confined to PM microdomains with a similar number of dispersed CRAC channels to activate transcription factors, which subsequently increase nuclear gene expression. For similar levels of channel activity, we find that channel confinement is considerably more effective in stimulating gene expression. Our results identify a long-range signaling advantage to the tight evolutionary conservation of channel clustering and reveal that CRAC channel aggregation increases the strength, fidelity, and reliability of the general process of excitation-transcription coupling.

Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

Science.gov (United States)

Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

2015-01-01

For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

Elevated peritoneal expression and estrogen regulation of nociceptive ion channels in endometriosis.

Science.gov (United States)

Greaves, Erin; Grieve, Kelsey; Horne, Andrew W; Saunders, Philippa T K

2014-09-01

Ovarian suppression is a common treatment for endometriosis-associated pelvic pain. Its exact mechanism of action is poorly understood, although it is assumed to reflect reduced production/action of estrogens. The objective of the study was to measure the expression of mRNAs encoded by nociceptive genes in the peritoneum of women with chronic pelvic pain (CPP) with or without endometriosis and to investigate whether estrogens alter nociceptive gene expression in human sensory neurons. The study was performed using human tissue analysis and cell culture. The study was conducted at a university research institute. Peritoneal biopsies were obtained from women with CPP and endometriosis (n = 12), CPP and no endometriosis (n = 10), and no pain or endometriosis (n = 5). Endometriosis lesions were obtained from women with endometriosis (n = 18). mRNAs encoding ion channels (P2RX3, SCN9A, SCN11A, TRPA1, TRPV1) and the neurotransmitter TAC1 were measured in human tissue samples and in human embryonic stem cell-derived sensory neurons treated with estrogens. TRPV1, TRPA1, and SCN11A mRNAs were significantly higher in the peritoneum from women with endometriosis (P endometriosis lesions (P endometriosis (P endometriosis-associated pain. Strategies directly targeting ion channels may offer an alternative option for the management of CPP.

Exploring the key genes and pathways in enchondromas using a gene expression microarray.

Science.gov (United States)

Shi, Zhongju; Zhou, Hengxing; Pan, Bin; Lu, Lu; Kang, Yi; Liu, Lu; Wei, Zhijian; Feng, Shiqing

2017-07-04

Enchondromas are the most common primary benign osseous neoplasms that occur in the medullary bone; they can undergo malignant transformation into chondrosarcoma. However, enchondromas are always undetected in patients, and the molecular mechanism is unclear. To identify key genes and pathways associated with the occurrence and development of enchondromas, we downloaded the gene expression dataset GSE22855 and obtained the differentially expressed genes (DEGs) by analyzing high-throughput gene expression in enchondromas. In total, 635 genes were identified as DEGs. Of these, 225 genes (35.43%) were up-regulated, and the remaining 410 genes (64.57%) were down-regulated. We identified the predominant gene ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways that were significantly over-represented in the enchondromas samples compared with the control samples. Subsequently the top 10 core genes were identified from the protein-protein interaction (PPI) network. The enrichment analyses of the genes mainly involved in two significant modules showed that the DEGs were principally related to ribosomes, protein digestion and absorption, ECM-receptor interaction, focal adhesion, amoebiasis and the PI3K-Akt signaling pathway.Together, these data elucidate the molecular mechanisms underlying the occurrence and development of enchondromas and provide promising candidates for therapeutic intervention and prognostic evaluation. However, further experimental studies are needed to confirm these results.

Differential phase-shift keying and channel equalization in free space optical communication system

Science.gov (United States)

Zhang, Dai; Hao, Shiqi; Zhao, Qingsong; Wan, Xiongfeng; Xu, Chenlu

2018-01-01

We present the performance benefits of differential phase-shift keying (DPSK) modulation in eliminating influence from atmospheric turbulence, especially for coherent free space optical (FSO) communication with a high communication rate. Analytic expression of detected signal is derived, based on which, homodyne detection efficiency is calculated to indicate the performance of wavefront compensation. Considered laser pulses always suffer from atmospheric scattering effect by clouds, intersymbol interference (ISI) in high-speed FSO communication link is analyzed. Correspondingly, the channel equalization method of a binormalized modified constant modulus algorithm based on set-membership filtering (SM-BNMCMA) is proposed to solve the ISI problem. Finally, through the comparison with existing channel equalization methods, its performance benefits of both ISI elimination and convergence speed are verified. The research findings have theoretical significance in a high-speed FSO communication system.

Functional Na(V)1.8 Channels in Intracardiac Neurons The Link Between SCN10A and Cardiac Electrophysiology

NARCIS (Netherlands)

Verkerk, Arie O.; Remme, Carol Ann; Schumacher, Cees A.; Scicluna, Brendon P.; Wolswinkel, Rianne; de Jonge, Berend; Bezzina, Connie R.; Veldkamp, Marieke W.

2012-01-01

Rationale: The SCN10A gene encodes the neuronal sodium channel isoform Na(V)1.8. Several recent genome-wide association studies have linked SCN10A to PR interval and QRS duration, strongly suggesting an as-yet unknown role for Na(V)1.8 in cardiac electrophysiology. Objective: To demonstrate the

Fault-Tolerate Three-Party Quantum Secret Sharing over a Collective-Noise Channel

International Nuclear Information System (INIS)

Li Chun-Yan; Li Yan-Song

2011-01-01

We present a fault-tolerate three-party quantum secret sharing (QSS) scheme over a collective-noise channel. Decoherence-free subspaces are used to tolerate two noise modes, a collective-dephasing channel and a collective-rotating channel, respectively. In this scheme, the boss uses two physical qubits to construct a logical qubit which acts as a quantum channel to transmit one bit information to her two agents. The agents can get the information of the private key established by the boss only if they collaborate. The boss Alice encodes information with two unitary operations. Only single-photon measurements are required to rebuilt Alice's information and detect the security by the agents Bob and Charlie, not Bell-state measurements. Moreover, Almost all of the photons are used to distribute information, and its success efficiency approaches 100% in theory. (general)

Physiology and pathophysiology of ClC-K/barttin channels.

Science.gov (United States)

Fahlke, Christoph; Fischer, Martin

2010-01-01

ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology, and pathophysiology of ClC-K/barttin channels.

Physiology and pathophysiology of ClC-K/barttin channels

Directory of Open Access Journals (Sweden)

Christoph eFahlke

2010-11-01

Full Text Available ClC-K channels form a subgroup of anion channels within the ClC family of anion transport proteins. They are expressed predominantly in the kidney and in the inner ear, and are necessary for NaCl resorption in the loop of Henle and for K+ secretion by the stria vascularis. Subcellular distribution as well as the function of these channels are tightly regulated by an accessory subunit, barttin. Barttin improves the stability of ClC-K channel protein, stimulates the exit from the endoplasmic reticulum and insertion into the plasma membrane and changes its function by modifying voltage-dependent gating processes. The importance of ClC-K/barttin channels is highlighted by several genetic diseases. Dysfunctions of ClC-K channels result in Bartter syndrome, an inherited human condition characterized by impaired urinary concentration. Mutations in the gene encoding barttin, BSND, affect the urinary concentration as well as the sensory function of the inner ear. Surprisingly, there is one BSND mutation that causes deafness without affecting renal function, indicating that kidney function tolerates a reduction of anion channel activity that is not sufficient to support normal signal transduction in inner hair cells. This review summarizes recent work on molecular mechanisms, physiology and pathophysiology of ClC-K/barttin channels.

Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

Directory of Open Access Journals (Sweden)

Hui-Yeng Y Yap

Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

Encoding mutually unbiased bases in orbital angular momentum for quantum key distribution

CSIR Research Space (South Africa)

Dudley, Angela L

2013-07-01

Full Text Available We encode mutually unbiased bases (MUBs) using the higher-dimensional orbital angular momentum (OAM) degree of freedom associated with optical fields. We illustrate how these states are encoded with the use of a spatial light modulator (SLM). We...

The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

Science.gov (United States)

Santiago, Margarita; Gardner, Richard C

2015-07-01

Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

ClC-K chloride channels: emerging pathophysiology of Bartter syndrome type 3.

Science.gov (United States)

Andrini, Olga; Keck, Mathilde; Briones, Rodolfo; Lourdel, Stéphane; Vargas-Poussou, Rosa; Teulon, Jacques

2015-06-15

The mutations in the CLCNKB gene encoding the ClC-Kb chloride channel are responsible for Bartter syndrome type 3, one of the four variants of Bartter syndrome in the genetically based nomenclature. All forms of Bartter syndrome are characterized by hypokalemia, metabolic alkalosis, and secondary hyperaldosteronism, but Bartter syndrome type 3 has the most heterogeneous presentation, extending from severe to very mild. A relatively large number of CLCNKB mutations have been reported, including gene deletions and nonsense or missense mutations. However, only 20 CLCNKB mutations have been functionally analyzed, due to technical difficulties regarding ClC-Kb functional expression in heterologous systems. This review provides an overview of recent progress in the functional consequences of CLCNKB mutations on ClC-Kb chloride channel activity. It has been observed that 1) all ClC-Kb mutants have an impaired expression at the membrane; and 2) a minority of the mutants combines reduced membrane expression with altered pH-dependent channel gating. Although further investigation is needed to fully characterize disease pathogenesis, Bartter syndrome type 3 probably belongs to the large family of conformational diseases, in which the mutations destabilize channel structure, inducing ClC-Kb retention in the endoplasmic reticulum and accelerated channel degradation. Copyright © 2015 the American Physiological Society.

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Science.gov (United States)

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

DEFF Research Database (Denmark)

Davis, Margaret R.; Andersson, Robin; Severin, Jessica

2014-01-01

in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

Design of a hybrid reconfigurable Software Defined Radio transceiver based on frequency shift keying using multiple encoding schemes

Directory of Open Access Journals (Sweden)

Nikhil Marriwala

2016-03-01

The aim of this paper was to analyze Frequency Shift Keying (FSK Transceiver built using Laboratory Virtual Instrumentation Engineering Workbench (LabVIEW and to measure the reduction in data errors in the presence of Forward Error Correction (FEC channel coding algorithms namely the Convolution and the Turbo Codes. Through this design a graphical representation of Bit Error Rate (BER vs Eb/N0 where (Eb is Energy per bit and (N0 is Spectral noise density has been given in the presence of Additive White Gaussian Noise (AWGN introduced in the channel. FSK is widely used for data transmission over band pass channels; hence, we have chosen FSK for the implementation of SDR. The SDR transceiver module designed has been fully implemented and has the ability to navigate over a wide range of frequencies with programmable channel bandwidth and modulation characteristics. We are able to build an interactive FSK based SDR transceiver in a shorter time with the use of LabVIEW. The outputs achieved show a low BER for very high data rates in the presence of AWGN noise.

Attention-deficit/hyperactivity disorder associated with KChIP1 rs1541665 in Kv channels accessory proteins.

Directory of Open Access Journals (Sweden)

Fang-Fen Yuan

Full Text Available Attention-deficit/hyperactivity disorder (ADHD is an early onset childhood neurodevelopmental disorder with high heritability. A number of genetic risk factors and environment factors have been implicated in the pathogenesis of ADHD. Genes encoding for subtypes of voltage-dependent K channels (Kv and accessory proteins to these channels have been identified in genome-wide association studies (GWAS of ADHD. We conducted a two-stage case-control study to investigate the associations between five key genes (KChIP4, KChIP1, DPP10, FHIT, and KCNC1 and the risk of developing ADHD. In the discovery stage comprising 256 cases and 372 controls, KChIP1 rs1541665 and FHIT rs3772475 were identified; they were further genotyped in the validation stage containing 328cases and 431 controls.KChIP1 rs1541665 showed significant association with a risk of ADHD at both stages, with CC vs TT odds ratio (OR = 1.961, 95% confidence interval (CI = 1.366-2.497, in combined analyses (P-FDR = 0.007. Moreover, we also found rs1541665 involvement in ADHD-I subtype (OR (95% CI = 2.341(1.713, 3.282, and Hyperactive index score (P = 0.005 in combined samples.Intriguingly, gene-environmental interactions analysis consistently revealed the potential interactionsof rs1541665 collaboratingwith maternal stress pregnancy (Pmul = 0.021 and blood lead (Padd = 0.017 to modify ADHD risk. In conclusion, the current study provides evidence that genetic variants of Kv accessory proteins may contribute to the susceptibility of ADHD.Further studies with different ethnicitiesare warranted to produce definitive conclusions.

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

You Wanhui

2012-04-01

Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

OpenAIRE

Hahn, F M; Baker, J A; Poulter, C D

1996-01-01

Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

TRESK potassium channel in human T lymphoblasts

International Nuclear Information System (INIS)

Sánchez-Miguel, Dénison Selene; García-Dolores, Fernando; Rosa Flores-Márquez, María; Delgado-Enciso, Iván; Pottosin, Igor; Dobrovinskaya, Oxana

2013-01-01

Highlights: • TRESK (KCNK18) mRNA is present in different T lymphoblastic cell lines. • KCNK18 mRNA was not found in resting peripheral blood lymphocytes. • Clinical samples of T lymphoblastic leukemias and lymphomas were positive for TRESK. • TRESK in T lymphoblasts has dual localization, in plasma membrane and intracellular. -- Abstract: TRESK (TWIK-related spinal cord K + ) channel, encoded by KCNK18 gene, belongs to the double-pore domain K + channel family and in normal conditions is expressed predominantly in the central nervous system. In our previous patch-clamp study on Jurkat T lymphoblasts we have characterized highly selective K + channel with pharmacological profile identical to TRESK. In the present work, the presence of KCNK18 mRNA was confirmed in T lymphoblastic cell lines (Jurkat, JCaM, H9) but not in resting peripheral blood lymphocytes of healthy donors. Positive immunostaining for TRESK was demonstrated in lymphoblastic cell lines, in germinal centers of non-tumoral lymph nodes, and in clinical samples of T acute lymphoblastic leukemias/lymphomas. Besides detection in the plasma membrane, intracellular TRESK localization was also revealed. Possible involvement of TRESK channel in lymphocyte proliferation and tumorigenesis is discussed

TRESK potassium channel in human T lymphoblasts

Energy Technology Data Exchange (ETDEWEB)

Sánchez-Miguel, Dénison Selene, E-mail: amurusk@hotmail.com [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico); García-Dolores, Fernando, E-mail: garciaddf@yahoo.com [Department of Pathology, Institute of Forensic Sciences, Av. Niños Héroes 130, Col. Doctores, C.P. 06720 Mexico, DF (Mexico); Rosa Flores-Márquez, María, E-mail: mariafo31@yahoo.com.mx [National Medical Center of Occident (CMNO) IMSS, Belisario Dominguez 735, Col. Independencia Oriente, C.P. 44340 Guadalajara, Jalisco (Mexico); Delgado-Enciso, Iván [University of Colima, School of Medicine, Av. Universidad 333, Col. Las Viboras, C.P. 28040 Colima (Mexico); Pottosin, Igor, E-mail: pottosin@ucol.mx [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico); Dobrovinskaya, Oxana, E-mail: oxana@ucol.mx [Center for Biomedical Research, University of Colima, Av. 25 de Julio 965, Villa San Sebastian, C.P. 28045 Colima (Mexico)

2013-05-03

Highlights: • TRESK (KCNK18) mRNA is present in different T lymphoblastic cell lines. • KCNK18 mRNA was not found in resting peripheral blood lymphocytes. • Clinical samples of T lymphoblastic leukemias and lymphomas were positive for TRESK. • TRESK in T lymphoblasts has dual localization, in plasma membrane and intracellular. -- Abstract: TRESK (TWIK-related spinal cord K{sup +}) channel, encoded by KCNK18 gene, belongs to the double-pore domain K{sup +} channel family and in normal conditions is expressed predominantly in the central nervous system. In our previous patch-clamp study on Jurkat T lymphoblasts we have characterized highly selective K{sup +} channel with pharmacological profile identical to TRESK. In the present work, the presence of KCNK18 mRNA was confirmed in T lymphoblastic cell lines (Jurkat, JCaM, H9) but not in resting peripheral blood lymphocytes of healthy donors. Positive immunostaining for TRESK was demonstrated in lymphoblastic cell lines, in germinal centers of non-tumoral lymph nodes, and in clinical samples of T acute lymphoblastic leukemias/lymphomas. Besides detection in the plasma membrane, intracellular TRESK localization was also revealed. Possible involvement of TRESK channel in lymphocyte proliferation and tumorigenesis is discussed.

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

Science.gov (United States)

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

RING finger protein 121 facilitates the degradation and membrane localization of voltage-gated sodium channels

Science.gov (United States)

Ogino, Kazutoyo; Low, Sean E.; Yamada, Kenta; Saint-Amant, Louis; Zhou, Weibin; Muto, Akira; Asakawa, Kazuhide; Nakai, Junichi; Kawakami, Koichi; Kuwada, John Y.; Hirata, Hiromi

2015-01-01

Following their synthesis in the endoplasmic reticulum (ER), voltage-gated sodium channels (NaV) are transported to the membranes of excitable cells, where they often cluster, such as at the axon initial segment of neurons. Although the mechanisms by which NaV channels form and maintain clusters have been extensively examined, the processes that govern their transport and degradation have received less attention. Our entry into the study of these processes began with the isolation of a new allele of the zebrafish mutant alligator, which we found to be caused by mutations in the gene encoding really interesting new gene (RING) finger protein 121 (RNF121), an E3-ubiquitin ligase present in the ER and cis-Golgi compartments. Here we demonstrate that RNF121 facilitates two opposing fates of NaV channels: (i) ubiquitin-mediated proteasome degradation and (ii) membrane localization when coexpressed with auxiliary NaVβ subunits. Collectively, these results indicate that RNF121 participates in the quality control of NaV channels during their synthesis and subsequent transport to the membrane. PMID:25691753

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

Science.gov (United States)

Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

2017-03-01

The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

Science.gov (United States)

Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

2017-10-15

Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

Science.gov (United States)

Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

2011-01-01

Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

Influence of experimental parameters inherent to optical fibers on Quantum Key Distribution, the protocol BB84

Directory of Open Access Journals (Sweden)

L. Bouchoucha

2018-03-01

Full Text Available In this work, we represent the principle of quantum cryptography (QC that is based on fundamental laws of quantum physics. QC or Quantum Key Distribution (QKD uses various protocols to exchange a secret key between two communicating parties. This research paper focuses and examines the quantum key distribution by using the protocol BB84 in the case of encoding on the single-photon polarization and shows the influence of optical components parameters on the quantum key distribution. We also introduce Quantum Bit Error Rate (QBER to better interpret our results and show its relationship with the intrusion of the eavesdropper called Eve on the optical channel to exploit these vulnerabilities.

The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

Science.gov (United States)

Shukla, Avi; Chatterjee, Anirvan

2018-01-01

Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

Hacking on decoy-state quantum key distribution system with partial phase randomization

Science.gov (United States)

Sun, Shi-Hai; Jiang, Mu-Sheng; Ma, Xiang-Chun; Li, Chun-Yan; Liang, Lin-Mei

2014-04-01

Quantum key distribution (QKD) provides means for unconditional secure key transmission between two distant parties. However, in practical implementations, it suffers from quantum hacking due to device imperfections. Here we propose a hybrid measurement attack, with only linear optics, homodyne detection, and single photon detection, to the widely used vacuum + weak decoy state QKD system when the phase of source is partially randomized. Our analysis shows that, in some parameter regimes, the proposed attack would result in an entanglement breaking channel but still be able to trick the legitimate users to believe they have transmitted secure keys. That is, the eavesdropper is able to steal all the key information without discovered by the users. Thus, our proposal reveals that partial phase randomization is not sufficient to guarantee the security of phase-encoding QKD systems with weak coherent states.

Hacking on decoy-state quantum key distribution system with partial phase randomization.

Science.gov (United States)

Sun, Shi-Hai; Jiang, Mu-Sheng; Ma, Xiang-Chun; Li, Chun-Yan; Liang, Lin-Mei

2014-04-23

Quantum key distribution (QKD) provides means for unconditional secure key transmission between two distant parties. However, in practical implementations, it suffers from quantum hacking due to device imperfections. Here we propose a hybrid measurement attack, with only linear optics, homodyne detection, and single photon detection, to the widely used vacuum + weak decoy state QKD system when the phase of source is partially randomized. Our analysis shows that, in some parameter regimes, the proposed attack would result in an entanglement breaking channel but still be able to trick the legitimate users to believe they have transmitted secure keys. That is, the eavesdropper is able to steal all the key information without discovered by the users. Thus, our proposal reveals that partial phase randomization is not sufficient to guarantee the security of phase-encoding QKD systems with weak coherent states.

The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

NARCIS (Netherlands)

Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

2015-01-01

The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Single nucleotide polymorphisms and genotypes of transient receptor potential ion channel and acetylcholine receptor genes from isolated B lymphocytes in myalgic encephalomyelitis/chronic fatigue syndrome patients.

Science.gov (United States)

Marshall-Gradisnik, Sonya; Johnston, Samantha; Chacko, Anu; Nguyen, Thao; Smith, Peter; Staines, Donald

2016-12-01

Objective The pathomechanism of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) is unknown; however, a small subgroup of patients has shown muscarinic antibody positivity and reduced symptom presentation following anti-CD20 intervention. Given the important roles of calcium (Ca 2+ ) and acetylcholine (ACh) signalling in B cell activation and potential antibody development, we aimed to identify relevant single nucleotide polymorphisms (SNPs) and genotypes in isolated B cells from CFS/ME patients. Methods A total of 11 CFS/ME patients (aged 31.82 ± 5.50 years) and 11 non-fatigued controls (aged 33.91 ± 5.06 years) were included. Flow cytometric protocols were used to determine B cell purity, followed by SNP and genotype analysis for 21 mammalian TRP ion channel genes and nine mammalian ACh receptor genes. SNP association and genotyping analysis were performed using ANOVA and PLINK analysis software. Results Seventy-eight SNPs were identified in nicotinic and muscarinic acetylcholine receptor genes in the CFS/ME group, of which 35 were in mAChM3. The remaining SNPs were identified in nAChR delta (n = 12), nAChR alpha 9 (n = 5), TRPV2 (n = 7), TRPM3 (n = 4), TRPM4 (n = 1) mAChRM3 2 (n = 2), and mAChRM5 (n = 3) genes. Nine genotypes were identified from SNPs in TRPM3 (n = 1), TRPC6 (n = 1), mAChRM3 (n = 2), nAChR alpha 4 (n = 1), and nAChR beta 1 (n = 4) genes, and were located in introns and 3' untranslated regions. Odds ratios for these specific genotypes ranged between 7.11 and 26.67 for CFS/ME compared with the non-fatigued control group. Conclusion This preliminary investigation identified a number of SNPs and genotypes in genes encoding TRP ion channels and AChRs from B cells in patients with CFS/ME. These may be involved in B cell functional changes, and suggest a role for Ca 2+ dysregulation in AChR and TRP ion channel signalling in the pathomechanism of CFS/ME.

Genetic variation in Hyperpolarization-activated cyclic nucleotide-gated (HCN channels and its relationship with neuroticism, cognition and risk of depression

Directory of Open Access Journals (Sweden)

Andrew Mark Mcintosh

2012-07-01

Full Text Available Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are encoded by four genes (HCN1-4 and, through activation by cyclic AMP (cAMP, represent a point of convergence for several psychosis risk genes. On the basis of positive preliminary data, we sought to test whether genetic variation in HCN1-4 conferred risk of depression or cognitive impairment in the Generation Scotland: Scottish Family Health Study. HCN1, HCN2, HCN3 and HCN4 were genotyped for 43 haplotype-tagging SNPs and tested for association with DSM-IV depression, neuroticism and a battery of cognitive tests assessing cognitive ability, memory, verbal fluency and psychomotor performance. No association was found between any HCN channel gene SNP and risk of depression, neuroticism or on any cognitive measure. The current study does not support a genetic role for HCN channels in conferring risk of depression or cognitive impairment in human subjects within the Scottish population.

Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon

Science.gov (United States)

Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling

2018-01-01

Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867

Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon.

Directory of Open Access Journals (Sweden)

Lei Gao

Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

Comparative transcriptome analysis reveals key genes potentially related to soluble sugar and organic acid accumulation in watermelon.

Science.gov (United States)

Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge

2018-01-01

Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.

Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.

Science.gov (United States)

Murata, Takatoshi; Hanada, Nobuhiro

2016-06-01

Genes encoding fluoride transporters have been identified in bacterial and archaeal species. The genome sequence of the cariogenic Streptococcus mutans bacteria suggests the presence of a putative fluoride transporter, which is referred to as a chloride channel permease. Two homologues of this gene (GenBank locus tags SMU_1290c and SMU_1289c) reside in tandem in the genome of S. mutans The aim of this study was to determine whether the chloride channel permeases contribute to fluoride resistance. We constructed SMU_1290c- and SMU_1289c-knockout S. mutans UA159 strains. We also constructed a double-knockout strain lacking both genes. SMU_1290c or SMU_1289c was transformed into a fluoride transporter- disrupted Escherichia coli strain. All bacterial strains were cultured under appropriate conditions with or without sodium fluoride, and fluoride resistance was evaluated. All three gene-knockout S. mutans strains showed lower resistance to sodium fluoride than did the wild-type strain. No significant changes in resistance to other sodium halides were recognized between the wild-type and double-knockout strains. Both SMU_1290c and SMU_1289c transformation rescued fluoride transporter-disrupted E. coli cell from fluoride toxicity. We conclude that the chloride channel permeases contribute to fluoride resistance in S. mutans. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

Science.gov (United States)

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

2013-01-01

Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

Science.gov (United States)

Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

2017-03-01

The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

International Nuclear Information System (INIS)

Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

2005-01-01

Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

Isolation and characterization of CNGC17 gene from Arabidopsis thaliana

International Nuclear Information System (INIS)

Yamagami, Mutsumi; Kobayashi, Daisuke; Hisamatsu, Shun'ichi

2007-01-01

Phytoremediation is a possible countermeasure for cleaning up soil contaminated by 137 Cs, and development of plants which can effectively absorb 137 Cs is important for it. It is expected that capability of Cs extraction from soil can be strengthened by genetic alteration of the Cs + root-uptake mechanism of plants. This study aimed at elucidating the uptake mechanism of Cs + for future genetic engineering. Plant roots take up Cs + from the soil solution via transport proteins at the plasma membrane of root cells. Voltage-insensitive cation channels (VICCs) are a possible transfer route of Cs + , and they are encoded by cyclic-nucleotide gated channel (CNGC) and glutamate receptor (GLR) gene families. The genome of Arabidopsis thaliana contains 20 CNGC genes. We have cloned a putative AtCNGC17 gene from cDNAs which were generated with total-RNA obtained from leaves of Arabidopsis thaliana by RT-PCR. The cDNA contained 2163 bp with an ORF that encoded a protein consisting of 721 amino acids residues. The plasmid prepared by the insertion of the gene under a Taq promoter was used to transform an E. coli deficient in the three major K + uptake systems (Kdp, Trk, and Kup). Only the E. coli with AtCNGC17 gene grew in low K + concentration minimal medium. This result suggested that the AtCNGC17 protein has a function of K + uptake. Growth rates of the E. coli cells expressing the gene were strongly inhibited by CsCl in low K + concentration minimal medium, suggesting that the AtCNGC17 transporter also carries Cs + . (author)

aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

Directory of Open Access Journals (Sweden)

Tuffery Pierre

2009-12-01

Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

Directory of Open Access Journals (Sweden)

Moysés Elias-Neto

2013-06-01

Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

Science.gov (United States)

Sudagidan, Mert; Aydin, Ali

2010-04-15

In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

Available nitrogen is the key factor influencing soil microbial functional gene diversity in tropical rainforest.

Science.gov (United States)

Cong, Jing; Liu, Xueduan; Lu, Hui; Xu, Han; Li, Yide; Deng, Ye; Li, Diqiang; Zhang, Yuguang

2015-08-20

Tropical rainforests cover over 50% of all known plant and animal species and provide a variety of key resources and ecosystem services to humans, largely mediated by metabolic activities of soil microbial communities. A deep analysis of soil microbial communities and their roles in ecological processes would improve our understanding on biogeochemical elemental cycles. However, soil microbial functional gene diversity in tropical rainforests and causative factors remain unclear. GeoChip, contained almost all of the key functional genes related to biogeochemical cycles, could be used as a specific and sensitive tool for studying microbial gene diversity and metabolic potential. In this study, soil microbial functional gene diversity in tropical rainforest was analyzed by using GeoChip technology. Gene categories detected in the tropical rainforest soils were related to different biogeochemical processes, such as carbon (C), nitrogen (N) and phosphorus (P) cycling. The relative abundance of genes related to C and P cycling detected mostly derived from the cultured bacteria. C degradation gene categories for substrates ranging from labile C to recalcitrant C were all detected, and gene abundances involved in many recalcitrant C degradation gene categories were significantly (P rainforest. Soil available N could be the key factor in shaping the soil microbial functional gene structure and metabolic potential.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

Directory of Open Access Journals (Sweden)

Ying Wang

Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

Identification of key genes involved in polysaccharide bioflocculant synthesis in Bacillus licheniformis.

Science.gov (United States)

Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning

2017-03-01

The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Bartter's and Gitelman's syndromes: from gene to clinic

OpenAIRE

Naesens, Maarten; STEELS, Paul; Verberckmoes, René; Vanrenterghem, Yves; Kuypers, Dirk

2004-01-01

Bartter's and Gitelman's syndromes are characterized by hypokalemia, normal to low blood pressure and hypochloremic metabolic alkalosis. Recently, investigators have been able to demonstrate mutations of six genes encoding several renal tubular transporters and ion channels that can be held responsible for Bartter's and Gitelman's syndromes. Neonatal Bartter's syndrome is caused by mutations of NKCC2 or ROMK, classic Bartter's syndrome by mutations of ClC-Kb, Bartter's syndrome associated wit...

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

Directory of Open Access Journals (Sweden)

DEWI FITRIANI

2010-06-01

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

DEFF Research Database (Denmark)

Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

2014-01-01

OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

Mutations of the Corynebacterium glutamicum NCgl1221 Gene, Encoding a Mechanosensitive Channel Homolog, Induce l-Glutamic Acid Production▿

OpenAIRE

Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

2007-01-01

Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-gluta...

Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins