WorldWideScience

Sample records for chalcone synthase gene

  1. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    Science.gov (United States)

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  2. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  3. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  4. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Indian Academy of Sciences (India)

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  5. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.;

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  6. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii.

    Science.gov (United States)

    Awasthi, Praveen; Mahajan, Vidushi; Jamwal, Vijay Lakshmi; Kapoor, Nitika; Rasool, Shafaq; Bedi, Yashbir S; Gandhi, Sumit G

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant-microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plant CHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C. forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction of CfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, our in silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34.

  7. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii

    Indian Academy of Sciences (India)

    PRAVEEN AWASTHI; VIDUSHI MAHAJAN; VIJAY LAKSHMI JAMWAL; NITIKA KAPOOR; SHAFAQ RASOOL; YASHBIR S. BEDI; SUMIT G. GANDHI

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant–microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C.forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction ofCfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, ourin silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34.

  8. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  9. Molecular cloning and transgenic characterization of the genes encoding chalcone synthase and chalcone isomerase from the Tibetan herbal plant Mirabilis himalaica.

    Science.gov (United States)

    Lan, Xiaozhong; Quan, Hong; Xia, Xinli; Yin, Weilun; Zheng, Weilie

    2016-05-01

    Mirabilis himalaica is an endangered medicinal plant species in the Tibetan Plateau. The two genes respectively encoding chalcone synthase (MhCHS) and chalcone isomerase (MhCHI) were isolated and characterized from M. himalaica. The sequence analysis revealed that the two genes were similar with their corresponding homologous genes in other plants. The tissue profiles showed that both MhCHS and MhCHI had higher expression levels in roots than in stems and leaves. Transgenic hairy root cultures respectively with overexpressing MhCHS and MhCHI were established. The genomic PCR detection confirmed the authority of transgenic hairy root lines, in which either MhCHS or MhCHI expression levels were much higher than that in non-transgenic hairy root line. Finally, the HPLC detection results demonstrated that the rotenoid contents in MhCHS/MhCHI-transformed hairy root lines were enhanced. This study provided two candidate genes that could be used to genetic engineering rotenoid biosynthesis in M. himalaica and an alternative method to produce rotenoid using transgenic hairy root cultures.

  10. One type of chalcone synthase gene expressed during embryogenesis regulates the flavonoid accumulation in citrus cell cultures.

    Science.gov (United States)

    Moriguchi, T; Kita, M; Tomono, Y; EndoInagaki, T; Omura, M

    1999-06-01

    To elucidate the relationship between the expression of chalcone synthase (CHS) genes and the production of flavonoid in citrus cell cultures, two cDNA clones encoding CHS were isolated (CitCHS1 and CitCHS2) from the citrus. The accumulation of CitCHS2 mRNA was notably induced by embryogenesis but CitCHS1 mRNA was not. There was no detectable accumulation of flavonoid in the undifferentiated calli, but flavonoid accumulated after the morphological changes to embryoids. These results indicate that two CHS genes differentially expressed during citrus somatic embryogenesis and CitCHS2 may regulate the accumulation of flavonoid in citrus cell cultures.

  11. Endogenous, tissue-specific short interfering RNAs silence the chalcone synthase gene family in glycine max seed coats.

    Science.gov (United States)

    Tuteja, Jigyasa H; Zabala, Gracia; Varala, Kranthi; Hudson, Matthew; Vodkin, Lila O

    2009-10-01

    Two dominant alleles of the I locus in Glycine max silence nine chalcone synthase (CHS) genes to inhibit function of the flavonoid pathway in the seed coat. We describe here the intricacies of this naturally occurring silencing mechanism based on results from small RNA gel blots and high-throughput sequencing of small RNA populations. The two dominant alleles of the I locus encompass a 27-kb region containing two perfectly repeated and inverted clusters of three chalcone synthase genes (CHS1, CHS3, and CHS4). This structure silences the expression of all CHS genes, including CHS7 and CHS8, located on other chromosomes. The CHS short interfering RNAs (siRNAs) sequenced support a mechanism by which RNAs transcribed from the CHS inverted repeat form aberrant double-stranded RNAs that become substrates for dicer-like ribonuclease. The resulting primary siRNAs become guides that target the mRNAs of the nonlinked, highly expressed CHS7 and CHS8 genes, followed by subsequent amplification of CHS7 and CHS8 secondary siRNAs by RNA-dependent RNA polymerase. Most remarkably, this silencing mechanism occurs only in one tissue, the seed coat, as shown by the lack of CHS siRNAs in cotyledons and vegetative tissues. Thus, production of the trigger double-stranded RNA that initiates the process occurs in a specific tissue and represents an example of naturally occurring inhibition of a metabolic pathway by siRNAs in one tissue while allowing expression of the pathway and synthesis of valuable secondary metabolites in all other organs/tissues of the plant.

  12. A new member of the chalcone synthase (CHS family in sugarcane

    Directory of Open Access Journals (Sweden)

    Contessotto Miriam G.G.

    2001-01-01

    Full Text Available Sequences from the sugarcane expressed sequence tag (SUCEST database were analyzed based on their identities to genes encoding chalcone-synthase-like enzymes. The sorghum (Sorghum bicolor chalcone-synthase (CHS, EC 2.3.1.74 protein sequence (gi|12229613 was used to search the SUCEST database for clusters of sequencing reads that were most similar to chalcone synthase. We found 121 reads with homology to sorghum chalcone synthase, which we were then able to sort into 14 clusters which themselves were divided into two groups (group 1 and group 2 based on the similarity of their deduced amino acid sequences. Clusters in group 1 were more similar to the sorghum enzyme than those in group 2, having the consensus sequence of the active site of chalcone and stilbene synthase. Analysis of gene expression (based on the number of reads from a specific library present in each group indicated that most of the group 1 reads were from sugarcane flower and root libraries. Group 2 clusters were more similar to the amino acid sequence of an uncharacterized pathogen-induced protein (PI1, gi|9855801 from the S. bicolor expressed sequence tag (EST database. The group 2 clusters sequences and PI1 proteins are 90% identical, having two amino acid changes at the chalcone and stilbene synthase consensi but conserving the cysteine residue at the active site. The PI1 EST has not been previously associated with chalcone synthase and has a different consensus sequence from the previously described chalcone synthase of sorghum. Most of the group 2 reads were from libraries prepared from sugarcane roots and plants infected with Herbaspirillum rubrisubalbicans and Gluconacetobacter diazotroficans. Our results indicate that we have identified a sugarcane chalcone synthase similar to the pathogen-induced PI1 protein found in the sorghum cDNA libraries, and it appears that both proteins represent new members of the chalcone and stilbene synthase super-family.

  13. Cloning and Sequence Analyzing of Chalcone Synthase Gene in Loropetalum chinense var.Rubrum%红花檵木CHS基因的克隆与序列分析

    Institute of Scientific and Technical Information of China (English)

    许威; 于晓英; 陈己任; 符红艳; 胡博文; 陈彦斌; 李达

    2013-01-01

    查尔酮合酶(chalcone synthase,CHS)是进入类黄酮和花色素苷次生代谢的第1个关键酶.根据植物查尔酮合成酶保守区序列设计引物,以红花檵木Loropetalurn chinense var.Rubrum)大叶红的嫩叶为材料,用RT-PCR方法,分离得到了一个查尔酮合成酶基因的eDNA(GenBank登录号为JQ609678),将该基因命名为Lc vrCHS1.该序列长927 bp,编码232个氨基酸残基.其核苷酸序列与GenBank已登录的同样来源的核桃、山茶属植物CHS序列同源性达83%,与其他科植物(绣球花、葡萄、桃、马铃薯、甘草、领春木属)CHS序列同源性也达到80%以上;其编码的氨基酸序列与山茶属、葡萄、鳄梨、洋梨、沙梨、映山红CHS基因编码的氨基酸序列同样具有高度同源性,同源性高达98%.%Chalcone synthase (chalcone synthase, CHS) is the key enzyme that catalyzes the first step in flavonoids biosynthesis and anthocyanins secondary metabolites. A full-length cDNA encoding CHS was cloned from the young leaves of Loropetalurn chinense var. rubrum by RT-PCR using specific primers based on the highly conserved sequences of plant CHS that had already known. Blast search revealed that it was a new gene, and was named as LcvrCHSl (GenBank accession: JQ609678). The sequence was 927 bp, encoding 232 amino acid residues. It had 83% sequence homology with walnut and camellia that had been logged in GenBank; with other genus plants (hydrangea, grapes, peaches, potatoes, licorice, Euptelea genus), CHS sequence homology was also more than 80%; with other plants (camellia, grapes, avocados, bartlett pear, sand pear, azalea), CHS sequence also had high homology, up to 98% homology.

  14. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia.

    Science.gov (United States)

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu

    2011-11-01

    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias.

  15. Duplication and divergent evolution of the CHS and CHS-like genes in the chalcone synthase (CHS) superfamily

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The enzymes of the CHS-superfamily are responsible for biosynthesis of a wide range of natural products in plants. They are important for flower pigmentation, protection against UV light and defense against phytopathogens. Many plants were found to contain multiple copies of CHS genes. This review summarizes the recent progress in the studies of the CHS-superfamily, focusing on the duplication and divergent evolution of the CHS and CHS-like genes. Comparative analyses of gene structure, expression patterns and catalytic properties revealed extensive differentiation in both regulation and function among duplicate CHS genes. It is also proposed that the CHS-like enzymes in the CHS-superfamily evolved from CHS at different times in various organisms. The CHS-superfamily thus offers a valuable model to study the rates and patterns of sequence divergence between duplicate genes.

  16. Cloning and Expression Analysis of Chilling-induced Chalcone Synthase Gene from Jatropha curcas%小桐子低温诱导查耳酮合酶基因的克隆及其表达分析

    Institute of Scientific and Technical Information of China (English)

    王海波; 邹竹荣; 龚明

    2015-01-01

    In order to understand the function of chalcone synthase in cold resistance of Jatropha curcas, a chilling-induced chalcone synthase gene, named as JcCHS, was cloned from J. curcas based on data of transcriptome and digital gene expression proifling (DGE), and the expression patterns were analyzed by semi-quantitative RT-PCR. The results showed that the full length of JcCHS cDNA was 1386 bp, with entire open reading frame (ORF) of 1170 bp encoding 389 amino acids. The theoretical molecular weight of JcCHS was 42.2 kDa with pI of 6.53. JcCHS protein shared 93.6%identity with CHS from Ricinus communis (Euphorbiaceae), and belong to the type-III polyketide synthase family containing conserved domains of chalcone synthase/styrene synthase. The expression of JcCHS was detected in all tissues with the highest expression in root. In addition, the over-expression of JcCHS in yeast enhanced its resistance to low temperature. So, it was suggested that JcCHS gene would involve in the cold-resistance formation in J. curcas.%为了解查耳酮合酶在小桐子(Jatropha curcas)抗冷性形成中的作用,基于小桐子低温锻炼转录组和数字基因表达谱数据,克隆了低温新诱导表达的小桐子查耳酮合酶基因(JcCHS),并分析了该基因的表达特性和功能。结果表明,JcCHS基因的cDNA全长为1386 bp,包含完整开放阅读框(ORF)1170 bp,编码389个氨基酸,JcCHS的理论分子量为42.2 kDa、等电点为6.53,与蓖麻CHS蛋白序列的相似性高达93.6%,具有III型聚酮合酶家族保守的查耳酮合酶/对苯乙烯合酶结构域。半定量RT-PCR分析表明,JcCHS在小桐子各组织中都有表达,其中根的表达量较高。JcCHS基因的表达能在一定程度上提高重组酵母菌的低温抵抗能力,这说明JcCHS基因可能参与了小桐子的抗低温响应。

  17. Co-suppression in transgenic Petunia hybrida expressing chalcone synthase A (chsA)

    Institute of Scientific and Technical Information of China (English)

    李艳; 惠有为; 张仲凯; 黄兴奇; 李毅

    2001-01-01

    Chalcone synthase A is a key enzyme in the anthocyanin biosynthesis pathway. Expression of chsA gene in transgenic Petunia hybrida resulted in flower color alterations and co-suppression of transgenes and endogenous genes. We fused the β-glucuronidase (uidA) gene to the C-terminal of chsA gene, and transferred the fusion gene into Petunia hybrida via Agrobacterium tumefaciens. GUS histochemical staining analysis showed that co-suppression occurred specifically during the development of flowers and co-suppression required the mutual interaction of endogenous genes and transgenes. RNA in situ hybridization analysis suggested that co-suppression occurred in the entire plant, and RNA degradation occurred in the cytoplasm.

  18. Benzophenone Synthase and Chalcone Synthase Accumulate in the Mesophyll of Hypericum perforatum Leaves at Different Developmental Stages

    OpenAIRE

    Belkheir, Asma K.; Gaid, Mariam; Liu, Benye; Hänsch, Robert; Beerhues, Ludger

    2016-01-01

    The active medicinal constituents in Hypericum perforatum, used to treat depression and skin irritation, include flavonoids and xanthones. The carbon skeletons of these compounds are formed by chalcone synthase (CHS) and benzophenone synthase (BPS), respectively. Polyclonal antisera were raised against the polyketide synthases from Hypericum androsaemum and their IgG fractions were isolated. Immunoblotting and immunotitration were used to test the IgGs for crossreactivity and monospecificity ...

  19. Genome-Wide Identification, Characterization and Expression Analysis of the Chalcone Synthase Family in Maize.

    Science.gov (United States)

    Han, Yahui; Ding, Ting; Su, Bo; Jiang, Haiyang

    2016-01-27

    Members of the chalcone synthase (CHS) family participate in the synthesis of a series of secondary metabolites in plants, fungi and bacteria. The metabolites play important roles in protecting land plants against various environmental stresses during the evolutionary process. Our research was conducted on comprehensive investigation of CHS genes in maize (Zea mays L.), including their phylogenetic relationships, gene structures, chromosomal locations and expression analysis. Fourteen CHS genes (ZmCHS01-14) were identified in the genome of maize, representing one of the largest numbers of CHS family members identified in one organism to date. The gene family was classified into four major classes (classes I-IV) based on their phylogenetic relationships. Most of them contained two exons and one intron. The 14 genes were unevenly located on six chromosomes. Two segmental duplication events were identified, which might contribute to the expansion of the maize CHS gene family to some extent. In addition, quantitative real-time PCR and microarray data analyses suggested that ZmCHS genes exhibited various expression patterns, indicating functional diversification of the ZmCHS genes. Our results will contribute to future studies of the complexity of the CHS gene family in maize and provide valuable information for the systematic analysis of the functions of the CHS gene family.

  20. Co-suppression in transgenic Petunia hybrida expressing chalcone synthase A (chsA)

    Institute of Scientific and Technical Information of China (English)

    LI; Yan; (

    2001-01-01

    [1]Napoli, C., Lemieux, C., Jorgensen, R., Introduction of a chimeric chalone synthase gene into petunia results in reversible cosuppession of homologous genes in trans, The Plant Cell, 1990, 2: 279-289.[2]Van der Krol, A.R., Mur, L.A., Beld, M. M. et al., Flavonnoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression, The Plant Cell, 1990, 2: 291-299.[3]Manika, P.B., Bhadra, U., Birchler, J., Cosuppression in Drosophila: gene silencing of Alcohol dehydrogenase by White-Adh transgene is Polycomb dependent, Cell, 1997, 90: 479-498.[4]de Carvalho Niebel, F., Frendo, P., Van Montagu, M. et al., Post-transcriptional cosuppression of ?-1,3-glucanase transgene expression in homozygous plants, EMBO J., 1992, 11: 2595-2602.[5]Van Blokland, R., Van der Geest, N., Mol, J. N. M. et al., Transgene-mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RNA turnover, The Plant Cell, 1994, 6: 861-877.[6]Stam, M., Mol, J. N. M., Kooter, J. M., The silence of genes in transgenic plants, Annals of Bot., 1997, 79: 3-12.[7]Vaucheret, H., Beclin, C., Elmayan, T. et al., Transgene-induced gene silencing in plants, Plant J., 1998, 16(6): 651-659.[8]Shao, L., Li, Y., Yang, M. Z. et al., Transformation of Petunia hybrida with chalcone synthase A (chsA) resulting flower colour alteration and male sterility, Acta Botanica Sinica (in Chinese), 1996, 38(7): 517-524.[9]Koes, R. E., Spelt, C. E., Mol, J. N. M., The chalcone synthase multigene family of Petunia hybrida (V30): differential, light-regulated expression during flower development and UV light induction, Plant Mol. Biol., 1989, 12: 213-225.[10]Drews, G. N., Beals, T. P., Bul, A. Q. et al., Regional and cell-specific expression patterns during petal development, The Plant Cell, 1992, 4: 1383-1404.[11]Martin, C., Gerats, T., Control of pigment biosynthesis genes during petal development, The

  1. Transient silencing of CHALCONE SYNTHASE during fruit ripening modifies tomato epidermal cells and cuticle properties.

    Science.gov (United States)

    España, Laura; Heredia-Guerrero, José A; Reina-Pinto, José J; Fernández-Muñoz, Rafael; Heredia, Antonio; Domínguez, Eva

    2014-11-01

    Tomato (Solanum lycopersicum) fruit ripening is accompanied by an increase in CHALCONE SYNTHASE (CHS) activity and flavonoid biosynthesis. Flavonoids accumulate in the cuticle, giving its characteristic orange color that contributes to the eventual red color of the ripe fruit. Using virus-induced gene silencing in fruits, we have down-regulated the expression of SlCHS during ripening and compared the cuticles derived from silenced and nonsilenced regions. Silenced regions showed a pink color due to the lack of flavonoids incorporated to the cuticle. This change in color was accompanied by several other changes in the cuticle and epidermis. The epidermal cells displayed a decreased tangential cell width; a decrease in the amount of cuticle and its main components, cutin and polysaccharides, was also observed. Flavonoids dramatically altered the cuticle biomechanical properties by stiffening the elastic and viscoelastic phase and by reducing the ability of the cuticle to deform. There seemed to be a negative relation between SlCHS expression and wax accumulation during ripening that could be related to the decreased cuticle permeability to water observed in the regions silencing SlCHS. A reduction in the overall number of ester linkages present in the cutin matrix was also dependent on the presence of flavonoids.

  2. Differential modification of flavonoid and isoflavonoid biosynthesis with an antisense chalcone synthase construct in transgenic Lotus corniculatus.

    Science.gov (United States)

    Colliver, S P; Morris, P; Robbins, M P

    1997-11-01

    Three clonal genotypes of Lotus corniculatus L. (bird's foot trefoil) were transformed with an antisense chalcone synthase (CHS) gene construct made using a stress induced CHS17 cDNA from Phaseolus vulgaris under the control of the constitutive CaMV 35S promoter and Nos terminator via Agrobacterium rhizogenes. After initial screening, ten antisense and five control co-transformation events from each recipient clonal genotype were analysed. After elicitation with glutathione, the level of tannin accumulation was found to be increased in a number of antisense root cultures derived from the low (S33) and moderate (S50) tannin recipient genotypes. Six antisense and four control transformed lines from genotype S50 were selected for more detailed study. The antisense CHS construct was found to be integrated into the genome, with a copy number ranging from 1 to 5 and antisense orientation was confirmed by PCR. In transformed root cultures, increased CHS transcript levels were noted in a number of antisense lines. Biochemical analyses of glutathione-elicited-root cultures indicated a significant increase in tannin accumulation in antisense CHS lines and mean vestitol levels were reduced. These results show that the introduction of a heterologous antisense chalcone synthase construct into L. corniculatus resulted in an unpredicted molecular and biochemical phenotype. Such findings are discussed in relation to manipulation of this complex multigene family.

  3. Benzophenone Synthase and Chalcone Synthase Accumulate in the Mesophyll of Hypericum perforatum Leaves at Different Developmental Stages

    Science.gov (United States)

    Belkheir, Asma K.; Gaid, Mariam; Liu, Benye; Hänsch, Robert; Beerhues, Ludger

    2016-01-01

    The active medicinal constituents in Hypericum perforatum, used to treat depression and skin irritation, include flavonoids and xanthones. The carbon skeletons of these compounds are formed by chalcone synthase (CHS) and benzophenone synthase (BPS), respectively. Polyclonal antisera were raised against the polyketide synthases from Hypericum androsaemum and their IgG fractions were isolated. Immunoblotting and immunotitration were used to test the IgGs for crossreactivity and monospecificity in H. perforatum leaf protein extract. Immunofluorescence localization revealed that both CHS and BPS are located in the mesophyll. The maximum fluorescence levels were observed in approx. 0.5 and 1 cm long leaves, respectively. The fluorescence intensity observed for CHS significantly exceeded that for BPS. Using histochemical staining, flavonoids were detected in the mesophyll, indicating that the sites of biosynthesis and accumulation coincide. Our results help understand the biosynthesis and underlying regulation of active H. perforatum constituents. PMID:27446151

  4. Benzophenone Synthase and Chalcone Synthase Accumulate in the Mesophyll of Hypericum perforatum Leaves at Different Developmental Stages.

    Science.gov (United States)

    Belkheir, Asma K; Gaid, Mariam; Liu, Benye; Hänsch, Robert; Beerhues, Ludger

    2016-01-01

    The active medicinal constituents in Hypericum perforatum, used to treat depression and skin irritation, include flavonoids and xanthones. The carbon skeletons of these compounds are formed by chalcone synthase (CHS) and benzophenone synthase (BPS), respectively. Polyclonal antisera were raised against the polyketide synthases from Hypericum androsaemum and their IgG fractions were isolated. Immunoblotting and immunotitration were used to test the IgGs for crossreactivity and monospecificity in H. perforatum leaf protein extract. Immunofluorescence localization revealed that both CHS and BPS are located in the mesophyll. The maximum fluorescence levels were observed in approx. 0.5 and 1 cm long leaves, respectively. The fluorescence intensity observed for CHS significantly exceeded that for BPS. Using histochemical staining, flavonoids were detected in the mesophyll, indicating that the sites of biosynthesis and accumulation coincide. Our results help understand the biosynthesis and underlying regulation of active H. perforatum constituents.

  5. Metabolic changes in Arabidopsis thaliana plants overexpressing chalcone synthase

    NARCIS (Netherlands)

    Dao, Thi Thanh Hien

    2010-01-01

    The study has shown that it is possible to introduce the heterologous CHS gene in Arabidopsis thaliana and common multicopies of transgenes containing plants were obtained. Analysis of the change in metabolome of CHS transgenic plants, high expression transgenic lines can be identified by markers su

  6. Novel anti-inflammatory chalcone derivatives inhibit the induction of nitric oxide synthase and cyclooxygenase-2 in mouse peritoneal macrophages.

    Science.gov (United States)

    Herencia, F; Ferrándiz, M L; Ubeda, A; Guillén, I; Dominguez, J N; Charris, J E; Lobo, G M; Alcaraz, M J

    1999-06-18

    In a previous work, we tested a series of chalcone derivatives as possible anti-inflammatory compounds. We now investigate the effects of three of those compounds, CHI, CH8 and CH12, on nitric oxide and prostanoid generation in mouse peritoneal macrophages stimulated with lipopolysaccharide and in the mouse air pouch injected with zymosan, where they showed a dose-dependent inhibition with inhibitory concentration 50% values in the microM range. This effect was not the consequence of a direct inhibitory action on enzyme activities. Our results demonstrated that chalcone derivatives inhibited de novo inducible nitric oxide synthase and cyclooxygenase-2 synthesis, being a novel therapeutic approach for inflammatory diseases.

  7. Silencing CHALCONE SYNTHASE in Maize Impedes the Incorporation of Tricin into Lignin and Increases Lignin Content1[OPEN

    Science.gov (United States)

    2017-01-01

    Lignin is a phenolic heteropolymer that is deposited in secondary-thickened cell walls, where it provides mechanical strength. A recent structural characterization of cell walls from monocot species showed that the flavone tricin is part of the native lignin polymer, where it is hypothesized to initiate lignin chains. In this study, we investigated the consequences of altered tricin levels on lignin structure and cell wall recalcitrance by phenolic profiling, nuclear magnetic resonance, and saccharification assays of the naturally silenced maize (Zea mays) C2-Idf (inhibitor diffuse) mutant, defective in the CHALCONE SYNTHASE Colorless2 (C2) gene. We show that the C2-Idf mutant produces highly reduced levels of apigenin- and tricin-related flavonoids, resulting in a strongly reduced incorporation of tricin into the lignin polymer. Moreover, the lignin was enriched in β-β and β-5 units, lending support to the contention that tricin acts to initiate lignin chains and that, in the absence of tricin, more monolignol dimerization reactions occur. In addition, the C2-Idf mutation resulted in strikingly higher Klason lignin levels in the leaves. As a consequence, the leaves of C2-Idf mutants had significantly reduced saccharification efficiencies compared with those of control plants. These findings are instructive for lignin engineering strategies to improve biomass processing and biochemical production. PMID:27940492

  8. Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in flavonoid biosynthetic pathway.

    Directory of Open Access Journals (Sweden)

    Wei Sun

    Full Text Available Chalcone synthase (CHS catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1 encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants.

  9. 非洲菊查尔酮合酶基因的克隆、序列分析及在大肠杆菌中的表达%Chalcone Synthase Gene Cloning in Gerbera hybrida and Expression in E.coli

    Institute of Scientific and Technical Information of China (English)

    谢修志; 陈兆平; 王小菁

    2004-01-01

    利用RT-PCR方法,从非洲菊(Gerbera hybrida)花瓣的cDNA中克隆到了查尔酮合酶(Chalcone Synthase,CHS)基因CHS,进行了序列分析.结果表明,克隆到的CHS基因全长为1197 bps,编码一个由398个氨基酸残基组成的多肽,与Helariutta等发表的非洲菊查尔酮合酶CHS1基因的cDNA序列的CHS基因同源性高达99%.进一步将该基因克隆到表达载体pET32a上,经IPTG诱导表达,得到高效表达的融合蛋白.

  10. CHS基因起源初探及其在被子植物中的进化分析%A Preliminary Study on the Origin and Evolution of Chalcone Synthase (CHS) Gene in Angiosperms

    Institute of Scientific and Technical Information of China (English)

    黄金霞; 瞿礼嘉; 杨继; 银好; 顾红雅

    2004-01-01

    利用PCR与TAlL-PCR方法,从半月苔(Lunularia cructata(L.)Dum.ex Lindb)中获得了一段长约l 000 bp的基因片段,它与已知的CHS基因在核苷酸水平上的相似性大于56%,在氨基酸水平上的相似性大于60%,所推断的氨基酸序列中酶反应的4个催化位点与已知晶体结构的紫花苜蓿MCHS2A上的催化位点相同,首次证明了苔类植物中可能存在类CHS基因,将CHS基因的起源时间推到苔藓类植物出现之前.以该序列和两种蕨类植物(Psilotumnudum(L.)Griseb.和Equisetum arvense L.)的CHS序列作为外类群,应用邻接法、最大简约法和最大似然法分别构建了被子植物的CHS的分子系统树.结果表明,大部分科中的CHS分布在不同的分支上,而十字花科、可科和禾本科各自聚成一个单系类群.以邻接树为依据,对茄科、旋花科和菊科的CHS基因进行了相对碱基替换速率的检测,发现这三个科内或科间序列的替换速率不一致.被子植物的CHS基因在基因拷贝数目、碱基替换速率以及重复/丢失事件的发生上都存在较大的差异,这种差异可能与被子植物的生活史、生活环境、花的特性以及对外界的防御系统等的多样性相关.%By using Thermal Asymmetric Interlaced PCR (TAIL-PCR) method, a DNA fragment of about 1 000 bp was amplified and cloned from a liverwort species (Lunularia cruciata (L.) Dum. ex Lindb). The nucleotide sequence of this fragment and its deduced amino acid sequence shared about 56% and 60% identity with those of exon 2 of CHS genes from vascular plants respectively. The four characteristic catalyzing sites of CHS were found conserved in the deduced amino acid sequences of the fragment when compared with other CHS sequences. This is the first report of cloning a CHS-like gene from liverworts,suggesting that the origin of CHS genes may predate liverworts. Using the CHS-like sequence from L.cruciata and CHS sequences from two fern-alien species, Psilotum

  11. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria x ananassa).

    Science.gov (United States)

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria x ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus.

  12. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    Science.gov (United States)

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  13. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  14. The tomato terpene synthase gene family

    NARCIS (Netherlands)

    Falara, V.; Akhtar, T.A.; Nguyen, T.T.H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R.C.; Pichersky, E.

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  15. Review on the molecular biology of plant chalcone synthase%植物查尔酮合成酶分子生物学研究进展

    Institute of Scientific and Technical Information of China (English)

    王燕; 许锋; 程水源

    2007-01-01

    查尔酮合成酶(chalcone synthase,CHS,EC 2.3.1.74),是植物类黄酮物质合成途径中的第一个酶,也是植物次生代谢途径中的关键酶之一,对植物具有非常重要的生理意义.为此,综述了查尔酮合成酶基因结构、基因进化、表达调控机理以及诱导因子,概述了查尔酮合成酶基因工程在植物生理方面的研究,并进一步对查尔酮合成酶的分子生物学研究做了展望.

  16. Involvement of Salicylic Acid on Antioxidant and Anticancer Properties, Anthocyanin Production and Chalcone Synthase Activity in Ginger (Zingiber officinale Roscoe Varieties

    Directory of Open Access Journals (Sweden)

    Ehsan Karimi

    2012-11-01

    Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of

  17. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo;

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...... affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes....

  18. 苦荞查尔酮合成酶基因序列特征及分子进化分析%Characterize of Sequences and Molecular Evolution Analysis of Chalcone Synthase in Fagopyrum Tartaricum

    Institute of Scientific and Technical Information of China (English)

    孙朝霞; 侯思宇; 郭彬; 令狐斌; 黄可盛; 许冬梅; 韩渊怀

    2014-01-01

    Compared to other grain crops, Fagopyrum tataricum contain high levels of flavonoids, especially rutin. It has important significance for the research of key enzymes in the rutin biosynthesis pathway. This study focuses on the rutin biosynthesis pathway first key gene-chalcone synthase. Two genes FtCHS1 (1 430 bp, Genbank number:KJ130961) and FtCHS2 (1 454 bp, Gnebank number: KJ139980) were assembing and sequenced according to flo-wer transcriptom in F. tataricum. Protein 3D structure domain analysis showed that FtCHS contains three active site, 11 product binding sites, five acetyl coenzyme A binding sites. The amino acid sequences were aligned and compared to orthologous sequences from other plants, such as F. esculentum, F. dibotrys and P. cuspidatum. The phylogenetic tree showed that 22 polygonaceae plants was divided into two categories: (Ⅰ and Ⅱ), FtCHS1 and FtCHS2 belong to different categories. Gene expression of different tissues for FtCHS were analysed by semi-quantitive and real-time PCR. It showed that it had a higher expression level in immature embryo and flower for FtCHS1 and FtCHS2, and the expression level were decreased in roots and stems. Our work provides a strategy to improve rutin content, which could also be used to study molecular mechanism of rutin biosynthesis pathway.%相比其他杂粮作物,苦荞(Fagopyrum tataricum)植株中含有高含量的黄酮类物质--‘芦丁’,因此对其生物合成途径中关键酶的研究具有十分重要意义。查尔酮合成酶(chalcone synthase)是黄酮类物质生物合成的第一个关键酶,本研究基于转录组数据库同源搜索方法,核酸序列拼接获得两个查尔酮合成酶基因,分别命名为 FtCHS1(Genbank 登录号: KJ130961)和 FtCHS2(Genbank 登录号: KJ139980)。生物信息学分析结果表明,这两个基因编码的蛋白序列有3个保守结构域,其结构域上包含3个活性位点,11个产物结合位点,5个乙酰辅酶 A 结合

  19. Excision of transposable elements from the chalcone isomerase and dihydroflavonol 4-reductase genes may contribute to the variegation of the yellow-flowered carnation (Dianthus caryophyllus).

    Science.gov (United States)

    Itoh, Yoshio; Higeta, Daisuke; Suzuki, Akane; Yoshida, Hiroyuki; Ozeki, Yoshihiro

    2002-05-01

    In the "Rhapsody" cultivar of the carnation, which bears white flowers variegated with red flecks and sectors, a transposable element, dTdic1, belonging to the Ac/Ds superfamily, was found within the dihydroflavonol 4-reductase (DFR) gene. The red flecks and sectors of "Rhapsody" may be attributable to a reversion to DFR activity after the excision of dTdic1. The yellow color of the carnation petals is attributed to the synthesis and accumulation of chalcone 2'-glucoside. In several of the carnation cultivars that bear yellow flowers variegated with white flecks and sectors, both the chalcone isomerase (CHI) and DFR genes are disrupted by dTdic1.

  20. Cloning and Prokaryotic Expression Vector Construction of Cassia tora Chalcone Synthase%决明查尔酮合成酶全长cDNA的克隆及其原核表达载体的构建

    Institute of Scientific and Technical Information of China (English)

    方袁梦梦; 崔润泽; 陈访访; 周嘉裕; 廖海

    2011-01-01

    从决明子叶中提取查尔酮合成酶(Chalcone synthase)总RNA,经过RT-PCR获得查尔酮合成酶cDNA,纯化后与pMD18-T载体连接,转化大肠杆菌Top10,获得了查尔酮合成酶全长基因序列.序列测定表明,查尔酮合成酶全长核苷酸长度为1 173 bp,编码390个氨基酸.与GenBank中已发表序列EU430077进行比较,核苷酸同源性为100%.将该基因片段克隆到原核表达栽体pET-28a(+)中,构建重组质粒pET-28a(+)/Chalcone synthase,所获重组质粒经过双酶切、PCR和序列测定,证实含有目的片段,且连接、构建正确,为查尔酮合成酶的进一步表达奠定了基础.

  1. Bacillus caldolyticus prs gene encoding phosphoribosyl-diphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-1-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  2. Changes in phytochemical synthesis, chalcone synthase activity and pharmaceutical qualities of sabah snake grass (Clinacanthus nutans L.) in relation to plant age.

    Science.gov (United States)

    Ghasemzadeh, Ali; Nasiri, Alireza; Jaafar, Hawa Z E; Baghdadi, Ali; Ahmad, Izham

    2014-10-30

    In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old). The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74) was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF) production were observed between the three plant growth periods and the different plant parts. The highest contents of TF (6.32 mg/g dry weight [DW]) and total phenolic (TP) (18.21 mg/g DW) were recorded in 6-month-old buds. Among the flavonoids isolated in this study the most important ones based on concentration were from high to low as follows: catechin > quercetin > kaempferol > luteolin. Production of phenolic acids increased from 1 to 6 months, but after 6 months up to 1 year of age, they decreased significantly. The highest contents of caffeic acid (0.307 mg/g DW) and gallic acid (5.96 mg/g DW) were recorded in 1-year and 6-month-old buds, respectively. The lowest and highest activity of CHS was recorded in 1-month and 6-month-old buds with values of 3.6 and 9.5 nkat/mg protein, respectively. These results indicate that the increment in flavonoids and phenolic acids in 6-month-old buds can be attributed to an increase in CHS activity. The highest 1,1-diphenyl-2-picrylhydrazyl (DPPH) activity was observed in the extract of 1-year-old buds followed by 6-month-old buds, with 50% of free radical scavenging (IC50) values of 64.6 and 73.5 µg/mL, respectively. Interestingly, a ferric reducing antioxidant power (FRAP) assay showed a higher activity in 6-month-old buds (488 μM of Fe(II)/g) than in 1-year-old buds (453 μM of Fe(II)/g), in contrast to the DPPH result. Significant correlations (p < 0.05) were observed between CHS enzyme activity and FRAP activity, TF, catechin, and kaempferol content. Extracts of 6-month-old bud exhibited a significant in vitro anticancer activity against

  3. Changes in Phytochemical Synthesis, Chalcone Synthase Activity and Pharmaceutical Qualities of Sabah Snake Grass (Clinacanthus nutans L. in Relation to Plant Age

    Directory of Open Access Journals (Sweden)

    Ali Ghasemzadeh

    2014-10-01

    Full Text Available In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old. The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74 was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF production were observed between the three plant growth periods and the different plant parts. The highest contents of TF (6.32 mg/g dry weight [DW] and total phenolic (TP (18.21 mg/g DW were recorded in 6-month-old buds. Among the flavonoids isolated in this study the most important ones based on concentration were from high to low as follows: catechin > quercetin > kaempferol > luteolin. Production of phenolic acids increased from 1 to 6 months, but after 6 months up to 1 year of age, they decreased significantly. The highest contents of caffeic acid (0.307 mg/g DW and gallic acid (5.96 mg/g DW were recorded in 1-year and 6-month-old buds, respectively. The lowest and highest activity of CHS was recorded in 1-month and 6-month-old buds with values of 3.6 and 9.5 nkat/mg protein, respectively. These results indicate that the increment in flavonoids and phenolic acids in 6-month-old buds can be attributed to an increase in CHS activity. The highest 1,1-diphenyl-2-picrylhydrazyl (DPPH activity was observed in the extract of 1-year-old buds followed by 6-month-old buds, with 50% of free radical scavenging (IC50 values of 64.6 and 73.5 µg/mL, respectively. Interestingly, a ferric reducing antioxidant power (FRAP assay showed a higher activity in 6-month-old buds (488 μM of Fe(II/g than in 1-year-old buds (453 μM of Fe(II/g, in contrast to the DPPH result. Significant correlations (p < 0.05 were observed between CHS enzyme activity and FRAP activity, TF, catechin, and kaempferol content. Extracts of 6-month-old bud exhibited a significant in vitro anticancer activity

  4. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  5. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  6. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  7. Chalcone synthesis and hydroxylation of flavonoids in 3'-position with enzyme preparations from flowers of Dianthus caryophyllus L. (carnation).

    Science.gov (United States)

    Spribille, R; Forkmann, G

    1982-07-01

    Chalcone synthase activity was demonstrated in enzyme preparations from flowers of defined genotypes of Dianthus caryophyllus L. (carnation). In the absence of chalcone isomerase activity, which could be completely excluded by genetic methods, the first product formed from malonyl-CoA and 4-coumaroyl-CoA proved to be naringenin chalcone, followed by formation of naringenin as a result of chemical cyclization. In the presence of chalcone isomerase activity, however, naringenin was the only product of the synthase reaction. In vitro, both 4-coumaryl-CoA and caffeoyl-CoA were found to be used as substrates for the condensation reaction with respective pH optima of 8.0 and 7.0. The results of chemogenetic and enzymatic studies, however, showed that in vivo only 4-coumaroyl-CoA serves as substrate for the formation of the flavonoid skeleton. In confirmation of these results, an NADPH-dependent microsomal 3'-hydroxylase activity could be demonstrated, catalyzing hydroxylation of naringenin and dihydrokaempferol in 3'-position. Furthermore, a strict correlation was found between 3'-hydroxylase activity and the gene r which is known to control the formation of 3', 4'-hydroxylated flavonoid compounds.

  8. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    Science.gov (United States)

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  9. Cloning and Identification of Methionine Synthase Gene from Pichia pastoris

    Institute of Scientific and Technical Information of China (English)

    Lan HUANG; Dong-Yang LI; Shao-Xiao WANG; Shi-Ming ZHANG; Jun-Hui CHEN; Xiang-Fu WU

    2005-01-01

    Methionine synthase (MS) is grouped into two classes. Class One MS (MetH) and Class Two MS (MetE) share no homology and differ in their catalytic model. Based on the conserved sequences of metE genes from different organisms, a segment of the metE gene was first cloned from Pichia pastoris genomic DNA by PCR, and its 5' and 3' regions were further cloned by 5'- and 3'-rapid amplification of cDNA ends (RACE), respectively. The assembled sequence reveals an open reading frame encoding a polypeptide of 768 residues, and the deduced product shares 76% identity with MetE of Saccharomyces cerevisiae. P. pastoris methionine synthase (PpMetE) consists of two domains common to MetEs. The active site is located in the C-terminal domain, in which the residues involved in the interaction of zinc with substrates are conserved. Homologous expression of PpMetE in P. pastoris was achieved, and the heterologous expression of PpMetE in the S. cerevisiae strain XJB3-1D that is MetE-defective restored the growth of the mutant on methionine-free minimal media. The gene sequence has been submitted to GenBank/EMBL/DDBJ under accession No. AY601648.

  10. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  11. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene.

    Science.gov (United States)

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_000366.1, NM_000375.2]) in evolution by studying the phylogenetic relationship and divergence of this gene using computational methods. The UROS protein sequences from various taxa were retrieved from GenBank database and were compared using Clustal-W (multiple sequence alignment) with defaults and a first-pass phylogenetic tree was built using neighbor-joining method as in DELTA BLAST 2.2.27+ version. A total of 163 BLAST hits were found for the uroporphyrinogen III synthase query sequence and these hits showed putative conserved domain, HemD superfamily (as on 14(th) Nov 2012). We then narrowed down the search by manually deleting the proteins which were not UROS sequences and sequences belonging to phyla other than Chordata were deleted. A repeat phylogenetic analysis of 39 taxa was performed using PhyML and TreeDyn software to confirm that UROS is a highly conserved protein with approximately 85% conserved sequences in almost all chordate taxons emphasizing its importance in heme synthesis.

  12. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-01-01

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley – Cer-c, Cer-q and Cer-u – known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. PMID:26962211

  13. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-03-09

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes.

  14. Transcriptional regulation of human thromboxane synthase gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Lee, K.D.; Baek, S.J.; Fleischer, T [Univ. of Maryland Medical School, Baltimore, MD (United States)] [and others

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  15. 4'-Acetoamido-4-hydroxychalcone, a chalcone derivative, inhibits glioma growth and invasion through regulation of the tropomyosin 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Ku, Bo Mi [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of); Ryu, Hyung Won [Division of Applied Life Science (BK21 Program), EB-NCRC, Institute of Agriculture Life Science, Graduate School of Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Lee, Yeon Kyung; Ryu, Jinhyun; Jeong, Joo Yeon; Choi, Jungil [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of); Cho, Hee Jun [Department of Microbiology, Research Institute of Life Science, College of Natureal Sciences, Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Park, Ki Hun, E-mail: khpark@gnu.ac.kr [Division of Applied Life Science (BK21 Program), EB-NCRC, Institute of Agriculture Life Science, Graduate School of Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Kang, Sang Soo, E-mail: kangss@gnu.ac.kr [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of)

    2010-11-19

    Research highlights: {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) has anti-cancer property for glioma. {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) increased tropomyosin expreesion through activattion of PKA signaling. {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) inhibits glioma cell migration and invasion. {yields} In vivo administration of 4'-acetoamido-4-hydroxychalcone (AHC) reduced tumor growth. -- Abstract: Chalcones are precursors of flavonoids and have been shown to have anti-cancer activity. Here, we identify the synthetic chalcone derivative 4'-acetoamido-4-hydroxychalcone (AHC) as a potential therapeutic agent for the treatment of glioma. Treatment with AHC reduced glioma cell invasion, migration, and colony formation in a concentration-dependent manner. In addition, AHC inhibited vascular endothelial growth factor-induced migration, invasion, and tube formation in HUVECs. To determine the mechanism underlying the inhibitory effect of AHC on glioma cell invasion and migration, we investigated the effect of AHC on the gene expression change and found that AHC affects actin dynamics in U87MG glioma cells. In actin cytoskeleton regulating system, AHC increased tropomyosin expression and stress fiber formation, probably through activation of PKA. Suppression of tropomyosin expression by siRNA or treatment with the PKA inhibitor H89 reduced the inhibitory effects of AHC on glioma cell invasion and migration. In vivo experiments also showed that AHC inhibited tumor growth in a xenograft mouse tumor model. Together, these data suggest that the synthetic chalcone derivative AHC has potent anti-cancer activity through inhibition of glioma proliferation, invasion, and angiogenesis and is therefore a potential chemotherapeutic candidate for the treatment of glioma.

  16. Adenovirus-mediated nitric oxide synthase gene transfer.

    Science.gov (United States)

    Raman, Kathleen G; Shapiro, Richard A; Tzeng, Edith; Kibbe, Melina R

    2004-01-01

    The varied biological effects of nitric oxide (NO) have led to intense research into its diverse physiologic and pathophysiologic roles in multiple disease processes. It has been implicated in the development of altered vasomotor tone, intimal hyperplasia, atherosclerosis, impotence, host defense, and wound healing. Using the modern technologies of recombinant DNA and gene transfer using adenoviral vectors, the effects of NO derived from various NO synthase (NOS) enzymes can be studied in a variety of tissues and the therapeutic applications of NOS is possible. Such uses of NOS gene transfer have been investigated extensively in the vasculature where NO is critical to regulating vascular homeostasis. NOS gene therapy has the theoretical advantage of allowing NO delivery to be localized, thereby limiting potential adverse effects of NO. The benefits of adenoviral vectors in gene transfer include relatively high transduction efficiencies, both replicating and nonreplicating cells may be infected, and the high titers of adenovirus that can be produced. The methods described in this chapter include the cloning of the iNOS cDNA into a recombinant adenoviral vector, large-scale production of that vector AdiNOS preparation, and the use of the vector to transduce tissue in vitro and in vivo.

  17. Time courses for phytochrome-induced enzyme levels in phenylpropanoid metabolism (phenylalanine ammonia-lyase, naringenin-chalcone synthase) compared with time courses for phytochrome-mediated end-product accumulation (anthocyanin, quercetin).

    Science.gov (United States)

    Brödenfeldt, R; Mohr, H

    1988-12-01

    Time course for changes in the levels of enzymes characteristic of general phenylpropanoid metabolism (phenylalanine ammonia-lyase, PAL; EC 4.3.1.5) and of the flavonoid-glycoside branch pathway (naringenin-chalcone synthase, CHS; EC 2.3.1.74) were measured in the cotyledons of mustard (Sinapis alba L.) seedlings and compared with the rates of accumulation of related end products (anthocyanin and quercetin). Induction of enzyme levels and of end-product accumulation was carried out with red and far-red (FR) light, operating via phytochrome. The data are compatible with the concept that the phytochrome-mediated appearance of enzymes such as PAL and CHS is indeed a prerequisite for the appearance of anthocyanins and flavonols. However, there is no close correlation between enzyme levels and the rates of synthesis of end products which could justify the identification of specific rate-limiting enzymes. Rather, the data indicate that there is a second phytochrome-dependent step, beyond enzyme induction, where the actual rate of flavonoid accumulation is determined. Anthocyanin and quercetin accumulation respond differently to light. However, the relative action of continuous FR, red light pulses and 'stored phytochrome signal' is the same in both cases. This indicates that the mode of operation of phytochrome is the same in both cases. The two syntheses differ only in the degree of responsiveness towards phytochrome. The time course for changes in CHS levels in continuous FR, i.e. under conditions of phytochrome photosteady state, is similar to the time course for PAL levels whereas the time courses in darkness, following transfer from FR to darkness, are totally different. In the case of CHS, a transient rise is observed whereas, with PAL, an instantaneous drop in enzyme level occurs after transfer from FR to darkness. It is concluded that the 'stored phytochrome signal' operates in darkness in the case of CHS but not in the case of PAL.

  18. Virus-induced silencing of a tobacco deoxyhypusine synthase gene

    Institute of Scientific and Technical Information of China (English)

    WANG Hongzhi; MA Rongcai; LI Ruifen; WANG Guoying; WEI Jianhua

    2005-01-01

    A cDNA fragment corresponding to deoxyhypusine synthase gene NbDHS was isolated and cloned into potato virus X (PVX) vector for functional analysis in Nicotiana benthamiana by using virus-induced gene silencing (VIGS). Plants agroinfected with recombinant virus vector PVX-NbDHS exhibited an increase in leaf biomass, delay in natural leaf senescence and flowering time, and decrease in leaf chlorophyll content. Semi-quantitative RT-PCR and Northern analysis showed that the transcript level of DHS was significantly lower in PVX-NbDHS infected plants. At the same time, the expression for eIF-5A, the target proteins of DHS in N. benthamiana, was concomitantly suppressed by semi-quantitative RT-PCR and Western analysis. From the phenotypic feature of the infected plants and the reduced expression abundance of DHS and eIF-5A, we concluded that NbDHS plays important roles in plant growth, development and senescence. The possible application of DHS gene in genetic modification of crops and horticultural plants was discussed.

  19. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases.

    Science.gov (United States)

    Shibuya, M; Zhang, H; Endo, A; Shishikura, K; Kushiro, T; Ebizuka, Y

    1999-11-01

    Two new triterpene synthase cDNAs, named as OEW and TRW, were cloned from olive leaves (Olea europaea) and from dandelion roots (Taraxacum officinale), respectively, by the PCR method with primers designed from the conserved sequences found in the known oxidosqualene cyclases. Their ORFs consisted of 2274 bp nucleotides and coded for 758 amino acid long polypeptides. They shared high sequence identity (78%) to each other, while they showed only about 60% identities to the known triterpene synthases LUPI (lupeol synthase clone from Arabidopsis thaliana) and PNY (beta-amyrin synthase clone from Panax ginseng) at amino acid level. To determine the enzyme functions of the translates, they were expressed in an ERG7 deficient yeast mutant. Accumulation of lupeol in the cells of yeast transformants proved both of these clones code for lupeol synthase proteins. An EST (expression sequence tag) clone isolated from Medicago truncatula roots as a homologue of cycloartenol synthase gene, exhibits high sequence identity (75-77%) to these two lupeol synthase cDNAs, suggesting it to be another lupeol synthase clone. Comparatively low identity (approximately 57%) of LUP1 from Arabidopsis thaliana to either one of these clones leaves LUP1 as a distinct clone among lupeol synthases. From these sequence comparisons, now we propose that two branches of lupeol synthase gene have been generated in higher plants during the course of evolution.

  20. The y1 gene of maize codes for phytoene synthase.

    Science.gov (United States)

    Buckner, B; Miguel, P S; Janick-Buckner, D; Bennetzen, J L

    1996-05-01

    The cloned y1 locus of maize was sequenced and found to encode phytoene synthase. Different "wild-type" alleles of the locus were found to differ by the insertion of transposable elements in their promoter and polyA addition regions, and by the length of a CCA tandem repeat series, without any obvious effect on function of the gene. A dominant Y1 ("wild-type") allele was observed to be expressed at highest levels in the seedling but also in the embryo and endosperm. The Mu3 transposable element insertion responsible for a pastel allele of y1, which gives lowered levels of carotenoids in the endosperm of kernels and seedlings grown at high temperatures, was located in the 5' end of the gene. Although the size of the transcript from this y1 mutation suggests that the Mu3 element provides the promoter for this allele, leaf tissue in this mutant line contained approximately normal amounts of y1 mRNA. A recessive allele of y1, which conditions normal levels of carotenoids in the embryo and seedling, but almost no carotenoids in the endosperm, was found to accumulate normal amounts of y1 mRNA in the seedling and embryo, while y1 transcripts were not detected in the endosperm.

  1. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    OpenAIRE

    Anam eYousaf; Abdul eQadir; Tehmina eAnjum; Aqeel eAhmad

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four ...

  2. Molecular evolution and functional divergence of soluble starch synthase genes in cassava (manihot esculenta crantz).

    Science.gov (United States)

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes.

  3. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...... of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  4. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  5. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  6. Structure, expression profile and phylogenetic inference of chalcone isomerase-like genes from the narrow-leafed lupin (Lupinus angustifolius L. genome

    Directory of Open Access Journals (Sweden)

    Łucja ePrzysiecka

    2015-04-01

    Full Text Available Lupins, like other legumes, have a unique biosynthesis scheme of 5-deoxy-type flavonoids and isoflavonoids. A key enzyme in this pathway is chalcone isomerase (CHI, a member of CHI-fold protein family, encompassing subfamilies of CHI1, CHI2, CHI-like (CHIL, and fatty acid-binding (FAP proteins. Here, two Lupinus angustifolius (narrow-leafed lupin CHILs, LangCHIL1 and LangCHIL2, were identified and characterized using DNA fingerprinting, cytogenetic and linkage mapping, sequencing and expression profiling. Clones carrying CHIL sequences were assembled into two contigs. Full gene sequences were obtained from these contigs, and mapped in two L. angustifolius linkage groups by gene-specific markers. Bacterial artificial chromosome fluorescence in situ hybridization approach confirmed the localization of two LangCHIL genes in distinct chromosomes. The expression profiles of both LangCHIL isoforms were very similar. The highest level of transcription was in the roots of the third week of plant growth; thereafter, expression declined. The expression of both LangCHIL genes in leaves and stems was similar and low. Comparative mapping to reference legume genome sequences revealed strong syntenic links; however, LangCHIL2 contig had a much more conserved structure than LangCHIL1. LangCHIL2 is assumed to be an ancestor gene, whereas LangCHIL1 probably appeared as a result of duplication. As both copies are transcriptionally active, questions arise concerning their hypothetical functional divergence. Screening of the narrow-leafed lupin genome and transcriptome with CHI-fold protein sequences, followed by Bayesian inference of phylogeny and cross-genera synteny survey, identified representatives of all but one (CHI1 main subfamilies. They are as follows: two copies of CHI2, FAPa2 and CHIL, and single copies of FAPb and FAPa1. Duplicated genes are remnants of whole genome duplication which is assumed to have occurred after the divergence of Lupinus, Arachis

  7. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits

    Energy Technology Data Exchange (ETDEWEB)

    Olson, D.C.; White, J.A.; Edelman, L.; Kende, H. (Michigan State Univ., East Lansing (United States)); Harkins, R.N. (Berlex Biosciences, Alameda, CA (United States))

    1991-06-15

    1-Aminocyclopropane-1-carboxylate synthase is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits. The authors report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5{prime} and 3{prime} ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes.

  8. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  9. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    Science.gov (United States)

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  10. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    OpenAIRE

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e...

  11. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    Science.gov (United States)

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  12. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    Science.gov (United States)

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported.

  13. Genetic control of chalcone isomerase activity in flowers of Dianthus caryophyllus.

    Science.gov (United States)

    Forkmann, G; Dangelmayr, B

    1980-06-01

    In flowers of Dianthus caryophyllus (carnation), the gene I is concerned with a discrete step in flavonoid biosynthesis, Genotypes with recessive (ii) alleles produce yellow flowers, which contain the chalcone isosalipurposide (naringenin-chalcone-2'-glucoside) as the major petal pigment, but in genotypes with wild-type alleles flavonols and anthocyanins can be formed and the flowers are white or red. Enzymatic measurements on petal extracts of four strains with different flower coloration revealed a clear correlation between accumulation of chalcone in recessive genotypes and deficiency of chalcone isomerase (E.C. 5.5.1.6) activity. From the chemogenetic and enzymological evidence it can be concluded that naringenin-chalcone is the first product of the synthesis of the flavonoid skeleton and that only the conversion of naringenin-chalcone to naringenin furnishes the substrate for the further reactions to flavonol and anthocyanin.

  14. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  15. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Science.gov (United States)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  16. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    Filamentous fungi possess an advanced secondary metabolism that is regulated and coordinated in a complex manner depending on environmental challenges. The number of known and putative polyketide synthase genes greatly exceeds the number of polyketides (PKs) that these fungi are known to produce....

  17. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  18. Disruption of homocitrate synthase genes in Candida albicans affects growth but not virulence.

    Science.gov (United States)

    Kur, Krzysztof; Gabriel, Iwona; Morschhäuser, Joachim; Barchiesi, Francesco; Spreghini, Elisabetta; Milewski, Sławomir

    2010-12-01

    Two genes, LYS21 and LYS22, encoding isoforms of homocitrate synthase, an enzyme catalysing the first committed step in the lysine biosynthetic pathway, were disrupted in Candida albicans using the SAT1 flipper strategy. The double null lys21Δ/lys22Δ mutant lacked homocitrate synthase activity and exhibited lysine auxotrophy in minimal media that could be fully rescued by the addition of 0.5-0.6 mM L: -lysine. On the other hand, its virulence in vivo in the model of disseminated murine candidiasis appeared identical to that of the mother, wild-type strain. These findings strongly question a possibility of exploitation of homocitrate synthase and possibly also other enzymes of the lysine biosynthetic pathway as targets in chemotherapy of disseminated fungal infections.

  19. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    Science.gov (United States)

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  20. Morphology engineering of Penicillium chrysogenum by RNA silencing of chitin synthase gene.

    Science.gov (United States)

    Liu, Hui; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai; Zheng, Zhiming

    2013-03-01

    Chitin synthases, that catalyze the formation of chitin the major component of cell walls in most filamentous fungi, play crucial roles in the growth and morphogenesis. To investigate the roles of chitin synthase in Penicillium chrysogenum, we developed an RNAi system to silence the class III chitin synthase gene chs4. After transformation, mutants had a slow growth rate and shorter but highly branched hyphae. All transformants either were unable to form conidia or could form only a few. Changes in chs4 expression could lead to a completely different morphology and eventually cause distinct penicillin yields. In particular, the yield of one transformant was 41 % higher than that of the original strain.

  1. Stereoselectivity of chalcone isomerase with chalcone derivatives: a computational study.

    Science.gov (United States)

    Yao, Yuan; Zhang, Hui; Li, Ze-Sheng

    2013-11-01

    Chalcone isomerase (CHI) catalyzes the intramolecular cyclization of chalcones into flavonoids. The activity of CHI is essential for the biosynthesis of flavonoids precursors of floral pigments and phenylpropanoid plant defense compounds. In the present study, we explored the detailed binding structures and binding free energies for two different active site conformations of CHI with s-cis/s-trans conformers of three chalcone compounds by performing molecular dynamics (MD) simulations and binding free energy calculations. The computational results indicate that s-cis/s-trans conformers of chalcone compounds are orientated in the similar binding position in the active site of CHI and stabilized by the different first hydrogen bond network and the same second hydrogen bond network. The first hydrogen bond network results in much lower binding affinity of s-trans conformer of chalcone compound with CHI than that of s-cis conformer. The conformational change of the active site residue T48 from indirectly interacting with the substrate via the second hydrogen bond network to directly forming the hydrogen bond with the substrates cannot affect the binding mode of both conformers of chalcone compounds, but remarkably improves the binding affinity. These results show that CHI has a strong stereoselectivity. The calculated binding free energies for three chalcone compounds with CHI are consistent with the experimental activity data. In addition, several valuable insights are suggested for future rational design and discovery of high-efficiency mutants of CHI.

  2. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  4. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  5. Expression pattern of the coparyl diphosphate synthase gene in developing rice anthers.

    Science.gov (United States)

    Fukuda, Ari; Nemoto, Keisuke; Chono, Makiko; Yamaguchi, Shinjiro; Nakajima, Masatoshi; Yamagishi, Junko; Maekawa, Masahiko; Yamaguchi, Isomaro

    2004-08-01

    Rice anthers contain high concentrations of gibberellins A(4) and A(7). To understand their physiological roles, we examined the site of their biosynthesis by analyzing the expression pattern of a gene (OsCPS) encoding coparyl diphosphate synthase in developing rice flowers. Expression was apparent in the anthers 1-2 days before flowering, and CPS mRNA accumulated in the maturing pollen.

  6. Polymorphisms in Chlamydia trachomatis tryptophan synthase genes differentiate between genital and ocular isolates

    Science.gov (United States)

    Caldwell, Harlan D.; Wood, Heidi; Crane, Debbie; Bailey, Robin; Jones, Robert B.; Mabey, David; Maclean, Ian; Mohammed, Zeena; Peeling, Rosanna; Roshick, Christine; Schachter, Julius; Solomon, Anthony W.; Stamm, Walter E.; Suchland, Robert J.; Taylor, Lacey; West, Sheila K.; Quinn, Tom C.; Belland, Robert J.; McClarty, Grant

    2003-01-01

    We previously reported that laboratory reference strains of Chlamydia trachomatis differing in infection organotropism correlated with inactivating mutations in the pathogen’s tryptophan synthase (trpBA) genes. Here, we have applied functional genomics to extend this work and find that the paradigm established for reference serovars also applies to clinical isolates — specifically, all ocular trachoma isolates tested have inactivating mutations in the synthase, whereas all genital isolates encode a functional enzyme. Moreover, functional enzyme activity was directly correlated to IFN-γ resistance through an indole rescue mechanism. Hence, a strong selective pressure exists for genital strains to maintain a functional synthase capable of using indole for tryptophan biosynthesis. The fact that ocular serovars (serovar B) isolated from the genital tract were found to possess a functional synthase provided further persuasive evidence of this association. These results argue that there is an important host-parasite relationship between chlamydial genital strains and the human host that determines organotropism of infection and the pathophysiology of disease. We speculate that this relationship involves the production of indole by components of the vaginal microbial flora, allowing chlamydiae to escape IFN-γ–mediated eradication and thus establish persistent infection. PMID:12782678

  7. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  8. Six new chalcones from Angelica keiskei inducing adiponectin production in 3T3-L1 adipocytes.

    Science.gov (United States)

    Ohnogi, Hiromu; Kudo, Yoko; Tahara, Kenichi; Sugiyama, Katsumi; Enoki, Tatsuji; Hayami, Shoko; Sagawa, Hiroaki; Tanimura, Yuko; Aoi, Wataru; Naito, Yuji; Kato, Ikunoshin; Yoshikawa, Toshikazu

    2012-01-01

    Angelica keiskei (Ashitaba in Japanese), a traditional herb in Japan, contains abundant prenylated chalcones. It has been reported that the chalcones from A. keiskei showed such bioactivities as anti-bacterial, anti-cancer and anti-diabetic effects. Xanthoangelol, 4-hydroxyderricin and six new chalcones were isolated in this study from an ethanol extract of A. keiskei by octadecyl silyl (ODS) and silica gel chromatography, and identified by 1D- and 2D-nuclear magnetic resonance (NMR) and high-resolution mass spectrometric analyses. The chalcones from A. keiskei markedly increased the expression of the adiponectin gene and the production of adiponectin in 3T3-L1 adipocytes. These results suggest that the chalcones from A. keiskei might be useful for preventing the metabolic syndrome.

  9. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Science.gov (United States)

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells.

  10. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    Science.gov (United States)

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  11. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  12. Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors.

    Directory of Open Access Journals (Sweden)

    Jennifer Alcaíno

    Full Text Available The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20 in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5 and dimethylallyl pyrophosphate (DMAPP, C5 was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15 synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10 from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to

  13. Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors.

    Science.gov (United States)

    Alcaíno, Jennifer; Romero, Ignacio; Niklitschek, Mauricio; Sepúlveda, Dionisia; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor

    2014-01-01

    The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20) in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5) and dimethylallyl pyrophosphate (DMAPP, C5) was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15) synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10) from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to favor

  14. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  15. Cytotoxic and apoptotic effects of chalcone derivatives of 2-acetyl thiophene on human colon adenocarcinoma cells.

    Science.gov (United States)

    de Vasconcelos, Alana; Campos, Vinicius Farias; Nedel, Fernanda; Seixas, Fabiana Kömmling; Dellagostin, Odir A; Smith, Kevin R; de Pereira, Cláudio Martin Pereira; Stefanello, Francieli Moro; Collares, Tiago; Barschak, Alethéa Gatto

    2013-06-01

    Recent studies report that chalcones exhibit cytotoxicity to human cancer cell lines. Typically, the form of cell death induced by these compounds is apoptosis. In the context of the discovery of new anticancer agents and in light of the antitumour potential of several chalcone derivatives, in the present study, we synthesized and tested the cytotoxicity of six chalcone derivatives on human colon adenocarcinoma cells. Six derivatives of 3-phenyl-1-(thiophen-2-yl) prop-2-en-1-one were prepared and characterized on the basis of their (1) H and (13) C NMR spectra. HT-29 cells were treated with synthesized chalcones on two concentrations by three different incubation times. Cells were evaluated by cell morphology, Tetrazolium dye (MTT) colorimetric assay, live/dead, flow cytometry (annexin V) and gene expression analyses to determine the cytotoxic way. Chalcones 3-(4-bromophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C06) and 3-(2-nitrophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C09) demonstrated higher cytotoxicity than other chalcones as shown by cell morphology, live/dead and MTT assays. In addition, C06 induced apoptosis on flow cytometry annexin V assay. These data were confirmed by a decreased expression of anti-apoptotic genes and increased pro-apoptotic genes. Our findings indicate in summary that the cytotoxic activity of chalcone C06 on colorectal carcinoma cells occurs by apoptosis.

  16. Human gene encoding prostacyclin synthase (PTGIS): Genomic organization, chromosomal localization, and promoter activity

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, Chieko; Yabuki, Tomoko; Inoue, Hiroyasu [National Cardiovascular Center Research Institute, Osaka (Japan)] [and others

    1996-09-01

    The prostacyclin synthase gene isolated from human genomic libraries (PTGIS) consists of 10 exons spanning approximately 60 kb. All the splice donor and acceptor sites conform to the GT/AG rule. Genomic Southern blot and fluorescence in situ hybridization analyses revealed that the human prostacyclin synthase gene is present as a single copy per haploid genome and is localized on chromosome 20q13.11-q13.13. The 1.5-kb sequence of the 5{prime} of the translational initiation site contained both GC-rich and pyrimidine-rich regions and consensus sequences of the transcription factor recognition sites such as Sp1, AP-2, the interferon-{gamma} response element, GATA, NF-{kappa}B, the CACCC box, and the glucocorticoid response element. The core binding sequence (GAGACC) of the shear stress responsive element was also found in the 5{prime}-flanking region of the gene. The major product of the primer extension analysis suggested that the transcription of the gene started from the positions around 49 bp upstream of the translational initiation codon. Transient transfection experiments using human aortic and bovine arterial endothelial cells demonstrated that the GC-rich region (positions -145 to -10) possessed a significant promoter activity. The 6-kb downstream sequence of the translational termination codon contained multiple polyadenylation signals, Alu repeat sequences, and the consensus sequence of the primate-repetitive DNA element, MER1. Two sizes of the prostacyclin synthase mRNAs (approximately 6 and 3.3 kb) were detected with the human aorta and lung. RNA blot hybridization analysis using the 3{prime}-untranslated region as probe indicated that the sizes of the 3{prime}-flanking regions were different in the major 6-kb and minor 3.3-kb mRNAs. 54 refs., 7 figs.

  17. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Indian Academy of Sciences (India)

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  18. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Science.gov (United States)

    Li, Meng-Jun; Li, Ai-Qin; Xia, Han; Zhao, Chuan-Zhi; Li, Chang-Sheng; Wan, Shu-Bo; Bi, Yu-Ping; Wang, Xing-Jun

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, beta-ketoacyl-ACP synthase (I, II, III), beta-ketoacyl-ACP reductase, beta-hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  19. Function of resveratrol de- rived from transgenic plant expressing resveratrol synthase gene

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Two genes from grapevine coding for resveratrol synthase, named RS1 and RS2, were cloned by RT-PCR. An Escherichia coli expression vector was constructed by insertion of RS1 into pBV221. A specific protein with the same molecular weight (42 ku) as the resveratrol synthase was expressed and used to prepare the rabbit antiserum. A plant expression vector was constructed by inserting the RS1 gene into pBin438 downstream of the doubled CaMV 35S promoter and TMV-W fragment. PCR-positive transgenic tobacco plants were obtained after transformation with Agrobacterium tumefaciens LBA4404 harboring the plant expression vector. Southern blot analysis demonstrated that the foreign gene was integrated into the tobacco genome. The results of RT-PCR and Western blot indicated that the RS1 gene was transcribed and expressed. Formation of resvera-trol in transgenic tobacco was further determined by thin-layer chromatography of silica gel and HPLC. Increased accumulation of human breast adenocarcinoma cells in G0 and G1 phases of cell cycle was observed in cells treated with resveratrol purified from transgenic tobacco as compared to the untreated cells.

  20. Congenital hyperreninemic hypoaldosteronism unlinked to the aldosterone synthase (CYP11B2) gene.

    Science.gov (United States)

    Kayes-Wandover, K M; Tannin, G M; Shulman, D; Peled, D; Jones, K L; Karaviti, L; White, P C

    2001-11-01

    Isolated hyperreninemic hypoaldosteronism presenting in infancy is usually caused by mutations in the CYP11B2 gene encoding aldosterone synthase. We studied five patients in four unrelated kindreds with hyperreninemic hypoaldosteronism, in whom we were unable to find such mutations. All presented in infancy with failure to thrive, hyponatremia, hyperkalemia, markedly elevated plasma renin activity, and low or inappropriately normal aldosterone levels. All had normal cortisol levels and no signs or symptoms of congenital adrenal hyperplasia. All responded to fludrocortisone treatment. There were no mutations detected in exons or splice junctions of CYP11B2. Linkage of the disorder to CYP11B2 was studied in two unrelated consanguineous patients and in an affected sib pair. The consanguineous patients were each heterozygous for at least one of three polymorphic microsatellite markers near CYP11B2, excluding linkage to CYP11B2. However, linkage of the disease to CYP11B2 could not be excluded in the affected sib pair. Genes involved in the regulation of aldosterone biosynthesis, including those encoding angiotensinogen, angiotensin-converting enzyme, and the AT1 angiotensin II receptor were similarly excluded from linkage. These results demonstrate the existence of an inherited form of hyperreninemic hypoaldosteronism distinct from aldosterone synthase deficiency. The affected gene(s) remain to be determined.

  1. Cloning, Expression and Identification of a New Trehalose Synthase Gene from Thermobifida fusca Genome

    Institute of Scientific and Technical Information of China (English)

    Yu-Tuo WEI; Ri-Bo HUANG; Qi-Xia ZHU; Zhao-Fei LUO; Fu-Shen LU; Fa-Zhong CHEN; Qing-Yan WANG; Kun HUANG; Jian-Zhong MENG; Rong WANG

    2004-01-01

    A new open reading frame in Thermobifida fusca sequenced genome was identified to encode a new trehalose synthase, annotated as "glycosidase" in the GenBank database, by bioinformatics searching and experimental validation. The gene had a length of 1830 bp with about 65% GC content and encoded for a new trehalose synthase with 610 amino acids and deduced molecular weight of 66 kD. The high GC content seemed not to affect its good expression in E. coli BL21 in which the target protein could account for as high as 15% of the total cell proteins. The recombinant enzyme showed its optimal activities at 25 ℃ and pH 6.5 when it converted substrate maltose into trehalose. However it would divert a high proportion of its substrate into glucose when the temperature was increased to 37 ℃, or when the enzyme concentration was high Its activity was not inhibited by 5 mM heavy metals such as Cu2+, Mn2+, and Zn2+ but affected by high concentration of glucose. Blasting against the database indicated that amino acid sequence of this protein had maximal 69% homology with the known trehalose synthases, and two highly conserved segments of the protein sequence were identified and their possible linkage with functions was discussed.

  2. A CELLULOSE SYNTHASE (CESA) GENE FROM THE RED ALGA PORPHYRA YEZOENSIS (RHODOPHYTA)(1).

    Science.gov (United States)

    Roberts, Eric; Roberts, Alison W

    2009-02-01

    The cell walls of Porphyra species, like those of land plants, contain cellulose microfibrils that are synthesized by clusters of cellulose synthase enzymes ("terminal complexes"), which move in the plasma membrane. However, the morphologies of the Porphyra terminal complexes and the cellulose microfibrils they produce differ from those of land plants. To characterize the genetic basis for these differences, we have identified, cloned, and sequenced a cellulose synthase (CESA) gene from Porphyra yezoensis Ueda strain TU-1. A partial cDNA sequence was identified in the P. yezoensis expressed sequence tag (EST) index using a land plant CESA sequence as a query. High-efficiency thermal asymmetric interlaced PCR was used to amplify sequences upstream of the cDNA sequence from P. yezoensis genomic DNA. Using the resulting genomic sequences as queries, we identified additional EST sequences and a full-length cDNA clone, which we named PyCESA1. The conceptual translation of PyCESA1 includes the four catalytic domains and the N- and C-terminal transmembrane domains that characterize CESA proteins. Genomic PCR demonstrated that PyCESA1 contains no introns. Southern blot analysis indicated that P. yezoensis has at least three genomic sequences with high similarity to the cloned gene; two of these are pseudogenes based on analysis of amplified genomic sequences. The P. yezoensis CESA peptide sequence is most similar to cellulose synthase sequences from the oomycete Phytophthora infestans and from cyanobacteria. Comparing the CESA genes of P. yezoensis and land plants may facilitate identification of sequences that control terminal complex and cellulose microfibril morphology.

  3. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  4. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  5. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles.

    Science.gov (United States)

    Piel, Jörn

    2002-10-29

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were cloned from total DNA of Paederus fuscipes beetles, which use this compound for chemical defense. Sequence analysis of the gene cluster and adjacent regions revealed the presence of ORFs with typical bacterial architecture and homologies. The ped cluster, which is present only in beetle specimens with high pederin content, is located on a 54-kb region bordered by transposase pseudogenes and encodes a mixed modular polyketide synthase/nonribosomal peptide synthetase. Notably, none of the modules contains regions with homology to acyltransferase domains, but two copies of isolated monodomain acyltransferase genes were found at the upstream end of the cluster. In line with an involvement in pederin biosynthesis, the upstream cluster region perfectly mirrors pederin structure. The unexpected presence of additional polyketide synthase/nonribosomal peptide synthetase modules reveals surprising insights into the evolutionary relationship between pederin-type pathways in beetles and sponges.

  6. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  7. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  8. Chitin synthase 1 (Chs1) gene sequences of Microsporum equinum and Trichophyton equinum.

    Science.gov (United States)

    Kano, R; Aihara, S; Nakamura, Y; Watanabe, S; Hasegawa, A

    2001-01-05

    Chitin synthase 1 (Chs1) genes from Microsporum equinum and Trichophyton equinum were compared with those of the other dermatophytes. The Chs1 nucleotide sequences of these dermatophytes from horses showed more than 80% similarity to those of Arthroderma benhamiae, A. fulvum, A. grubyi, A. gypseum, A. incruvatum, A. otae, A. simii, A. vanbreuseghemii, Epidermophyton floccosum, T. mentagrophytes var. interdigitale (T. interdigitale), T. rubrum and T. violaceum. Especially high degree of nucleotide sequence similarity of more than 99% was noted between the Chs1 gene fragments of M. equinum and A. otae, and those of T. equinum, T. interdigitale and A. vanbreuseghemii, respectively. The phylogenetic analysis of their sequences revealed that M. equinum was genetically very close to A. otae and T. equinum to A. vanbreuseghemii. A molecular analysis of Chs1 genes will provide useful information for the genetic relatedness of M. equinum and T. equinum and confirm the value of DNA sequencing in identification of these two dermatophytes.

  9. Exploration of geosmin synthase from Streptomyces peucetius ATCC 27952 by deletion of doxorubicin biosynthetic gene cluster.

    Science.gov (United States)

    Singh, Bijay; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-10-01

    Thorough investigation of Streptomyces peucetius ATCC 27952 genome revealed a sesquiterpene synthase, named spterp13, which encodes a putative protein of 732 amino acids with significant similarity to S. avermitilis MA-4680 (SAV2163, GeoA) and S. coelicolor A3(2) (SCO6073). The proteins encoded by SAV2163 and SCO6073 produce geosmin in the respective strains. However, the spterp13 gene seemed to be silent in S. peucetius. Deletion of the doxorubicin gene cluster from S. peucetius resulted in increased cell growth rate along with detectable production of geosmin. When we over expressed the spterp13 gene in S. peucetius DM07 under the control of an ermE* promoter, 2.4 +/- 0.4-fold enhanced production of geosmin was observed.

  10. Molecular cloning and in vitro expression of a silent phenoxazinone synthase gene from Streptomyces lividans.

    Science.gov (United States)

    Madu, A C; Jones, G H

    1989-12-14

    Phenoxazinone synthase (PHS) catalyzes a step in actinomycin D biosynthesis in Streptomyces antibioticus. Two sequences from Streptomyces lividans that hybridize to the phs gene of S. antibioticus have been cloned in Escherichia coli K-12 using the plasmid pBR322. Although there was some similarity in the restriction maps of the two cloned fragments, neither insert appeared to be a direct subset of the other nor of the S. antibioticus phs gene. In vitro expression studies, in a streptomycete coupled transcription-translation system, showed that a 3.98-kb SphI fragment encoded a PHS-related protein. These observations provide additional support for the existence of silent genes for antibiotic production in streptomycetes.

  11. A comparative analysis of the plant cellulose synthase (CesA) gene family.

    Science.gov (United States)

    Holland, N; Holland, D; Helentjaris, T; Dhugga, K S; Xoconostle-Cazares, B; Delmer, D P

    2000-08-01

    CesA genes are believed to encode the catalytic subunit of cellulose synthase. Identification of nine distinct CesA cDNAs from maize (Zea mays) has allowed us to initiate comparative studies with homologs from Arabidopsis and other plant species. Mapping studies show that closely related CesA genes are not clustered but are found at different chromosomal locations in both Arabidopsis and maize. Furthermore, sequence comparisons among the CesA-deduced proteins show that these cluster in groups wherein orthologs are often more similar than paralogs, indicating that different subclasses evolved prior to the divergence of the monocot and dicot lineages. Studies using reverse transcriptase polymerase chain reaction with gene-specific primers for six of the nine maize genes indicate that all genes are expressed to at least some level in all of the organs examined. However, when expression patterns for a few selected genes from maize and Arabidopsis were analyzed in more detail, they were found to be expressed in unique cell types engaged in either primary or secondary wall synthesis. These studies also indicate that amino acid sequence comparisons, at least in some cases, may have value for prediction of such patterns of gene expression. Such analyses begin to provide insights useful for future genetic engineering of cellulose deposition, in that identification of close orthologs across species may prove useful for prediction of patterns of gene expression and may also aid in prediction of mutant combinations that may be necessary to generate severe phenotypes.

  12. Cloning and functional analysis of the second geranylgeranyl diphosphate synthase gene influencing helvolic acid biosynthesis in Metarhizium anisopliae.

    Science.gov (United States)

    Singkaravanit, Suthitar; Kinoshita, Hiroshi; Ihara, Fumio; Nihira, Takuya

    2010-07-01

    A gene (ggs2) having high similarity to the geranylgeranyl diphosphate synthase (GGPP synthase) gene was cloned from Metarhizium anisopliae NAFF635007. The ggs2 gene (1,239-bp open reading frame with no intron) encoded a protein of 412 amino acids, and the transcription occurred only after late log-phase during the growth. Gene disruption of ggs2, performed to clarify the function in M. anisopliae, resulted in decreased GGPP synthase activity together with a slight delay of sporulation. An high performance liquid chromatography (HPLC) comparison of compound profiles between the wild-type strain and the disruptant revealed that a compound was abolished by the ggs2 disruption. Purification and structural elucidation by 1H-NMR and mass spectrometry analyses revealed that the lost compound is helvolic acid. Furthermore, the pathogenicity assay against two species of insect larvae revealed that the ggs2-disruptant possessed much weaker toxicity than the wild-type strain. Based on these results, it was concluded that ggs2 encodes the GGPP synthase influencing the biosynthesis of secondary metabolites in various species, including helvolic acid in M. anisopliae. To the best of our knowledge, this is the first report to identify a GGPP synthase gene related to secondary metabolism in entomopathogenic fungi.

  13. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae: combinatorial expression of the five PRS genes in Escherichia coli.

    Science.gov (United States)

    Hove-Jensen, Bjarne

    2004-09-24

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no detectable PRPP synthase activity. In contrast PRPP could be detected in growing cells containing PRS1 PRS2, PRS1 PRS3, PRS5 PRS2, or PRS5 PRS4. These apparent conflicting results indicate that, apart from the PRS1 PRS3-specified enzyme, PRS-specified enzyme is functional in vivo but unstable when released from the cell. Certain combinations of three PRS genes appeared to produce an enzyme that is stable in vitro. Thus, extracts of strains harboring PRS1 PRS2 PRS5, PRS1 PRS4 PRS5, or PRS2 PRS4 PRS5 as well as extracts of strains harboring combinations with PRS1 PRS3 contained readily assayable PRPP synthase activity. The data indicate that although certain pairwise combinations of subunits produce an active enzyme, yeast PRPP synthase requires at least three different subunits to be stable in vitro. The activity of PRPP synthases containing subunits 1 and 3 or subunits 1, 2, and 5 was found to be dependent on Pi, to be temperature-sensitive, and inhibited by ADP.

  14. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  15. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  16. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    Science.gov (United States)

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  17. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  18. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Indian Academy of Sciences (India)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  19. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    Science.gov (United States)

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  20. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    Science.gov (United States)

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  1. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    Science.gov (United States)

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  2. Morphological changes induced by class III chitin synthase gene silencing could enhance penicillin production of Penicillium chrysogenum.

    Science.gov (United States)

    Liu, Hui; Zheng, Zhiming; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai

    2013-04-01

    Chitin synthases catalyze the formation of β-(1,4)-glycosidic bonds between N-acetylglucosamine residues to form the unbranched polysaccharide chitin, which is the major component of cell walls in most filamentous fungi. Several studies have shown that chitin synthases are structurally and functionally divergent and play crucial roles in the growth and morphogenesis of the genus Aspergillus although little research on this topic has been done in Penicillium chrysogenum. We used BLAST to find the genes encoding chitin synthases in P. chrysogenum related to chitin synthase genes in Aspergillus nidulans. Three homologous sequences coding for a class III chitin synthase CHS4 and two hypothetical proteins in P. chrysogenum were found. The gene which product showed the highest identity and encoded the class III chitin synthase CHS4 was studied in detail. To investigate the role of CHS4 in P. chrysogenum morphogenesis, we developed an RNA interference system to silence the class III chitin synthase gene chs4. After transformation, mutants exhibited a slow growth rate and shorter and more branched hyphae, which were distinct from those of the original strain. The results also showed that the conidiation efficiency of all transformants was reduced sharply and indicated that chs4 is essential in conidia development. The morphologies of all transformants and the original strain in penicillin production were investigated by light microscopy, which showed that changes in chs4 expression led to a completely different morphology during fermentation and eventually caused distinct penicillin yields, especially in the transformants PcRNAi1-17 and PcRNAi2-1 where penicillin production rose by 27 % and 41 %, respectively.

  3. Analysis of the relationship between Chalcone Isomerase gene expression level and rutin production in Ficus deltoidea var. deltoidea and F. deltoidea var. angustifolia

    Science.gov (United States)

    Najid, Najihah Mohd; Zain, Che Radziah Che Mohd; Zainal, Zamri

    2016-11-01

    Ficus deltoidea (moraceae) is a herbal plant with medicinal values. Previous studies reported that the F. deltoidea contains a high level of bioactive compounds such as flavonoids. A cDNA encodes for chalcone isomerase was identified from F. deltoidea, designated as FdCHI, which involved in the isomerization of naringenin chalcone to naringenin. Naringenin is a key branch point for the synthesis of rutin, which is believed involved in defense mechanism in the plant. Therefore, we hypothesized that there might be a direct relationship between FdCHI expression level and rutin production in leaves of F. deltoidea var. deltoidea (FDD) and F. deltoidea var. angustifolia (FDA). Our result showed that expression level of FdCHI in leaves FDD was greater than FDA. Analysis of High Performance Liquid Chromatography (HPLC) revealed that rutin was only detected in FDA leaves. Based on the results between FdCHI expression and rutin production, this study concluded that there is no relationship between FdCHI expression and rutin production in leaves of FDA and FDD.

  4. Heterocyclic chalcone analogues as potential anticancer agents.

    Science.gov (United States)

    Sharma, Vikas; Kumar, Vipin; Kumar, Pradeep

    2013-03-01

    Chalcones, aromatic ketones and enones acting as the precursor for flavonoids such as Quercetin, are known for their anticancer effects. Although, parent chalcones consist of two aromatic rings joined by a three-carbon α,β-unsaturated carbonyl system, various synthetic compounds possessing heterocyclic rings like pyrazole, indole etc. are well known and proved to be effective anticancer agents. In addition to their use as anticancer agents in cancer cell lines, heterocyclic analogues are reported to be effective even against resistant cell lines. In this connection, we hereby highlight the potential of various heterocyclic chalcone analogues as anticancer agents with a brief summary about therapeutic potential of chalcones, mechanism of anticancer action of various chalcone analogues, and current and future prospects related to the chalcones-derived anticancer research. Furthermore, some key points regarding chalcone analogues have been reviewed by analyzing their medicinal properties.

  5. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  6. Mutant acetolactate synthase (ALS) gene as a selectable marker for Agrobacterium-mediated transformation of soybean

    Institute of Scientific and Technical Information of China (English)

    Chen Shiyun; Zhang Yong

    2006-01-01

    Soybean is one of the crops most difficult to be manipulated in vitro. Although several soybean transformation systems with different selectable marker genes have been reported, e.g. antibiotic (kanamycin or hygromycin) resistant genes and herbicide ( glufosinate, glyphosate) resistant selectable marker genes, all the selectable markers used were from bacteria origin. To find suitable selectable marker gene from plant origin for soybean transformation, a mutant acetolactate synthase (ALS) gene from Arabidopsis thaliana was tested for Agrobacterium-mediated soybean embryo axis transformation with the herbicide Arsenal as the selective agent. Transgenic soybean plants were obtained after the herbicide selection and the To transgenic lines showed resistance to the herbicide at a concentration of 100 g/ha. ALS enzyme assay of To transgenic line also showed higher activity compared to the wild type control plant.PCR analysis of the T1 transgenic lines confirmed the integration and segregation of the transgene. Taken together, our results showed that the mutant ALS gene is a suitable selectable marker for soybean transformation.

  7. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    Science.gov (United States)

    Kondrák, Mihály; Marincs, Ferenc; Kalapos, Balázs; Juhász, Zsófia; Bánfalvi, Zsófia

    2011-01-01

    Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1) gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  8. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    Directory of Open Access Journals (Sweden)

    Mihály Kondrák

    Full Text Available Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1 gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  9. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    Science.gov (United States)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  10. Characterization of a Chitin Synthase Encoding Gene and Effect of Diflubenzuron in Soybean Aphid, Aphis Glycines

    Directory of Open Access Journals (Sweden)

    Raman Bansal, M. A. Rouf Mian, Omprakash Mittapalli, Andy P. Michel

    2012-01-01

    Full Text Available Chitin synthases are critical enzymes for synthesis of chitin and thus for subsequent growth and development in insects. We identified the cDNA of chitin synthase gene (CHS in Aphis glycines, the soybean aphid, which is a serious pest of soybean. The full-length cDNA of CHS in A. glycines (AyCHS was 5802 bp long with an open reading frame of 4704 bp that encoded for a 1567 amino acid residues protein. The predicted AyCHS protein had a molecular mass of 180.05 kDa and its amino acid sequence contained all the signature motifs (EDR, QRRRW and TWGTR of chitin synthases. The quantitative real-time PCR (qPCR analysis revealed that AyCHS was expressed in all major tissues (gut, fat body and integument; however, it had the highest expression in integument (~3.5 fold compared to gut. Interestingly, the expression of AyCHS in developing embryos was nearly 7 fold higher compared to adult integument, which probably is a reflection of embryonic molts in hemimetabolus insects. Expression analysis in different developmental stages of A. glycines revealed a consistent AyCHS expression in all stages. Further, through leaf dip bioassay, we tested the effect of diflubenzuron (DFB, Dimilin ®, a chitin-synthesis inhibitor, on A. glycines' survival, fecundity and body weight. When fed with soybean leaves previously dipped in 50 ppm DFB solution, A. glycines nymphs suffered significantly higher mortality compared to control. A. glycines nymphs feeding on diflubenzuron treated leaves showed a slightly enhanced expression (1.67 fold of AyCHS compared to nymphs on untreated leaves. We discussed the potential applications of the current study to develop novel management strategies using chitin-synthesis inhibitors and using RNAi by knocking down AyCHS expression.

  11. Tissue specificity and diurnal change in gene expression of the sucrose phosphate synthase gene family in rice.

    Science.gov (United States)

    Okamura, Masaki; Aoki, Naohiro; Hirose, Tatsuro; Yonekura, Madoka; Ohto, Chikara; Ohsugi, Ryu

    2011-08-01

    The rice genome contains 5 isogenes for sucrose phosphate synthase (SPS), the key enzyme in sucrose synthesis; however, little is known about their transcriptional regulation. In order to determine the expression patterns of the SPS gene family in rice plants, we conducted an expression analysis in various tissues and developmental stages by real-time quantitative RT-PCR. At the transcript level, the rice SPS genes, particularly SPS1, were preferentially expressed in source tissues, whereas SPS2, SPS6, and SPS8 were expressed equally in source and sink tissues. We also investigated diurnal changes in SPS gene expression, SPS activity, and soluble sugar content in leaf blades. Interestingly, the expression of all the SPS genes, particularly that of SPS1 and SPS11, tended to be higher at night when the activation state of the SPS proteins was low, and the mRNA levels of SPS1 and SPS6 were negatively correlated with sucrose content. Furthermore, the temporal patterns of SPS gene expression and sugar content under continuous light conditions suggested the involvement of endogenous rhythm and/or sucrose sensing in the transcriptional regulation of SPS genes. Our data revealed differential expression patterns in the rice SPS gene family and part of the complex mechanisms of their transcriptional control.

  12. Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit.

    Science.gov (United States)

    Aluru, Maneesha R; Mazourek, Michael; Landry, Laurie G; Curry, Jeanne; Jahn, Molly; O'Connell, Mary A

    2003-07-01

    The biosynthesis of capsaicinoids in the placenta of chilli fruit is modelled to require components of the fatty acid synthase (FAS) complex. Three candidate genes for subunits in this complex, Kas, Acl, and Fat, isolated based on differential expression, were characterized. Transcription of these three genes was placental-specific and RNA abundance was positively correlated with degree of pungency. Kas and Acl were mapped to linkage group 1 and Fat to linkage group 6. None of the genes is linked to the pungency locus, C, on linkage group 2. KAS accumulation was positively correlated with pungency. Western blots of placental extracts and histological sections both demonstrated that the accumulation of this enzyme was correlated with fruit pungency and KAS was immunolocalized to the expected cell layer, the placental epidermis. Enzyme activity of the recombinant form of the placental-specific KAS was confirmed using crude cell extracts. These FAS components are fruit-specific members of their respective gene families. These genes are predicted to be associated with Capsicum fruit traits, for example, capsaicinoid biosynthesis or fatty acid biosynthesis necessary for placental development.

  13. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    Science.gov (United States)

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5.

  14. The cellulose synthase (CESA) gene superfamily of the moss Physcomitrella patens.

    Science.gov (United States)

    Roberts, Alison W; Bushoven, John T

    2007-01-01

    The CESA gene superfamily of Arabidopsis and other seed plants comprises the CESA family, which encodes the catalytic subunits of cellulose synthase, and eight families of CESA-like (CSL) genes whose functions are largely unknown. The CSL genes have been proposed to encode processive beta-glycosyl transferases that synthesize noncellulosic cell wall polysaccharides. BLAST searches of EST and shotgun genomic sequences from the moss Physcomitrella patens (Hedw.) B.S.G. were used to identify genes with high similarity to vascular plant CESAs, CSLAs, CSLCs, and CSLDs. However, searches using Arabidopsis CSLBs, CSLEs, and CSLGs or rice CSLFs or CSLHs as queries identified no additional CESA superfamily members in P. patens, indicating that this moss lacks representatives of these families. Intron insertion sites are highly conserved between Arabidopsis and P. patens in all four shared gene families. However, phylogenetic analysis strongly supports independent diversification of the shared families in mosses and vascular plants. The lack of orthologs of vascular plant CESAs in the P. patens genome indicates that the divergence of mosses and vascular plants predated divergence and specialization of CESAs for primary and secondary cell wall syntheses and for distinct roles within the rosette terminal complexes. In contrast to Arabidopsis, the CSLD family is highly represented among P. patens ESTs. This is consistent with the proposed function of CSLDs in tip growth and the central role of tip growth in the development of the moss protonema.

  15. Gene expression of two kinds of constitutive nitric oxide synthase in injured spinal cord tissue

    Institute of Scientific and Technical Information of China (English)

    刘成龙; 靳安民; 周初松; 闵少雄

    2002-01-01

    Objective: To investigate the gene expression of two kinds of constitutive nitric oxide synthase (cNOS): neuronal NOS (nNOS) and endothelial NOS (eNOS) in injured spinal cord tissue.   Methods: Thirty-six adult Sprague-Dawley rats were divided randomly into six groups: the normal group and the injury groups (2, 6, 12, 24, 48 h after injury, respectively). A compression injury model of the spinal cord was made and gene expression of nNOS and eNOS were examined by reverse transcription polymerase chain reaction (RT-PCR).   Results: The gene expression of nNOS and eNOS was detected in the normal group and they were up-regulated quickly after injury, reaching the maximum at 6 h. There was no difference between gene expression of nNOS and eNOS in the normal group, but in each injury group the gene expression of eNOS was much higher than that of nNOS.   Conclusions: Expression of constitutive NOS (cNOS) in spinal cord tissue was up-regulated after injury mainly in the early stage. cNOS as a whole offers protection in spinal cord injury, but different cNOS may play different roles.

  16. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    Science.gov (United States)

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  17. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  18. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    Science.gov (United States)

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  19. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  20. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Directory of Open Access Journals (Sweden)

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  1. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    Science.gov (United States)

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  2. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  3. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii.

  4. Heteroexpression of the wheat phytochelatin synthase gene (TaPCS1) in rice enhances cadmium sensitivity

    Institute of Scientific and Technical Information of China (English)

    Feijuan Wang; Zhubing Wang; Cheng Zhu

    2012-01-01

    Phytochelatin synthase (PCS) (EC 2.3.2.15) catalyzes the final step of phytochelatins (PCs) biosynthesis.PCs are a family of cysteine-rich thiol-reactive and heavy metalbinding peptides that play an important role in sequestration and detoxification of heavy metals in plants.Previous studies have indicated that plants that overexpressed PCS displayed contrasting phenotypes,ranging from enhanced cadmium (Cd) tolerance to Cd hypersensitivity in Arabidopsis thaliana.In this study,the wheat phytochelatin synthase gene,TaPCS1,was heteroexpressed in wildtype rice (Oryza sativa L.,cv.Zhonghua 11) to evaluate the relationship between synthesis of PCs and Cd tolerance in rice.Data showed that the heteroexpression of TaPCS1 in rice enhanced Cd sensitivity and significantly increased Cd accumulation in shoots,but not in roots.Additionally,the PCS line exhibited a much higher content of PCs and non-protein thiols (NPTs) in shoots.Prominent changes in NPT composition led to reduced glutathione pool depletion and higher Cd content in cell organelles in shoots,followed by higher oxidative stress,which might result in Cd sensitivity.Therefore,the heteroexpression of TaPCS1 in rice is capable of increasing Cd accumulation in rice shoots and enhancing Cd sensitivity.

  5. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme.

  6. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  7. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism

    Directory of Open Access Journals (Sweden)

    Lin Yao

    2016-06-01

    Full Text Available Abstract Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669 bp and pksT-2 (7901 bp suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase–acyltransferase domains through Agrobacterium -mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88.

  8. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  9. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  10. Effects of homoeologous wheat starch synthase IIa genes on starch properties.

    Science.gov (United States)

    Shimbata, Tomoya; Ai, Yongfeng; Fujita, Masaya; Inokuma, Takayuki; Vrinten, Patricia; Sunohara, Ai; Saito, Mika; Takiya, Toshiyuki; Jane, Jay-lin; Nakamura, Toshiki

    2012-12-05

    Near-isogenic lines (NILs) of the eight haplotypes of starch synthase IIa (SSIIa) were used to analyze the effects of SSIIa gene dosage on branch chain length, gelatinization, pasting, retrogradation, and enzymatic hydrolysis of starches. Compared to wild-type, the amylopectin of lines missing one or more active SSIIa enzymes had increases in the proportion of short branch chains (DP6-10) and decreases in midlength chains (DP11-24), and the size of these differences depended on the dosage of active SSIIa enzymes. Of the three loci, SSIIa-A1 had the smallest contribution to amylopectin structure and SSIIa-B1 the largest. The different effects of the three SSIIa enzymes on starch properties were also seen in gelatinization, retrogradation, pasting, and enzymatic hydrolysis properties. Such differences in starch properties might be useful in influencing the texture and shelf life of food products.

  11. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  12. Lack of association between endothelial nitric oxide synthase (NOS3 gene polymorphisms and suicide attempts

    Directory of Open Access Journals (Sweden)

    Bousoño Manuel

    2007-07-01

    Full Text Available Abstract Objective The aim of this study is to investigate the association between two polymorphisms of endothelial nitric oxide synthase (NOS3 and suicide attempts. Methods We genotyped 186 suicide attempters and 420 unrelated healthy controls. The following polymorphisms were analysed: T-786C and 27-bp repeat in intron 4. Results No significant differences were found in genotype or in allelic distribution of the aforesaid polymorphisms. There were also no differences in the genotype distribution or allelic frequencies when separately assessing males and females or impulsive and non-impulsive attempters and normal controls. Estimated haplotype frequencies were similar in both groups. Conclusion Our data do not support the hypothesis that genetically determined changes in the NOS3 gene confer increased susceptibility for suicidal behavior.

  13. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.

    2009-01-01

    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the p

  14. Effects of Nephritis No. 3 Recipe on Nitric Oxide, Nitric Oxide Synthase Secreted by Cultured Mesangial Cells in Rats and the Gene Expression of Inducible Nitric Oxide Synthase

    Institute of Scientific and Technical Information of China (English)

    陈志强; 黄怀鹏; 黄文政; 朱小棣; 林清棋

    2003-01-01

    Objective: To explore the effect of the Nephritis No. 3 (N-3) recipe on nitric oxide (NO),nitric oxide synthase (NOS) secreted by cultured mesangial cells (MC) and its gene expression of the inducible nitric oxide synthase (iNOS). Methods: The drug (nephritis No. 3)-containing serum was prepared with serum pharmacological technique, and then was applied to react on mesangial cells cultured in fetal calf serum (FCS) and cells cultured in FCS plus lipopolysaccharide. To observe the secretion of NO and NOS and the gene expression of iNOS by means of RT-PCR. Results: Under the two kinds of culture conditions, the content of NO and NOS in the groups with drug-containing serum were higher than those without drug-containing serum (P<0.05, P<0.01), and the expression of iNOS mRNA was up-regulated too. Conclusion: The N-3 could significantly promote the secretion of NO and NOS and the mRNA expression of iNOS in rats.

  15. Cellulose synthase (CesA) genes in the green alga Mesotaenium caldariorum.

    Science.gov (United States)

    Roberts, Alison W; Roberts, Eric M; Delmer, Deborah P

    2002-12-01

    Cellulose, a microfibrillar polysaccharide consisting of bundles of beta-1,4-glucan chains, is a major component of plant and most algal cell walls and is also synthesized by some prokaryotes. Seed plants and bacteria differ in the structures of their membrane terminal complexes that make cellulose and, in turn, control the dimensions of the microfibrils produced. They also differ in the domain structures of their CesA gene products (the catalytic subunit of cellulose synthase), which have been localized to terminal complexes and appear to help maintain terminal complex structure. Terminal complex structures in algae range from rosettes (plant-like) to linear forms (bacterium-like). Thus, algal CesA genes may reveal domains that control terminal complex assembly and microfibril structure. The CesA genes from the alga Mesotaenium caldariorum, a member of the order Zygnematales, which have rosette terminal complexes, are remarkably similar to seed plant CesAs, with deduced amino acid sequence identities of up to 59%. In addition to the putative transmembrane helices and the D-D-D-QXXRW motif shared by all known CesA gene products, M. caldariorum and seed plant CesAs share a region conserved among plants, an N-terminal zinc-binding domain, and a variable or class-specific region. This indicates that the domains that characterize seed plant CesAs arose prior to the evolution of land plants and may play a role in maintaining the structures of rosette terminal complexes. The CesA genes identified in M. caldariorum are the first reported for any eukaryotic alga and will provide a basis for analyzing the CesA genes of algae with different types of terminal complexes.

  16. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    Institute of Scientific and Technical Information of China (English)

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  17. Cloning of genomic DNA of rice 5-enolpyruvylshikimate 3-phosphate synthase gene and chromosomal localization of the gene

    Institute of Scientific and Technical Information of China (English)

    徐军望; 冯德江; 李旭刚; 常团结; 朱祯

    2002-01-01

    The shikimate pathway enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPs) is the target of nonselective herbicide glyphosate. A partial rice epsps cDNA was generated by RT-PCR with primers designed according to EST sequence in GenBank and used as probe for rice genomic library screening. In a screen of approximately 8.0×104 clones from the rice genomic library, sixteen positive clones were obtained, which strongly hybridized to the probe. One clone, E11, was selected for further analysis and the full-length 3661 bp rice epsps genomic sequence was obtained. Sequence analysis and homologous comparison revealed that epsps gene is composed of 8 exons and 7 introns. Analysis by restriction fragment length polymorphism with the probe of rice epsps cDNA fragment confirmed that rice epsps is located on chromosome 6 with an indica-japonica (ZYQ8-JX17) double-haploid (DH) population. This is the first report on the EPSP synthase from monocotyledons.

  18. Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate.

    Science.gov (United States)

    Wang, Jian-Rong; Lin, Jun-Fang; Guo, Li-Qiong; You, Lin-Feng; Zeng, Xian-Lu; Wen, Jia-Ming

    2014-02-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate to give presqualene diphosphate and the subsequent rearrangement to form squalene. The gene encoding squalene synthase was cloned from Poria cocos by degenerate PCR and inverse PCR. The open reading frame of the gene is 1,497 bp, which encodes 499 amino acid residues. A phylogenetic analysis revealed that P. cocos SQS belonged to the fungus group, and was more closely related to the SQS of Ganoderma lucidum than other fungi. The treatment of P. cocos with methyl jasmonate (MeJA) significantly enhanced the transcriptional level of P. cocos sqs gene and the content of squalene in P. cocos. The transcriptional level of sqs gene was approximately fourfold higher than the control sample and the squalene content reached 128.62 μg/g, when the concentration of MeJA was 300 μM after 72 h induction.

  19. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C;

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...

  20. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    Science.gov (United States)

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  1. Homologous recombination and gene replacement at the dihydrofolate reductase-thymidylate synthase locus in Toxoplasma gondii.

    Science.gov (United States)

    Donald, R G; Roos, D S

    1994-02-01

    To investigate the feasibility of genomic transgene expression and gene targeting in Toxoplasma gondii, parasites have been transfected with constructs differing in the length of contiguous genomic sequence spanning the dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. We have previously reported that vectors derived from a DHFR-TS cDNA 'minigene' containing mutations in the DHFR coding sequence confer pyrimethamine resistance to transfected parasites (Donald and Roos, 1993). Stably resistant parasite clones arise at high frequency, generally by virtue of transgene integration into parasite chromosomes at locations scattered throughout the genome. In contrast, using a vector which contains 8 kb of contiguous genomic sequence (vs. homologous recombination. Homologous recombination appears to occur at even higher frequency when a 16 kb genomic clone is used. Circular plasmids were more efficient than linearized molecules at producing homologous recombination in this system, integrating by reciprocal crossing-over to produce a duplication of the DHFR-TS locus. Double crossing-over (or gene conversion) was also observed at low frequency, resulting in complete allelic replacement in this haploid stage of the parasite. The ability to produce either homologous or non-homologous recombinants, by the selection of appropriate transformation constructs, has considerable genetic potential.

  2. Gene expression of inducible nitric oxide synthase in injured spinal cord tissue

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: To investigate gene expression of inducible nitric oxide synthase (iNOS) in injured spinal cord tissue of rats.Methods: Thirty-six adult Sprague-Dawley rats were divided randomly into six groups: a normal group and five injury groups, six animals in each group. Animals in the injury groups were killed at 2, 6, 12, 24, 48 hours after injury, respectively. A compression injury model of spinal cord was established according to Nystrom B et al, and gene expression of iNOS in spinal cord tissue was examined by means of reverse transcription polymerase chain reaction (RT-PCR).Results: Gene expression of iNOS was not detectable in normal spinal cord tissue but was seen in the injury groups. The expression was gradually up-regulated, reaching the maximum at 24 hours. The expression at 48hours began to decrease but was still significantly higher than that at 2 hours.Conclusions: iNOS is not involved in the normal physiological activities of spinal cord. Expression of iNOS is up-regulated in spinal cord tissue in response to injury and the up-regulation exists mainly in the late stage after injury. Over-expression of iNOS may contribute to the late injury of spinal cord.

  3. Cloning and characterization of farnesyl diphosphate synthase gene involved in triterpenoids biosynthesis from Poria cocos.

    Science.gov (United States)

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-12-02

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  4. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  5. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  6. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans(+5). The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans(+5) and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  7. Natural biocombinatorics in the polyketide synthase genes of the actinobacterium Streptomyces avermitilis.

    Directory of Open Access Journals (Sweden)

    Holger Jenke-Kodama

    2006-10-01

    Full Text Available Modular polyketide synthases (PKSs of bacteria provide an enormous reservoir of natural chemical diversity. Studying natural biocombinatorics may aid in the development of concepts for experimental design of genes for the biosynthesis of new bioactive compounds. Here we address the question of how the modularity of biosynthetic enzymes and the prevalence of multiple gene clusters in Streptomyces drive the evolution of metabolic diversity. The phylogeny of ketosynthase (KS domains of Streptomyces PKSs revealed that the majority of modules involved in the biosynthesis of a single compound evolved by duplication of a single ancestor module. Using Streptomyces avermitilis as a model organism, we have reconstructed the evolutionary relationships of different domain types. This analysis suggests that 65% of the modules were altered by recombinational replacements that occurred within and between biosynthetic gene clusters. The natural reprogramming of the biosynthetic pathways was unambiguously confined to domains that account for the structural diversity of the polyketide products and never observed for the KS domains. We provide examples for natural acyltransferase (AT, ketoreductase (KR, and dehydratase (DH-KR domain replacements. Potential sites of homologous recombination could be identified in interdomain regions and within domains. Our results indicate that homologous recombination facilitated by the modularity of PKS architecture is the most important mechanism underlying polyketide diversity in bacteria.

  8. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    Institute of Scientific and Technical Information of China (English)

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  9. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  10. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    Science.gov (United States)

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  11. Advances in chalcones with anticancer activities.

    Science.gov (United States)

    Karthikeyan, Chandrabose; Moorthy, Narayana S H Narayana; Ramasamy, Sakthivel; Vanam, Uma; Manivannan, Elangovan; Karunagaran, Devarajan; Trivedi, Piyush

    2015-01-01

    Chalcones are naturally occurring compounds exhibiting broad spectrum biological activities including anticancer activity through multiple mechanisms. Literature on anticancer chalcones highlights the employment of three pronged strategies, namely; structural manipulation of both aryl rings, replacement of aryl rings with heteroaryl scaffolds, molecular hybridization through conjugation with other pharmacologically interesting scaffolds for enhancement of anticancer properties. Methoxy substitutions on both the aryl rings (A and B) of the chalcones, depending upon their positions in the aryl rings appear to influence anticancer and other activities. Similarly, heterocyclic rings either as ring A or B in chalcones, also influence the anticancer activity shown by this class of compounds. Hybrid chalcones formulated by chemically linking chalcones to other prominent anticancer scaffolds such as pyrrol[2,1-c][1,4]benzodiazepines, benzothiazoles, imidazolones have demonstrated synergistic or additive pharmacological activities. The successful application of these three pronged strategies for discovering novel anticancer agents based on chalcone scaffold has resulted in many novel and chemically diverse chalcones with potential therapeutic application for many types of cancer. This review summarizes the concerted efforts expended on the design and development of anticancer chalcones recorded in recent literature and also provides an overview of the patents published in this area between 2007 and 2014 (WO2013022951, WO201201745 & US2012029489).

  12. Identification and characterization of three putative genes for 1-aminocyclopropane-1-carboxylate synthase from etiolated mung bean hypocotyl segments.

    Science.gov (United States)

    Botella, J R; Schlagnhaufer, C D; Arteca, R N; Phillips, A T

    1992-02-01

    The polymerase chain reaction (PCR) was used to produce 3 putative clones for ACC synthase from etiolated mung bean (Vigna radiata Rwilcz cv. Berken) hypocotyls. This was accomplished by utilizing genomic DNA from mung bean and degenerate primers made from information derived from highly conserved regions of ACC synthase from different plant tissues. The total length of pMAC-1, pMAC-2 and pMAC-3 are 308, 321, and 326 bp, respectively, all of which code for 68 amino acids. The introns for pMAC-1, pMAC-2 and pMAC-3 are 92, 105, and 110 bp, respectively. The degrees of homology at the DNA level for each of these clones is ca. 80% in their coding region and ca. 50% in their respective introns. This is the first report providing evidence that there are at least 3 genes for ACC synthase in etiolated mung bean.

  13. Association of methionine synthase gene polymorphisms with wool production and quality traits in Chinese Merino population.

    Science.gov (United States)

    Rong, E G; Yang, H; Zhang, Z W; Wang, Z P; Yan, X H; Li, H; Wang, N

    2015-10-01

    Methionine synthase (MTR) plays a crucial role in maintaining homeostasis of intracellular methionine, folate, and homocysteine, and its activity correlates with DNA methylation in many mammalian tissues. Our previous genomewide association study identified that 1 SNP located in the gene was associated with several wool production and quality traits in Chinese Merino. To confirm the potential involvement of the gene in sheep wool production and quality traits, we performed sheep tissue expression profiling, SNP detection, and association analysis with sheep wool production and quality traits. The semiquantitative reverse transcription PCR analysis showed that the gene was differentially expressed in skin from Merino and Kazak sheep. The sequencing analysis identified a total of 13 SNP in the gene from Chinese Merino sheep. Comparison of the allele frequencies revealed that these 13 identified SNP were significantly different among the 6 tested Chinese Merino strains ( < 0.001). Linkage disequilibrium analysis showed that SNP 3 to 11 were strongly linked in a single haplotype block in the tested population. Association analysis showed that SNP 2 to 11 were significantly associated with the average wool fiber diameter and the fineness SD and that SNP 4 to 11 were significantly associated with the CV of fiber diameter trait ( < 0.05). Single nucleotide polymorphism 2 and SNP 5 to 12 were weakly associated with wool crimp. Similarly, the haplotypes derived from these 13 identified SNP were also significantly associated with the average wool fiber diameter, fineness SD, and the CV of fiber diameter ( < 0.05). Our results suggest that is a candidate gene for sheep wool production and quality traits, and the identified SNP might be used in sheep breeding.

  14. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Science.gov (United States)

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients.

  15. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites

    Institute of Scientific and Technical Information of China (English)

    Ya-e ZHAO; Zheng-hang WANG; Yang XU; Ji-ru XU; Wen-yan LIU; Meng WEI; Chu-ying WANG

    2012-01-01

    To our knowledge,few reports on Demodex studied at the molecular level are available at present.In this study our group,for the first time,cloned,sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum,Demodex brevis,and Demodex canis (three isolates from each species) from Xi'an China,by designing specific primers based on the only partial sequence of the CHS gene of D.canis from Japan,retrieved from GenBank.Results show that amplification was successful only in three D.canis isolates and one D.brevis isolate out of the nine Demodex isolates.The obtained fragments were sequenced to be 339 bp for D.canis and 338 bp for D.brevis.The CHS gene sequence similarities between the three Xi'an D.canis isolates and one Japanese D.canis isolate ranged from 99.7% to 100.0%,and those between four D.canis isolates and one D.brevis isolate were 99.1%-99.4%.Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters,according with the traditional classification.Two open reading frames (ORFs) were identified in each CHS gene sequenced,and their corresponding amino acid sequences were located at the catalytic domain.The relatively conserved sequences could be deduced to be a CHS class A gene,which is associated with chitin synthesis in the integument of Demodex mites.

  16. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  17. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  18. Toxicological assessment of Ashitaba Chalcone.

    Science.gov (United States)

    Maronpot, Robert R

    2015-03-01

    The plant Angelica keiskei contains two main physiologically active flavonoid chalcones, 4-hydroxyderricin and xanthoangelol. Known as ashitaba in Japan, powder from the sap is widely consumed for its medicinal properties in Asia as a dietary supplement. Limited previously reported mammalian studies were without evidence of toxicity. GLP studies reported here, including a bacterial reverse mutation assay, a chromosome aberration assay, and an in vivo micronucleus assay are negative for genotoxicity. A GLP- compliant 90-day repeated oral gavage study of ashitaba yellow sap powder containing 8.45% chalcones in Sprague Dawley rats resulted in expected known physiological effects on coagulation parameters and plasma lipids at 300 and 1000 mg/kg/day. Ashitaba-related pathology included a dose-related male rat-specific alpha 2-urinary globulin nephropathy at 100, 300, and 1000 mg/kg/day and jejunal lymphangiectasia in both sexes at 1000 mg/kg/day. All other study parameters and histopathological changes were incidental or not of toxicological concern. Based on these studies ashitaba chalcone powder is not genotoxic with a NOAEL of 300 mg/kg in male and female rats.

  19. Linkage of the human inducible nitric oxide synthase gene to type 1 diabetes.

    Science.gov (United States)

    Johannesen, J; Pie, A; Pociot, F; Kristiansen, O P; Karlsen, A E; Nerup, J

    2001-06-01

    Exposure of human pancreatic islets to a mixture of cytokines induces expression of the inducible nitric oxide synthase (iNOS), impairs beta-cell function, and induces apoptosis. We performed a mutational scanning of all 27 exons of the human NOS2 gene and linkage transmission disequilibrium testing of identified NOS2 polymorphisms in a Danish nationwide type 1 diabetes mellitus (IDDM) family collection. Mutational screening was performed using PCR-amplified exons, followed by single stranded conformation polymorphism and verification of potential polymorphisms by sequencing. The transmission disequilibrium test was performed in an IDDM family material comprising 257 Danish families; 154 families were affected sibling pair families, and 103 families were simplex families. In total, 10 polymorphisms were identified in 8 exons, of which 4 were tested in the family material. A C/T single nucleotide polymorphism in exon 16 resulting in an amino acid substitution, Ser(608)Leu, showed linkage to IDDM in human leukocyte antigen DR3/4-positive affected offspring (P = 0.008; corrected P = 0.024). No other distorted transmission patterns were found for any other tested single nucleotide polymorphism or constructed haplotypes with the exception of those including data from exon 16. In conclusion, linkage of the human NOS2 gene to IDDM in a subset of patients supports a pathogenic role of nitric oxide in human IDDM.

  20. Mutations and polymorphisms in the human N-acetylglutamate synthase (NAGS) gene.

    Science.gov (United States)

    Caldovic, Ljubica; Morizono, Hiroki; Tuchman, Mendel

    2007-08-01

    N-acetylglutamate synthase (NAGS) deficiency, an autosomal recessive disorder, is the last urea cycle disorder for which molecular testing became available. This is the first comprehensive report of 21 mutations that cause NAGS deficiency and of commonly found polymorphisms in the NAGS gene. Five mutations are reported here for the first time. A total of 10 disease-causing mutations are associated with acute neonatal hyperammonemia; the remaining mutations were found in patients with late onset disease. Residual enzymatic activities are included in this report and the deleterious effects of eight mutations were confirmed by expression studies. Mutations in the NAGS gene are distributed throughout its reading frame. No mutations have been found in exon 1, which encodes for the putative mitochondrial targeting signal and variable segment of NAGS. Three polymorphisms have been found. Early, accurate, and specific diagnosis of NAGS deficiency is critical since this condition can be successfully treated with N-carbamylglutamate (NCG, Carbaglu; Orphan Europe). Treatment with NCG should be initiated as soon as a patient is suspected of having NAGS deficiency. Molecular testing represents the most reliable method of diagnosis.

  1. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Science.gov (United States)

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.

  2. Enhanced Cadmium Accumulation in Transgenic Tobacco Expressing the Phytochelatin Synthase Gene of Cynodon dactylon L.

    Institute of Scientific and Technical Information of China (English)

    Jiangchuan Li; Jiangbo Guo; Wenzhong Xu; Mi Ma

    2006-01-01

    Bermudagrass (Cynodon dactylon L. cv. Goldensun) is highly resistant to and accumulates large amounts of cadmium (Cd). A phytochelatin synthase (PCS) cDNA (CdPCS1) was isolated from this grass by rapid amplification of cDNA ends. The putative CdPCS1 protein shared a high homology with PCS from other plants, with 79% homology at the N-terminal and 47% homology at the C-terminal. However, 16 Cys residues were found at the C-terminal of CdPCS1, and among these residues, three positions were different from other PCS proteins. Semiquantitative reverse transcription-polymerase chain reaction analysis showed that Cd stress induced CdPCS1 expression in both roots and leaves in Bermudagrass. We verified that CdPCS1 plays an important role in Cd tolerance in yeast cells by expressing the gene in ABDE1, a Cd-sensitive mutant. CdPCS1 was then introduced into tobacco plants. The phytochelatin level in some transgenic tobacco lines increased 3.88-fold more than in wild type plants and Cd accumulation in these transgenic plants was enhanced 3.21-fold accordingly. The results suggested that CdPCS1 could be used as a gene element for phytoremediation in the future.

  3. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    Science.gov (United States)

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  4. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Science.gov (United States)

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  5. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  6. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Science.gov (United States)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( Pcloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  7. Characterization of the Sesbania rostrata Phytochelatin Synthase Gene: Alternative Splicing and Function of Four Isoforms

    Directory of Open Access Journals (Sweden)

    Zeng-Fu Xu

    2009-07-01

    Full Text Available Phytochelatins (PCs play an important role in detoxification of heavy metals in plants. PCs are synthesized from glutathione by phytochelatin synthase (PCS, a dipeptidyltransferase. Sesbania rostrata is a tropical legume plant that can tolerate high concentrations of Cd and Zn. In this study, the S. rostrata PCS gene (SrPCS and cDNAs were isolated and characterized. Southern blot and sequence analysis revealed that a single copy of the SrPCS gene occurs in the S. rostrata genome, and produces four different SrPCS mRNAs and proteins, SrPCS1-SrPCS4, by alternative splicing of the SrPCS pre-mRNA. The SrPCS1 and SrPCS3 proteins conferred Cd tolerance when expressed in yeast cells, whereas the SrPCS2 and SrPCS4 proteins, which lack the catalytic triad and the N-terminal domains, did not. These results suggested that SrPCS1 and SrPCS3 have potential applications in genetic engineering of plants for enhancing heavy metal tolerance and phytoremediation of contaminated soils.

  8. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    Science.gov (United States)

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  9. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  10. Solvent-Free Synthesis of Chalcones

    Science.gov (United States)

    Palleros, Daniel R.

    2004-01-01

    The synthesis of twenty different chalcones in the absence of solvent is presented. The results indicated that out of the twenty different chalcones investigated seventeen can be obtained in a matter of minutes by mixing the corresponding benzaldehyde and acetophenone in the presence of solid NaOH in a mortar with pestle.

  11. Chalcones: compounds possessing a diversity in applications

    OpenAIRE

    2012-01-01

    Chalcones are a class of α, β- unsaturated carbonyl compounds that form the central core for a variety of naturally occurring biologically active compounds. They exhibit tremendous potential to act as a pharmacological agent. Besides their various pharmacological activities, chalcones have been explored for different optical applications including second harmonic generation materials in non- linear optics, fluorescent probe for sensing different molecules.

  12. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    Institute of Scientific and Technical Information of China (English)

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  13. Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase.

    Science.gov (United States)

    Tan, Fui-Ching; Cheng, Qi; Saha, Kaushik; Heinemann, Ilka U; Jahn, Martina; Jahn, Dieter; Smith, Alison G

    2008-03-01

    UROS (uroporphyrinogen III synthase; EC 4.2.1.75) is the enzyme responsible for the formation of uroporphyrinogen III, the precursor of all cellular tetrapyrroles including haem, chlorophyll and bilins. Although UROS genes have been cloned from many organisms, the level of sequence conservation between them is low, making sequence similarity searches difficult. As an alternative approach to identify the UROS gene from plants, we used functional complementation, since this does not require conservation of primary sequence. A mutant of Saccharomyces cerevisiae was constructed in which the HEM4 gene encoding UROS was deleted. This mutant was transformed with an Arabidopsis thaliana cDNA library in a yeast expression vector and two colonies were obtained that could grow in the absence of haem. The rescuing plasmids encoded an ORF (open reading frame) of 321 amino acids which, when subcloned into an Escherichia coli expression vector, was able to complement an E. coli hemD mutant defective in UROS. Final proof that the ORF encoded UROS came from the fact that the recombinant protein expressed with an N-terminal histidine-tag was found to have UROS activity. Comparison of the sequence of AtUROS (A. thaliana UROS) with the human enzyme found that the seven invariant residues previously identified were conserved, including three shown to be important for enzyme activity. Furthermore, a structure-based homology search of the protein database with AtUROS identified the human crystal structure. AtUROS has an N-terminal extension compared with orthologues from other organisms, suggesting that this might act as a targeting sequence. The precursor protein of 34 kDa translated in vitro was imported into isolated chloroplasts and processed to the mature size of 29 kDa. Confocal microscopy of plant cells transiently expressing a fusion protein of AtUROS with GFP (green fluorescent protein) confirmed that AtUROS was targeted exclusively to chloroplasts in vivo.

  14. Analysis of methionine synthase (rs1805087) gene polymorphism in autism patients in Northern Iran.

    Science.gov (United States)

    Haghiri, Rosa; Mashayekhi, Farhad; Bidabadi, Elham; Salehi, Zivar

    2016-01-01

    Autism is characterized by impairment in reciprocal communication and speech, repetitive behaviors, and social communication. The genetic and environmental factors play roles in the pathogenesis of autism. It was recently shown that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. One of the genes that may be the risk factor for autism is Methionine synthase (MTR). MTR is responsible for the regeneration of methionine from homocysteine. The aim of this study was to analyze the association of MTR A2756G gene polymorphism (rs1805087) and the risk of autism in a population in northern Iran. The prevalence of MTR A2756G polymorphism was determined in 108 children with autism and 130 controls in northern Iran. Genotypes and allele frequencies were determined in patients and controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The prevalence of genotype frequencies of AA, AG and GG in autistic children were 57.41%, 22.22% and 20.37%, respectively, while in controls were 61.54%, 32.31% and 6.15%, respectively. There was significant difference between the MTR polymorphism distribution in control and patient groups. The prevalence of allele frequencies of A and G in autistic children were 0.69 and 0.31, respectively and in controls were 0.78 and 0.22, respectively (P=0.03). The MTR G allele conferred a 1.6-fold increased risk to autism relative to the A allele (95% CI=1.06-2.41, P=0.02). The present study suggests that the G allele of MTR A2756G polymorphism is associated with an increased risk of autism.

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  17. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Science.gov (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  18. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    Science.gov (United States)

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T

    1994-01-01

    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  19. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families

    Energy Technology Data Exchange (ETDEWEB)

    Suchi, Mariko; Mizuno, Haruo; Tsuboi, Takashi [Nagoya City Univ. Medical School (Japan)] [and others

    1997-03-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5{prime}-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a {lambda}EMBL-3 human genomic library and report a single-copy gene spanning {approximately}15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5{prime} flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A- to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A ({nu} = .26) and 440 Gpoly ({nu} = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. 76 refs., 5 figs., 7 tabs.

  20. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    Science.gov (United States)

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  1. A CELLULOSE SYNTHASE (CESA) gene essential for gametophore morphogenesis in the moss Physcomitrella patens.

    Science.gov (United States)

    Goss, Chessa A; Brockmann, Derek J; Bushoven, John T; Roberts, Alison W

    2012-06-01

    In seed plants, different groups of orthologous genes encode the CELLULOSE SYNTHASE (CESA) proteins that are responsible for cellulose biosynthesis in primary and secondary cell walls. The seven CESA sequences of the moss Physcomitrella patens (Hedw.) B. S. G. form a monophyletic sister group to seed plant CESAs, consistent with independent CESA diversification and specialization in moss and seed plant lines. The role of PpCESA5 in the development of P. patens was investigated by targeted mutagenesis. The cesa5 knockout lines were tested for cellulose deficiency using carbohydrate-binding module affinity cytochemistry and the morphology of the leafy gametophores was analyzed by 3D reconstruction of confocal images. No defects were identified in the development of the filamentous protonema or in production of bud initials that normally give rise to the leafy gametophores. However, the gametophore buds were cellulose deficient and defects in subsequent cell expansion, cytokinesis, and leaf initiation resulted in the formation of irregular cell clumps instead of leafy shoots. Analysis of the cesa5 knockout phenotype indicates that a biophysical model of organogenesis can be extended to the moss gametophore shoot apical meristem.

  2. Phytoene Synthase Gene Cloning from Citrus sinensis Osbeck cv.Cara Cara and Its Prokaryotic Expression

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-cheng; TAO Neng-guo; TONG Zhu; DENG Xiu-xin

    2008-01-01

    Using the mRNA from the fruit of Cara Cara as the template,the cDNA of phytoene synthase(PSY)gene was amplified by reverse transcription polymerse chain reaction(RT-PCR).Sequence analysis indicated that the eDNA was of 1 520 bp,which had an open reading frame of 1 308 bp and encoded a protein of 436 amino acids.The homology analysis showed that PSY of Cara Cara shared high similarities of nucleotides and deduced amino acids with those in other plants up to more than 75 and 70%,respectively.A putative signal transit peptide for plastid targeting was found in the N-terminal region of PSY.The mature forms of PSY included a transmembrane(TM) domain.The recombinant plasmid pET-CitPSY was constructed by subeloning the full coding sequence of PSY eDNA into pET-28(+).After transformation of E.coil BL21 and induced by 1 mmol L-1 isopropyl-a-D-thiogalacropyranoside(IPTG),the fusion protein(6×His-PSY)with 52 kD was produced at a high level by prokaryotic expression system.The results of Western blot demonstrated that the fusion protein(6xHis-PSY)could be recognized by anti-6×His monoclonal antibody.The study could establish a basis for molecular improvement of Citrus fruit colors.

  3. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    Science.gov (United States)

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  4. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  5. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    Science.gov (United States)

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  6. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  7. Endothelial nitric oxide synthase gene polymorphism and elite endurance athlete status: the Genathlete study.

    Science.gov (United States)

    Wolfarth, B; Rankinen, T; Mühlbauer, S; Ducke, M; Rauramaa, R; Boulay, M R; Pérusse, L; Bouchard, C

    2008-08-01

    In the Genathlete study, we examined the contribution of three polymorphisms in the endothelial nitric oxide synthase (NOS3) gene to discriminate elite endurance athletes (EEA) from sedentary controls (SC). The EEA group included a total of 316 Caucasian males with a VO2max >75 mL/kg. The SC group comprised 299 unrelated sedentary Caucasian males who had VO2max values below 50 mL/kg. The polymerase chain reaction technique was used to amplify a microsatellite (CA)(n) repeat in intron 13, a 27 bp repeat in intron 4 and a third fragment in exon 7 containing the Glu298Asp SNP. No difference was found between the EEA and SC groups for the 27 bp repeat and the Glu298Asp polymorphism. Chi-square analysis of the overall allelic distribution of the (CA)(n) repeat revealed no significant difference between the two groups (P=0.135). However, comparing carriers and non-carriers for the most common (CA)(n) repeat alleles, we found significant differences between SC and EEA, with more EEA subjects carrying the 164 bp allele (P=0.007). In summary, we found suggestive evidence that the 164 bp allele of the (CA)(n) repeat in intron 13 is associated with EEA status and may account for some of the differences between EEA and SC.

  8. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Institute of Scientific and Technical Information of China (English)

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  9. Clinical Significance of a Myeloperoxidase Gene Polymorphism and Inducible Nitric Oxide Synthase Expression in Cirrhotic Patients with Hepatopulmonary Syndrome

    Institute of Scientific and Technical Information of China (English)

    王燕颖; 王文多; 张艳霞; 赵欣; 杨东亮

    2010-01-01

    The clinical significance of a myeloperoxidase (MPO) gene polymorphism and inducible nitric oxide synthase (iNOS) expression in cirrhotic patients with hepatopulmonary syndrome (HPS) was explored. Enrolled subjects were divided into three groups according to their disease/health conditions: the HPS group (cirrhotic patients with HPS; n=63), the non-HPS group (cirrhotic patients without HPS; n=182), and the control group (healthy subjects without liver disease; n=35). The distribution of the MPO-463 G/A geno...

  10. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    Science.gov (United States)

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  11. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  12. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Institute of Scientific and Technical Information of China (English)

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  13. Late-onset cutaneous porphyria in a patient heterozygous for a uroporphyrinogen III synthase gene mutation.

    Science.gov (United States)

    Aguilera, P; Badenas, C; Whatley, S D; To-Figueras, J

    2016-12-01

    Deficiency of uroporphyrinogen III synthase (UROS) causes congenital erythropoietic porphyria (CEP). The disease, originating from the inheritance of mutations within the UROS gene, presents a recessive form of transmission. In a few patients, a late-onset CEP-like phenotype without UROS mutations appears to be associated with a myelodysplastic syndrome. We report a 60-year-old man with late-onset signs of cutaneous porphyria and accumulation in urine, plasma and faeces of type I porphyrin isomers characteristic of CEP. Analysis of DNA from peripheral leucocytes, skin and bone marrow aspirate showed that he was a heterozygous carrier of a Cys73Arg (c.217 T>C) mutation within UROS. Sequencing of cDNA from peripheral blood confirmed heterozygosity and expression of the normal allele. Measurement of UROS enzymatic activity in erythrocytes showed values ~70% of normal, indirectly indicating expression of the normal allele. Differently from other cases of late-onset uroporphyria, the patient did not present thrombocytopenia or any evidence of a myelodysplastic syndrome. Five years of clinical follow-up showed persistence of skin signs and increased excretion of porphyrins, independently of lifestyle factors or changes in medication regimes. We hypothesize acquired mosaicism (in the bone marrow) affecting the UROS gene. Thus, unstable cellular clones initiated overproduction of isomer I porphyrins leading to a CEP phenotype. This could be explained either by a clonal expansion of the porphyric (Cys73Arg) allele or by loss of function of the normal allele. Cellular turnover would facilitate release of uroporphyrins into circulation and subsequent skin lesions. This is the first case of a CEP heterozygous carrier presenting clinical manifestations.

  14. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Science.gov (United States)

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation.

  15. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  16. Beta-D-glycan synthases and the CesA gene family: lessons to be learned from the mixed-linkage (1-->3),(1-->4)beta-D-glucan synthase.

    Science.gov (United States)

    Vergara, C E; Carpita, N C

    2001-09-01

    Cellulose synthase genes (CesAs) encode a broad range of processive glycosyltransferases that synthesize (1-->4)beta-D-glycosyl units. The proteins predicted to be encoded by these genes contain up to eight membrane-spanning domains and four 'U-motifs' with conserved aspartate residues and a QxxRW motif that are essential for substrate binding and catalysis. In higher plants, the domain structure includes two plant-specific regions, one that is relatively conserved and a second, so-called 'hypervariable region' (HVR). Analysis of the phylogenetic relationships among members of the CesA multi-gene families from two grass species, Oryza sativa and Zea mays, with Arabidopsis thaliana and other dicotyledonous species reveals that the CesA genes cluster into several distinct sub-classes. Whereas some sub-classes are populated by CesAs from all species, two sub-classes are populated solely by CesAs from grass species. The sub-class identity is primarily defined by the HVR, and the sequence in this region does not vary substantially among members of the same sub-class. Hence, we suggest that the region is more aptly termed a 'class-specific region' (CSR). Several motifs containing cysteine, basic, acidic and aromatic residues indicate that the CSR may function in substrate binding specificity and catalysis. Similar motifs are conserved in bacterial cellulose synthases, the Dictyostelium discoideum cellulose synthase, and other processive glycosyltransferases involved in the synthesis of non-cellulosic polymers with (1-->4)beta-linked backbones, including chitin, heparan, and hyaluronan. These analyses re-open the question whether all the CesA genes encode cellulose synthases or whether some of the sub-class members may encode other non-cellulosic (1-->4)beta-glycan synthases in plants. For example, the mixed-linkage (1-->3)(1-->4)beta-D-glucan synthase is found specifically in grasses and possesses many features more similar to those of cellulose synthase than to those of

  17. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  18. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  19. Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

    Science.gov (United States)

    Mizuno, Daichi; Higuchi, Kyoko; Sakamoto, Tatsuya; Nakanishi, Hiromi; Mori, Satoshi; Nishizawa, Naoko K

    2003-08-01

    Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

  20. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  1. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  2. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR.

    Science.gov (United States)

    Obembe, Olawole O; Jacobsen, Evert; Vincken, Jean-Paul; Visser, Richard G F

    2009-01-01

    Two transgenic potato lines, csr2-1 and csr4-8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the proteins of the two CesA genes in the same cellulose synthase enzyme complex. SYBR-Green quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) assays were carried out on four CesA gene transcripts (CesA1, 2, 3, and 4) in the wild type genetic background, and on the two antisense CesA gene transcripts (CesA2 and 4) in the progeny resulting from the cross between the two transgenic potato lines. The quantitative RT-PCR analyses revealed different expression patterns of the two CesA genes. The CesA2 mRNA was shown to be relatively more abundant than CesA4 mRNA, regardless of the genetic background, suggesting that the two proteins are not present in the same enzyme complex.

  3. Lentivirus-mediated gene transfer of uroporphyrinogen III synthase fully corrects the porphyric phenotype in human cells.

    Science.gov (United States)

    Géronimi, F; Richard, E; Lamrissi-Garcia, I; Lalanne, M; Ged, C; Redonnet-Vernhet, I; Moreau-Gaudry, F; de Verneuil, H

    2003-05-01

    Congenital erythropoietic porphyria (CEP) is an inherited disease due to a deficiency in the uroporphyrinogen III synthase, the fourth enzyme of the heme biosynthesis pathway. It is characterized by accumulation of uroporphyrin I in the bone marrow, peripheral blood and other organs. The prognosis of CEP is poor, with death often occurring early in adult life. For severe transfusion-dependent cases, when allogeneic cell transplantation cannot be performed, the autografting of genetically modified primitive/stem cells may be the only alternative. In vitro gene transfer experiments have documented the feasibility of gene therapy via hematopoietic cells to treat this disease. In the present study lentiviral transduction of porphyric cell lines and primary CD34(+) cells with the therapeutic human uroporphyrinogen III synthase (UROS) cDNA resulted in both enzymatic and metabolic correction, as demonstrated by the increase in UROS activity and the suppression of porphyrin accumulation in transduced cells. Very high gene transfer efficiency (up to 90%) was achieved in both cell lines and CD34(+) cells without any selection. Expression of the transgene remained stable over long-term liquid culture. Furthermore, gene expression was maintained during in vitro erythroid differentiation of CD34(+) cells. Therefore the use of lentiviral vectors is promising for the future treatment of CEP patients by gene therapy.

  4. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    Science.gov (United States)

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  5. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Indian Academy of Sciences (India)

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  6. The genome sequence of black cottonwood (Populus trichocarpa) reveals 18 conserved cellulose synthase (CesA) genes.

    Science.gov (United States)

    Djerbi, Soraya; Lindskog, Mats; Arvestad, Lars; Sterky, Fredrik; Teeri, Tuula T

    2005-07-01

    The genome sequence of Populus trichocarpa was screened for genes encoding cellulose synthases by using full-length cDNA sequences and ESTs previously identified in the tissue specific cDNA libraries of other poplars. The data obtained revealed 18 distinct CesA gene sequences in P. trichocarpa. The identified genes were grouped in seven gene pairs, one group of three sequences and one single gene. Evidence from gene expression studies of hybrid aspen suggests that both copies of at least one pair, CesA3-1 and CesA3-2, are actively transcribed. No sequences corresponding to the gene pair, CesA6-1 and CesA6-2, were found in Arabidopsis or hybrid aspen, while one homologous gene has been identified in the rice genome and an active transcript in Populus tremuloides. A phylogenetic analysis suggests that the CesA genes previously associated with secondary cell wall synthesis originate from a single ancestor gene and group in three distinct subgroups. The newly identified copies of CesA genes in P. trichocarpa give rise to a number of new questions concerning the mechanism of cellulose synthesis in trees.

  7. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    Science.gov (United States)

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  8. Nuclear factor YY1 activates the mammalian F0F1 ATP synthase alpha-subunit gene.

    Science.gov (United States)

    Breen, G A; Vander Zee, C A; Jordan, E M

    1996-01-01

    Analysis of the promoters of the bovine and human nuclear-encoded mitochondrial F0F1 ATP synthase alpha-subunit genes (ATPA) has identified several positive cis-acting regulatory regions that are important for basal promoter activity in human HeLa cells. We have previously determined that the binding of a protein factor, termed ATPF1, to an E-box sequence (CANNTG) located within one of these cis-acting regions is critical for transcriptional activation of the ATPA gene. In this article, we describe a second positive cis-acting regulatory element of the ATPA gene that is important for expression of the ATPA gene. We show that this cis-acting element also contains a binding site for a protein present in HeLa cells. On the basis of electrophoretic mobility shift patterns, oligonucleotide competition assays, and immunological cross-reactivity, we conclude that this protein factor is Yin-Yang 1 (YY1). Experiments carried out to examine the functional role of YY1 within the context of the ATPA promoter demonstrated that YY1 acts as a positive regulator of the ATPA gene. For example, when the YY1 binding site of the ATPA promoter was placed upstream of a reporter gene it was found to activate transcription in transient transfection assays. In addition, disruption of the YY1 binding site in the ATPA gene resulted in a loss of transcriptional activity. Furthermore, in cotransfection experiments overexpression of YY1 in trans was found to activate transcription of ATPA promoter-CAT constructs. Thus, at least two positive trans-acting regulatory factors, ATPF1 and YY1, are important for expression of the bovine and human F0F1 ATP synthase alpha-subunit genes.

  9. Chalcones: compounds possessing a diversity in applications

    Directory of Open Access Journals (Sweden)

    Urmila Berar

    2012-10-01

    Full Text Available Chalcones are a class of α, β- unsaturated carbonyl compounds that form the central core for a variety of naturally occurring biologically active compounds. They exhibit tremendous potential to act as a pharmacological agent. Besides their various pharmacological activities, chalcones have been explored for different optical applications including second harmonic generation materials in non- linear optics, fluorescent probe for sensing different molecules.

  10. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  11. Cloning and Expression Analysis of Chalcone Isomerase Gene from Narcissus tazetta var.chinensis%中国水仙查尔酮异构酶基因的克隆与表达分析

    Institute of Scientific and Technical Information of China (English)

    蔡雪玲; 陈晓静; 叶一江; 何玮毅; 申艳红

    2011-01-01

    Chalcone isomerase(CHI)is one of the key enzymes in the biosynthesis pathway of flavonoids and plays an important role in the process of flower color development. Three genes, named NtCHIW, NtCHIJ and NtCHIY respectively, were cloned from Narcissus tazetta var. Chinensis petal by RT-PCR and RACE. The open reading frame encompassed 735 bp encoding a polypeptide of 244 amino acids. Sequencing analysis showed that the amino acid sequence of Baihua Narcissus was 93.03%, 93.44%, 64.75%, 55.42%, 50.58%, 59.43%, and 58.20% homologous with CHI genes from Jinzhanyintai Narcissus, Huanghua Narcissus, Allium cepa, Elaeis oleifera, Vitis labrusca, Oryza saliva Japonica, Arabidopsis thaliana, respectively. The result of real time RT-PCR showed that the transcription expression of CHI gene changed accordingly during flower blooming, indicating the possible role of CHI genes in the change of flower color.%查尔酮异构酶(CHI)是影响类黄酮合成的一个重要限速酶,在植物花色发育过程中起着重要作用.通过RT-PCR和RACE技术从中国水仙的花瓣中克隆得到3条CHI基因,分别命名为NtCHIW、NtCHIJ和NtCHIY.3个基因均含有一个735 bp的开放阅读框(ORF),编码244个氨基酸.氨基酸序列分析表明:白花水仙与金盏银台、黄花水仙、洋葱、粳稻、拟南芥、油棕榈、葡萄相应基因的氨基酸序列同源性分别为93.03%、93.44%、64.75%、55.42%、50.58%、59.43%、58.20%.荧光定量PCR分析表明:随着花开放的过程,中国水仙的CHI基因转录水平发生变化,说明CHI基因可能参与花色变化的过程.

  12. Monoamine oxidase inhibitory activities of heterocyclic chalcones.

    Science.gov (United States)

    Minders, Corné; Petzer, Jacobus P; Petzer, Anél; Lourens, Anna C U

    2015-11-15

    Studies have shown that natural and synthetic chalcones (1,3-diphenyl-2-propen-1-ones) possess monoamine oxidase (MAO) inhibition activities. Of particular importance to the present study is a report that a series of furanochalcones acts as MAO-B selective inhibitors. Since the effect of heterocyclic substitution, other than furan (and more recently thiophene, piperidine and quinoline) on the MAO inhibitory properties of the chalcone scaffold remains unexplored, the aim of this study was to synthesise and evaluate further heterocyclic chalcone analogues as inhibitors of the human MAOs. For this purpose, heterocyclic chalcone analogues that incorporate pyrrole, 5-methylthiophene, 5-chlorothiophene and 6-methoxypyridine substitution were examined. Seven of the nine synthesised compounds exhibited IC50 values chalcones are reversible and competitive MAO inhibitors. 4h, however, may exhibit tight-binding to MAO-B, a property linked to its thiophene moiety. We conclude that high potency chalcones such as 4h represent suitable leads for the development of MAO-B inhibitors for the treatment of Parkinson's disease and possibly other neurodegenerative disorders.

  13. Cloning and Expression Analysis of Key Enzymes Genes in Biosynthesis of Soybean Isoflavones%大豆异黄酮合成关键酶基因的克隆及表达分析

    Institute of Scientific and Technical Information of China (English)

    钱丹丹; 龚德顺; 焦丽; 翟莹; 张海军; 李景文; 王英; 王庆钰

    2011-01-01

    采用RT-PCR法克隆了大豆异黄酮生物合成途径中查尔酮合酶(Chalcone synthase,CHS)和查尔酮异构酶(Chalcone Isomerase,CHI)2个关键酶基因,并利用SOE-PCR技术成功将2个基因融合,将其均构建成原核表达载体,在大肠杆菌中进行了初步的表达研究,为进一步研究CHS和CHI 2种关键酶的功能奠定了基础.同时构建了真核表达载体,采用农杆菌转化法侵染大豆子叶节,获得了转基因抗性植株.%Chalcone Synthase(CHS)and Chalcone Isomerase(CHI) are two key enzymes in soybean isoflavones biosynthesis pathway,the cDNAs of CHS and CHI were cloned using RT-PCR method and these two genes were fused using SOE-PCR,then constructed E. Coli expression vectors to study the expression. The eukaryocyte expression vectors were also constructed and transferred into soybean cotyledonary nodes using Agrobacterium-mediated transformation,and then obtained the resistant trans-genic plants.

  14. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Jeffrey T. Morré; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H. H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  15. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    Indian Academy of Sciences (India)

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  16. Changes of macrovascular endothelial ultrastructure and gene expression of endothelial nitric oxide synthase in diabetic rats

    Institute of Scientific and Technical Information of China (English)

    陆颖理; 胡申江; 沈周俊; 邵一川

    2004-01-01

    Background The most intimidatory pathological changes in patients with DM are cardiovascular illnesses, which are the major causes of death in diabetic patients and are far more prevalent than in nondiabetics because of accelerated atherosclerosis. In this study, we tried to clarify the changes in macrovascular endothelial ultrastructure and in the gene expression of endothelial nitric oxide synthase (eNOS)mRNA in diabetic rats. Methods The study was conducted on 52 of 10-week old Sprague Dawley (SD) rats with body weight of (320±42) g. SD rats were divided into: experimental group treated with a single intraperitoneal injection of streptozotocin (STZ, 60 mg/kg), (male, n=20, diabetes mellitus (DMM)); female, n=12, diabetes mellitus female (DMF)) and control group (male, n=10, diabetes mellitus male control (DMMC); female, n=10, diabetes mellitus female control (DMFC)). Four weeks after treatment, half of the rats were sacrificed; the remainders were sacrificed ten weeks after treatment. One part of the abdominal aortic sample was stored under glutaraldehyde (volume fraction ψB = 2.5 %). After the process of chemical fixation, chemical dehydration, drying and conductivity enhancement, all samples were observed and photographed using scanning electron microscopy (Leica-Stereoscan 260, England). The other part of the abdominal aortic sample was treated with liquid nitrogen and the expression of eNOSmRNA was assessed by semi-quantitative RT-PCR. Results The aortic lumen of both experimental groups adsorbed much more debris than that of either control group. The endothelial surfaces of diabetic rats were coarse, wrinkled and protuberant like fingers or villi. The vascular endothelial lesions of diabetic male rats were very distinct after 4 weeks, and as obvious as those at 10 weeks. The vascular endothelial lesions of diabetic female rats were not severe at 4 weeks and only became marked after 10 weeks. In both males and females, the abdominal aortic eNOSmRNA content

  17. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Institute of Scientific and Technical Information of China (English)

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  18. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  19. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  20. Structural organization of the human neuronal nitric oxide synthase gene (NOS1).

    Science.gov (United States)

    Hall, A V; Antoniou, H; Wang, Y; Cheung, A H; Arbus, A M; Olson, S L; Lu, W C; Kau, C L; Marsden, P A

    1994-12-30

    Neuronal nitric oxide (NO) synthase, localized to human chromosome 12, uniquely participates in diverse biologic processes; neurotransmission, the regulation of body fluid homeostasis, neuroendocrine physiology, control of smooth muscle motility, sexual function, and myocyte/myoblast biology, among others. Restriction enzyme mapping, subcloning, and DNA sequence analysis of bacteriophage- and yeast artificial chromosome-derived human genomic DNA indicated that the mRNA for neuronal NO synthase is dispersed over a minimum of 160 kilobases of human genomic DNA. Analysis of intron-exon splice junctions predicted that the open reading frame is encoded by 28 exons, with translation initiation and termination in exon 2 and exon 29, respectively. Determination of transcription initiation sites in brain poly(A) RNA with primer extension analysis and RNase protection revealed a major start site 28 nucleotides downstream from a TATA box. Sequence inspection of 5'-flanking regions revealed potential cis-acting DNA elements: AP-2, TEF-1/MCBF, CREB/ATF/c-Fos, NRF-1, Ets, NF-1, and NF-kappa B-like sequences. Diversity appears to represent a major theme apparent upon analysis of human neuronal NO synthase mRNA transcripts. A microsatellite of the dinucleotide variety was detected within the 3'-untranslated region of exon 29. Multiple alleles were evident in normal individuals indicating the existence of allelic mRNA sequence variation. Characterization of variant human neuronal NO synthase cDNAs indicated the existence of casette exon 9/10 and exon 10 deletions as examples of structural mRNA diversity due to alternative splicing. The latter deletion of a 175-nucleotide exon introduces a frame-shift and premature stop codon indicating the potential existence of a novel NH2 terminus protein. In summary, analysis of the human neuronal NO synthase locus reveals a complex genomic organization and mRNA diversity that is both allelic and structural.

  1. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    Science.gov (United States)

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  2. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  3. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck Constitutively Overexpressing a Spermidine Synthase Gene

    Directory of Open Access Journals (Sweden)

    Xing-Zheng Fu

    2013-01-01

    Full Text Available Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT and the transgenic line (TG9 by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  4. CHALCONE AS A VERSATILE MOIETY FOR DIVERSE PHARMACOLOGICAL ACTIVITIES

    OpenAIRE

    2012-01-01

    Chalcones are 1, 3-diphenyl-2-propene-1-one, consist of two aromatic rings linked by a three carbon α, β-unsaturated carbonyl system. The chemistry of chalcones has generated intensive scientific studies throughout the world. Especially interest has been focused on the synthesis and biodynamic activities of chalcones. These are considered to be precursors of flavonoids and isoflavonoids. The aim of this review is to summarize chalcones and their diverse pharmacological activities like antican...

  5. ANTIMICROBIAL SCREENING OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    OpenAIRE

    2012-01-01

    Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The derivatives of chalcones with an annular nitrogen atom in the phenyl ring were reported to have a wide range of biologically activities, such as antibacterial, anti-tuberculostatic and anti- inflammatory. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of nove...

  6. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    Science.gov (United States)

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions.

  7. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  8. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies.

  9. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  10. Chalcone Scaffold in Anticancer Armamentarium: A Molecular Insight

    Directory of Open Access Journals (Sweden)

    Manik Das

    2016-01-01

    Full Text Available Cancer is an inevitable matter of concern in the medicinal chemistry era. Chalcone is the well exploited scaffold in the anticancer domain. The molecular mechanism of chalcone at cellular level was explored in past decades. This mini review provides the most recent updates on anticancer potential of chalcones.

  11. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    2016-06-01

    Full Text Available WD40 repeat (WDR proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD. FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed.

  12. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    Institute of Scientific and Technical Information of China (English)

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  13. [Identification and characterization of intraspecific variability of the sucrose synthase gene Sus4 of potato (Solanum tuberosum)].

    Science.gov (United States)

    Boris, K V; Ryzhova, N N; Kochieva, E Z

    2011-02-01

    Nucleotide and amino acid variability of fragments of the Sus4 gene encoding the sucrose synthase enzyme was studied in 24 potato cultivars selected in Russia and other countries and differing in starch content in tubers. Both SNPs and indels were detected in a chosen Sus4 gene fragment including the sequence from exon 3 to exon 6 and corresponding to the main part of the sucrose synthase domain. Four types of Sus4 sequences were revealed depending on the presence of an insertion in introns 4 and 5 and of the mononucleotide octamer (T)8 in intron 5. Differentiation of these sequences was confirmed by statistical methods. Sixteen amino acid substitutions were identified in the translated sequence, of which eleven were nonsynonymous. Specific varietal nucleotide and amino acid substitutions were also revealed, which can be used in future for marking potato cultivars/genotypes. No direct associations between the mutational changes and the starch content were found in the potato cultivars studied by us.

  14. A genomic approach to characterization of the Citrus terpene synthase gene family

    Directory of Open Access Journals (Sweden)

    Marcelo Carnier Dornelas

    2007-01-01

    Full Text Available Terpenes are a very large and structurally diverse group of secondary metabolites which are abundant in many essential oils, resins and floral scents. Additionally, some terpenes have roles as phytoalexins in plant-pathogen relationships, allelopathic inhibitors in plant-plant interactions, or as airborne molecules of plant-herbivore multitrophic signaling. Thus the elucidation of the biochemistry and molecular genetics of terpenoid biosynthesis has paramount importance in any crop species. With this aim, we searched the CitEST database for clusters of expressed sequence tags (ESTs coding for terpene synthases. Herein is a report on the identification and in silico characterization of 49 putative members of the terpene synthase family in diverse Citrus species. The expression patterns and the possible physiological roles of the identified sequences are also discussed.

  15. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Science.gov (United States)

    Komoto, Tatiana Takahasi; Bitencourt, Tamires Aparecida; Silva, Gabriel; Beleboni, Rene Oliveira; Marins, Mozart; Fachin, Ana Lúcia

    2015-01-01

    Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.). Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets. PMID:26257814

  16. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  17. 蓝粒小麦花青素合成途径中的查尔酮合酶基因和类黄酮3′5′-羟化酶基因3′末端的克隆和表达分析%Cloning and Expression of Two Chalcone Synthase and a Flavonoid 3′5′- Hydroxylase 3′-end cDNAs from Developing Seeds of Blue-grained Wheat Involved in Anthocyanin Biosynthetic Pathway

    Institute of Scientific and Technical Information of China (English)

    杨国华; 李滨; 高建伟; 刘建中; 赵学强; 郑琪; 童依平; 李振声

    2004-01-01

    DNA ends (RACE) strategies, two chalcone synthase (CHS) cDNAs were cloned from developing seeds of blue-grained wheat, both of the deduced peptides contain 394 amino acids, and share 98.9% of amino acid sequence identity and the nucleotide sequences have the identity of 96.0%, and one flavonoid 3′5′-hydroxylase (F3 ′5 ′H) 3′-end cDNA was isolated. Four CHS genomic DNAs were cloned from Thinopyrum ponticum (Podp.) Z. W. Liu et R. R.-C. Wang (ThpCHS.tg), blue-grained wheat (TaCHS.bg), white-grained offspring of light blue-grained wheat (TaCHS. wg) and Chinese Spring (2n=42)( TaCHS. csg), respectively.Although these four genomic DNAs were isolated from different materials, they are very high homologous and each has one intron. The difference of the four CHS genomic DNAs mainly exists in intron. Through DNA alignment we found that one CHS cDNA ( TaCHS. t1) came from one of the parents, Th. ponticum, the other one ( TaCHS. w1) had the identity of 100% with white grain parent. This indicated that CHS genes from two parents expressed at the same developing stage in blue-grained wheat. Southern blotting analysis showed that they have at least four copies in wheat, the copy numbers in different color grains are not significantly different, but they are different from that of Th. ponticum. CHS in blue-grained wheat belongs to a CHS multifamily. Reverse Northern analysis indicated that the CHS expressed strongly in the developing blue-grained seeds at early stage (15 d after flowering, DAF), but F3 ′5 ′Hand dihydroflavonol 4-reductase (DFR) transcripts accumulated less than that of CHS at early stage. However, at the later developing stage (21 DAF), F3 ′5′Hand DFR transcripts accumulated more than that of CHS, the transcripts of CHS could hardly be detected. The expression order of the three genes is the same as the order of the biosynthetic steps in anthocyanin biosynthesis. At the same time, CHS genes cloned from seeds have not been detected in leaves of blue

  18. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Directory of Open Access Journals (Sweden)

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  19. Chalcone scaffolds as anti-infective agents: structural and molecular target perspectives.

    Science.gov (United States)

    Mahapatra, Debarshi Kar; Bharti, Sanjay Kumar; Asati, Vivek

    2015-08-28

    In recent years, widespread outbreak of numerous infectious diseases across the globe has created havoc among the population. Particularly, the inhabitants of tropical and sub-tropical regions are mainly affected by these pathogens. Several natural and (semi) synthetic chalcones deserve the credit of being potential anti-infective candidates that inhibit various parasitic, malarial, bacterial, viral, and fungal targets like cruzain-1/2, trypanopain-Tb, trans-sialidase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), fumarate reductase, falcipain-1/2, β-hematin, topoisomerase-II, plasmepsin-II, lactate dehydrogenase, protein kinases (Pfmrk and PfPK5), and sorbitol-induced hemolysis, DEN-1 NS3, H1N1, HIV (Integrase/Protease), protein tyrosine phosphatase A/B (Ptp-A/B), FtsZ, FAS-II, lactate/isocitrate dehydrogenase, NorA efflux pump, DNA gyrase, fatty acid synthase, chitin synthase, and β-(1,3)-glucan synthase. In this review, a comprehensive study (from Jan. 1982 to May 2015) of the structural features of anti-infective chalcones, their mechanism of actions (MOAs) and structure activity relationships (SARs) have been highlighted. With the knowledge of molecular targets, structural insights and SARs, this review may be helpful for (medicinal) chemists to design more potent, safe, selective and cost effective anti-infective agents.

  20. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met).

    Science.gov (United States)

    Gucev, Zoran; Slavevska, Nevenka; Tasic, Velibor; Laban, Nevenka; Pop-Jordanova, Nada; Danilovski, Dragan; Woolf, Jacqueline; Cole, Duncan

    2011-05-01

    Congenital erythropoietic porphyria (CEP) is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS). We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met). The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  1. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Directory of Open Access Journals (Sweden)

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  2. The endothelial nitric oxide synthase gene and risk of diabetic nephropathy and development of cardiovascular disease in type 1 diabetes

    DEFF Research Database (Denmark)

    Möllsten, Anna; Lajer, Maria Stenkil; Jorsal, Anders

    2009-01-01

    Nitric oxide (NO) is important in the maintenance of vascular tone and regulation of blood pressure. NO may also play a role in the development of both nephropathy and cardiovascular disease (CVD) in patients with diabetes. The susceptibility to nephropathy and CVD depends to some extent on genetic...... factors, therefore polymorphisms in the gene coding for endothelial NO-synthase, NOS3, can affect the risk of developing these diseases. Type 1 diabetes patients attending the Steno Diabetes Center, Denmark, between 1993 and 2001 were enrolled in this study. A total of 458 cases with diabetic nephropathy...... (albumin excretion >300 mg/24h) and 319 controls with persistent normoalbuminuria ( or =20 years of diabetes duration at follow-up were identified. Patients were followed until death or end of the study. Associations between seven NOS3-gene polymorphisms and nephropathy, progression...

  3. Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance.

    Science.gov (United States)

    Romero, C; Bellés, J M; Vayá, J L; Serrano, R; Culiáñez-Macià, F A

    1997-03-01

    The yeast trehalose-6-phosphate synthase gene (TPS1) was engineered under the control of the cauliflower mosaic virus regulatory sequences (CaMV35S) for expression in plants. Using Agrobacterium-mediated transfer, the gene was incorporated into the genomic DNA and constitutively expressed in Nicotiana tabacum L. plants. Trehalose was determined in the transformants, by anion-exchange chromatography coupled to pulsed amperometric detection. The non-reducing disaccharide accumulated up to 0.17 mg per g fresh weight in leaf extracts of transgenic plants. Trehaloseaccumulating plants exhibited multiple phenotypic alterations, including stunted growth, lancet-shaped leaves, reduced sucrose content and improved drought tolerance. These pleiotropic effects, and the fact that water loss from detached leaves was not significantly affected by trehalose accumulation, suggest that synthesis of this sugar, rather than leading to an osmoprotectant effect, had altered sugar metabolism and regulatory pathways affecting plant development and stress tolerance.

  4. Diversification of the monoterpene synthase gene family (TPSb) in Protium, a highly diverse genus of tropical trees.

    Science.gov (United States)

    Zapata, Felipe; Fine, Paul V A

    2013-09-01

    Plant monoterpenes are a diverse class of secondary metabolites mediating biotic and abiotic interactions with direct effects on plant fitness. To evaluate the hypothesis that monoterpene diversity is related to functional diversification after gene duplication, we reconstructed the evolutionary history of monoterpene synthases (TPSb)--the genes underlying monoterpene synthesis--in Protium, a taxonomically and chemically diverse genus of tropical trees. We isolated multiple copies of TPSb genes from chemically divergent Protium species, reconstructed the phylogeny of this gene family, used maximum-likelihood estimation of selection coefficients, and inferred residues evolving under positive selection. We found evidence for one ancient and multiple more recent duplication events giving rise to three, and potentially five, copies of TPSb genes currently present in Protium. There was evidence for adaptive evolution in one copy with a positively selected residue likely involved in protein folding and product specificity. All other copies were inferred to be evolving under a combination of stabilizing and/or relaxed selection. Although gene copy number is consistent with the extensive phenotypic diversity in monoterpenes shown in Protium, selection analyses suggest that not all copies are undergoing divergent selection consistent with a coevolutionary arms race with enemies, but instead may be under stabilizing and relaxed selection consistent with signaling or physiological stress functionality.

  5. Identification of a Polyketide Synthase Gene in the Synthesis of Phleichrome of the Phytopathogenic Fungus Cladosporium phlei.

    Science.gov (United States)

    So, Kum-Kang; Chung, Yun-Jo; Kim, Jung-Mi; Kim, Beom-Tae; Park, Seung-Moon; Kim, Dae-Hyuk

    2015-12-01

    Phleichrome, a pigment produced by the phytopathogenic fungus Cladosporium phlei, is a fungal perylenequinone whose photodynamic activity has been studied intensively. To determine the biological function of phleichrome and to engineer a strain with enhanced production of phleichrome, we identified the gene responsible for the synthesis of phleichrome. Structural comparison of phleichrome with other fungal perylenequinones suggested that phleichrome is synthesized via polyketide pathway. We recently identified four different polyketide synthase (PKS) genes encompassing three major clades of fungal PKSs that differ with respect to reducing conditions for the polyketide product. Based on in silico analysis of cloned genes, we hypothesized that the non-reducing PKS gene, Cppks1, is involved in phleichrome biosynthesis. Increased accumulation of Cppks1 transcript was observed in response to supplementation with the application of synthetic inducer cyclo-(l-Pro-l-Phe). In addition, heterologous expression of the Cppks1 gene in Cryphonectria parasitica resulted in the production of phleichrome. These results provide convincing evidence that the Cppks1 gene is responsible for the biosynthesis of phleichrome.

  6. Biphenyl synthase, a novel type III polyketide synthase.

    Science.gov (United States)

    Liu, B; Raeth, T; Beuerle, T; Beerhues, L

    2007-05-01

    Biphenyls and dibenzofurans are the phytoalexins of the Maloideae, a subfamily of the economically important Rosaceae. The carbon skeleton of the two classes of antimicrobial secondary metabolites is formed by biphenyl synthase (BIS). A cDNA encoding this key enzyme was cloned from yeast-extract-treated cell cultures of Sorbus aucuparia. BIS is a novel type III polyketide synthase (PKS) that shares about 60% amino acid sequence identity with other members of the enzyme superfamily. Its preferred starter substrate is benzoyl-CoA that undergoes iterative condensation with three molecules of malonyl-CoA to give 3,5-dihydroxybiphenyl via intramolecular aldol condensation. BIS did not accept CoA-linked cinnamic acids such as 4-coumaroyl-CoA. This substrate, however, was the preferential starter molecule for chalcone synthase (CHS) that was also cloned from S. aucuparia cell cultures. While BIS expression was rapidly, strongly and transiently induced by yeast extract treatment, CHS expression was not. In a phylogenetic tree, BIS grouped together closely with benzophenone synthase (BPS) that also uses benzoyl-CoA as starter molecule but cyclizes the common intermediate via intramolecular Claisen condensation. The molecular characterization of BIS thus contributes to the understanding of the functional diversity and evolution of type III PKSs.

  7. Genome-wide identification and evolution analysis of Trehalose-6-phosphate synthase gene family in Nelumbo nucifera

    Directory of Open Access Journals (Sweden)

    Qijiang Jin

    2016-09-01

    Full Text Available Trehalose-6-phosphate synthase (TPS plays a key role in plant carbohydrate metabolism and the perception of carbohydrate availability. In the present work, the publicly available Nelumbo nucifera (lotus genome sequence database was analyzed which led to identification of nine lotus TPS genes (NnTPS. It was found that at least two introns are included in the coding sequences of NnTPS genes. When the motif compositions were analyzed we found that NnTPS generally shared the similar motifs, implying that they have similar functions. The dN/dS ratios were always less than 1 for different domains and regions outside domains, suggesting purifying selection on the lotus TPS gene family. The regions outside TPS domain evolved relatively faster than NnTPS domains. A phylogenetic tree was constructed using all predicted coding sequences of lotus TPS genes, together with those from Arabidopsis, poplar, soybean and rice. The result indicated that those TPS genes could be clearly divided into two main subfamilies (I-II, where each subfamily could be further divided into 2 (I and 5 (II subgroups. Analyses of divergence and adaptive evolution show that purifying selection may have been the main force driving evolution of plant TPS genes. Some of the critical sites that contributed to divergence may have been under positive selection. Transcriptome data analysis revealed that most NnTPS genes were predominantly expressed in sink tissues. Expression pattern of NnTPS genes under copper and submergence stress indicated that NNU_014679 and NNU_022788 might play important roles in lotus energy metabolism and participate in stress response. Our results can facilitate further functional studies of TPS genes in lotus.

  8. Against All Odds: Trehalose-6-Phosphate Synthase and Trehalase Genes in the Bdelloid Rotifer Adineta vaga Were Acquired by Horizontal Gene Transfer and Are Upregulated during Desiccation.

    Directory of Open Access Journals (Sweden)

    Boris Hespeels

    Full Text Available The disaccharide sugar trehalose is essential for desiccation resistance in most metazoans that survive dryness; however, neither trehalose nor the enzymes involved in its metabolism have ever been detected in bdelloid rotifers despite their extreme resistance to desiccation. Here we screened the genome of the bdelloid rotifer Adineta vaga for genes involved in trehalose metabolism. We discovered a total of four putative trehalose-6-phosphate synthase (TPS and seven putative trehalase (TRE gene copies in the genome of this ameiotic organism; however, no trehalose-6-phosphate phosphatase (TPP gene or domain was detected. The four TPS copies of A. vaga appear more closely related to plant and fungi proteins, as well as to some protists, whereas the seven TRE copies fall in bacterial clades. Therefore, A. vaga likely acquired its trehalose biosynthesis and hydrolysis genes by horizontal gene transfers. Nearly all residues important for substrate binding in the predicted TPS domains are highly conserved, supporting the hypothesis that several copies of the genes might be functional. Besides, RNAseq library screening showed that trehalase genes were highly expressed compared to TPS genes, explaining probably why trehalose had not been detected in previous studies of bdelloids. A strong overexpression of their TPS genes was observed when bdelloids enter desiccation, suggesting a possible signaling role of trehalose-6-phosphate or trehalose in this process.

  9. Effect of thymidylate synthase (TYMS) gene polymorphisms with methotrexate treatment outcome in south Indian Tamil patients with rheumatoid arthritis.

    Science.gov (United States)

    Muralidharan, Niveditha; Misra, Durga P; Jain, Vikramraj K; Negi, Vir Singh

    2017-03-27

    Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease causing joint damage and significant functional impairment. Methotrexate (MTX) remains the mainstay for the treatment of RA. MTX inhibits several enzymes of the folate and nucleotide pathways. Thymidylate synthase (TYMS) is an important enzyme in the de novo pyrimidine pathway responsible for DNA replication. The two common gene polymorphisms analyzed in TYMS are 28-bp tandem repeat polymorphism and a 6-bp insertion/deletion polymorphism. The present study was carried out to find the role of these TYMS gene polymorphisms with clinical phenotype, treatment response, and MTX adverse events in 254 patients with RA of south Indian Tamil ethnicity. TYMS gene polymorphisms were analyzed by PCR. The allele frequencies of TYMS gene polymorphisms did not differ between good and non-responders. However, the TYMS 28-bp tandem repeat 3R allele was higher in non-responders than in patients undergoing remission [64 vs 51.11%, p = 0.06, OR 0.58, 95% CI (0.34-1.00)]. The TYMS 6-bp deletion allele was higher in non-responders than good responders [78.20 vs 64.92%, p = 0.06, OR 0.51 95% CI (0.27-0.98)]. TYMS 3R allele and TYMS 6-bp deletion allele may favor non-response to MTX in south Indian Tamils. TYMS gene polymorphisms did not influence MTX adverse events.

  10. Suppression of the barley uroporphyrinogen III synthase gene by a Ds activation tagging element generates developmental photosensitivity.

    Science.gov (United States)

    Ayliffe, Michael A; Agostino, Anthony; Clarke, Bryan C; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J

    2009-03-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen.

  11. Regulation of Expression of GLT1, the Gene Encoding Glutamate Synthase in Saccharomyces cerevisiae

    OpenAIRE

    Valenzuela, Lourdes; Ballario, Paola; Aranda, Cristina; Filetici, Patrizia; González, Alicia

    1998-01-01

    Saccharomyces cerevisiae glutamate synthase (GOGAT) is an oligomeric enzyme composed of three 199-kDa identical subunits encoded by GLT1. In this work, we analyzed GLT1 transcriptional regulation. GLT1-lacZ fusions were prepared and GLT1 expression was determined in a GDH1 wild-type strain and in a gdh1 mutant derivative grown in the presence of various nitrogen sources. Null mutants impaired in GCN4, GLN3, GAT1/NIL1, or UGA43/DAL80 were transformed with a GLT1-lacZ fusion to determine whethe...

  12. SYNTHESIS AND CHARACTERIZATION OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Ramesh Dhani

    2012-12-01

    Full Text Available Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The name chalcones was given by Kostanecki and Tambor. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of novel heterocyclics with good pharmaceutical profile can be designed. Chalcones have been considered as a magic moiety possessing myriad spectrum of medicinal activities. Diversity of biological response profile has attracted considerable interest of several researchers across the globe to explore this skeleton for its assorted therapeutic significance. By using different synthetic methods new chalcone derivatives were synthesized and characterized by physicochemical analysis. Chalcone is a lead nucleus for future developments to get effective compounds.

  13. Two-photon-induced cycloreversion reaction of chalcone photodimers

    Science.gov (United States)

    Träger, J.; Härtner, S.; Heinzer, J.; Kim, H.-C.; Hampp, N.

    2008-04-01

    The photocleavage reaction of chalcone photodimers has been studied using a two-photon process. For this purpose, a novel chalcone dimer has been synthesized as a low molecular weight model substance for polymer bound chalcones and its photochemistry triggered by two-photon-absorption (2PA) has been investigated using a pulsed frequency-doubled Nd:YAG-laser. The 2PA-induced cycloreversion reaction selectively leads to the cleavage of the chalcone photodimers resulting in the formation of monomeric chalcone molecules. Hence, as an application chalcones can be used as a photosensitive linker which can be cleaved beyond an UV-absorbing barrier. The 2PA cross section of the chalcone photodimer was determined to be of 1.1 × 10 -49 cm 4 s photon -1 (11 GM).

  14. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Directory of Open Access Journals (Sweden)

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.

  15. Association of Variable Number of Tandem Repeats in Endothelial Nitric Oxide Synthase Gene with Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    S Salimi

    2006-08-01

    Full Text Available Endo-derived nitric oxide (NO is synthesized from L-arginine by endothelium nitric oxide synthase (eNOS. Since reduced NO synthesis has been implicated in the development of coronary atherosclerosis; we hypothesized that polymorphisms of NOS gene might be associated with increased susceptibility to this disorder and coronary artery disease (CAD. We studied the 27 base pair tandem repeat polymorphism in intron4 of the endothelial nitric oxide synthase (eNOS gene in 141 unrelated CAD patients with positive coronary angiograms in Shahid Rajaee Heart Hospital and 159 age matched control subjects without a history of symptomatic CAD. The study protocol was approved by the Iran University of Medical Sciences Ethics Committee. The eNOS gene intron4a/b VNTR polymorphism was analyzed by polymerase chain reaction. The plasma lipids levels and other risk factors were also determined. The genotype frequencies for eNOS4b/b, eNOS4a/b and eNOS4a/a were 68.8, 29.1 and 2.1% in CAD subjects, and 81, 18.4 and 0.6 % in control subjects, respectively. The genotype frequencies differed significantly between the two groups (χ²= 6.38 P= 0.041. The frequency of the allele was 16.7% in CAD subjects and 9.8% in control subjects and was significantly higher in the patients (χ²= 6.18 P= 0.013, odds ratio=1.84. Plasma lipids, except HDL-C were also remarkablely increased in CAD group.

  16. Structural Antitumoral Activity Relationships of Synthetic Chalcones

    Science.gov (United States)

    Echeverria, Cesar; Santibañez, Juan Francisco; Donoso-Tauda, Oscar; Escobar, Carlos A.; Ramirez-Tagle, Rodrigo

    2009-01-01

    Relationships between the structural characteristic of synthetic chalcones and their antitumoral activity were studied. Treatment of HepG2 cells for 24 h with synthetic 2’-hydroxychalcones resulted in apoptosis induction and dose-dependent inhibition of cell proliferation. The calculated reactivity indexes and the adiabatic electron affinities using the DFT method including solvent effects, suggest a structure-activity relationship between the Chalcones structure and the apoptosis in HepG2 cells. The absence of methoxy substituents in the B ring of synthetic 2’-hydroxychalcones, showed the mayor structure-activity pattern along the series. PMID:19333443

  17. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  18. Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus

    Science.gov (United States)

    Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

    2016-01-01

    Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5′ UTR and 3′ UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE–PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress. PMID:27786294

  19. A case of primary selective hypoaldosteronism carrying three mutations in the aldosterone synthase (Cyp11b2) gene.

    Science.gov (United States)

    Taranta, Anna; Bizzarri, Carla; Masotti, Andrea; Sciré, Giuseppe; Pampanini, Valentina; Cappa, Marco

    2012-05-25

    An infant with a clinical phenotype of early onset hypoaldosteronism has been screened for mutation analysis of the Cyp11b2 gene encoding aldosterone synthase enzyme. We have described a novel nonsense mutation in exon 3 (c.508C>T) that gave rise to a shorter protein (Q170X) and two known concurrent missense mutations (c.594A>C in exon 3 and c.1157T>C in exon 7) that led to substitution of glutamic acid for aspartic acid at amino acid position 198 (E198D) and of valine for alanine at amino acid position 386 (V386A). The father, who carried E198D plus V386A mutations, showed a fractional sodium excretion of 1.25% that was unmodified by dietary salt restriction, suggesting a mild haploinsufficiency. We examined by in silico analysis the effect of the mutations on the secondary and tertiary structures of aldosterone synthase to explain the inefficient enzymatic activity. The Q170X mutation produced a truncated protein, which was consequently associated with a loss of catalytic activity. As predicted by JPred web system and Dock 6.3 software, the concurrent expression of E198D and V386A mutations induced a significant secondary structure rearrangement and a shift of the heme group and the 18-hydroxycorticosterone substrate from their optimal placement.

  20. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  1. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    Full Text Available Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L., no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress at various time points (e.g. 0, 24, 72 and 96 h. We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots, under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses.

  2. Toxicity assessments of chalcone and some synthetic chalcone analogues in a zebrafish model.

    Science.gov (United States)

    Lee, Ya-Ting; Fong, Tsorng-Harn; Chen, Hui-Min; Chang, Chao-Yuan; Wang, Yun-Hsin; Chern, Ching-Yuh; Chen, Yau-Hung

    2014-01-07

    The aim of this study was to investigate the in vivo toxicities of some novel synthetic chalcones. Chalcone and four chalcone analogues 1a-d were evaluated using zebrafish embryos following antibody staining to visualize their morphological changes and muscle fiber alignment. Results showed that embryos treated with 3'-hydroxychalcone (compound 1b) displayed a high percentage of muscle defects (96.6%), especially myofibril misalignment. Ultrastructural analysis revealed that compound 1b-treated embryos displayed many muscle defect phenotypes, including breakage and collapse of myofibrils, reduced cell numbers, and disorganized thick (myosin) and thin (actin) filaments. Taken together, our results provide in vivo evidence of the myotoxic effects of the synthesized chalcone analogues on developing zebrafish embryos.

  3. Evaluation of the anti-inflammatory effect of chalcone and chalcone analogues in a zebrafish model.

    Science.gov (United States)

    Chen, Yau-Hung; Wang, Wei-Hua; Wang, Yun-Hsin; Lin, Zi-Yu; Wen, Chi-Chung; Chern, Ching-Yuh

    2013-02-05

    The aim of this study was to investigate novel chalcones with potent anti-inflammatory activities in vivo. Chalcone and two chalcone analogues (compound 5 and 9) were evaluated using a caudal fin-wounded transgenic zebrafish line "Tg(mpx:gfp)" to visualize the effect of neutrophil recruitment dynamically. Results showed that treatment with compound 9 not only affected wound-induced neutrophil recruitment, but also affected Mpx enzymatic activity. Moreover, protein expression levels of pro-inflammatory factors (Mpx, NFκB, and TNFα) were also regulated by compound 9. Taken together, our results provide in vivo evidence of the anti-inflammatory effects of synthesized chalcone analogues on wound-induced inflammation.

  4. Toxicity Assessments of Chalcone and Some Synthetic Chalcone Analogues in a Zebrafish Model

    Directory of Open Access Journals (Sweden)

    Ya-Ting Lee

    2014-01-01

    Full Text Available The aim of this study was to investigate the in vivo toxicities of some novel synthetic chalcones. Chalcone and four chalcone analogues 1a–d were evaluated using zebrafish embryos following antibody staining to visualize their morphological changes and muscle fiber alignment. Results showed that embryos treated with 3'-hydroxychalcone (compound 1b displayed a high percentage of muscle defects (96.6%, especially myofibril misalignment. Ultrastructural analysis revealed that compound 1b-treated embryos displayed many muscle defect phenotypes, including breakage and collapse of myofibrils, reduced cell numbers, and disorganized thick (myosin and thin (actin filaments. Taken together, our results provide in vivo evidence of the myotoxic effects of the synthesized chalcone analogues on developing zebrafish embryos.

  5. Expression of the inducible nitric oxide synthase gene in diaphragm and skeletal muscle.

    Science.gov (United States)

    Thompson, M; Becker, L; Bryant, D; Williams, G; Levin, D; Margraf, L; Giroir, B P

    1996-12-01

    Nitric oxide (NO) is a pluripotent molecule that can be secreted by skeletal muscle through the activity of the neuronal constitutive isoform of NO synthase. To determine whether skeletal muscle and diaphragm might also express the macrophage-inducible form of NO synthase (iNOS) during provocative states, we examined tissue from mice at serial times after intravenous administration of Escherichia coli endotoxin. In these studies, iNOS mRNA was strongly expressed in the diaphragm and skeletal muscle of mice 4 h after intravenous endotoxin and was significantly diminished by 8 h after challenge. Induction of iNOS mRNA was followed by expression of iNOS immunoreactive protein on Western immunoblots. Increased iNOS activity was demonstrated by conversion of arginine to citrulline. Immunochemical analysis of diaphragmatic explants exposed to endotoxin in vitro revealed specific iNOS staining in myocytes, in addition to macrophages and endothelium. These results may be important in understanding the pathogenesis of respiratory pump failure during septic shock, as well as skeletal muscle injury during inflammation or metabolic stress.

  6. Cloning and expression of sesquiterpene synthase genes from lettuce (Lactuca sativa L.).

    Science.gov (United States)

    Bennett, Mark H; Mansfield, John W; Lewis, Mervyn J; Beale, Michael H

    2002-06-01

    Sesquiterpenoid lactones (SLs) from lettuce (Lactuca sativa L.) include constitutive components of latex such as lactucin and the induced phytoalexin, lettucenin A. A redundant primer strategy was used to recover two full length cDNA clones (LTC1 and LTC2) encoding sesquiterpene synthases from a cDNA library derived from seedlings with the red spot disorder, which accumulate phytoalexins. Recombinant enzymes produced from LTC1 and LTC2 in Escherichia coli catalysed the cyclisation of farnesyl diphosphate to germacrene A, potentially an early step in the biosynthesis of SLs. RT-PCR analysis showed LTC1 and LTC2 were expressed constitutively in roots, hypocotyls and true leaves but not in cotyledons. Expression in cotyledons was induced by challenge with the downy mildew pathogen Bremia lactucae in the disease resistant cultivar Diana. Southern hybridisation experiments showed that LTC1 and LTC2 were not part of a multigene family. The germacrene A synthases provide targets for modified expression to generate beneficial modifications to the SL profile in lettuce.

  7. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.).

    Science.gov (United States)

    Prasad, B C Narasimha; Kumar, Vinod; Gururaj, H B; Parimalan, R; Giridhar, P; Ravishankar, G A

    2006-09-05

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS ( approximately 35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes.

  8. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis

    Science.gov (United States)

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-01-01

    Background Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. Material/Methods PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. Results Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (pmeta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations. PMID:28188309

  9. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  10. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Science.gov (United States)

    Chai, Ran; Qiu, Cuiwei; Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  11. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    2015-08-01

    Full Text Available Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  12. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  13. Novel point mutation in the uroporphyrinogen III synthase gene causes congenital erythropoietic porphyria of a Japanese family.

    Science.gov (United States)

    Takamura, N; Hombrados, I; Tanigawa, K; Namba, H; Nagayama, Y; de Verneuil, H; Yamashita, S

    1997-06-13

    The molecular basis of the uroporphyrinogen III synthase (UROIIIS) deficiency was investigated in a member of a Japanese family. This defect in heme biosynthesis is responsible for a rare autosomal recessive disease: congenital erythropoietic porphyria (CEP) or Günther's disease. The patient was homozygous for a novel missense mutation: a G to T transition of nucleotide 7 that predicted a valine to phenylalanine substitution at residue 3 (V3F). The parents were heterozygous for the same mutation. The loss of UROIIIS activity was verified by an in vitro assay system. The corresponding mutated protein was expressed in Escherichia coli and no residual activity was observed. Further studies are needed to determine whether the mutations of the UROIIIS gene (UROS) have a specific profile in Japan compared to European or American countries.

  14. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri;

    2014-01-01

    Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-related peptide (CGRP...

  15. SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

    NARCIS (Netherlands)

    van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

    1991-01-01

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type seq

  16. Diversity of cystathionine ß-synthase haplotypes bearing the most common homocystinuria mutation c.833T>C: a possible role for gene conversion

    DEFF Research Database (Denmark)

    Vyletal, P; Sokolová, J; Cooper, DN;

    2007-01-01

    Homozygosity or compound heterozygosity for the c.833T>C transition (p.I278 T) in the cystathionine beta-synthase (CBS) gene represents the most common cause of pyridoxine-responsive homocystinuria in Western Eurasians. However, the frequency of the pathogenic c.833C allele, as observed in healthy...

  17. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  18. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  19. Overexpression of erg20 gene encoding farnesyl pyrophosphate synthase has contrasting effects on activity of enzymes of the dolichyl and sterol branches of mevalonate pathway in Trichoderma reesei.

    Science.gov (United States)

    Piłsyk, Sebastian; Perlińska-Lenart, Urszula; Górka-Nieć, Wioletta; Graczyk, Sebastian; Antosiewicz, Beata; Zembek, Patrycja; Palamarczyk, Grażyna; Kruszewska, Joanna S

    2014-07-10

    The mevalonate pathway is the most diverse metabolic route resulting in the biosynthesis of at least 30,000 isoprenoid compounds, many of which, such as sterols or dolichols, are indispensable for living cells. In the filamentous fungus Trichoderma of major biotechnological interest isoprenoid metabolites are also involved in the biocontrol processes giving the mevalonate pathway an additional significance. On the other hand, little is known about genes coding for enzymes of the mevalonate pathway in Trichoderma. Here, we present cloning and functional analysis of the erg20 gene from Trichoderma reesei coding for farnesyl pyrophosphate (FPP) synthase (EC 2.5.1.10), an enzyme located at the branching point of the mevalonate pathway. Expression of the gene in a thermosensitive erg20-2 mutant of Saccharomyces cerevisiae impaired in the FPP synthase activity suppressed the thermosensitive phenotype. The same gene overexpressed in T. reesei significantly enhanced the FPP synthase activity and also stimulated the activity of cis-prenyltransferase, an enzyme of the dolichyl branch of the mevalonate pathway. Unexpectedly, the activity of squalene synthase from the other, sterol branch, was significantly decreased without, however, affecting ergosterol level.

  20. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    , the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...

  1. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  2. Four novel cellulose synthase (CESA) genes from Birch (Betula platyphylla Suk.) involved in primary and secondary cell Wall biosynthesis.

    Science.gov (United States)

    Liu, Xuemei; Wang, Qiuyu; Chen, Pengfei; Song, Funan; Guan, Minxiao; Jin, Lihua; Wang, Yucheng; Yang, Chuanping

    2012-09-25

    Cellulose synthase (CESA), which is an essential catalyst for the generation of plant cell wall biomass, is mainly encoded by the CesA gene family that contains ten or more members. In this study; four full-length cDNAs encoding CESA were isolated from Betula platyphylla Suk., which is an important timber species, using RT-PCR combined with the RACE method and were named as BplCesA3, -4, -7 and -8. These deduced CESAs contained the same typical domains and regions as their Arabidopsis homologs. The cDNA lengths differed among these four genes, as did the locations of the various protein domains inferred from the deduced amino acid sequences, which shared amino acid sequence identities ranging from only 63.8% to 70.5%. Real-time RT-PCR showed that all four BplCesAs were expressed at different levels in diverse tissues. Results indicated that BplCESA8 might be involved in secondary cell wall biosynthesis and floral development. BplCESA3 appeared in a unique expression pattern and was possibly involved in primary cell wall biosynthesis and seed development; it might also be related to the homogalacturonan synthesis. BplCESA7 and BplCESA4 may be related to the formation of a cellulose synthase complex and participate mainly in secondary cell wall biosynthesis. The extremely low expression abundance of the four BplCESAs in mature pollen suggested very little involvement of them in mature pollen formation in Betula. The distinct expression pattern of the four BplCesAs suggested they might participate in developments of various tissues and that they are possibly controlled by distinct mechanisms in Betula.

  3. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    Science.gov (United States)

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  4. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  5. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  6. An antileishmanial chalcone from Chinese licorice roots

    DEFF Research Database (Denmark)

    Christensen, S B; Ming, C; Andersen, L

    1994-01-01

    A bioassay guided fractionation of an extract of Chinese licorice roots led to the isolation of (E)-1-[2,4-dihydroxy-3-(3-methyl-2-butenyl)phenyl]-3-[4- hydroxy-3-(3-methyl-2-butenyl]phenyl-2-propen-1-one, which in vitro showed potent antileishmanial activity. In addition, the novel chalcone (E)-...

  7. A novel chalcone derivative from Onychium japonicum

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A novel chalcone derivative was isolated from Onychium japonicum and its structure was elucidated by spectroscopic methods.The isolated compound showed cytotoxic activity against the human carcinoma cell lines Hela and BEL-7402 in vitro.(C) 2007 Hong Quan Duan. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved.

  8. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  9. Expression, subcellular localization, and cis-regulatory structure of duplicated phytoene synthase genes in melon (Cucumis melo L.).

    Science.gov (United States)

    Qin, Xiaoqiong; Coku, Ardian; Inoue, Kentaro; Tian, Li

    2011-10-01

    Carotenoids perform many critical functions in plants, animals, and humans. It is therefore important to understand carotenoid biosynthesis and its regulation in plants. Phytoene synthase (PSY) catalyzes the first committed and rate-limiting step in carotenoid biosynthesis. While PSY is present as a single copy gene in Arabidopsis, duplicated PSY genes have been identified in many economically important monocot and dicot crops. CmPSY1 was previously identified from melon (Cucumis melo L.), but was not functionally characterized. We isolated a second PSY gene, CmPSY2, from melon in this work. CmPSY2 possesses a unique intron/exon structure that has not been observed in other plant PSYs. Both CmPSY1 and CmPSY2 are functional in vitro, but exhibit distinct expression patterns in different melon tissues and during fruit development, suggesting differential regulation of the duplicated melon PSY genes. In vitro chloroplast import assays verified the plastidic localization of CmPSY1 and CmPSY2 despite the lack of an obvious plastid target peptide in CmPSY2. Promoter motif analysis of the duplicated melon and tomato PSY genes and the Arabidopsis PSY revealed distinctive cis-regulatory structures of melon PSYs and identified gibberellin-responsive motifs in all PSYs except for SlPSY1, which has not been reported previously. Overall, these data provide new insights into the evolutionary history of plant PSY genes and the regulation of PSY expression by developmental and environmental signals that may involve different regulatory networks.

  10. Chrysanthemyl diphosphate synthase: Isolation of the gene and characterization of the recombinant non-head-to-tail monoterpene synthase from Chrysanthemum cinerariaefolium

    OpenAIRE

    Rivera, Susan B.; Swedlund, Bradley D.; King, Gretchen J.; Bell, Russell N.; Hussey, Charles E.; Shattuck-Eidens, Donna M.; Wrobel, Wislawa M.; Peiser, Galen D.; Poulter, C. Dale

    2001-01-01

    Chrysanthemyl diphosphate synthase (CPPase) catalyzes the condensation of two molecules of dimethylallyl diphosphate to produce chrysanthemyl diphosphate (CPP), a monoterpene with a non-head-to-tail or irregular c1′-2-3 linkage between isoprenoid units. Irregular monoterpenes are common in Chrysanthemum cinerariaefolium and related members of the Asteraceae family. In C. cinerariaefolium, CPP is an intermediate in the biosynthesis of the pyrethrin ester insecticides. CPPa...

  11. Cloning and characterization of the gene encoding β-amyrin synthase in the glycyrrhizic acid biosynthetic pathway in Glycyrrhiza uralensis

    Directory of Open Access Journals (Sweden)

    Honghao Chen

    2013-12-01

    Full Text Available Glycyrrhiza uralensis is considered to be one of the most important herbs in traditional Chinese medicine due to its numerous pharmacological effects particularly its ability to relieve cough and act as a mucolytic. Based on previous research, these effects are mediated by a number of active ingredients, especially glycyrrhizic acid (GA. In the present study, a gene encoding β-amyrin synthase (β-AS involved in GA biosynthesis in G. uralensis has been cloned and expressed in Saccharomyces cerevisiae. The cloned enzyme showed similar activity to native enzymes isolated from other Glycyrrhiza species to catalyze the conversion of 2,3-oxidosqualene into β-amyrin. In fact the β-AS gene is particularly important in the GA biosynthetic pathway in G. uralensis. The complete sequence of the enzyme was determined and a phylogenetic tree based on the β-AS gene of G. uralensis and 20 other species was created. This showed that Glycyrrhiza glabra had the closest kinship with G. uralensis. The results of this work will be useful in determining how to improve the efficacy of G. uralensis by improving its GA content and in exploring the biosynthesis of GA in vitro.

  12. Molecular cloning and functional characterization of Catharanthus roseus hydroxymethylbutenyl 4-diphosphate synthase gene promoter from the methyl erythritol phosphate pathway.

    Science.gov (United States)

    Ginis, Olivia; Courdavault, Vincent; Melin, Céline; Lanoue, Arnaud; Giglioli-Guivarc'h, Nathalie; St-Pierre, Benoit; Courtois, Martine; Oudin, Audrey

    2012-05-01

    The Madagascar periwinkle produces monoterpenoid indole alkaloids (MIA) of high interest due to their therapeutical values. The terpenoid moiety of MIA is derived from the methyl erythritol phosphate (MEP) and seco-iridoid pathways. These pathways are regarded as the limiting branch for MIA biosynthesis in C. roseus cell and tissue cultures. In previous studies, we demonstrated a coordinated regulation at the transcriptional and spatial levels of genes from both pathways. We report here on the isolation of the 5'-flanking region (1,049 bp) of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene from the MEP pathway. To investigate promoter transcriptional activities, the HDS promoter was fused to GUS reporter gene. Agrobacterium-mediated transformation of young tobacco leaves revealed that the cloned HDS promoter displays a tissue-specific GUS staining restricted to the vascular region of the leaves and limited to a part of the vein that encompasses the phloem in agreement with the previous localization of HDS transcripts in C. roseus aerial organs. Further functional characterizations in stably or transiently transformed C. roseus cells allowed us to identify the region that can be consider as the minimal promoter and to demonstrate the induction of HDS promoter by several hormonal signals (auxin, cytokinin, methyljasmonate and ethylene) leading to MIA production. These results, and the bioinformatic analysis of the HDS 5'-region, suggest that the HDS promoter harbours a number of cis-elements binding specific transcription factors that would regulate the flux of terpenoid precursors involved in MIA biosynthesis.

  13. Therapeutic potential of chalcones as cardiovascular agents.

    Science.gov (United States)

    Mahapatra, Debarshi Kar; Bharti, Sanjay Kumar

    2016-03-01

    Cardiovascular diseases are the leading cause of death affecting 17.3 million people across the globe and are estimated to affect 23.3 million people by year 2030. In recent years, about 7.3 million people died due to coronary heart disease, 9.4 million deaths due to high blood pressure and 6.2 million due to stroke, where obesity and atherosclerotic progression remain the chief pathological factors. The search for newer and better cardiovascular agents is the foremost need to manage cardiac patient population across the world. Several natural and (semi) synthetic chalcones deserve the credit of being potential candidates to inhibit various cardiovascular, hematological and anti-obesity targets like angiotensin converting enzyme (ACE), cholesteryl ester transfer protein (CETP), diacylglycerol acyltransferase (DGAT), acyl-coenzyme A: cholesterol acyltransferase (ACAT), pancreatic lipase (PL), lipoprotein lipase (LPL), calcium (Ca(2+))/potassium (K(+)) channel, COX-1, TXA2 and TXB2. In this review, a comprehensive study of chalcones, their therapeutic targets, structure activity relationships (SARs), mechanisms of actions (MOAs) have been discussed. Chemically diverse chalcone scaffolds, their derivatives including structural manipulation of both aryl rings, replacement with heteroaryl scaffold(s) and hybridization through conjugation with other pharmacologically active scaffold have been highlighted. Chalcones which showed promising activity and have a well-defined MOAs, SARs must be considered as prototype for the design and development of potential anti-hypertensive, anti-anginal, anti-arrhythmic and cardioprotective agents. With the knowledge of these molecular targets, structural insights and SARs, this review may be helpful for (medicinal) chemists to design more potent, safe, selective and cost effective chalcone derivatives as potential cardiovascular agents.

  14. Endothelial Nitric Oxide Synthase Gene Intron 4, 27 bp Repeat Polymorphism and Essential Hypertension in the Kazakh Chinese Population

    Institute of Scientific and Technical Information of China (English)

    Fengmei DENG; Huimin ZHANG; Juan ZHAO; Hua ZHONG; Ling HE; Jun LI; Le ZHANG; Shuren WANG; Qinghua HU; Bin TANG; Fang HE; Shuxia GUO; Jiang CHEN; Feng LI; Xuehua WU; Jun ZHANG

    2007-01-01

    To investigate the relationship between 27 bp repeat polymorphism in intron 4 in the endothelial nitric oxide synthase (eNOS4) gene and essential hypertension in the Kazakh Chinese population, 151 patients with essential hypertension and 138 healthy people were selected from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China in 2006. The polymorphism of eNOS in the two groups was detected with polymerase chain reaction assays and the genotype frequencies in each group were calculated following the Hardy-Weinberg law. Four and five tandem 27 bp repeats were designated as "a" and "b", respectively. It was found that the frequencies of b/b, b/a and a/a genotypes of the eNOS4 gene were 84.06%, 15.22% and 0.72% in the control group, and 81.46%, 15.89% and 2.65% in the hypertension group, respectively. The frequencies of gene "b" and "a" were 91.67% and 8.33% in the control group and 89.40% and 10.60% in the hypertension group, respectively. It was found that plasma eNOS activity was not associated with genotypes and alleles of eNOS gene. Plasma eNOS activity in the hypertension group was significantly decreased compared with the control group (P<0.01). The results suggest that eNOS4 gene polymorphisms are unlikely to be the major genetic susceptibility factors for essential hypertension in the Xinjiang Kazakh population. However, a positive association between plasma eNOS activity and essential hypertension has been revealed.

  15. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  16. Molecular cloning and expression profile of β-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.

    Directory of Open Access Journals (Sweden)

    Long Hongxu

    2015-01-01

    Full Text Available Tung tree (Vernicia fordii is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole α-eleostearic acid (9 cis, 11 trans, 13 trans octadecatrienoic acid. Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a multienzyme complex including β-ketoacyl-acyl-carrier-protein synthase (KAS. Little is known about KAS in tung tree. The objective of this study was to clone KAS genes and analyze their expression profiles in tung tree. A full-length cDNA encoding KAS III and a partial cDNA encoding KAS II were isolated from tung tree by PCR cloning using degenerate primers and rapid amplification of cDNA ends system. The full-length cDNA of VfKAS III was 1881 bp in length with an open reading frame of 1212 bp. VfKAS III genomic DNA was also isolated and sequenced, which contained 8 exons in 5403 bp length. The deduced VfKAS III protein shared approximately 80% identity with homologous KAS IIIs from other plants. Quantitative PCR analysis revealed that KAS II and KAS III were expressed in all of the tissues and organs tested but exhibited different expression patterns in tung tree. The expression levels of KAS II in young tissues were much lower than those in mature tissues, whereas the highest expression levels of KAS III were observed in young stem and young leaf. These results should facilitate further studies on the regulation of tung oil biosynthesis by KAS in tung tree.

  17. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    Science.gov (United States)

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  18. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    Science.gov (United States)

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  19. Genetics Home Reference: GM3 synthase deficiency

    Science.gov (United States)

    ... Facebook Share on Twitter Your Guide to Understanding Genetic Conditions Search MENU Toggle navigation Home Page Search ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions GM3 synthase deficiency GM3 synthase ...

  20. Chalcones as Promising Lead Compounds on Cancer Therapy.

    Science.gov (United States)

    León-González, Antonio J; Acero, Nuria; Muñoz-Mingarro, Dolores; Navarro, Inmaculada; Martín-Cordero, Carmen

    2015-01-01

    Chalcones constitute a group of phenolic compounds that command an increasing interest on cancer research. Natural chalcones are widespread through the plant kingdom. The most abundant and investigated chalcones are isoliquiritigenin, flavokawain and xanthohumol, which are present in the Fabaceae, Piperaceae, Cannabaceae, and Moraceae families. These chalcones have been shown to be promising lead antitumor-chemopreventive drugs by three different activities: antioxidants, cytotoxic and apoptosis inducers. In the recent years, SAR (structure-activity relationship) has contributed towards the improvement of anticancer properties of chalcones by substituting aryl rings and introducing heterocyclic moieties. This review summarizes the anticancer activities shown by natural chalcones and the SAR and describes how different chemical moiety modifications could lead them to be therapeutically useful in the treatment of cancer.

  1. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  2. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  3. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  4. Differential expression of flavonoid biosynthesis genes and accumulation of phenolic compounds in common buckwheat (Fagopyrum esculentum).

    Science.gov (United States)

    Li, Xiaohua; Park, Nam Il; Xu, Hui; Woo, Sun-Hee; Park, Cheol Ho; Park, Sang Un

    2010-12-01

    Common buckwheat (Fagopyrum esculentum) is a short-season grain crop that is a source of rutin and other phenolic compounds. In this study, we isolated the cDNAs of 11 F. esculentum enzymes in the flavonoid biosynthesis pathway, namely, phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), 4-coumarate:CoA ligase (4CL) 1 and 2, chalcone synthase (CHS), chalcone isomerase (CHI), flavone 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H), flavonol synthase (FLS) 1 and 2, and anthocyanidin synthase (ANS). Quantitative real-time polymerase chain reaction analysis showed that these genes were most highly expressed in the stems and roots. However, high performance liquid chromatography analysis indicated that their flavonoid products, such as rutin and catechin, accumulated in the flowers and leaves. These results suggested that flavonoids may be transported within F. esculentum. In addition, light and dark growth conditions affected the expression levels of the biosynthesis genes and accumulation of phenolic compounds in F. esculentum sprouts.

  5. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  6. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  7. Gene therapy via inducible nitric oxide synthase: a tool for the treatment of a diverse range of pathological conditions.

    Science.gov (United States)

    McCarthy, Helen O; Coulter, Jonathan A; Robson, Tracy; Hirst, David G

    2008-08-01

    Nitric oxide (NO(.)) is a reactive nitrogen radical produced by the NO synthase (NOS) enzymes; it affects a plethora of downstream physiological and pathological processes. The past two decades have seen an explosion in the understanding of the role of NO(.) biology, highlighting various protective and damaging modes of action. Much of the controversy surrounding the role of NO(.) relates to the differing concentrations generated by the three isoforms of NOS. Both calcium-dependent isoforms of the enzyme (endothelial and neuronal NOS) generate low-nanomolar/picomolar concentrations of NO(.). By contrast, the calcium-independent isoform (inducible NOS (iNOS)) generates high concentrations of NO(.), 2-3 orders of magnitude greater. This review summarizes the current literature in relation to iNOS gene therapy for the therapeutic benefit of various pathological conditions, including various states of vascular disease, wound healing, erectile dysfunction, renal dysfunction and oncology. The available data provide convincing evidence that manipulation of endogenous NO(.) using iNOS gene therapy can provide the basis for future clinical trials.

  8. Association of a functional variant of the nitric oxide synthase 1 gene with personality, anxiety, and depressiveness.

    Science.gov (United States)

    Kurrikoff, Triin; Lesch, Klaus-Peter; Kiive, Evelyn; Konstabel, Kenn; Herterich, Sabine; Veidebaum, Toomas; Reif, Andreas; Harro, Jaanus

    2012-11-01

    A functional promoter polymorphism of the nitric oxide synthase 1 gene first exon 1f variable number tandem repeat (NOS1 ex1f-VNTR) is associated with impulsivity and related psychopathology. Facets of impulsivity are strongly associated with personality traits; maladaptive impulsivity with neuroticism; and adaptive impulsivity with extraversion. Both high neuroticism and low extraversion predict anxiety and depressive symptoms. The aim of the present study was to evaluate the effect of the NOS1 ex1f-VNTR genotype and possible interaction with environmental factors on personality, anxiety, and depressiveness in a population-representative sample. Short allele carriers had higher neuroticism and anxiety than individuals with the long/long (l/l) genotype. Male short/short homozygotes also had higher extraversion. In the face of environmental adversity, females with a short allele had higher scores of neuroticism, anxiety, and depressiveness compared to the l/l genotype. Males were more sensitive to environmental conditions when they had the l/l genotype and low extraversion. In conclusion, the NOS1 ex1f-VNTR influences personality and emotional regulation dependent on gender and environment. Together with previous findings on the effect of the NOS1 genotype on impulse control, these data suggest that NOS1 should be considered another plasticity gene, because its variants are associated with different coping strategies.

  9. Structural analysis of the promoter of tomato 1-aminocyclopropane-1-carboxylate synthase 6 gene(Le-ACS6)

    Institute of Scientific and Technical Information of China (English)

    LIN JingYu; FAN Rong; WAN XiaoRong; CHARNG Yeeyung; WANG NingNing

    2007-01-01

    Ethylene plays an important role in the regulation of many growth and developmental processes of higher plants. In tomato, Le-ACS6, a member of the ACC synthase multigene family involved in system 1 ethylene biosynthesis during fruit ripening, is subject to negative feedback regulation by ethylene. To identify the cis-elements that are responsible for the negative feedback control, we established an in vitro transient assay system employing particle bombardment on mature-green tomato fruit pericarp to examine the expression of a luciferase (LUC) reporter gene driven by a 5'-serially deleted Le-ACS6 promoter. The results localized putative cis-elements required for negative ethylene-response between -347 and -266 upstream from the translational start site ATG. Several lines of stable transformation of the Le-ACS6 promoter and GUS reporter fusion gene containing internal deletion from -347 to -266 were generated. The expression pattern of the GUS reporter showed that removal of the nucleotides from -347 to -266 completely eliminated the response of the Le-ACS6 promoter to exogenous ethylene.

  10. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  11. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    Science.gov (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  12. Bioinformatic and molecular analysis of hydroxymethylbutenyl diphosphate synthase (GCPE) gene expression during carotenoid accumulation in ripening tomato fruit.

    Science.gov (United States)

    Rodríguez-Concepción, Manuel; Querol, Jordi; Lois, Luisa María; Imperial, Santiago; Boronat, Albert

    2003-07-01

    Carotenoids are plastidic isoprenoid pigments of great biological and biotechnological interest. The precursors for carotenoid production are synthesized through the recently elucidated methylerythritol phosphate (MEP) pathway. Here we have identified a tomato ( Lycopersicon esculentum Mill.) cDNA sequence encoding a full-length protein with homology to the MEP pathway enzyme hydroxymethylbutenyl 4-diphosphate synthase (HDS, also called GCPE). Comparison with other plant and bacterial HDS sequences showed that the plant enzymes contain a plastid-targeting N-terminal sequence and two highly conserved plant-specific domains in the mature protein with no homology to any other sequence in the databases. The ubiquitous distribution of HDS-encoding expressed sequence tags (ESTs) in the tomato collections suggests that the corresponding gene is likely expressed throughout the plant. The role of HDS in controlling the supply of precursors for carotenoid biosynthesis was estimated from the bioinformatic and molecular analysis of transcript abundance in different stages of fruit development. No significant changes in HDS gene expression were deduced from the statistical analysis of EST distribution during fruit ripening, when an active MEP pathway is required to support a massive accumulation of carotenoids. RNA blot experiments confirmed that similar transcript levels were present in both the wild-type and carotenoid-depleted yellow ripe ( r) mutant fruit independent of the stage of development and the carotenoid composition of the fruit. Together, our results are consistent with a non-limiting role for HDS in carotenoid biosynthesis during tomato fruit ripening.

  13. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  14. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  15. Relationship of endothelial nitric oxide synthase gene polymorphism with blood pressure,lipid profile and blood glucose level

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To study the relationship of the polymorphism of endothelial nitric oxide synthase(eNOS)gene and blood pressure,lipid profiles and blood glucose level.By using PCR-RFLP,the eNOS Glu298Asp gene polymorphism was detected in 184 patients with essential hypertension and 196 matched healthy individuals with normal blood pressure.Taking into account eNOS Glu298Asp polymorphisms,the relationship of blood pressure with triglycerides(TG),total cholesterol(TC),high density lipoprotein(HDL),low density lipoprotein(LDL)and blood glucose level was analyzed.The distribution of eNOS Glu298Asp polymorphism had no significant difference between different blood pressure groups and gender groups,but there was a significant difference between different age groups,diastolic blood pressure groups or BMI groups(P<0.05).Asp/Asp genotype significantly increased the risk of hypertension in individuals with serum TC above 5.4 mmol/L(P=0.03,OR=2.65).eNOSGlu298Asp polymorphism and serum lipid could synergistically modulate the blood pressure,eNOS Asp/Asp genotype could significantly increase the risk of hypertension in individuals with serum TC over 5.4 mmol/L,eNOS Glu298Asp in combination with serum TC could be used to predict the risk of hypertension.

  16. The comparative analysis of the potential relationship between resveratrol and stilbene synthase gene family in the development stages of grapes (Vitis quinquangularis and Vitis vinifera).

    Science.gov (United States)

    Shi, Jiangli; He, Mingyang; Cao, Jiangling; Wang, Huan; Ding, Jiahua; Jiao, Yuntong; Li, Ruimin; He, Jing; Wang, Dan; Wang, Yuejin

    2014-01-01

    Resveratrol is positively correlated with grapevine disease resistance and its consumption is also highly beneficial to human health. HPLC analyses showed that resveratrol content was significantly higher in most wild Chinese grapevines than in most European Vitis vinifera grapevine cvs. Fruit of the wild Chinese genotype Vitis quinquangularis Danfeng-2 contains much higher levels of resveratrol than some others. Because stilbene synthase is responsible for resveratrol biosynthesis, 41 full-length stilbene synthase genes were isolated from Danfeng-2 using the RACE method. A neighbor-joining tree of the STS family displayed high similarity between Danfeng-2 and V. vinifera cv. Pinot Noir. The content of the endogenous stilbene synthase family in tissues and the expression levels induced by powdery mildew were both higher in Danfeng-2 than in Pinot Noir. Moreover, expression in the berry was significantly higher than in the leaves. Our results demonstrated that resveratrol accumulation was consistent with endogenous STS gene expressions, and that both were higher in Danfeng-2 than in Pinot Noir. Therefore, STS genes and producing resveratrol from V. quinquangularis played more important role in Vitis resistance. Otherwise, the gene VqSTS6 was markedly higher than the other VqSTS genes in the six tissues/organs assayed by Real-time PCR, which will offer a useful basis for commercial application of resveratrol from Chinese wild grapes.

  17. The Endothelial Nitric Oxide Synthase Gene T-786C Polymorphism Increases Myocardial Infarction Risk: A Meta-Analysis.

    Science.gov (United States)

    Kong, Xiang-Zhen; Zhang, Zheng-Yi; Wei, Lian-Hua; Li, Rui; Yu, Jing

    2017-02-11

    BACKGROUND Polymorphisms of the endothelial nitric oxide synthase (eNOS) gene are reportedly associated with myocardial infarction (MI) risk. However, definitive evidence of this association is lacking. In this study, we investigated the potential association of eNOS gene polymorphisms with MI risk by conducting a meta-analysis of studies evaluating this association. MATERIAL AND METHODS PubMed, Web of Knowledge, ScienceDirect, China National Knowledge Infrastructure (CNKI), WanFang, and Database of Chinese Scientific and Technical Periodicals (VIP) were searched for relevant studies. Pooled odds ratios (OR) with 95% confidence interval (CI) were calculated to evaluate the association of eNOS gene T-786C and 4b4a polymorphisms with MI risk. RESULTS Fifteen studies with 8,067 controls and 4,923 MI cases were included in the final meta-analysis. In the overall analysis, T-786C (rs2070744) polymorphism was associated with MI risk (p<0.05, OR=1.69, 95% CI: 1.53-1.86 for T vs. C; p<0.05, OR=2.76, 95% CI: 2.03-3.75 for TT vs. CC; p<0.05, OR=1.74, 95% CI 1.56-1.95 for TT vs. (CT + CC); p<0.05, OR=2.43, 95% CI: 1.79-3.30 for (CT + TT) vs. CC). In addition, a significant association between 4b4a VNTR polymorphism and MI risk was observed. On sub-group analyses by ethnicity, a significant increase in MI risk was observed separately for Asian and Caucasian populations for T-786C polymorphism, but not for the 4b4a polymorphism. CONCLUSIONS In this meta-analysis, T-786C polymorphism of the eNOS gene was associated with the risk of MI, especially in the Asian populations.

  18. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  19. CHALCONE AS A VERSATILE MOIETY FOR DIVERSE PHARMACOLOGICAL ACTIVITIES

    Directory of Open Access Journals (Sweden)

    Hatish Prashar*, Anshul Chawla, Anil Kumar Sharma and Rajeev Kharb

    2012-07-01

    Full Text Available Chalcones are 1, 3-diphenyl-2-propene-1-one, consist of two aromatic rings linked by a three carbon α, β-unsaturated carbonyl system. The chemistry of chalcones has generated intensive scientific studies throughout the world. Especially interest has been focused on the synthesis and biodynamic activities of chalcones. These are considered to be precursors of flavonoids and isoflavonoids. The aim of this review is to summarize chalcones and their diverse pharmacological activities like anticancer, antimicrobial, analgesic and antiviral activities etc.

  20. Recent trends of chalcones potentialities as antiproliferative and antiresistance agents.

    Science.gov (United States)

    Winter, Evelyn; Locatelli, Claudriana; Di Pietro, Attilio; Creczynski-Pasa, Tânia B

    2015-01-01

    Chalcones are natural compounds found in plants, fruits and vegetables. This class of compounds has shown many biological activities including antioxidant, antimicrobial, anti-inflammatory, antifungal and antihypertensive, among others. In cancer, it has been reported that chalcones interfere in several points of the signal transduction pathways related to cellular proliferation, angiogenesis, metastasis, apoptosis and the reversal of multidrug resistance. The large number of research articles and patents related to chalcones is already an indication of their importance as a lead class of compounds. This article gathers recent efforts to elucidate the molecular mechanisms of action of chalcones, associated with their anticancer and anti resistance potential.

  1. Biosynthesis of biphenyls and benzophenones--evolution of benzoic acid-specific type III polyketide synthases in plants.

    Science.gov (United States)

    Beerhues, Ludger; Liu, Benye

    2009-01-01

    Type III polyketide synthases (PKSs) generate a diverse array of secondary metabolites by varying the starter substrate, the number of condensation reactions, and the mechanism of ring closure. Among the starter substrates used, benzoyl-CoA is a rare starter molecule. Biphenyl synthase (BIS) and benzophenone synthase (BPS) catalyze the formation of identical linear tetraketide intermediates from benzoyl-CoA and three molecules of malonyl-CoA but use alternative intramolecular cyclization reactions to form 3,5-dihydroxybiphenyl and 2,4,6-trihydroxybenzophenone, respectively. In a phylogenetic tree, BIS and BPS group together closely, indicating that they arise from a relatively recent functional diversification of a common ancestral gene. The functionally diverse PKSs, which include BIS and BPS, and the ubiquitously distributed chalcone synthases (CHSs) form separate clusters, which originate from a gene duplication event prior to the speciation of the angiosperms. BIS is the key enzyme of biphenyl metabolism. Biphenyls and the related dibenzofurans are the phytoalexins of the Maloideae. This subfamily of the Rosaceae includes a number of economically important fruit trees, such as apple and pear. When incubated with ortho-hydroxybenzoyl (salicoyl)-CoA, BIS catalyzes a single decarboxylative condensation with malonyl-CoA to form 4-hydroxycoumarin. A well-known anticoagulant derivative of this enzymatic product is dicoumarol. Elicitor-treated cell cultures of Sorbus aucuparia also formed 4-hydroxycoumarin when fed with the N-acetylcysteamine thioester of salicylic acid (salicoyl-NAC). BPS is the key enzyme of benzophenone metabolism. Polyprenylated benzophenone derivatives with bridged polycyclic skeletons are widely distributed in the Clusiaceae (Guttiferae). Xanthones are regioselectively cyclized benzophenone derivatives. BPS was converted into a functional phenylpyrone synthase (PPS) by a single amino acid substitution in the initiation/elongation cavity. The

  2. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips.

    Science.gov (United States)

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A

    2013-09-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound.

  3. Regulation of expression of GLT1, the gene encoding glutamate synthase in Saccharomyces cerevisiae.

    Science.gov (United States)

    Valenzuela, L; Ballario, P; Aranda, C; Filetici, P; González, A

    1998-07-01

    Saccharomyces cerevisiae glutamate synthase (GOGAT) is an oligomeric enzyme composed of three 199-kDa identical subunits encoded by GLT1. In this work, we analyzed GLT1 transcriptional regulation. GLT1-lacZ fusions were prepared and GLT1 expression was determined in a GDH1 wild-type strain and in a gdh1 mutant derivative grown in the presence of various nitrogen sources. Null mutants impaired in GCN4, GLN3, GAT1/NIL1, or UGA43/DAL80 were transformed with a GLT1-lacZ fusion to determine whether the above-mentioned transcriptional factors had a role in GLT1 expression. A collection of increasingly larger 5' deletion derivatives of the GLT1 promoter was constructed to identify DNA sequences that could be involved in GLT1 transcriptional regulation. The effect of the lack of GCN4, GLN3, or GAT1/NIL1 was also tested in the pertinent 5' deletion derivatives. Our results indicate that (i) GLT1 expression is negatively modulated by glutamate-mediated repression and positively regulated by Gln3p- and Gcn4p-dependent transcriptional activation; (ii) two cis-acting elements, a CGGN15CCG palindrome and an imperfect poly(dA-dT), are present and could play a role in GLT1 transcriptional activation; and (iii) GLT1 expression is moderately regulated by GCN4 under amino acid deprivation. Our results suggest that in a wild-type strain grown on ammonium, GOGAT constitutes an ancillary pathway for glutamate biosynthesis.

  4. Sequence analysis of a 9873 bp fragment of the left arm of yeast chromosome XV that contains the ARG8 and CDC33 genes, a putative riboflavin synthase beta chain gene, and four new open reading frames.

    Science.gov (United States)

    Casas, C; Aldea, M; Casamayor, A; Lafuente, M J; Gamo, F J; Gancedo, C; Ariño, J; Herrero, E

    1995-09-15

    The DNA sequence of a 9873 bp fragment located near the left telomere of chromosome XV has been determined. Sequence analysis reveals seven open reading frames. One is the ARG8 gene coding for N-acetylornithine aminotransferase. Another corresponds to CDC33, which codes for the initiation factor 4E or cap binding protein. The open reading frame AOE169 can be considered as the putative gene for the Saccharomyces cerevisiae riboflavin synthase beta chain, since its translation product shows strong homology with four prokaryotic riboflavin synthase beta chains.

  5. Cloning and expression of quorum sensing N-acyl-homoserine synthase (LuxI gene detected in Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Farzan Modarresi

    2016-05-01

    Full Text Available Objectives: In present study we aimed to clone the luxI gene encoding N-acyl-homoserine synthase detected in biofilm forming clinical isolates of Acinetobacter baumannii and study its expression in Escherichia coli transformants.Materials and Methods: Four A. baumannii hospital strains which demonstrated strong biofilm activity were selected in this investigation. The presence of luxI gene was detected using PCR technique. Purified PCR product DNA was initially cloned to pTG19 plasmid embedded with overhang 3'dT residue and transformed to Escherichia coli K12 DH5α (luxI- mutant. The gene was then recovered from agarose gel after digestion after digestion with DraI restriction enzyme and ligated by T4 DNA ligase into pET28a expression vector using NdeI and XhoI enzymes. Recombinant (pET28a + luxI was transformed into E. coli BL21 (DE3 containing knockout luxI- gene. The luxI putative gene was further detected in transformants by colony PCR. Expression of the luxI gene in the recombinant E. coli BL21 cells was studied by quantitative real time PCR (qRT-PCR and the presence of N-acyl-homoserine lactone (AHL in wild types and the transformants were checked by colorimetric assay and Fourier Transform Infra- Red (FT-IR.Results: In our study, we found successful cloning of AHL from A. baumannii strain 23 which showed high biofilm. The presence of luxI gene in recombinant E. coli BL21 was confirmed by PCR. There was four fold increases in expression of luxI in the transformants (P ≤ 0.05. To verify the AHL synthesis, it was found that, strain 23 and the transformants showed highest amount of AHL activity (OD = 1.524. The FT-IR analysis indicated stretching C=O bond of the lactone ring and primary amides (N=H at 1764.69 cm-1 and 1659.23 cm-1 respectively.Conclusion: From above results we concluded that, luxI and AHL are the only quorum sensing elements existed in A. baumannii and pET28a vector allows efficient AHL expression in E. coli BL21

  6. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Yan Ping Lim

    2016-06-01

    Full Text Available Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalcone synthase in plants to novel PKSs in bacteria and fungi. To date, at least 15 families of type III PKSs have been characterized, highlighting the utility of PKSs in the development of natural product libraries for therapeutic development.

  7. Influence of hCG on inducible nitric oxide synthase gene expression in ram testicular arteries

    Directory of Open Access Journals (Sweden)

    Maria Matteo

    2014-09-01

    Full Text Available Background. Experimental evidence suggests a relationship between the vasodilatory effect of hCG and the NOS system in the testis. The influence of hCG administration on testicular vascular NOS gene expression has not been fully investigated. Objective: This study aimed to evaluate the presence of the nitric oxide syntheses gene in ram testicular arteries and the influence of hCG administration on its expression. Materials and methods: Both testicular arteries of sixteen rams were extracted before and after i.v. administration of 5000 IU of hCG or placebo. The expression of the iNOS gene was investigated by real time PCR. Data were analyzed by means of Wilcoxon and Mann-Whitney tests. A p value of < 0.05 was considered statistically significant. Results: PCR revealed the presence of iNOS mRNA in all basal samples but the expression of the iNOS gene was significantly reduced in all arteries obtained 24 h after the administration of either hCG or placebo. A significant reduction in the expression of iNOS gene was observed in the testicular arteries extracted after 24 h in both treated and placebo groups. On the other hand hCG stimulation did not significantly influence iNOS expression following its administration compared to a placebo. Conclusion: Ram testicular arteries express the iNOS gene but hCG stimulation did not significantly influence iNOS expression. A significant reduction in the expression of this gene was observed in the testicular arteries extracted after 24 h in both treated and placebo groups, suggesting that iNOS expression on the testicular artery could be influenced by the spermatic vessel ligation of the controlateral testis.

  8. Polymorphisms in thymidylate synthase gene and susceptibility to breast cancer in a Chinese population: a case-control analysis

    Directory of Open Access Journals (Sweden)

    Liu Jiyong

    2006-05-01

    Full Text Available Abstract Background Accumulative evidence suggests that low folate intake is associated with increased risk of breast cancer. Polymorphisms in genes involved in folate metabolism may influence DNA methylation, nucleotide synthesis, and thus individual susceptibility to cancer. Thymidylate synthase (TYMS is a key enzyme that participates in folate metabolism and catalyzes the conversion of dUMP to dTMP in the process of DNA synthesis. Two potentially functional polymorphisms [a 28-bp tandem repeat in the TYMS 5'-untranslated enhanced region (TSER and a 6-bp deletion/insertion in the TYMS 3'-untranslated region (TS 3'-UTR] were suggested to be correlated with alteration of thymidylate synthase expression and associated with cancer risk. Methods To test the hypothesis that polymorphisms of the TYMS gene are associated with risk of breast cancer, we genotyped these two polymorphisms in a case-control study of 432 incident cases with invasive breast cancer and 473 cancer-free controls in a Chinese population. Results We found that the distribution of TS3'-UTR (1494del6 genotype frequencies were significantly different between the cases and controls (P = 0.026. Compared with the TS3'-UTR del6/del6 wild-type genotype, a significantly reduced risk was associated with the ins6/ins6 homozygous variant genotype (adjusted OR = 0.58, 95% CI = 0.35–0.97 but not the del6/ins6 genotype (OR = 1.09, 95% CI = 0.82–1.46. Furthermore, breast cancer risks associated with the TS3'-UTR del6/del6 genotype were more evident in older women, postmenopausal subjects, individuals with a younger age at first-live birth and individuals with an older age at menarche. However, there was no evidence for an association between the TSER polymorphism and breast cancer risks. Conclusion These findings suggest that the TS3'-UTR del6 polymorphism may play a role in the etiology of breast cancer. Further larger population-based studies as well as functional evaluation of the

  9. Structural Antitumoral Activity Relationships of Synthetic Chalcones

    Directory of Open Access Journals (Sweden)

    Cesar Echeverria

    2009-01-01

    Full Text Available Relationships between the structural characteristic of synthetic chalcones and their antitumoral activity were studied. Treatment of HepG2 cells for 24 h with synthetic 2’-hydroxychalcones resulted in apoptosis induction and dose-dependent inhibition of cell proliferation. The calculated reactivity indexes and the adiabatic electron affinities using the DFT method including solvent effects, suggest a structure-activity relationship between the Chalcones structure and the apoptosis in HepG2 cells. The absence of methoxy substituents in the B ring of synthetic 2’-hydroxychalcones, showed the mayor structure-activity pattern along the series.

  10. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    Science.gov (United States)

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  11. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    Science.gov (United States)

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  12. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers.

    Science.gov (United States)

    Wen, Xiao-Peng; Pang, Xiao-Ming; Matsuda, Narumi; Kita, Masayuki; Inoue, Hiromichi; Hao, Yu-Jin; Honda, Chikako; Moriguchi, Takaya

    2008-04-01

    An apple spermidine synthase (SPDS) gene (MdSPDS1) was verified to encode a functional protein by the complementation of the spe3 yeast mutant, which lacks the SPDS gene. To justify our hypothesis that apple SPDS is involved in abiotic stress responses and to obtain transgenic fruit trees tolerant to abiotic stresses as well, MdSPDS1-over-expressing transgenic European pear (Pyrus communis L. 'Ballad') plants were created by Agrobacterium-mediated transformation. A total of 21 transgenic lines showing various spermidine (Spd) titers and MdSPDS1 expression levels were obtained. Selected lines were exposed to salt (150 mM NaCl), osmosis (300 mM mannitol), and heavy metal (500 microM CuSO4) stresses for evaluating their stress tolerances. Transgenic line no. 32, which was revealed to have the highest Spd accumulation and expression level of MdSPDS1, showed the strongest tolerance to these stresses. When growth increments, electrolyte leakage (EL), and values of thiobarbituric acid reactive substances (TBARS) were monitored, line no. 32 showed the lowest growth inhibition and the least increase in EL or TBARS under stress conditions. Spd titers in wild-type and transgenic lines showed diverse changes upon stresses, and these changes were not consistent with the changes in MdSPDS1 expressions. Moreover, there were no differences in the sodium concentration in the shoots between the wild type and line no. 32, whereas the copper concentration was higher in the wild type than in line no. 32. Although the mechanism(s) underlying the involvement of polyamines in stress responses is not known, these results suggest that the over-expression of the SPDS gene substantially increased the tolerance to multiple stresses by altering the polyamine titers in pear. Thus, MdSPDS1-over-expressing transgenic pear plants could be used to improve desert land and/or to repair polluted environments.

  13. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    Science.gov (United States)

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarity with FLSs from other plant species. Using quantitative real-time PCR and high-performance liquid chromatography (HPLC), the expression of FtFLS1/2 and the production of 3 main flavonols (kaempferol, myricetin and quercetin) was detected in roots, leaves, stems, flowers and different stages of developing seeds. The relationship between the expression of the 2 FLS genes and the accumulation of the 3 basic flavonols was analyzed in 2 tartary buckwheat cultivars. FtFLS1 and FtFLS2 exhibited differential transcriptional levels between the tartary buckwheat cultivars 'Hokkai T10' and 'Hokkai T8'. Generally, higher transcript levels of FtFLS1 and FtFLS2 and a higher amount of flavonols were observed in the 'Hokkai T10' cultivar than 'Hokkai T8'. The content of flavonols showed tissue-specific accumulation between the 2 cultivars. The transcription of FtFLS1 was inhibited by the exogenous application of abscisic acid (ABA), salicylic acid (SA) and sodium chloride (NaCl), while FtFLS2 was not affected by ABA but up-regulated by SA and NaCl. These data indicate that the 2 FtFLS isoforms of buckwheat have different functions in the response of buckwheat to environmental stress.

  14. Five new prenylated chalcones from Desmodium renifolium.

    Science.gov (United States)

    Li, Yan-Ping; Yang, Yu-Chun; Li, Yin-Ke; Jiang, Zhi-Yong; Huang, Xiang-Zhong; Wang, Wei-Guang; Gao, Xue-Mei; Hu, Qiu-Fen

    2014-06-01

    Five unusual new prenylated chalcones, renifolins D-H (1-5), were isolated from whole Desmodium renifolium plants. All of their structures were determined by spectroscopic methods including 1D and 2D NMR. All of the isolates were evaluated for cytotoxicity using five tumor cell lines. Compounds 2 and 3 exhibited cytotoxicity against A549 cells, with IC50 values of 2.8 and 2.2 μM, respectively.

  15. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette;

    2012-01-01

    Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...... and NRPS genes in sequenced Fusarium species and their known products. With the rapid increase in the number of sequenced fungal genomes a systematic classification will greatly aid the scientific community in obtaining an overview of the number of different NRPS and PKS genes and their potential...

  16. Cloning of the Soybean Chalcone Reductase Gene GmCHR and Construction of Its Plant Expression Vector%大豆查尔酮还原酶基因GmCHR的克隆与植物表达载体构建

    Institute of Scientific and Technical Information of China (English)

    刘江; 陈沛; 邢光南; 赵团结; 李艳; 盖钧镒

    2013-01-01

    黄酮类化合物在植物中参与过滤紫外线、固氮和花色形成等过程,异黄酮对人体有抗氧化、预防乳腺癌等保健作用.查尔酮还原酶(chalcone reductase,CHR)是植物中参与黄酮类化合物代谢的重要酶.克隆大豆查尔酮还原酶基因并构建植物表达载体,有助于进一步研究其功能和异黄酮的代谢过程.采用RT-PCR方法,从栽培大豆(Gly-cine mx)南农1138-2中,克隆得到了第14号染色体上的一个编码大豆查尔酮还原酶(chalcone reductase,CHR)的基因,命名为GmCHR.该基因含有948 bp长的编码区序列(Coding DNA Sequence,CDS),编码315个氨基酸.预测其蛋白质分子量为35.5 kDa,等电点为6.32.与其他豆科植物中的查尔酮还原酶相比,GmCHR蛋白序列与葛藤(Puerariae montana)CHR的相似性最高,达94%.组织表达分析表明,在自然生长条件下GmCHR在叶中的表达量最大;其次是种子;在花和茎中相同;在根中的表达量最小.利用Gateway方法获得植物过表达载体pMDC83-GmCHR,经检测表明过表达载体已成功转化农杆菌EHA105,为今后进一步了解GmCHR在大豆异黄酮代谢过程中的功能提供材料基础.%Flavonoids are involved in UV filtration,symbiotic nitrogen fixation and floral pigmentation in plants. Isoflavones have potential effects on human health,such as antioxirlant activity,preventing breast cancer and other cancers. Chalcone reductase ( CHR) is an important enzyme involved in flavonoid biosynthesis. Cloning of soybean chalcone reductase and construction of its plant expression vector would help study its function and the phenylpropanoid pathway. A gene encoding CHR on chromosome 14 was cloned from the cultivated soybean( Giycine max)cultivar Nannong 1138-2 using RT-PCR,and was designated as GmCHR. This gene contains a coding DNA sequence(CDS)of 948 bp,and the corresponding protein consists of 315 a-mino acids. The protein is estimated to have a molecular weight of 35.5 kDa and

  17. Activation of oxidative stress response by hydroxyl substituted chalcones and cyclic chalcone analogues in mitochondria.

    Science.gov (United States)

    Guzy, J; Vasková-Kubálková, J; Rozmer, Z; Fodor, K; Mareková, M; Poskrobová, M; Perjési, P

    2010-02-05

    We investigated the effect of hydroxyl substituted chalcone (1a) and some chalcone analogues (1b-d) on isolated rat liver mitochondria to gain new insights into the cytotoxic mechanism of these compounds. We observed an inhibitory effect on phosphorylation and the partial uncoupling of compounds 1a and 1d. Increased radical generation and possible covalent interaction of the compounds with cellular thiols resulted in glutathione (GSH) depletion and modulation of the investigated mitochondrial activities. Disruption of interconnected mechanisms as electron transport chain and energetic metabolism, ROS production and insufficiency of antioxidant defensive system could lead to induction of cell death.

  18. De Novo Sequencing and Analysis of the Safflower Transcriptome to Discover Putative Genes Associated with Safflor Yellow in Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Xiuming Liu

    2015-10-01

    Full Text Available Safflower (Carthamus tinctorius L., an important traditional Chinese medicine, is cultured widely for its pharmacological effects, but little is known regarding the genes related to the metabolic regulation of the safflower’s yellow pigment. To investigate genes related to safflor yellow biosynthesis, 454 pyrosequencing of flower RNA at different developmental stages was performed, generating large databases.In this study, we analyzed 454 sequencing data from different flowering stages in safflower. In total, 1,151,324 raw reads and 1,140,594 clean reads were produced, which were assembled into 51,591 unigenes with an average length of 679 bp and a maximum length of 5109 bp. Among the unigenes, 40,139 were in the early group, 39,768 were obtained from the full group and 28,316 were detected in both samples. With the threshold of “log2 ratio ≥ 1”, there were 34,464 differentially expressed genes, of which 18,043 were up-regulated and 16,421 were down-regulated in the early flower library. Based on the annotations of the unigenes, 281 pathways were predicted. We selected 12 putative genes and analyzed their expression levels using quantitative real time-PCR. The results were consistent with the 454 sequencing results. In addition, the expression of chalcone synthase, chalcone isomerase and anthocyanidin synthase, which are involved in safflor yellow biosynthesis and safflower yellow pigment (SYP content, were analyzed in different flowering periods, indicating that their expression levels were related to SYP synthesis. Moreover, to further confirm the results of the 454 pyrosequencing, full-length cDNA of chalcone isomerase (CHI and anthocyanidin synthase (ANS were cloned from safflower petal by RACE (Rapid-amplification of cDNA ends method according to fragment of the transcriptome.

  19. Cloning and expression of anthocyanin biosynthetic genes in red and white pomegranate.

    Science.gov (United States)

    Zhao, Xueqing; Yuan, Zhaohe; Feng, Lijuan; Fang, Yanming

    2015-07-01

    Exterior fruit color is an important trait for the evaluation of pomegranate fruit quality, but the molecular mechanism underlying the variation in color between red- and white-fruited pomegranate is poorly understood. In this study, full-length cDNA clones encoding enzymes involved in anthocyanin biosynthesis-such as chalcone synthase, chalcone isomerase, flavanone 3-hydoxylase, dihydroflavonol 4-reductase, anthocyanidin synthase (ANS), UDP-glucose-flavonoid 3-O-glucosyltransferase, and the R2R3 MYB transcription factor PgMYB-were isolated from fruit peels. In addition, transcript levels of anthocyanin biosynthetic genes were quantitatively measured by real-time PCR in red and white fruits. In both cultivars, two expression peaks for structural genes were detected during fruit development, whereas only one peak was observed-during early development-for PgMYB. While PgMYB is important for flavonoid biosynthesis, other transcription factors appear to also be necessary for the regulation of anthocyanin biosynthesis. No anthocyanins were detected in the white cultivar. Peels of white fruits contained transcripts of all identified genes except for PgANS, suggesting that the lack of PgANS expression may be the main factor responsible for the absence of anthocyanins in white pomegranate. PgANS may be the key gene involved in anthocyanin biosynthesis in pomegranate fruit.

  20. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  1. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars.

    Directory of Open Access Journals (Sweden)

    Cornelia Chizzali

    Full Text Available Pear (Pyrus communis is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS. Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in 'Harrow Sweet', while only PcBIS2 transcripts were detected in 'Alexander Lucas' and 'Conference'. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight was observed in the transition zone of 'Harrow Sweet', whereas the concentrations were ten times lower in 'Conference' and not even detectable in 'Alexander Lucas'. In 'Harrow Sweet', the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of 'Alexander Lucas' and 'Conference' advanced down to the rootstock, resulting in necrosis of the entire shoots.

  2. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars.

    Science.gov (United States)

    Chizzali, Cornelia; Swiddan, Asya K; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in 'Harrow Sweet', while only PcBIS2 transcripts were detected in 'Alexander Lucas' and 'Conference'. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of 'Harrow Sweet', whereas the concentrations were ten times lower in 'Conference' and not even detectable in 'Alexander Lucas'. In 'Harrow Sweet', the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of 'Alexander Lucas' and 'Conference' advanced down to the rootstock, resulting in necrosis of the entire shoots.

  3. Cloning and Characterisation of the Gene Encoding 3-Hydroxy-3-Methylglutaryl-CoA Synthase in Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Yu-Jia Liu

    2014-11-01

    Full Text Available Tripterygium wilfordii is a traditional Chinese medical plant used to treat rheumatoid arthritis and cancer. The main bioactive compounds of the plant are diterpenoids and triterpenoids. 3-Hydroxy-3-methylglutaryl-CoA synthase (HMGS catalyses the reaction of acetoacetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA, which is the first committed enzyme in the mevalonate (MVA pathway. The sequence information of HMGS in Tripterygium wilfordii is a basic resource necessary for studying the terpenoids in the plant. In this paper, full-length cDNA encoding HMGS was isolated from Tripterygium wilfordii (abbreviated TwHMGS, GenBank accession number: KM978213. The full length of TwHMGS is 1814 bp, and the gene encodes a protein with 465 amino acids. Sequence comparison revealed that TwHMGS exhibits high similarity to HMGSs of other plants. The tissue expression patterns revealed that the expression level of TwHMGS is highest in the stems and lowest in the roots. Induced expression of TwHMGS can be induced by MeJA, and the expression level is highest 4 h after induction. The functional complement assays in the YML126C knockout yeast demonstrated that TwHMGS participates in yeast terpenoid biosynthesis.

  4. Functional analyses of a flavonol synthase - like gene from Camellia nitidissima reveal its roles in flavonoid metabolism during floral pigmentation

    Indian Academy of Sciences (India)

    Xing-Wen Zhou; Zheng-Qi Fan; Yue Chen; Yu-Lin Zhu; Ji-Yuan Li; Heng-Fu Yin

    2013-09-01

    The flavonoids metabolic pathway plays central roles in floral coloration, in which anthocyanins and flavonols are derived from common precursors, dihydroflavonols. Flavonol synthase (FLS) catalyses dihydroflavonols into flavonols, which presents a key branch of anthocyanins biosynthesis. The yellow flower of Camellia nitidissima Chi. is a unique feature within the genus Camellia, which makes it a precious resource for breeding yellow camellia varieties. In this work, we characterized the secondary metabolites of pigments during floral development of C. nitidissima and revealed that accumulation of flavonols correlates with floral coloration. We first isolated CnFLS1 and showed that it is a FLS of C. nitidissima by gene family analysis. Second, expression analysis during floral development and different floral organs indicated that the expression level of CnFLS1 was regulated by developmental cues, which was in agreement with the accumulating pattern of flavonols. Furthermore, over-expression of CnFLS1 in Nicotiana tabacum altered floral colour into white or light yellow, and metabolic analysis showed significant increasing of flavonols and reducing of anthocyanins in transgenic plants. Our work suggested CnFLS1 plays critical roles in yellow colour pigmentation and is potentially a key point of genetic engineering toward colour modification in Camellia.

  5. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    Science.gov (United States)

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest.

  6. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    Science.gov (United States)

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  7. Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum.

    Science.gov (United States)

    Tijerino, Anamariela; Cardoza, R Elena; Moraga, Javier; Malmierca, Mónica G; Vicente, Francisca; Aleu, Josefina; Collado, Isidro G; Gutiérrez, Santiago; Monte, Enrique; Hermosa, Rosa

    2011-03-01

    Trichoderma brevicompactum produces trichodermin, a simple trichothecene-type toxin that shares the first steps of the sesquiterpene biosynthetic pathway with other phytotoxic trichothecenes from Fusarium spp. Trichodiene synthase catalyses the conversion of farnesyl pyrophosphate to trichodiene and it is encoded by the tri5 gene that was cloned and analysed functionally by homologous overexpression in T. brevicompactum. tri5 expression was up-regulated in media with glucose, H(2)O(2) or glycerol. tri5 repression was observed in cultures supplemented with the antioxidants ferulic acid and tyrosol. Acetone extracts of tri5-overexpressing transformants displayed higher antifungal activity than those from the wild-type. Chromatographic and spectroscopic analyses revealed that tri5 overexpression led to an increased production of trichodermin and tyrosol. Agar diffusion assays with these two purified metabolites from the tri5-overexpressing transformant T. brevicompactum Tb41tri5 showed that only trichodermin had antifungal activity against Saccharomyces cerevisiae, Kluyveromyces marxianus, Candida albicans, Candida glabrata, Candida tropicalis and Aspergillus fumigatus, in most cases such activity being higher than that observed for amphotericin B and hygromycin. Our results point to the significant role of tri5 in the production of trichodermin and in the antifungal activity of T. brevicompactum.

  8. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles

    OpenAIRE

    Piel, Jörn

    2002-01-01

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were ...

  9. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  10. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  11. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    Science.gov (United States)

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers.

  12. Genomic structure and sequence polymorphism of E,E-alphafarnesene synthase gene in apples (Malus domestica Borkh.)

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Primer pairs were designed to amplify the genomic DNA sequence of the alpha-farnesene synthase (AFS) gene by PCR.The PCR products were sequenced,spliced and compared to Cdna sequences in the GenBank (accession No.AY182241).The genomic sequence and intron-exon organization of the AFS gene were thus obtained.The AFS genomic sequence has been registered in the GenBank (accession No.DQ901739).It has 6 introns and 7 exons,encoding a protein of 576 amino acids.The sizes of the 6 introns were 108 bp,113 bp,>1000 bp,125 bp,220 bp and 88 bp,and their phases were 0,1,2,2,0,0,respectively.The sizes of the deduced amino acids of the 7 exons were 57,89,127,73,48,83 and 99,respectively.The AFS protein contained three motifs:the RR(X8)W motif encoded by a sequence in exon 1,and the RxR motif and DDxxD motif encoded by two sequences in exon 4.After comparing the AFS genomic sequence (accession No.DQ901739) to the Cdna sequence (accession No.AY523409) in the GenBank,it was found that there were 6 single-nucleotide polymorphisms between the two sequences,four of which caused mutations at the amino acid level.Interestingly,one amino acid mutation (291R→G) was found in the RxR motif,and further investigation is needed to determine whether the alpha-farnesene synthesis ability and superficial scald susceptibility of apples are influenced by this amino acid mutation and other mutations.

  13. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  14. A type-B response regulator drives the expression of the hydroxymethylbutenyl diphosphate synthase gene in periwinkle.

    Science.gov (United States)

    Ginis, Olivia; Oudin, Audrey; Guirimand, Grégory; Chebbi, Mouadh; Courdavault, Vincent; Glévarec, Gaëlle; Papon, Nicolas; Crèche, Joel; Courtois, Martine

    2012-10-15

    In plant cytokinin (CK) signaling, type-B response regulators (RRs) act as major players in orchestrating the transcriptome changes in response to CK. However, their direct targets are poorly known. The identification of putative type-ARR1 motifs located within the promoter of the CK-responsive hydroxyl methyl butenyl diphosphate synthase (HDS) gene from the methyl erythritol phosphate (MEP) pathway prompted us to investigate the ability of a previously isolated periwinkle type-B RR (CrRR5) that presents high homologies with ARR1 to interact with the promoter. Electrophoretic mobility shift assays (EMSAs) demonstrated that the CrRR5 DNA-binding domain binds specifically type-ARR1 motifs within the HDS promoter. We also established through yellow fluorescent protein (YFP) imaging the targeting of CrRR5 into cell nucleus in accordance with its putative function of transcription factor. In transient assays performed on periwinkle cells cultivated with CK, overexpression of the full-length CrRR5 or a truncated CrRR5 engineering a constitutive active form (35S:ΔDDK) did not affect the HDS promoter activity that reached a threshold. By contrast, in absence of CK, overexpression of CrRR5ΔDDK enhanced promoter activity up to the threshold level observed in cells grown with CK. Our results strongly suggest that CrRR5 directly transactivates the HDS promoter. CrRR5 is the first identified transcription factor mediating the CK signaling that targets a gene from the MEP pathway involved in isoprenoid metabolism. Moreover, CrRR5 could play a role in a regulatory mechanism controlling CK homeostasis in periwinkle cells.

  15. Overexpression of a Potato Sucrose Synthase Gene in Cotton Accelerates Leaf Expansion,Reduces Seed Abortion, and Enhances Fiber Production

    Institute of Scientific and Technical Information of China (English)

    Shou-Min Xu; Elizabeth Brill; Danny J.Llewellyn; Robert T.Furbank; Yong-Ling Ruan

    2012-01-01

    Sucrose synthase (Sus) is a key enzyme in the breakdown of sucrose and is considered a biochemical marker for sink strength,especially in crop species,based on mutational and gene suppression studies.It remains elusive,however,whether,or to what extent,increase in Sus activity may enhance sink development.We aimed to address this question by expressing a potato Sus gene in cotton where Sus expression has been previously shown to be critical for normal seed and fiber development.Segregation analyses at T1 generation followed by studies in homozygous progeny lines revealed that increased Sus activity in cotton (1) enhanced leaf expansion with the effect evident from young leaves emerging from shoot apex; (2) improved early seed development,which reduced seed abortion,hence enhanced seed set,and (3) promoted fiber elongation.In young leaves of Sus overexpressing lines,fructose concentrations were significantly increased whereas,in elongating fibers,both fructose and glucose levels were increased.Since hexoses contribute little to osmolality in leaves,in contrast to developing fibers,it is concluded that high Sus activity promotes leaf development independently of osmotic regulation,probably through sugar signaling.The analyses also showed that doubling the Sus activity in 0-d cotton seeds increased their fresh weight by about 30%.However,further increase in Sus activity did not lead to any further increase in seed weight,indicating an upper limit for the Sus overexpression effect.Finally,based on the observed additive effect on fiber yield from increased fiber length and seed number,a new strategy is proposed to increase cotton fiber yield by improving seed development as a whole,rather than solely focusing on manipulating fiber growth.

  16. Ligands of Peroxisome Proliferator-activated Receptor Inhibit Homocysteineinduced DNA Methylation of Inducible Nitric Oxide Synthase Gene

    Institute of Scientific and Technical Information of China (English)

    Yideng JIANG; Jianzhong ZHANG; Jiantuan XIONG; Jun CAO; Guizhong LI; Shuren WANG

    2007-01-01

    Homocysteine (Hcy) is a risk factor for atherosclerosis. It is generally accepted that inducible nitric oxide synthase (iNOS) is a key enzyme in the regulation of vascular disease. The aim of the present study is to investigate the effects of peroxisome proliferator-activated receptor ligands on iNOS in the presence of Hcy in human monocytes. Foam cells, induced by oxidize low density lipoprotein (ox-LDL) and phorbol myristate acetate (PMA) in the presence of different concentrations of Hcy, clofibrate and pioglitazone in human monocytes for 4 d, were examined by oil red O staining. The activity of iNOS was detected by real-time quantitative reverse transcription-polymerase chain reaction and Western blot analysis. The capability of DNA methylation was measured by assaying endogenous C5 DNA methyltransferase (C5MTase)activity, and the iNOS promoter methylation level was determined by quantitative MethyLight assays. The results indicated that Hcy increased the activity of C5MTase and the level of iNOS gene DNA methylation,resulting in a decrease of iNOS expression. Clofibrate and pioglitazone could antagonize the Hcy effect on iNOS expression through DNA methylation, resulting in attenuation of iNOS transcription. These findings suggested that Hcy decreased the expression of iNOS by elevating iNOS DNA methylation levels, which can repress the transcription of some genes. Peroxisome proliferator-activated receptor α/γ ligands can down-regulate iNOS DNA methylation, and could be useful for preventing Hcy-induced atherosclerosis by repressing iNOS expression.

  17. Chalcone derivatives as potential antifungal agents: Synthesis, and antifungal activity

    Directory of Open Access Journals (Sweden)

    Deepa Gupta

    2015-01-01

    Full Text Available Much research has been carried out with the aim to discover the therapeutic values of chalcone derivatives. Chalcones possess wide range of pharmacological activity such as antibacterial, antimalarial, antiprotozoal, antitubercular, anticancer, and antifungal agents etc. The presence of reactive α,β-unsaturated keto group in chalcones is found to be responsible for their biological activity. The rapid developments of resistance to antifungal agents, led to design, and synthesize the new antifungal agents. The derivatives of chalcones were prepared using Claisen-Schmidt condensation scheme with appropriate tetralone and aldehyde derivatives. Ten derivatives were synthesized and were biologically screened for antifungal activity. The newly synthesized derivatives of chalcone showed antifungal activity against fungal species, Microsporum gypseum. The results so obtained were superior or comparable to ketoconazole. It was observed that none of the compounds tested showed positive results for fungi Candida albicans nor against fungi Aspergillus niger. Chalcone derivatives showed inhibitory effect against M. gypseum species of fungus. It was found that among the chalcone derivatives so synthesized, two of them, that is, 4-chloro derivative, and unsubstituted derivative of chalcone showed antifungal activity superior to ketoconazole. Thus, these can be the potential new molecule as antifungal agent.

  18. Chalcones Enhance TRAIL-Induced Apoptosis in Prostate Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ewelina Szliszka

    2009-12-01

    Full Text Available Chalcones exhibit chemopreventive and antitumor effects. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL is a naturally occurring anticancer agent that induces apoptosis in cancer cells and is not toxic to normal cells. We examined the cytotoxic and apoptotic effect of five chalcones in combination with TRAIL on prostate cancer cells. The cytotoxicity was evaluated by the MTT and LDH assays. The apoptosis was determined using flow cytometry with annexin V-FITC. Our study showed that all five tested chalcones: chalcone, licochalcone-A, isobavachalcone, xanthohumol, butein markedly augmented TRAIL-mediated apoptosis and cytotoxicity in prostate cancer cells and confirmed the significant role of chalcones in chemoprevention of prostate cancer.

  19. The rluC gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 955, 2504, and 2580 in 23 S ribosomal RNA.

    Science.gov (United States)

    Conrad, J; Sun, D; Englund, N; Ofengand, J

    1998-07-17

    Escherichia coli ribosomal RNA contains 10 pseudouridines, one in the 16 S RNA and nine in the 23 S RNA. Previously, the gene for the synthase responsible for the 16 S RNA pseudouridine was identified and cloned, as was a gene for a synthase that makes a single pseudouridine in 23 S RNA. The yceC open reading frame of E. coli is one of a set of genes homologous to these previously identified ribosomal RNA pseudouridine synthases. In this work, the gene was cloned, overexpressed, and shown to code for a pseudouridine synthase able to react with in vitro transcripts of 23 S ribosomal RNA. Deletion of the gene and analysis of the 23 S RNA from the deletion strain for the presence of pseudouridine at its nine known sites revealed that this synthase is solely responsible in vivo for the synthesis of three of the nine pseudouridine residues, at positions 955, 2504, and 2580. Therefore, this gene has been renamed rluC. Despite the absence of one-third of the normal complement of pseudouridines, there was no change in the exponential growth rate in either LB or M-9 medium at temperatures ranging from 24 to 42 degrees C. From this work and our previous studies, we have now identified three synthases that account for 50% of the pseudouridines in the E. coli ribosome.

  20. Domain analysis of 3 Keto Acyl-CoA synthase for structural variations in Vitis vinifera and Oryza brachyantha using comparative modelling.

    Science.gov (United States)

    Sagar, Mamta; Pandey, Neetesh; Qamar, Naseha; Singh, Brijendra; Shukla, Akanksha

    2015-03-01

    The long chain fatty acids incorporated into plant lipids are derived from the iterative addition of C2 units which is provided by malonyl-CoA to an acyl-CoA after interactions with 3-ketoacyl-CoA synthase (KCS), found in several plants. This study provides functional characterization of three 3 ketoacyl CoA synthase like proteins in Vitis vinifera (one) and Oryza brachyantha (two proteins). Sequence analysis reveals that protein of Oryza brachyantha shows 96% similarity to a hypothetical protein in Sorghum bicolor; total 11 homologs were predicted in Sorghum bicolor. Conserved domain prediction confirm the presence of FAE1/Type III polyketide synthase-like protein, Thiolase-like, subgroup; Thiolase-like and 3-Oxoacyl-ACP synthase III, C-terminal and chalcone synthase like domain but very long chain 3-keto acyl CoA domain is absent. All three proteins were found to have Chalcone and stilbene synthases C terminal domain which is similar to domain of thiolase and β keto acyl synthase. Its N terminal domain is absent in J3M9Z7 protein of Oryza brachyantha and F6HH63 protein of Vitis vinifera. Differences in N-terminal domain is responsible for distinguish activity. The J3MF16 protein of Oryza brachyantha contains N terminal domain and C terminal domain and characterized using annotation of these domains. Domains Gcs (streptomyces coelicolor) and Chalcone-stilbene synthases (KAS) in 2-pyrone synthase (Gerbera hybrid) and chalcone synthase 2 (Medicago sativa) were found to be present in three proteins. This similarity points toward anthocyanin biosynthetic process. Similarity to chalcone synthase 2 reveals its possible role in Naringenine and Chalcone synthase like activity. In 3 keto acyl CoA synthase of Oryza brachyantha. Active site residues C-240, H-407, N-447 are present in J3MF16 protein that are common in these three protein at different positions. Structural variations among dimer interface, product binding site, malonyl-CoA binding sites, were predicted in

  1. Target sequencing, cell experiments, and a population study establish endothelial nitric oxide synthase (eNOS) gene as hypertension susceptibility gene.

    Science.gov (United States)

    Salvi, Erika; Kuznetsova, Tatiana; Thijs, Lutgarde; Lupoli, Sara; Stolarz-Skrzypek, Katarzyna; D'Avila, Francesca; Tikhonoff, Valerie; De Astis, Silvia; Barcella, Matteo; Seidlerová, Jitka; Benaglio, Paola; Malyutina, Sofia; Frau, Francesca; Velayutham, Dinesh; Benfante, Roberta; Zagato, Laura; Title, Alexandra; Braga, Daniele; Marek, Diana; Kawecka-Jaszcz, Kalina; Casiglia, Edoardo; Filipovsky, Jan; Nikitin, Yuri; Rivolta, Carlo; Manunta, Paolo; Beckmann, Jacques S; Barlassina, Cristina; Cusi, Daniele; Staessen, Jan A

    2013-11-01

    A case-control study revealed association between hypertension and rs3918226 in the endothelial nitric oxide synthase (eNOS) gene promoter (minor/major allele, T/C allele). We aimed at substantiating these preliminary findings by target sequencing, cell experiments, and a population study. We sequenced the 140-kb genomic area encompassing the eNOS gene. In HeLa and HEK293T cells transfected with the eNOS promoter carrying either the T or the C allele, we quantified transcription by luciferase assay. In 2722 randomly recruited Europeans (53.0% women; mean age 40.1 years), we studied blood pressure change and incidence of hypertension in relation to rs3918226, using multivariable-adjusted models. Sequencing confirmed rs3918226, a binding site of E-twenty six transcription factors, as the single nucleotide polymorphism most closely associated with hypertension. In T compared with C transfected cells, eNOS promoter activity was from 20% to 40% (Phypertension. The hazard ratio and attributable risk associated with TT homozygosity were 2.04 (CI, 1.24-3.37; P=0.0054) and 51.0%, respectively. In conclusion, rs3918226 in the eNOS promoter tags a hypertension susceptibility locus, TT homozygosity being associated with lesser transcription and higher risk of hypertension.

  2. Induction of stilbene phytoalexins in grapevine (Vitis vinifera) and transgenic stilbene synthase-apple plants (Malus domestica) by a culture filtrate of Aureobasidium pullulans.

    Science.gov (United States)

    Rühmann, Susanne; Pfeiffer, Judith; Brunner, Philipp; Szankowski, Iris; Fischer, Thilo C; Forkmann, Gert; Treutter, Dieter

    2013-11-01

    Products containing the epiphytic yeast Aureobasidium pullulans are commercially available and applied by fruit growers to prevent several fungal and bacterial diseases of fruit trees. The proposed beneficial mechanisms relate to limitations of space and nutrients for the pathogens in presence of the rapidly proliferating yeast cells. These explanations ignore the potential of yeasts to elicit the plant's defense. Our experiments aim at clarifying if an autoclaved and centrifuged suspension of A. pullulans may induce defense mechanisms. As a model system, the biosynthesis and accumulation of stilbene phytoalexins in callus and shoots of grapevine Vitis vinifera grown in vitro was used. Yeast application to the plant tissue stimulated stilbene biosynthesis, sometimes at the cost of flavonoids. The expression of the gene encoding stilbene synthase was enhanced and the enzyme showed higher activity while chalcone synthase activity and expression was reduced in some cases. An accumulation of stilbenes was also found in transgenic apple trees (Malus domestica cv. Holsteiner Cox) harboring the stilbene synthase-gene under control of its own promoter. These results clearly show that the application of A. pullulans may induce defense mechanisms of the treated plants.

  3. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    Directory of Open Access Journals (Sweden)

    Rizk El-Baz(1; Azza Ismail(2 ; Maher Amer(2; Mai Elshahat(3; Amira Kazamel(2; Ahmad Settin

    2012-10-01

    Full Text Available Background: Enzymes of the Glutathione S-transferase system (GST modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR is a crucial mediator for the cellular effects of vitamin D and additionally interacts with other cell-signaling pathways that influence cancer development. Objectives: To check for the association of polymorphisms of GST, eNOS3 and VDR genes with the susceptibility and severity of breast cancer in Egyptian cases. Subjects: This work included 100 cases with breast cancer and 100 healthy individuals. The mean age of cases was 48.31±11.40 years. They included 100 females.Methods: DNA was amplified using PCR-RFLP for detection of polymorphisms related to eNOS3 and VDR , also DNA was amplified using PCR-SSP for detection of polymorphisms related to GST and calculating the odds ratios and their 95% confidence intervals.Results: Total cases showed high significant frequency of eNOS3-786 CC (P<0.05, OR=18.58 genotypes, GSTT1(null (OR = 2.68; CI 95%=1.51-4.75; p=0.001. These were considered risk genotypes for disease susceptibility. On the other hand, total cases showed low significant frequency with homozygosity for eNOS3-786 TT (P=0.01 and the GSTT1 gene was present in 42.0% of the cancers and in 66.0% of controls (OR = 0.37; CI 95%= 0.21-0.66; p=0.001. These may be considered low risk genotypes. No significant difference in frequencies of null and present genotypes of GSTM1 and VDR FOKI in total cases compared to controls. Conclusions: Polymorphisms related to eNOS3-786, GSTT1 and VDR FOKI genes may be considered genetic markers for BC among Egyptian cases. This may have potential impact on family counselling as well as future management plans.

  4. Macrophage inducible nitric oxide synthase gene expression is blocked by a benzothiophene derivative with anti-HIV properties.

    Science.gov (United States)

    Carballo, M; Conde, M; Tejedo, J; Gualberto, A; Jimenez, J; Monteseirín, J; Santa María, C; Bedoya, F J; Hunt, S W; Pintado, E; Baldwin, A S; Sobrino, F

    2002-04-01

    Nitric oxide (NO) has been shown to mediate multiple physiological and toxicological functions. The inducible nitric oxide synthase (iNOS) is responsible for the high output generation of NO by macrophages following their stimulation by cytokines or bacterial antigens. The inhibition of TNF alpha-stimulated HIV expression and the anti-inflammatory property of PD144795, a new benzothiophene derivative, have been recently described. We have now analyzed whether some of these properties could be mediated by an effect of PD144795 on NO-dependent inflammatory events. We show that PD144795 suppresses the lipopolysaccharide-elicited production of nitrite (NO(-)(2)) by primary peritoneal mouse macrophages and by a macrophage-derived cell line, RAW 264.7. This effect was dependent on the dose and timing of addition of PD144795 to the cells. Suppression of NO(-)(2) production was associated with a decrease in the amount of iNOS protein, iNOS enzyme activity and mRNA expression. The effect of PD144795 was partially abolished by coincubation of the cells with LPS and IFN gamma. However, the inhibitory effect of PD144795 was not abrogated by the simultaneous addition of LPS and TNF alpha, which indirectly suggests that the effect of PD144795 was not due to the inhibition of TNF alpha synthesis. Additionally, PD144795 did not block NF-kappa B nuclear translocation induced by LPS. Inhibition of iNOS gene expression represents a novel mechanism of PD144795 action that underlines the anti-inflammatory effects of this immunosuppressive drug.

  5. RNase E affects the expression of the acyl-homoserine lactone synthase gene sinI in Sinorhizobium meliloti.

    Science.gov (United States)

    Baumgardt, Kathrin; Charoenpanich, Pornsri; McIntosh, Matthew; Schikora, Adam; Stein, Elke; Thalmann, Sebastian; Kogel, Karl-Heinz; Klug, Gabriele; Becker, Anke; Evguenieva-Hackenberg, Elena

    2014-04-01

    Quorum sensing of Sinorhizobium meliloti relies on N-acyl-homoserine lactones (AHLs) as autoinducers. AHL production increases at high population density, and this depends on the AHL synthase SinI and two transcriptional regulators, SinR and ExpR. Our study demonstrates that ectopic expression of the gene rne, coding for RNase E, an endoribonuclease that is probably essential for growth, prevents the accumulation of AHLs at detectable levels. The ectopic rne expression led to a higher level of rne mRNA and a lower level of sinI mRNA independently of the presence of ExpR, the AHL receptor, and AHLs. In line with this, IPTG (isopropyl-β-D-thiogalactopyranoside)-induced overexpression of rne resulted in a shorter half-life of sinI mRNA and a strong reduction of AHL accumulation. Moreover, using translational sinI-egfp fusions, we found that sinI expression is specifically decreased upon induced overexpression of rne, independently of the presence of the global posttranscriptional regulator Hfq. The 28-nucleotide 5' untranslated region (UTR) of sinI mRNA was sufficient for this effect. Random amplification of 5' cDNA ends (5'-RACE) analyses revealed a potential RNase E cleavage site at position +24 between the Shine-Dalgarno site and the translation start site. We postulate therefore that RNase E-dependent degradation of sinI mRNA from the 5' end is one of the steps mediating a high turnover of sinI mRNA, which allows the Sin quorum-sensing system to respond rapidly to changes in transcriptional control of AHL production.

  6. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    Science.gov (United States)

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  7. Novel alleles of 31-bp VNTR polymorphism in the human cystathionine -synthase (CBS) gene were detected in healthy Asians

    Indian Academy of Sciences (India)

    Yik-Yuen Gan; Chuan-Fei Chen

    2010-12-01

    A 31-bp variable number of tandem repeats (VNTR) polymorphism of the cystathionine -synthase (CBS) gene was earlier reported in Caucasians of predominantly European descent and Indo–Caucasoid populations.We report here for the first time, the detection of allele 20, which was absent in Caucasian and Indo–Caucasoid populations, as a common allele present in Singaporean Chinese (6.25%), Indians (11.7%), and Malays (11.5%). Hence, allele 20 might be a specific allele for Asian populations. A relatively common allele 19 found in the Caucasian and Indo–Caucasoid populations (10.4%–10.6%) was absent in the Asian samples of this study. Therefore, allele 19 might be a specific allele for the Caucasian populations. A novel and rare allele 13, which was not reported before in the Caucasian and Indo–Caucasoid populations, was found in 0.5% of Singaporean Chinese as genotype 13/17 heterozygotes. The presence of alleles 13 and 20 were verified by DNA sequencing. There were five new genotypes (13/17, 16/20, 17/20, 18/20 and 20/20) not reported before in the Caucasian and Indo–Caucasoid populations, detected in this study. Nine genotypes (15/18, 16/18, 16/21, 17/19, 18/19, 18/21, 19/19, 19/21 and 21/21) which were present in the Caucasian and/or Indo–Caucasoid populations were absent in this study. Our results showed that CBS 31-bp VNTR polymorphism has a distinct genetic difference in allele and genotype frequencies between the European Caucasians, Indo–Caucasoid and Asian populations.

  8. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    Science.gov (United States)

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH.

  9. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Directory of Open Access Journals (Sweden)

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  10. Impact of the Xba1-polymorphism of the human muscle glycogen synthase gene on parameters of the insulin resistance syndrome in a Danish twin population

    DEFF Research Database (Denmark)

    Fenger, M; Poulsen, P; Beck-Nielsen, H;

    2000-01-01

    : The Xba1-polymorphism of the human muscle glycogen synthase gene is correlated to insulin resistance and to diastolic blood pressure. The polymorphism does not involve any known transcription factor or any structural change in GYS1, and these correlations are therefore most probably caused by linkage......AIMS: To establish the impact on the insulin resistance syndrome of the intron 14 Xba1-polymorphism in human muscle glycogen synthase (GYS1). METHODS: Parameters related to the insulin resistance syndrome were measured in 244 monozygotic twins and 322 dizygotic twins with or without impaired...... and the remainder had the genotype A1A2. No A2A2-genotypes were detected. In 11 genotypic discordant dizygotic twin pairs the insulin resistance was significantly increased in the twins carrying the A1A2 genotype regardless of sex (HOMA index 1.81 (A1A1) vs. 2.57 (A1A2), P

  11. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    Science.gov (United States)

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  12. QTAIM electron density study of natural chalcones

    Science.gov (United States)

    González Moa, María J.; Mandado, Marcos; Cordeiro, M. Natália D. S.; Mosquera, Ricardo A.

    2007-09-01

    QTAIM atomic and bond properties, ionization potential, and O-H bond dissociation energies calculated at the B3LYP/6-311++G(2d,2p) level indicate the natural chalcones bear a significant radical scavenging activity. However, their ionization potentials indicate they decrease the electron-transfer rate between antioxidant and oxygen that yields the pro-oxidative cations less than other natural antioxidants. Rings A and B display slight and similar positive charges, whereas ring B is involved in exocycle delocalization at a larger extension.

  13. ANTIMICROBIAL SCREENING OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Ramesh Dhani

    2012-10-01

    Full Text Available Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The derivatives of chalcones with an annular nitrogen atom in the phenyl ring were reported to have a wide range of biologically activities, such as antibacterial, anti-tuberculostatic and anti- inflammatory. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of novel heterocyclics with good pharmaceutical profile can be designed. Chalcones have been considered as a magic moiety possessing myriad spectrum of medicinal activities. Diversity of biological response profile has attracted considerable interest of several researchers across the globe to explore this skeleton for its assorted therapeutic significance. The synthesized chalcone derivatives were screened for antimicrobial activity by comparing with the standard drug of ciprofloxacin on two gram positive and two gram negative strains, the synthesized compounds, by using Disc-diffusion method. Chalcone is a lead nucleus for future developments to get effective compounds.

  14. Cucumber (Cucumis sativus L.) Nitric Oxide Synthase Associated Gene1 (CsNOA1) Plays a Role in Chilling Stress

    Science.gov (United States)

    Liu, Xingwang; Liu, Bin; Xue, Shudan; Cai, Yanlinq; Qi, Wenzhu; Jian, Chen; Xu, Shuo; Wang, Ting; Ren, Huazhong

    2016-01-01

    Nitric oxide (NO) is a gaseous signaling molecule in plants, transducing information as a result of exposure to low temperatures. However, the underlying molecular mechanism linking NO with chilling stress is not well understood. Here, we functionally characterized the cucumber (Cucumis sativus L.) nitric oxide synthase-associated gene, NITRIC OXIDE ASSOCIATED 1 (CsNOA1). Expression analysis of CsNOA1, using quantitative real-time PCR, in situ hybridization, and a promoter::β-glucuronidase (GUS) reporter assay, revealed that it is expressed mainly in the root and shoot apical meristem (SAM), and that expression is up-regulated by low temperatures. A CsNOA1-GFP fusion protein was found to be localized in the mitochondria, and ectopic expression of CsNOA1 in the A. thaliana noa1 mutant partially rescued the normal phenotype. When overexpressing CsNOA1 in the Atnoa1 mutant under normal condition, no obvious phenotypic differences was observed between its wild type and transgenic plants. However, the leaves from mutant plant grown under chilling conditions showed hydrophanous spots and wilting. Physiology tolerance markers, chlorophyll fluorescence parameter (Fv/Fm), and electrolyte leakage, were observed to dramatically change, compared mutant to overexpressing lines. Transgenic cucumber plants revealed that the gene is required by seedlings to tolerate chilling stress: constitutive over-expression of CsNOA1 led to a greater accumulation of soluble sugars, starch, and an up-regulation of Cold-regulatory C-repeat binding factor3 (CBF3) expression as well as a lower chilling damage index (CI). Conversely, suppression of CsNOA1 expression resulted in the opposite phenotype and a reduced NO content compared to wild type plants. Those results suggest that CsNOA1 regulates cucumber seedlings chilling tolerance. Additionally, under normal condition, we took several classic inhibitors to perform, and detect endogenous NO levels in wild type cucumber seedling. The results

  15. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  16. The Synthesis of Photocrosslinkable Chalcone-Bearing Polyphosphazenes

    Science.gov (United States)

    1993-05-18

    Form Approvea TION PAGE oM6 No 0704ý07887 AD-A264 915 tef,j I u tepre ntcn m ~efrfve" M~10%Wf- I%.qJ( The SytessofPoocoslna lee Chalcone -Beanng...N00014-91-J- 1194 R&T Code: 4132007 Technical Report No. 13 The Synthesis of Photocrosslinkable Chalcone -Bearing Polyphosphazenes by Harry R. Allcock and...for public release and sale; its distribution is unlimited. The Synthesis of Photocrosslinkable Chalcone -Bearing Polyphosphazenes Harry R. Allcock* and

  17. The clinical significance of aldosterone synthase deficiency: report of a novel mutation in the CYP11B2 gene

    Science.gov (United States)

    2014-01-01

    Background Aldosterone synthase (CYP11B2) deficiency is a rare autosomal recessive disorder, usually presenting with severe salt-wasting in infancy or stress-induced hyperkalaemia and postural hypotension in adulthood. Neonatal screening for congenital adrenal hyperplasia, another cause of salt wasting, using 17-hydroxyprogesterone measurement would fail to detect aldosterone synthase deficiency, a diagnosis which may be missed until the patient presents with salt-wasting crisis. Due to this potential life-threatening risk, comprehensive hormonal investigation followed by genetic confirmation for suspected patients would facilitate clinical management of the patient and assessment of the genetic implication in their offspring. Case presentation We describe a 33-year old Chinese man who presented in infancy with life-threatening hyponatraemia and failure to thrive, but remained asymptomatic on fludrocortisone since. Chromosomal analysis confirmed a normal male karyotype of 46, XY. Plasma steroid profile showed high plasma renin activity, low aldosterone level, and elevated 18-hydroxycorticosterone, compatible with type 2 aldosterone synthase deficiency. The patient was heterozygous for a novel CYP11B2 mutation: c.977C > A (p.Thr326Lys) in exon 3. He also carried a heterozygous mutation c.523_525delAAG (p.Lys175del) in exon 6, a known pathogenic mutation causing aldosterone synthase deficiency. Sequencing of CYP11B2 in his parents demonstrated that the mother was heterozygous for c.977C > A, and the father was heterozygous for c.523_525delAAG. Conclusion Although a rare cause of hyperreninaemic hypoaldosteronism, aldosterone synthase deficiency should be suspected and the diagnosis sought in patients who present with life-threatening salt-wasting in infancy, as it has a good long-term prognosis when adequate fludrocortisone replacement is instituted. To our knowledge, this is the first Chinese patient in which the molecular basis of aldosterone synthase

  18. Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells

    Institute of Scientific and Technical Information of China (English)

    ZHANG Qiang; ZHAO Yu-pei; LIAO Quan; HU Ya; XU Qiang; ZHOU Li; SHU Hong

    2011-01-01

    Background Thymidylate synthase (TS) is a key regulatory enzyme for de novo DNA synthesis.TS activity is also an important determinant of the response to chemotherapy with fluoropyrimidine prodrugs,and its expression may be affected by gene polymorphisms.In this study,we investigated the associations between polymorphisms of the TS gene and its protein expression,and the implications on the efficacy of 5-fluorouracil (5-FU) in pancreatic cancer cells.Methods Genotypes based on the 28-bp TS tandem repeat for pancreatic cell lines were determined by electrophoretic analysis of PCR products.A single nucleotide polymorphism (SNP) at nucleotide 12 of the second 28-bp repeat of the 3R allele was determined by nucleotide sequencing.The chemosensitivity of pancreatic carcinoma cells to 5-FU in vitro was evaluated using Cell Counting Kit-8 (CCK-8).TS protein expression was analyzed by Western blotting.Results Seven pancreatic carcinoma cell lines had different genotypes in terms of the 28-bp TS tandem repeat,as follows:homozygous 2R/2R (T3M4 and BxPC-3 cells),heterozygous 2R/3R (AsPC-1,Capan-1,and SU86.86),and homozygous 3R/3R (PANC-1 and COLO357).The optical density ratio of genotypes 3R/3R,2R/2R and 2R/3R was 1.393±0.374,0.568±0.032 and 0.561±0.056,respectively.Cells with the 2R/3R or 3R/3R genotypes were further analyzed for the G to C SNP at nucleotide 12 of the second 28-bp repeat of the 3R allele,yielding heterozygous 2R/3Rc (AsPC-1,Capan-1,and SU86.86),homozygous 3Rg/3Rg (COLO357) and homozygous 3Rc/3Rc (PANC-1).The optical density ratio of homozygous 3Rg/3Rg cells and homozygous 3Rc/3Rc cells was 1.723±0.062 and 1.063±0.134,respectively,and this difference was statistically significant (P <0.05).Cells with the 2R/2R and 2R/3R genotypes of TS were hypersensitive to 5-FU in vitro as compared with those with the 3R/3R cells.Conclusions Polymorphisms in the TS gene influenced its protein expression and affected sensitivity of 5-FU in seven pancreatic cancer cell

  19. Pseudouridine synthases.

    Science.gov (United States)

    Hamma, Tomoko; Ferré-D'Amaré, Adrian R

    2006-11-01

    Pseudouridine synthases are the enzymes responsible for the most abundant posttranscriptional modification of cellular RNAs. These enzymes catalyze the site-specific isomerization of uridine residues that are already part of an RNA chain, and appear to employ both sequence and structural information to achieve site specificity. Crystallographic analyses have demonstrated that all pseudouridine synthases share a common core fold and active site structure and that this core is modified by peripheral domains, accessory proteins, and guide RNAs to give rise to remarkable substrate versatility.

  20. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth......Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate...

  1. Anthocyanin accumulation and expression of anthocyanin biosynthetic genes in radish (Raphanus sativus).

    Science.gov (United States)

    Park, Nam Il; Xu, Hui; Li, Xiaohua; Jang, In Hyuk; Park, Suhyoung; Ahn, Gil Hwan; Lim, Yong Pyo; Kim, Sun Ju; Park, Sang Un

    2011-06-08

    Radish [Raphanus sativus (Rs)] is an important dietary vegetable in Asian countries, especially China, Japan, and Korea. To elucidate the molecular mechanisms of anthocyanin accumulation in radish, the gene expression of enzymes directly involved in anthocyanin biosynthesis was analyzed. These genes include phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), 4-coumarate-CoA ligase (4CL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol reductase (DFR), and anthocyanidin synthase (ANS). RsDFR and RsANS were found to accumulate in the flesh or skin of two radish cultivars (Man Tang Hong and Hong Feng No.1). Radish skin contained higher CHS, CHI, and F3H transcript levels than radish flesh in all three cultivars. In the red radish, 16 anthocyanins were separated and identified by high-performance liquid chromatography (HPLC) and elctrospray ionization-tandem mass spectrometry (ESI-MS/MS). Some of them were acylated with coumaroyl, malonoyl, feruoyl, and caffeoyl moieties. Furthermore (-)-epicatechin and ferulic acid were also identified in the three cultivars.

  2. Accumulation of Kaempferitrin and Expression of Phenyl-Propanoid Biosynthetic Genes in Kenaf (Hibiscus cannabinus

    Directory of Open Access Journals (Sweden)

    Shicheng Zhao

    2014-10-01

    Full Text Available Kenaf (Hibiscus cannabinus is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H and 4-coumarate-CoA ligase (Hc4CL were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS, chalcone isomerase (HcCHI, and flavone 3-hydroxylase (HcF3H was highest in young flowers, whereas that of flavone synthase (HcFLS was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.

  3. Transgenic tobacco simultaneously overexpressing glyphosate N-acetyltransferase and 5-enolpyruvylshikimate-3-phosphate synthase are more resistant to glyphosate than those containing one gene.

    Science.gov (United States)

    Liu, Yunjun; Cao, Gaoyi; Chen, Rongrong; Zhang, Shengxue; Ren, Yuan; Lu, Wei; Wang, Jianhua; Wang, Guoying

    2015-08-01

    5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) and glyphosate N-acetyltransferase (GAT) can detoxify glyphosate by alleviating the suppression of shikimate pathway. In this study, we obtained transgenic tobacco plants overexpressing AM79 aroA, GAT, and both of them, respectively, to evaluate whether overexpression of both genes could confer transgenic plants with higher glyphosate resistance. The transgenic plants harboring GAT or AM79 aroA, respectively, showed good glyphosate resistance. As expected, the hybrid plants containing both GAT and AM79 aroA exhibited improved glyphosate resistance than the transgenic plants overexpressing only a single gene. When grown on media with high concentration of glyphosate, seedlings containing a single gene were severely inhibited, whereas plants expressing both genes were affected less. When transgenic plants grown in the greenhouse were sprayed with glyphosate, less damage was observed for the plants containing both genes. Metabolomics analysis showed that transgenic plants containing two genes could maintain the metabolism balance better than those containing one gene after glyphosate treatment. Glyphosate treatment did not lead to a huge increase of shikimate contents of tobacco leaves in transgenic plants overexpressing two genes, whereas significant increase of shikimate contents in transgenic plants containing only a single gene was observed. These results demonstrated that pyramiding both aroA and GAT in transgenic plants can enhance glyphosate resistance, and this strategy can be used for the development of transgenic glyphosate-resistant crops.

  4. Newly synthesized 'hidabeni' chalcone derivatives potently suppress LPS-induced NO production via inhibition of STAT1, but not NF-κB, JNK, and p38, pathways in microglia.

    Science.gov (United States)

    Hara, Hirokazu; Ikeda, Ryoko; Ninomiya, Masayuki; Kamiya, Tetsuro; Koketsu, Mamoru; Adachi, Tetsuo

    2014-01-01

    Chalcones are open-chain flavonoids that are biosynthesized in various plants. Some of them possess anti-inflammatory activity. We previously found that chalcone glycosides from Brassica rapa L. 'hidabeni' suppress lipopolysaccharide (LPS)-induced nitric oxide (NO) production in rat microglia highly aggressively proliferating immortalized (HAPI) cells. In this study, to explore chalcone derivatives with potent NO inhibitory activity, we synthesized ten compounds based on 'hidabeni' chalcone and examined their effects on LPS-triggered inducible NO synthase (iNOS) expression and NO production. Compounds C4 and C10 potently inhibited NO production (IC50: 4.19, 2.88 µM, respectively). C4 and C10 suppressed LPS-induced iNOS expression via the inhibition of the signal transduction and activator of transcription 1 (STAT1), but not nuclear factor-kappa B (NF-κB), c-Jun N terminal kinase (JNK), and p38, pathways. C10, but not C4, inhibited activation of the MEK/extracellular signal-regulated kinase (ERK) pathway. C4 and C10 also suppressed LPS-induced expression of interferon regulatory factor 1 (IRF-1), which is an important transcription factor involved in iNOS expression. Our findings indicate that these chalcone derivatives are candidate compounds for preventing microglia-mediated neuroinflammation.

  5. New chalcone and dimeric chalcones with 1,4-p-benzoquinone residue from Combretum yunnanense.

    Science.gov (United States)

    Wu, Ming-Mei; Wang, Li-Qin; Hua, Yan; Chen, Ye-Gao; Wang, Yuan-Yuan; Li, Xing-Yao; Li, Yan; Li, Ting; Yang, Xun-Yun; Tang, Zheng-Rong

    2011-03-01

    New chalcone and dimeric chalcones with 1,4- P-benzoquinone residue, combrequinone A (1), combrequinone B (2), and combrequinone C (3), along with three known compounds (4-6), were isolated from the ethanolic extract of the stems and leaves of Combretum yunnanense, and their structures were determined by spectroscopic analysis. Compounds 1-3 were evaluated for in vitro cytotoxicity against five human cancer cell lines: HL-60, SMMC-7721, A-549, MCF-7, and SW480. Compounds 1, 2 and 3 were found to be most potent against HL-60 acute leukemia cells, with IC₅₀ values of 4.63, 4.07, and 1.26 µM, respectively.

  6. Association of the endothelial nitric oxide synthase gene G894T polymorphism with the risk of diabetic nephropathy in Qassim region, Saudi Arabia—A pilot study

    Science.gov (United States)

    Mackawy, Amal Mohammed Husein; Khan, Amjad Ali; Badawy, Mohammed El-Sayed

    2014-01-01

    Background Diabetic nephropathy (DN) is a chronic microangiopathic complication of type 2 diabetes mellitus (DM).Vascular endothelial dysfunction resulting from impaired nitric oxide synthase (NOS) activity in the vascular endothelial cells has been suggested as playing an important role in the pathogenesis of diabetic nephropathy (DN). Endothelial nitric oxide synthase (E-NOS) gene G894T polymorphism has been reported to be associated with endothelial dysfunction leading to DN. Our objective was to evaluate the association of G894T polymorphism of eNOS gene with the risk of DN among type 2 diabetic Saudi patients. Methods One hundred and twenty subjects were included in this study. They were divided into three groups. Group I, 40 controls. Group II, 40 type 2 diabetic patients without nephropathy. Group III, 40 type2 diabetic patients with nephropathy. Endothelial nitric oxide synthase (eNOS) G894Tpolymorphism was detected by polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP). Plasma nitric oxide (NO) levels were estimated. Results E-NOS genotype frequency showed non-significant differences among the all studied groups (p > 0.05). Both diabetic groups had significantly higher plasma nitrate levels than in controls with a significant increase in group III than in group II patients (all p diabetic Saudi patients. The higher plasma levels of nitrates as a marker of oxidative stress in diabetic patients with nephropathy suggest the possible role of oxidative stress but not e-NOS gene SNP in pathogenesis of the DN. PMID:25606424

  7. Modification of a viral satellite DNA-based gene silencing vector and its application to leaf or flower color change in Petunia hybrida

    Institute of Scientific and Technical Information of China (English)

    TAO Xiaorong; QIAN Yajuan; ZHOU Xueping

    2006-01-01

    Virus-induced gene silencing offers a powerful reverse-genetic tool for the study of gene function in plants. We have previously reported effective gene silencing of plant genes using a viral satellite DNA associated with Tomato yellow leaf curl China virus (TYLCCNV). In this study, we further modified the viral satellite DNA-based vector. The modified vector can induce sulfu (Su) gene silencing as effective as the original vector in Nicotiana benthamiana plants, but the new system simplifies procedures for construction of vector derivative. Furthermore, a fragment of petunia Su or chalcone synthase (CHS) endogenous gene was inserted into the modified vector. When petunia plants were agro- inoculated with the modified vector carrying a Su or CHS gene, the Su silenced plants started to appear yellowing in veins of systemically infected upper leaves two weeks after agroinoculation, while the CHS silenced plants started to show flower color change one month after agroinoculation and later single-color flowers became mosaic.

  8. Chrysanthemum expressing a linalool synthase gene ‘smells good’, but ‘tastes bad’to western flower thrips

    NARCIS (Netherlands)

    Ting Yang, Ting; Stoopen, G.M.; Thoen, H.P.M.; Wiegers, G.L.; Jongsma, M.A.

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the p

  9. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

    1999-01-01

    BACKGROUND: Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential...

  10. The association of single nucleotide polymorphisms of the maternal cystathionine-β-synthase gene with early-onset preeclampsia

    NARCIS (Netherlands)

    Holwerda, Kim M.; Weedon-Fekjær, M. Susanne; Staff, Anne C.; Nolte, Ilja M.; Van Goor, Harry; Lely, A. Titia; Faas, Marijke M.

    2016-01-01

    Objectives Preeclampsia (PE) is a pregnancy complication, characterized by hypertension and proteinuria. The transsulfuration pathway may be involved in its pathophysiology, since homocysteine, cystathionine and cysteine are increased in PE. Cystathionine-β-synthase (CBS) is a key-enzyme in the path

  11. The association of single nucleotide polymorphisms of the maternal cystathionine-beta-synthase gene with early-onset preeclampsia

    NARCIS (Netherlands)

    Holwerda, Kim M.; Weedon-Fekjaer, M. Susanne; Staff, Anne C.; Nolte, Ilja M.; van Goor, Harry; Lely, A. Titia; Faas, Marijke M.

    2016-01-01

    Objectives: Preeclampsia (PE) is a pregnancy complication, characterized by hypertension and proteinuria. The transsulfuration pathway may be involved in its pathophysiology, since homocysteine, cystathionine and cysteine are increased in PE. Cystathionine-beta-synthase (CBS) is a key-enzyme in the

  12. Induced point mutations in the phytoene synthase 1 gene cause differences in carotenoid content during tomato fruit ripening

    NARCIS (Netherlands)

    Gady, A.L.F.; Vriezen, W.; Wal, van de M.H.B.J.; Huang, P.; Bovy, A.G.; Visser, R.G.F.; Bachem, C.W.B.

    2012-01-01

    In tomato, carotenoids are important with regard to major breeding traits such as fruit colour and human health. The enzyme phytoene synthase (PSY1) directs metabolic flux towards carotenoid synthesis. Through TILLING (Targeting Induced Local Lesions IN Genomes), we have identified two point mutatio

  13. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The co

  14. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  15. Isolation of a (+)-δ-cadinene synthase gene CAD1-A and analysis of its expression pattern in seedlings of Gossypium arboreum L.

    Institute of Scientific and Technical Information of China (English)

    梁婉琪; 谭晓萍; 陈晓亚; Takashi; Hashimoto; Yasuyuki; Yamada; Peter; Heinstein

    2000-01-01

    The cotton sesquiterpene cyclase, (+)-δ-cadinene synthase.is encoded by a gene family, which can be divided into two subfamilies: CAD1-A and CAD1-C. The gene CAD1-A was isolated from G. arboreum. In situ hybridization performed on seven-day-old cotton seedlings localized transcripts of both the CAD1-A and CAD1-C mainly in lateral root primordium and apical ground meristem, vascular tissues of emerging lateral roots, and also in procambium and some subepidermal cells of the hypocotyl. The CAD1-A promoter showed a similar tissue-specificity in transgenic tobacco plants. Histochemistry showed occurrence of sesquiterpene aldehydes in outer cells of the lateral root tips, as well as in pigment glands. The CAD1 gene expression in G. arboreum seedlings and the spatial pattern of sesquiterpene biosynthesis constitute a chemical defense machinery in cotton seedlings.

  16. Isolation of a (+)-δ-cadinene synthase gene CAD1-A and analysis of its expression pattern in seedlings of Gossypium arboreum L.

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The cotton sesquiterpene cyclase,(+)-δ-cadinene synthase,is encoded by a gene family,which can be divided into two subfamilies:CAD1-A and CAD1-C.The gene CAD1-A was isolated from G.arboreum.In situ hybridization performed on seven-day-old cotton seedlings localized transcripts of both the CAD1-A and CAD1-C mainly in lateral root primordium and apical ground meristem,vascular tissues of emerging lateral roots,and also in procambium and some subepidermal cells of the hypocotyl.The CAD1-A promoter showed a similar tissue-specificity in transgenic tobacco plants.Histochemistry showed occurrence of sesquiterpene aldehydes in outer cells of the lateral root tips,as well as in pigment glands.The CAD1 gene expression in G.arboreum seedlings and the spatial pattern of sesquiterpene biosynthesis constitute a chemical defense machinery in cotton seedlings.

  17. Three-factor reciprocal cross mapping of a gene that causes expression of feedback-resistant acetohydroxy acid synthase in Escherichia coli K-12.

    Science.gov (United States)

    Jackson, J H; Davis, E J; Madu, A C; Braxter, S E

    1981-01-01

    The ilv-662 allele was previously identified as a mutation that caused acetohydroxy acid synthase activity to be resistant to feedback inhibition by valine (Davis et al. 1977). This allele was mapped between thr and leu by cotransduction analysis and labeled ilvJ. This report describes the mapping of ilvJ relative to genes that lie between thr and leu (ara, carA and pdxA) by three factor reciprocal cross analyses. We find that the probable gene order is thr-carA-pdxA-ilvJ-ara-leu. Although the phenotypic properties of ilvJ662 appear to be quite distinct from brnS, a gene reported to involve branched chain amino acid transport (Guardiola et al. 1974), we do not rule out possible allelism because of the uncertainty of the map position of brnS.

  18. Characterization of splice variants of the genes encoding human mitochondrial HMG-CoA lyase and HMG-CoA synthase, the main enzymes of the ketogenesis pathway.

    Science.gov (United States)

    Puisac, Beatriz; Ramos, Mónica; Arnedo, María; Menao, Sebastián; Gil-Rodríguez, María Concepción; Teresa-Rodrigo, María Esperanza; Pié, Angeles; de Karam, Juan Carlos; Wesselink, Jan-Jaap; Giménez, Ignacio; Ramos, Feliciano J; Casals, Nuria; Gómez-Puertas, Paulino; Hegardt, Fausto G; Pié, Juan

    2012-04-01

    The genes HMGCS2 and HMGCL encode the two main enzymes for ketone-body synthesis, mitochondrial HMG-CoA synthase and HMG-CoA lyase. Here, we identify and describe possible splice variants of these genes in human tissues. We detected an alternative transcript of HMGCS2 carrying a deletion of exon 4, and two alternative transcripts of HMGCL with deletions of exons 5 and 6, and exons 5, 6 and 7, respectively. All splice variants maintained the reading frame. However, Western blot studies and overexpression measurements in eukaryotic or prokaryotic cell models did not reveal HL or mHS protein variants. Both genes showed a similar distribution of the inactive variants in different tissues. Surprisingly, the highest percentages were found in tissues where almost no ketone bodies are synthesized: heart, skeletal muscle and brain. Our results suggest that alternative splicing might coordinately block the two main enzymes of ketogenesis in specific human tissues.

  19. Synthesis and antimicrobial evaluation of some heterocyclic chalcone derivatives.

    Science.gov (United States)

    Hamada, Nagwa Mohamed Mahrous; Sharshira, Essam Mohamed

    2011-03-09

    Some new heterocyclic compounds containing isoxazole, pyrazole and oxadiazole ring systems were prepared from various chalcones. The synthesized compounds have been characterized by elemental analysis and spectral methods. These compounds were screened for their antimicrobial activities.

  20. Exploring pharmacological significance of chalcone scaffold: a review.

    Science.gov (United States)

    Sahu, N K; Balbhadra, S S; Choudhary, J; Kohli, D V

    2012-01-01

    Chalcones (1,3-diaryl-2-propen-1-ones) and their heterocyclic analogues, belong to the flavonoid family, which possess a number of interesting biological properties such as antioxidant, cytotoxic, anticancer, antimicrobial, antiprotozoal, antiulcer, antihistaminic and anti-inflammatory activities. Several pure chalcones have been approved for clinical use or tested in humans. Clinical trials have shown that these compounds reached reasonable plasma concentration and are well-tolerated. For this reason they are an object of continuously growing interest amongst the scientists. However, much of the pharmacological potential of chalcones is still not utilized. The purpose of this review is to provide an overview of the pharmacological activity of naturally occurring and synthetic chalcones. This review highlights more recent pharmacological screening of these compounds, their mechanisms of action and relevant structure-activity relationships.

  1. Synthesis and Antimicrobial Evaluation of Some Heterocyclic Chalcone Derivatives

    Directory of Open Access Journals (Sweden)

    Essam Mohamed Sharshira

    2011-03-01

    Full Text Available Some new heterocyclic compounds containing isoxazole, pyrazole and oxadiazole ring systems were prepared from various chalcones. The synthesized compounds have been characterized by elemental analysis and spectral methods. These compounds were screened for their antimicrobial activities.

  2. Isolation and sequence analysis of chalcone synthase gene BaCHS from Brassica albograbra%芥蓝查尔酮合成酶基因BaCHS的克隆与序列分析

    Institute of Scientific and Technical Information of China (English)

    蒋明; 苗立祥; 胡齐赞; 贺蔡明; 陈珍

    2009-01-01

    查尔酮合成酶基因是类黄酮生物合成途径的关键基因,在植物发育和逆境反应中起着重要作用.根据已发表的查尔酮合成酶基因序列设计全长引物,以芥蓝(Brassica albograbra)叶片基因组DNA和花蕾cDNA为模板,克隆到了芥蓝查尔酮合成酶基因全长序列,命名为BaCHS.该基因DNA全长为1 263 bp,具一个长度为75 bp的内含子,编码区长度为1 188 bp,编码395个氨基酸.序列比对结果表明,BaCHS基因编码的氨基酸序列与其他十字花科植物之间的同源性很高,仅存在个别氨基酸残基的差别.

  3. Synthesis and anti-inflammatory activity of chalcone derivatives.

    Science.gov (United States)

    Herencia, F; Ferrándiz, M L; Ubeda, A; Domínguez, J N; Charris, J E; Lobo, G M; Alcaraz, M J

    1998-05-19

    Chalcones and their derivatives were synthesized and evaluated for their anti-inflammatory activity. In vitro, chalcones 2, 4, 8, 10 and 13 inhibited degranulation and 5-lipoxygenase in human neutrophils, whereas 11 behaved as scavenger of superoxide. Only four compounds (4-7) inhibited cyclo-oxygenase-2 activity. The majority of these samples showed anti-inflammatory effects in the mouse air pouch model.

  4. Synthesis and Antibacterial Activity of Chalcones and Pyrimidine-2-ones

    OpenAIRE

    2005-01-01

    Some new chalcones have been prepared by Claisen-schmidt condensation of ketone and different aromatic aldehydes. These chalcones on condensation with urea in presence of acid gave Pyrimidine-2-ones. The synthesized compounds have been characterized by elemental analysis, IR and 1H NMR spectral data. They have been screened for their antibacterial activity against Gram positive bacteria B. subtillis & S. aureus and Gram negative bacteria E. coli & S. typhi.

  5. Chalcones Enhance TRAIL-Induced Apoptosis in Prostate Cancer Cells

    OpenAIRE

    2009-01-01

    Chalcones exhibit chemopreventive and antitumor effects. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a naturally occurring anticancer agent that induces apoptosis in cancer cells and is not toxic to normal cells. We examined the cytotoxic and apoptotic effect of five chalcones in combination with TRAIL on prostate cancer cells. The cytotoxicity was evaluated by the MTT and LDH assays. The apoptosis was determined using flow cytometry with annexin V-FITC. Our study showe...

  6. Asymmetric cyclopropanation of chalcones using chiral phase-transfer catalysts

    OpenAIRE

    2013-01-01

    The first phase-transfer catalyzed cyclopropanation reaction of chalcones using bromomalonates as the nucleophiles in a Michael Initiated Ring Closing reaction (MIRC) was developed. Key to success was the use of a free OH-containing cinchona alkaloid ammonium salt catalyst and carefully optimized liquid/liquid reaction conditions. The reaction performed well for electron neutral and electron deficient chalcones giving the products in yields up to 98% and with enantiomeric ratios up to 91:9.

  7. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  8. Synthesis and biological evaluation of chalcone derivatives (mini review).

    Science.gov (United States)

    Bukhari, Syed Nasir Abbas; Jasamai, Malina; Jantan, Ibrahim

    2012-11-01

    Chalcones are the principal precursors for the biosynthesis of flavonoids and isoflavonoids. A three carbon α, β-unsaturated carbonyl system constitutes chalcones. Chalcones are the condensation products of aromatic aldehyde with acetophenones in attendance of catalyst. They go through an assortment of chemical reactions and are found advantageous in synthesis of pyrazoline, isoxazole and a variety of heterocyclic compounds. In synthesizing a range of therapeutic compounds, chalcones impart key role. They have showed worth mentioning therapeutic efficacy for the treatment of various diseases. Chalcone based derivatives have gained heed since they own simple structures, and diverse pharmacological actions. A lot of methods and schemes have been reported for the synthesis of these compounds. Amongst all, Aldol condensation and Claisen-Schmidt condensation still grasp high up position. Other distinguished techniques include Suzuki reaction, Witting reaction, Friedel-Crafts acylation with cinnamoyl chloride, Photo-Fries rearrangement of phenyl cinnamates etc. These inventive techniques utilize various catalysts and reagents including SOCl(2) natural phosphate, lithium nitrate, amino grafted zeolites, zinc oxide, water, Na(2)CO(3), PEG400, silicasulfuric acid, ZrCl(4) and ionic liquid etc. The development of better techniques for the synthesis of α, β- unsaturated carbonyl compounds is still in high demand. In brief, we have explained the methods and catalysts used in the synthesis of chalcones along with their biological activities in a review form to provide information for the development of new-fangled processes targeting better yield, less reaction time and least side effects with utmost pharmacological properties.

  9. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  10. Cloning and enzymology analysis of farnesyl pyrophosphate synthase gene from a superior strain of Artemisia annua L

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A cDNA(af1) encoding farnesyl pyrophosphate synthase AaFPS1 (FPS, EC2.5.1.1/EC2.5.1.10) from a high yield Artemisia annua strain 025 has been cloned from its cDNA library. Sequence analysis showed that the cDNA encoded a protein of 343 amino acid (aa) residues with molecular weight of 39 kD. Deduced aa sequence of the cDNA was similar to FPS from other plants, yeast and mammals, containing 5 conserved domains found in both prenyl transferase and polyprenyl synthase. The expression of the cDNA in Escherichia coli showed measurable specific activity of FPS in vitro. The enzyme was purified by ion exchange chromatography and its kinetics was measured. These results would further promote the molecular regulation of artemisinin biosynthesis.

  11. Molecular Cloning of Four Members of ACC Synthase Gene Family fromKiwifruit(Actinidia chinensis Planch.)%猕猴桃ACC合成酶基因家族四个成员的克隆

    Institute of Scientific and Technical Information of China (English)

    徐昌杰; 陈昆松; 张上隆

    2001-01-01

    Four members of 1-aminocyclopropane-1-carboxylate synthase(ACC synthase)gene family was isolated from Actinidia chinensis with the assigned names:AC-ACS1A,AC-ACS1B,AC-ACS2 and AC-ACS3 by PCR.The amino acid sequence of AC-ACS1A,AC-ACS1B and AC-ACS2 are over 76% identical to some ACC synthase from other plants,while AC-ACS3 shows only 51%~56% nucleotide or amino acid sequence homology to other known kiwifruit ACC synthase genes,and its amino acid sequence is less than 60% identical to all known plant ACC synthases.AC-ACS3 fragment is a little shorter than other kiwifruit ACC synthase genes,and does not contain MSSFGL conserved region.Therefore,it is suggested that AC-ACS3 is a novel member of ACC synthase gene family.%通过PCR方法从中华猕猴桃中分离出ACC合成酶基因家族的四个成员(AC-ACS1A、AC-ACS1B、AC-ACS2和AC-ACS3)的基因组DNA片段。AC-ACS1A、AC-ACS1B和AC-ACS2与其它植物该基因的氨基酸序列同源性最高可达76%以上, 而AC-ACS3与其它植物ACC合成酶基因的氨基酸序列同源性均低于60%,与已知的其它猕猴桃ACC合成酶基因的同源性在51%~56%之间,且不存在MSSFGL保守区,因而属于一个未见报道的新成员。

  12. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Directory of Open Access Journals (Sweden)

    Jun Cheng

    Full Text Available Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS, which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots.

  13. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    OpenAIRE

    Cornelia Chizzali; Swiddan, Asya K.; Sahar Abdelaziz; Mariam Gaid; Klaus Richter; Fischer, Thilo C.; Benye Liu; Ludger Beerhues

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regard...

  14. First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Patrick C Y Woo

    Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

  15. Radiation and quantum chemical studies of chalcone derivatives.

    Science.gov (United States)

    Gaikwad, P; Priyadarsini, K I; Naumov, S; Rao, B S M

    2010-08-05

    The reactions of oxidizing radicals ((*)OH, Br(2)(*-), and SO(4)(*-)) with -OH-, -CH(3)-, or -NH(2)-substituted indole chalcones and hydroxy benzenoid chalcones were studied by radiation and quantum chemical methods. The (*)OH radical was found to react by addition at diffusion-controlled rates (k = 1.1-1.7 x 10(10) dm(3) mol(-1) s(-1)), but Br(2)(*-) radical reacted by 2 orders of magnitude lower. Quantum chemical calculations at the B3LYP/6-31+G(d,p) level of theory have shown that the (C2-OH)(*), (C11-OH)(*), and (C10-OH)(*) adducts of the indole chalcones and the (C7-OH)(*) and (C8-OH)(*) adducts of the hydroxy benzenoid chalcones are more stable with DeltaH = -39 to -28 kcal mol(-1) and DeltaG = -32 to -19 kcal mol(-1). This suggests that (*)OH addition to the alpha,beta-unsaturated bond is a major reaction channel in both types of chalcones and is barrierless. The stability and lack of dehydration of the (*)OH adducts arise from two factors: strong frontier orbital interaction due to the low energy gap between interacting orbitals and the negligible Coulombic repulsion due to small absolute values of Mulliken charges. The transient absorption spectrum measured in the (*)OH radical reaction with all the indole chalcone derivatives exhibited a maximum at 390 nm, which is in excellent agreement with the computed value (394 nm). The formation of three phenolic products under steady-state radiolysis is in line with the three stable (*)OH adducts predicted by theory. Independent of the substituent, identical spectra (lambda(max) = 330-360 and approximately 580 nm) were obtained on one-electron oxidation of the three indole chalcones. MO calculations predict the deprotonation from the -NH group is more efficient than from the substituent due to the larger electron density on the N1 atom forming the chalcone indolyl radical. Its reduction potential was determined to be 0.56 V from the ABTS(*-)/ABTS(2-) couple. In benzenoid chalcones, the (*)OH adduct spectrum is

  16. Leishmanicidal activity of synthetic chalcones in Leishmania (Viannia) braziliensis.

    Science.gov (United States)

    de Mello, Tatiane F P; Bitencourt, Heriberto R; Pedroso, Raissa B; Aristides, Sandra M A; Lonardoni, Maria V C; Silveira, Thais G V

    2014-01-01

    The treatment of American cutaneous leishmaniasis (ACL) is based on a small group of compounds that were developed decades ago, all of which are highly toxic and have a high rate of treatment failure. The chalcones show leishmanicidal activity, yet few studies have evaluated this activity against Leishmania (Viannia) braziliensis, one of the most important species of Leishmania across Latin America. Four new synthetic chalcones (1-4) were evaluated for inhibitory activity in vitro against promastigotes and intracellular parasites 24h post infection of L. (V.) braziliensis, cytotoxicity for macrophages J774.A1 and red blood cells, and the ability to stimulate nitric oxide production. The results for the inhibitory concentration for 50% of the promastigotes (IC50) (1.38±1.09-6.36±2.04μM), cytotoxic concentration for 50% of the macrophages (CC50) (13.49±3.13-199.43±4.11μM), and selectivity index (SI) (3.76 to 33.94) indicate that all chalcones (1-4) showed an effect on promastigotes of L. (V.) braziliensis; chalcone 2 had the highest SI. The haemolytic assay with chalcones 1 (301.93μM), 2 (534.18μM), 3 (419.46μM) and 4 (381.11μM) showed 0.00%, 2.33%, 0.57% and 1.74% haemolysis, respectively. All chalcones significantly reduced the infection index of macrophages by parasites; for chalcones (1-3) this effect may be dependent on nitric-oxide production by macrophages. The chalcones tested exhibited inhibitory activity for promastigotes and intracellular parasites of L. (V.) braziliensis, with low toxicity for macrophages and red blood cells. The anti-Leishmania activity of chalcones (1-3) may depend on the stimulation of nitric-oxide production in the initial stage of infection. These results show an initially encouraging potential for the use of chalcones (1-4) to treat ACL.

  17. Functional analysis of the α-1,3-glucan synthase genes agsA and agsB in Aspergillus nidulans: agsB is the major α-1,3-glucan synthase in this fungus.

    Directory of Open Access Journals (Sweden)

    Akira Yoshimi

    Full Text Available Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and (13C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species.

  18. Functional analysis of the α-1,3-glucan synthase genes agsA and agsB in Aspergillus nidulans: agsB is the major α-1,3-glucan synthase in this fungus.

    Science.gov (United States)

    Yoshimi, Akira; Sano, Motoaki; Inaba, Azusa; Kokubun, Yuko; Fujioka, Tomonori; Mizutani, Osamu; Hagiwara, Daisuke; Fujikawa, Takashi; Nishimura, Marie; Yano, Shigekazu; Kasahara, Shin; Shimizu, Kiminori; Yamaguchi, Masashi; Kawakami, Kazuyoshi; Abe, Keietsu

    2013-01-01

    Although α-1,3-glucan is one of the major cell wall polysaccharides in filamentous fungi, the physiological roles of α-1,3-glucan remain unclear. The model fungus Aspergillus nidulans possesses two α-1,3-glucan synthase (AGS) genes, agsA and agsB. For functional analysis of these genes, we constructed several mutant strains in A. nidulans: agsA disruption, agsB disruption, and double-disruption strains. We also constructed several CagsB strains in which agsB expression was controlled by the inducible alcA promoter, with or without the agsA-disrupting mutation. The agsA disruption strains did not show markedly different phenotypes from those of the wild-type strain. The agsB disruption strains formed dispersed hyphal cells under liquid culture conditions, regardless of the agsA genetic background. Dispersed hyphal cells were also observed in liquid culture of the CagsB strains when agsB expression was repressed, whereas these strains grew normally in plate culture even under the agsB-repressed conditions. Fractionation of the cell wall based on the alkali solubility of its components, quantification of sugars, and (13)C-NMR spectroscopic analysis revealed that α-1,3-glucan was the main component of the alkali-soluble fraction in the wild-type and agsA disruption strains, but almost no α-1,3-glucan was found in the alkali-soluble fraction derived from either the agsB disruption strain or the CagsB strain under the agsB-repressed conditions, regardless of the agsA genetic background. Taken together, our data demonstrate that the two AGS genes are dispensable in A. nidulans, but that AgsB is required for normal growth characteristics under liquid culture conditions and is the major AGS in this species.

  19. Naringenin Chalcone Suppresses Allergic Asthma by Inhibiting the Type-2 Function of CD4 T Cells

    Directory of Open Access Journals (Sweden)

    Chiaki Iwamura

    2010-01-01

    Conclusions: : The results of this study suggest that naringenin chalcone suppresses asthmatic symptoms by inhibiting Th2 cytokine production from CD4 T cells. Thus, naringenin chalcone may be a useful supplement for the suppression of allergic symptoms in humans.

  20. Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus1[OPEN

    Science.gov (United States)

    Dillon, Andrew; Varanasi, Vijay K.; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E.; Friebe, Bernd

    2017-01-01

    Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus. PMID:27956489

  1. Characterization and localization of a hybrid non-ribosomal peptide synthetase and polyketide synthase gene from the toxic dinoflagellate Karenia brevis.

    Science.gov (United States)

    López-Legentil, Susanna; Song, Bongkeun; DeTure, Michael; Baden, Daniel G

    2010-02-01

    The toxic dinoflagellate Karenia brevis, a causative agent of the red tides in Florida, produces a series of toxic compounds known as brevetoxins and their derivatives. Recently, several putative genes encoding polyketide synthase (PKS) were identified from K. brevis in an effort to elucidate the genetic systems involved in brevetoxin production. In this study, novel PKS sequences were isolated from three clones of K. brevis. Eighteen unique sequences were obtained for the PKS ketosynthase (KS) domain of K. brevis. Phylogenetic comparison with closely related PKS genes revealed that 16 grouped with cyanobacteria sequences, while the remaining two grouped with Apicomplexa and previously reported sequences for K. brevis. A fosmid library was also constructed to further characterize PKS genes detected in K. brevis Wilson clone. Several fosmid clones were positive for the presence of PKS genes, and one was fully sequenced to determine the full structure of the PKS cluster. A hybrid non ribosomal peptide synthetase and PKS (NRPS-PKS) gene cluster of 16,061 bp was isolated. In addition, we assessed whether the isolated gene was being actively expressed using reverse transcription polymerase chain reaction (RT-PCR) and determined its localization at the cellular level by chloroplast isolation. RT-PCR analyses revealed that this gene was actively expressed in K. brevis cultures. The hybrid NRPS-PKS gene cluster was located in the chloroplast, suggesting that K. brevis acquired the ability to produce some of its secondary metabolites through endosymbiosis with ancestral cyanobacteria. Further work is needed to determine the compound produced by the NRPS-PKS hybrid, to find other PKS gene sequences, and to assess their role in K. brevis toxin biosynthetic pathway.

  2. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome.

  3. Modifications of the alpha,beta-double bond in chalcones only marginally affect the antiprotozoal activities

    DEFF Research Database (Denmark)

    Nielsen, S F; Kharazmi, A; Christensen, S B

    1998-01-01

    Methods for selective alkylation of chalcones in the alpha- or beta-position and for selective reduction of the alpha,beta-double bond have been developed. The antiparasitic potencies of the alpha,beta-double bond modified chalcones only differ marginally from the potencies of the parent chalcones...

  4. Synthesis and Biological Evaluation of Retinoid-Chalcones as Inhibitors of Colon Cancer Cell Growth

    Science.gov (United States)

    Based on the observed anticancer activity of chalcones and retinoids, a novel class of retinoid-chalcone hybrids were designed and synthesized. As part of our ongoing studies to discover natural product based anticancer compounds, the retinoid-chalcone hybrids were tested against the colon cancer ce...

  5. Endothelial nitric oxide synthase gene intron 4 variable number tandem repeat polymorphism in β-thalassemia major: relation to cardiovascular complications.

    Science.gov (United States)

    Tantawy, Azza A G; Adly, Amira A M; Ismail, Eman A; Aly, Shereen H

    2015-06-01

    Endothelial nitric oxide synthase (eNOS), an enzyme that generates nitric oxide, is a major determinant of endothelial function. Several eNOS gene polymorphisms have been reported as 'susceptibility genes' in various human diseases states, including cardiovascular, pulmonary and renal diseases. We studied the 27-base pair tandem repeat polymorphism in intron 4 of eNOS gene in 60 β-thalassemia major (β-TM) patients compared with 60 healthy controls and assessed its role in subclinical atherosclerosis and vascular complications. Patients were evaluated stressing on transfusion history, splenectomy, thrombotic events, echocardiography and carotid intima-media thickness (CIMT). Analysis of eNOS intron 4 gene polymorphism was performed by PCR. No significant difference was found between β-TM patients and controls with regard to the distribution of eNOS4 alleles or genotypes. The frequency of eNOS4a allele (aa and ab genotypes) was significantly higher in β-TM patients with pulmonary hypertension or cardiomyopathy. Logistic regression analysis revealed that eNOS4a allele was an independent risk factor for pulmonary hypertension in β-TM patients [odds ratio (OR) 2.2, 95% confidence interval (95% CI) 1.19-5.6; P < 0.001]. We suggest that eNOS intron 4 gene polymorphism is related to endothelial dysfunction and subclinical atherosclerosis and could be a possible genetic marker for prediction of increased susceptibility to cardiovascular complications.

  6. Isolation and functional analysis of the human glioblastoma-specific promoter region of the human GD3 synthase (hST8Sia I) gene

    Institute of Scientific and Technical Information of China (English)

    Hyun-Mi Dae; Haw-Young Kwon; Nam-Young Kang; Na-Ree Song; Kyoung-Sook Kim; Cheorl-Ho Kim; Jai-Heon Lee; Young-Choon Lee

    2009-01-01

    We identified the promoter region of the human GD3 synthase (hST8Sia I) gene to elucidate the mechanism underlying the regulation of hST8Sia I expression in human glioblastoma cells. The 5-rapid amplification of cDNA end using mRNA prepared from U-87MG cells revealed the presence of transcription start site of hST8Sia I gene, and the 5'-terminal analysis of its product showed that transcription started from 648 nucleotides upstream of the translational initiation site. Functional analysis of the 5'-flanking region of the hST8Sia I gene by transient expression method revealed that the region from 638 to 498 is important for transcriptional activity of the hST8Sia I gene in U-87MG and T98G cells. This region lacks apparent TATA and CAAT boxes, but contains putative binding sites for transcription factors AREB6 and Elk-1. Site-directed mutagenesis and transient transfection assays demonstrated that both AREB6 and Elk-1 elements in this region were required for the promoter activity in U-87MG and T98G cells. These results indicated that both AREB6 and Elk-1 might play an essential role in the transcriptional activity of hST8Sia I gene essential for GD3 synthesis in human glioblastoma cells.

  7. Flower color patterning in pansy (Viola × wittrockiana Gams.) is caused by the differential expression of three genes from the anthocyanin pathway in acyanic and cyanic flower areas.

    Science.gov (United States)

    Li, Qin; Wang, Jian; Sun, Hai-Yan; Shang, Xiao

    2014-11-01

    The petals of pansy (Viola × wittrockiana Gams.) 'Mengdie' exhibit a cyanic blotched pigmentation pattern. The accumulation of anthocyanins, cyanidin and delphinidin, was detected in the upper epidermal cells of the cyanic blotches. In order to elucidate the mechanism by which cyanic blotches are formed in pansy petal, the expression level of genes involved in anthocyanin synthesis was measured and compared between cyanic blotches and acyanic areas of the flower. The use of primers in conserved regions allowed the successful isolation of six cDNA clones encoding putative anthocyanin enzymes from pansy petals. The clones isolated encoded chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H), dihydroflavonol 4-reductase (DFR) and anthocyanidin synthase (ANS). The transcription patterns of seven genes (VwCHS, VwCHI, VwF3H, VwF3'H, VwDFR, VwF3'5'H, and VwANS) in cyanic blotches and acyanic areas of the petals at seven stages of flower development were determined by real-time quantitative PCR. Transcription of VwF3'5'H, VwDFR and VwANS was significantly increased in cyanic blotches at stages III-V of flower development, implicating these genes in the pigmentation of Viola × wittrockiana Gams. petals.

  8. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin

    OpenAIRE

    Kumar-Roine, Shilpa; Matsui, Mariko,; Chinain, M.; Laurent, Dominique; Pauillac, S.

    2008-01-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was qu...

  9. Cloning, expression and functional identification of a type Ⅲ polyketide synthase gene from Huperzia serrata%千层塔中Ⅲ型聚酮合酶基因的克隆、表达与功能鉴定

    Institute of Scientific and Technical Information of China (English)

    叶金翠; 张萍; 孙洁胤; 郭潮潭; 陈国神; 阿部郁朗; 野口博司

    2011-01-01

    Ⅲ型聚酮合酶是以合成聚酮类化合物为主的一类重要生物合成酶.本文利用逆转录聚合酶链反应从中草药千层塔新鲜嫩叶中扩增聚酮合酶基因,得到一个Ⅲ型聚酮合酶全长cDNA.该基因全长1 212 bp,编码404个氨基酸.与已知的其他植物来源的聚酮合酶氨基酸序列有约50%~66%的同源性.cDNA经双酶切后克隆至pQE81L,并导入大肠杆菌(E.coli) M15中表达,产生大量带寡聚组氨酸标记的重组酶,重组酶分子质量大小约为46.4 kDa.酶活性鉴定研究表明,该重组酶可催化芳香族底物、脂肪族底物生成系列非天然聚酮产物,尤其是其可催化N-甲基邻氨基苯甲酰CoA和丙二酰CoA生成1,3-二羟基-N-甲基-吖啶酮,吖啶酮生物碱一直被认为只能由吖啶酮合酶合成.该工作为研究千层塔中Ⅲ型聚酮合酶在天然药物石杉碱甲生物合成中的作用奠定基础.%A Cdna encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. By RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. Serrata PKS2. The terminal sequences of Cdna were obtained by the 3'- and 5'-RACE method. The full-length Cdna ofH, serrata PKS2 contained a 1 212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. Serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. Serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1

  10. Metabolic Engineering of Plant-derived (E)-β-farnesene Synthase Genes for a Novel Type of Aphid-resistant Genetically Modified Crop Plants

    Institute of Scientific and Technical Information of China (English)

    Xiu-Dao Yu; John Pickett; You-Zhi Ma; Toby Bruce; Johnathan Napier; Huw D.Jones; Lan-Qin Xia

    2012-01-01

    Aphids are major agricultural pests that cause significant yield losses of crop plants each year.Excessive dependence on insecticides for long-term aphid control is undesirable because of the development of insecticide resistance,the potential negative effects on non-target organisms and environmental pollution.Transgenic crops engineered for resistance to aphids via a non-toxic mode of action could be an efficient alternative strategy.(E)-β-Farnesene (EβF) synthases catalyze the formation of EβF,which for many pest aphids is the main component of the alarm pheromone involved in the chemical communication within these species.EβF can also be synthesized by certain plants but is then normally contaminated with inhibitory compounds.Engineering of crop plants capable of synthesizing and emitting EβF could cause repulsion of aphids and also the attraction of natural enemies that use EβF as a foraging cue,thus minimizing aphid infestation.In this review,the effects of aphids on host plants,plants' defenses against aphid herbivory and the recruitment of natural enemies for aphid control in an agricultural setting are briefly introduced.Furthermore,the plant-derived EβF synthase genes cloned to date along with their potential roles in generating novel aphid resistance via genetically modified approaches are discussed.

  11. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Wen-Kai Xia

    2014-02-01

    Full Text Available Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor, which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult. When larvae were exposed to diflubenzuron (DFB for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB.

  12. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  13. Phylogeny of type I polyketide synthases (PKSs) in fungal entomopathogens and expression analysis of PKS genes in Beauveria bassiana BCC 2660.

    Science.gov (United States)

    Punya, Juntira; Swangmaneecharern, Pratchya; Pinsupa, Suparat; Nitistaporn, Pornpen; Phonghanpot, Suranat; Kunathigan, Viyada; Cheevadhanarak, Supapon; Tanticharoen, Morakot; Amnuaykanjanasin, Alongkorn

    2015-06-01

    Entomopathogenic fungi are able to invade and kill insects. Various secondary metabolites can mediate the interaction of a fungal pathogen with an insect host and also help the fungus compete with other microbes. Here we screened 23 isolates of entomopathogenic fungi for polyketide synthase (PKS) genes and amplified 72 PKS gene fragments using degenerate PCR. We performed a phylogenetic analysis of conserved ketosynthase and acyltransferase regions in these 72 sequences and 72 PKSs identified from four insect fungal genome sequences. The resulting genealogy indicated 47 orthologous groups with 99-100 % bootstrap support, suggesting shared biosynthesis of identical or closely related compounds from different fungi. Three insect-specific groups were identified among the PKSs in reducing clades IIa, IIb, and III, which comprised PKSs from 12, 9, and 30 fungal isolates, respectively. A IIa-IIb pair could be found in seven fungi. Expression analyses revealed that eleven out of twelve PKS genes identified in Beauveria bassiana BCC 2660 were expressed in culture. PKS genes from insect-specific clades IIa and IIb were expressed only in insect-containing medium, while others were expressed only in PDB or in CYB, PDB and SDY. The data suggest the potential production of several polyketides in culture.

  14. Endothelial Nitric Oxide Synthase (−786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia

    Science.gov (United States)

    Vilas-Boas, Wendell; Figueiredo, Camylla V. B.; Pitanga, Thassila N.; Carvalho, Magda O. S.; Santiago, Rayra P.; Santana, Sânzio S.; Guarda, Caroline C.; Zanette, Angela M. D.; Cerqueira, Bruno A. V.; Gonçalves, Marilda S.

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS −786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  15. Expression of flavonoid 3',5'-hydroxylase and acetolactate synthase genes in transgenic carnation: assessing the safety of a nonfood plant.

    Science.gov (United States)

    Chandler, Stephen F; Senior, Michael; Nakamura, Noriko; Tsuda, Shinzo; Tanaka, Yoshikazu

    2013-12-04

    For 16 years, genetically modified flowers of carnation ( Dianthus caryophyllus ) have been sold to the floristry industry. The transgenic carnation carries a herbicide tolerance gene (a mutant gene encoding acetolactate synthase (ALS)) and has been modified to produce delphinidin-based anthocyanins in flowers, which conventionally bred carnation cannot produce. The modified flower color has been achieved by introduction of a gene encoding flavonoid 3',5'-hydroxylase (F3'5'H). Transgenic carnation flowers are produced in South America and are primarily distributed to North America, Europe, and Japan. Although a nonfood crop, the release of the genetically modified carnation varieties required an environmental risk impact assessment and an assessment of the potential for any increased risk of harm to human or animal health compared to conventionally bred carnation. The results of the health safety assessment and the experimental studies that accompanied them are described in this review. The conclusion from the assessments has been that the release of genetically modified carnation varieties which express F3'5'H and ALS genes and which accumulate delphinidin-based anthocyanins do not pose an increased risk of harm to human or animal health.

  16. Synthesis of Chalcones with Anticancer Activities

    Directory of Open Access Journals (Sweden)

    Syam Mohan

    2012-05-01

    Full Text Available Several chalcones were synthesized and their in vitro cytotoxicity against various human cell lines, including human breast adenocarcinoma cell line MCF-7, human lung adenocarcinoma cell line A549, human prostate cancer cell line PC3, human adenocarcinoma cell line HT-29 (colorectal cancer and human normal liver cell line WRL-68 was evaluated. Most of the compounds being active cytotoxic agents, four of them with minimal IC50 values were chosen and studied in detail with MCF-7 cells. The compounds 1, 5, 23, and 25 were capable in eliciting apoptosis in MCF-7 cells as shown by multiparameter cytotoxicity assay and caspase-3/7, -8, and -9 activities (p < 0.05. The ROS level showed 1.3-fold increase (p < 0.05 at the low concentrations used and thus it was concluded that the compounds increased the ROS level eventually leading to apoptosis in MCF-7 cells through intrinsic as well as extrinsic pathways.

  17. Synthesis of Novel Chalcones as Acetylcholinesterase Inhibitors

    Directory of Open Access Journals (Sweden)

    Thanh-Dao Tran

    2016-07-01

    Full Text Available A new series of benzylaminochalcone derivatives with different substituents on ring B were synthesized and evaluated as inhibitors of acetylcholinesterase. The study is aimed at identification of novel benzylaminochalcones capable of blocking acetylcholinesterase activity for further development of an approach to Alzheimer’s disease treatment. These compounds were produced in moderate to good yields via Claisen-Schmidt condensation and subjected to an in vitro acetylcholinesterase inhibition assay, using Ellman’s method. The in silico docking procedure was also employed to identify molecular interactions between the chalcone compounds and the enzyme. Compounds with ring B bearing pyridin-4-yl, 4-nitrophenyl, 4-chlorophenyl and 3,4-dimethoxyphenyl moieties were discovered to exhibit significant inhibitory activities against acetylcholinesterase, with IC50 values ranging from 23 to 39 µM. The molecular modeling studies are consistent with the hypothesis that benzylaminochalcones could exert their effects as dual-binding-site acetylcholinesterase inhibitors, which might simultaneously enhance cholinergic neurotransmission and inhibit β-amyloid aggregation through binding to both catalytic and peripheral sites of the enzyme. These derivatives could be further developed to provide novel leads for the discovery of new anti-Alzheimer drugs in the future.

  18. The antileishmanial activity of novel oxygenated chalcones and their mechanism of action

    DEFF Research Database (Denmark)

    Zhai, L; Chen, M; Blom, J

    1999-01-01

    and the mechanism of action of a group of new oxygenated chalcones. The tested oxygenated chalcones inhibited the in-vitro growth of Leishmania major promastigotes and Leishmania donovani amastigotes. Treatment of hamsters infected with L. donovani with intraperitoneal administration of two oxygenated chalcones...... the ultrastructure of the mitochondria of L. major promastigote. The data clearly indicate that this group of oxygenated chalcones has a strong antileishmanial activity and might be developed into a new antileishmanial drug. The antileishmanial activity of oxygenated chalcones might be the result of interference...

  19. ENDOTHELIAL NITRIC OXIDE SYNTHASE (ENOS GENE POLYMORPHISM IS ASSOCIATED WITH AGE ONSET OF MENARCHE IN SICKLE CELL DISEASE FEMALES OF INDIA

    Directory of Open Access Journals (Sweden)

    Sudhansu Sekhar Nishank

    2013-06-01

    Full Text Available ABSTRACT   Background and Objective :  Females with sickle cell disease (SCD often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphism- eNOS 4a/b, eNOS 894G>T and eNOS-786 T>C  and  plasma nitrite levels were tested among three groups of females- SCD late menarche, SCD early menarche and control females. Methods : PCR-RFLP method for genotyping eNOS gene polymorphisms and quantification of plasma nitrite level by ELISA based commercial kits were used Results: SCD late menarche females showed significantly higher prevalence and higher association of heterozygous genotypes, higher frequency of mutant alleles ‘4a’, ‘T’ and ‘C’ as compared to that of control group and SCD early menarche group. The frequency of haplotype  ‘4a-G-C’ and haplotype’ 4b-G-C’ (alleles in order of  eNOS 4a/b, eNOS 894G>T and eNOS-786 T>C respectively were found to be significantly high in SCD late menarche compared to combined groups of SCD early menarche and controls. SCD late menarche group had significantly low level of plasma nitrite concentration for all 3 eNOS gene polymorphisms as compared to controls and SCD early menarche females. Conclusion: eNOS gene polymorphism may influence age of onset of menarche in SCD females.   Key words : eNOS gene, sickle cell disease, menarche, haplotype, nitric oxide

  20. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  1. Regional assignment of the human uroporphyrinogen III synthase (UROS) gene to chromosome 10q25.2----q26.3.

    Science.gov (United States)

    Astrin, K H; Warner, C A; Yoo, H W; Goodfellow, P J; Tsai, S F; Desnick, R J

    1991-05-01

    Uroporphyrinogen III synthase [UROS; hydroxymethylbilane hydro-lyase (cyclizing), EC 4.2.1.75] is the fourth enzyme in the human heme biosynthetic pathway. The recent isolation of the cDNA encoding human UROS facilitated its chromosomal localization. Human UROS sequences were specifically amplified by the polymerase chain reaction (PCR) from genomic DNA of two independent panels of human-rodent somatic cell hybrids. There was 100% concordance for the presence of the human UROS PCR product and human chromosome 10. For each of the other chromosomes, there was 19%-53% discordance with human UROS. The chromosomal assignment was confirmed by Southern hybridization analysis of DNA from somatic cell hybrids with the full-length UROS cDNA. Using human-rodent hybrids containing different portions of human chromosome 10, we assigned the UROS gene to the region 10q25.2----q26.3.

  2. Nitric oxide-scavenging properties of some chalcone derivatives.

    Science.gov (United States)

    Herencia, Felipe; López-García, M Pilar; Ubeda, Amalia; Ferrándiz, M Luisa

    2002-03-01

    The implication of NO in many inflammatory diseases has been well documented. We have previously reported that some chalcone derivatives can control the iNOS pathway in inflammatory processes. In the present study, we have assessed the NO-scavenging capacity of three chalcone derivatives (CH8, CH11, and CH12) in a competitive assay with HbO(2), a well-known physiologically relevant NO scavenger. Our data identify these chalcones as new NO scavengers. The estimated second-order rate constants (k(s)) for the reaction of the three derivatives with NO is in the same range as the value obtained for HbO(2), with CH11 exerting the greatest effect. These results suggest an additional action of these compounds on NO regulation.

  3. Bis-chalcones and flavones: synthesis and antimicrobial activity.

    Science.gov (United States)

    Husain, Asif; Rashid, Mohd; Mishra, Ravinesh; Kumar, Deepak

    2013-01-01

    A series of bis-chalcones (3a-g) and their flavones derivatives (4a-g) were synthesized and evaluated for their antimicrobial activity. Bis-chalcones were prepared by condensing 1,1'-(4,6-dihydroxy-1,3-phenylene)diethanone (2) with appropriate aryl aldehydes following Claisen-Schmidt reaction conditions. Oxidative cyclization of bis-chalcones (3a-g) in DMSO in the presence of iodine furnished flavones (4a-g). The synthesized compounds were evaluated for their antibacterial and antifungal actions against some selected microbes. The results of antimicrobial evaluation showed that some of the synthesized compounds were good in their antibacterial and antifungal actions.

  4. Second harmonic generation and crystal growth of new chalcone derivatives

    Science.gov (United States)

    Patil, P. S.; Dharmaprakash, S. M.; Ramakrishna, K.; Fun, Hoong-Kun; Sai Santosh Kumar, R.; Narayana Rao, D.

    2007-05-01

    We report on the synthesis, crystal structure and optical characterization of chalcone derivatives developed for second-order nonlinear optics. The investigation of a series of five chalcone derivatives with the second harmonic generation powder test according to Kurtz and Perry revealed that these chalcones show efficient second-order nonlinear activity. Among them, high-quality single crystals of 3-Br-4'-methoxychalcone (3BMC) were grown by solvent evaporation solution growth technique. Grown crystals were characterized by X-ray powder diffraction (XRD), laser damage threshold, UV-vis-NIR and refractive index measurement studies. Infrared spectroscopy, thermogravimetric analysis and differential thermal analysis measurements were performed to study the molecular vibration and thermal behavior of 3BMC crystal. Thermal analysis does not show any structural phase transition.

  5. The Arabidopsis male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway

    DEFF Research Database (Denmark)

    von Malek, Bernadette; van der Graaff, Eric; Schneitz, Kay;

    2002-01-01

    exhibits a male-sterile phenotype. The dde2-2 phenotype can be rescued by application of methyl jasmonate, indicating that the mutant is affected in jasmonic acid biosynthesis. The combination of genetic mapping and a candidate-gene approach identified a frameshift mutation in the ALLENE OXIDE SYNTHASE...

  6. Cloning of a putative monogalactosyldiacylglycerol synthase gene from rice (Oryza sativa L.) plants and its expression in response to submergence and other stresses.

    Science.gov (United States)

    Qi, Yanhua; Yamauchi, Yasuo; Ling, Jianqun; Kawano, Naoyoshi; Li, Debao; Tanaka, Kiyoshi

    2004-07-01

    Suppression subtractive hybridization was used to construct a subtractive cDNA library from plants of non-submerged and 7-day-submerged rice (Oryza sativa L., FR13A, a submergence-tolerant cultivar). One clone of the subtractive cDNA library, S23, was expressed abundantly during submergence. The full length of S23 was amplified using 5'- and 3'-rapid amplification of cDNA ends, and found to consist of 1,671 bp with an open reading frame of 1,077 bp (181-1257) encoding 358 amino acids. Its deduced amino acid sequence showed a high homology with monogalactosyldiacylglycerol synthase (UDPgalactose: 1,2-diacylglycerol 3-beta-D-galactosyl transferase; EC 2.4.1.46, MGDG synthase) from Arabidopsis thaliana; therefore, we named the gene OsMGD. Time-course studies showed that the expression of OsMGD in the rice cultivars FR13A and IR42 (submergence-susceptive cultivar) during submergence was gradually increased and that expression in FR13A was higher than in IR42. The expression of OsMGD in FR13A was influenced by benzyladenine and illumination. The accumulation of OsMGD mRNA in both FR13A and IR42 was also increased by ethephon, gibberellin, drought and salt treatment, but cold stress had no effect on the expression of the gene. These results suggest that the expression of OsMGD mRNA requires benzyladenine or illumination, and that the process is also mediated by ethephon and gibberellin. Salt and drought stress have an effect similar to that of submergence. Furthermore, the enhanced expression of OsMGD may relate to photosynthesis, and play an important role during submergence.

  7. Gain-of-function mutations in the phosphatidylserine synthase 1 (PTDSS1) gene cause Lenz-Majewski syndrome.

    Science.gov (United States)

    Sousa, Sérgio B; Jenkins, Dagan; Chanudet, Estelle; Tasseva, Guergana; Ishida, Miho; Anderson, Glenn; Docker, James; Ryten, Mina; Sa, Joaquim; Saraiva, Jorge M; Barnicoat, Angela; Scott, Richard; Calder, Alistair; Wattanasirichaigoon, Duangrurdee; Chrzanowska, Krystyna; Simandlová, Martina; Van Maldergem, Lionel; Stanier, Philip; Beales, Philip L; Vance, Jean E; Moore, Gudrun E

    2014-01-01

    Lenz-Majewski syndrome (LMS) is a syndrome of intellectual disability and multiple congenital anomalies that features generalized craniotubular hyperostosis. By using whole-exome sequencing and selecting variants consistent with the predicted dominant de novo etiology of LMS, we identified causative heterozygous missense mutations in PTDSS1, which encodes phosphatidylserine synthase 1 (PSS1). PSS1 is one of two enzymes involved in the production of phosphatidylserine. Phosphatidylserine synthesis was increased in intact fibroblasts from affected individuals, and end-product inhibition of PSS1 by phosphatidylserine was markedly reduced. Therefore, these mutations cause a gain-of-function effect associated with regulatory dysfunction of PSS1. We have identified LMS as the first human disease, to our knowledge, caused by disrupted phosphatidylserine metabolism. Our results point to an unexplored link between phosphatidylserine synthesis and bone metabolism.

  8. Vitis vinifera secondary metabolism as affected by sulfate depletion: diagnosis through phenylpropanoid pathway genes and metabolites.

    Science.gov (United States)

    Tavares, Sílvia; Vesentini, Damiano; Fernandes, João Carlos; Ferreira, Ricardo B; Laureano, Olga; Ricardo-Da-Silva, Jorge M; Amâncio, Sara

    2013-05-01

    Grapevine (Vitis vinifera L.) is rich in phenylpropanoid compounds, namely flavonoids and stilbenes which, present in most tissues, are described as antioxidants and known to accumulate in response to biotic and abiotic stress. Grapevine is then a choice model for studying the interplay between the phenylpropanoid pathway and nutrient deficiency. Here we report the response to sulfur deficiency (-S) of flavonoids and stilbenes biosynthetic pathways in chlorophyll tissues (plantlets) and cell culture. Anthocyanins and trans-resveratrol accumulated in plantlets and trans-resveratrol glucoside in cell cultures in response to sulfur deficiency, while a significant decrease in chlorophyll was observed in -S plantlets. The up-regulation of chalcone synthase gene and the downstream flavonoid biosynthesis genes dihydroflavonol reductase and anthocyanidin synthase matched the accumulation of anthocyanins in -S V. vinifera plantlets. The mRNA level of stilbene synthase gene(s) was correlated tightly with the increase in trans-resveratrol and trans-resveratrol glucoside levels, respectively in -S plantlets and cell cultures. As a whole, the present study unveil that V. vinifera under sulfur deficiency allocates resources to the phenylpropanoid pathway, probably consecutive to inhibition of protein synthesis, which can be advantageous to resist against oxidative stress symptoms evoked by -S conditions.

  9. Synthesis and anti-inflammatory activity of three nitro chalcones.

    Science.gov (United States)

    Gómez-Rivera, Abraham; Aguilar-Mariscal, Hidemí; Romero-Ceronio, Nancy; Roa-de la Fuente, Luis F; Lobato-García, Carlos E

    2013-10-15

    The aim of this study was to synthesize three nitro substituted chalcones and to evaluate their anti-inflammatory activity in the model of carrageenan induced edema in rats. The nitro chalcone were prepared by aldol condensation using of mechanical agitation and environmentally friendly solvents with 72-73% yields in approximately 2h. The three structures were evaluated on biological activity at dose of 200mg/kg and they showed anti-inflammatory protective effect by both oral and intraperitoneal administration, this effect was time dependent.

  10. Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1-carboxylate synthase gene.

    Science.gov (United States)

    Gupta, Aarti; Pal, Ram Krishna; Rajam, Manchikatla Venkat

    2013-07-15

    The ripening hormone, ethylene is known to initiate, modulate and co-ordinate the expression of various genes involved in the ripening process. The burst in ethylene production is the key event for the onset of ripening in climacteric fruits, including tomatoes. Therefore ethylene is held accountable for the tons of post-harvest losses due to over-ripening and subsequently resulting in fruit rotting. In the present investigation, delayed ripening tomatoes were generated by silencing three homologs of 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) gene during the course of ripening using RNAi technology. The chimeric RNAi-ACS construct designed to target ACS homologs, effectively repressed the ethylene production in tomato fruits. Fruits from such lines exhibited delayed ripening and extended shelf life for ∼45 days, with improved juice quality. The ethylene suppression brought about compositional changes in these fruits by enhancing polyamine (PA) levels. Further, decreased levels of ethylene in RNAi-ACS fruits has led to the altered levels of various ripening-specific transcripts, especially the up-regulation of PA biosynthesis and ascorbic acid (AsA) metabolism genes and down-regulation of cell wall hydrolyzing enzyme genes. These results suggest that the down-regulation of ACS homologs using RNAi can be an effective approach for obtaining delayed ripening with longer shelf life and an enhanced processing quality of tomato fruits. Also, the chimeric gene fusion can be used as an effective design for simultaneous silencing of more than one gene. These observations would be useful in better understanding of the ethylene and PA signaling during fruit ripening and molecular mechanisms underlying the interaction of these two molecules in affecting fruit quality traits.

  11. Polymorphism of Plasmodium Falciparum Dihydrofolate Reductase and Dihydropteroate Synthase Genes among Pregnant Women with Falciparum Malaria in Banjar District, South Kalimantan Province, Indonesia

    Directory of Open Access Journals (Sweden)

    Sukmawati Basuki

    2012-12-01

    Full Text Available Pregnant women are highly vulnerable to malaria infection in its endemic areas, particularly infection by Plasmodium falciparum that can cause premature, low birth weight, severe anemia in pregnant women, and death. Sulfadoxine-pyrimethamine (SP for Intermittent Preventive Treatment for pregnant (IPTp is used for malaria control in pregnancy recommended by the World Health Organization that has already been implemented in Africa. The P. falciparum resistance to SP has been reported in several malarial endemic areas, and mutations in the genes of Plasmodium falciparum Dihydrofolate Reductase (Pfdhfr and Dihydropteroate Synthase (Pfdhps are shown to be associated with parasite resistance to SP treatment. Genetic analysis of Pfdhfr and Pfdhps genes in pregnant women infected with P. falciparum has not yet been examined in Indonesia. The cross-sectional study was conducted at tw