WorldWideScience

Sample records for chalcone synthase gene

  1. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  2. An anther-specific chalcone synthase-like gene D5 related to rice pollen development

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    It was shown in a previous analysis that D5 gene from rice (Oryza sativa L.) was an anther-specific gene encoding a chalcone synthase-related protein. In this study, D5 gene was found specifically expressed in tapetum cells as well as in the peripheral cells of the vascular bundle of rice anthers by RNA in situ hybridization. In order to study its function, D5 was transformed into rice in both sense and antisense directions driven by a rice Actin 1 promoter. It has been observed that the pollen grains from the antisense D5 transgenic rice plants are abnormal, indicating that D5 plays a critical role in rice pollen development.

  3. Molecular cloning and expression profiling of a chalcone synthase gene from Lamiophlomis rotata

    Indian Academy of Sciences (India)

    Qiao Feng; Geng Gui-Gong; Zeng Yang; Xie Hui-Chun; Jin Lan; Shang Jun; Chen Zhi

    2015-06-01

    Lamiophlomis rotata is a renowned Chinese medicinal plant. Chalcone synthase (CHS) is important in flavonoid and isoflavonoid biosynthesis, catalysing the formation of naringenin chalcone in plants. A full-length cDNA encoding the CHS gene was cloned from L. rotata based on the highly conserved CHS gene sequences of Labiatae plants. A blast search showed its homology (named LrCHS) with other CHS genes of Labiate plants. The full-length genomic DNA of LrCHS was 2026 bp with one intron of 651 bp, two exons of 178 bp and 998 bp, flanked by a 73 bp $5'$-UTR and a 126 bp $3'$-UTR. The cDNA sequence of the LrCHS gene had an 1176 bp open reading frame encoding a 391 amino acid protein of 42,798 Da. The CHS protein predicted from L. rotata showed 79–86% identity with CHS of other plant species. We conducted a phylogenetic analysis of nine families containing 48 plants and L. rotata based on the full amino acid sequences of CHS proteins. Consequently, LrCHS was located in the Labiatae branch. Additionally, we examined LrCHS gene expression patterns in different tissues by quantitative real-time PCR with specific primers. The expression analysis showed preferential expression of LrCHS in flowers and leaves during the flowering stage. Total flavonoid content and CHS gene expression exhibited similar patterns during L. rotata organ development. In agreement with its function as an elicitor-responsive gene, LrCHS expression was coordinated by methyl jasmonate and UV light, and induced between 6 and 18 h. These results provide a molecular basis for additional functional studies of LrCHS in L. rotata.

  4. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    Science.gov (United States)

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  5. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis

    Indian Academy of Sciences (India)

    Sepideh Sanjari; Zahra Sadat Shobbar; Mohsen Ebrahimi; Tahereh Hasanloo; Seyed-Ahmad Sadat-Noor; Soodeh Tirnaz

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants. Real-time PCR analysis indicated that 1 and 3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  6. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    Science.gov (United States)

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  7. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Science.gov (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  8. Enhanced expression and differential inducibility of soybean chalcone synthase genes by supplemental UV-B in dark-grown seedlings

    International Nuclear Information System (INIS)

    By developing gene-specific RT-PCR and using filters to allow transmission down to 290 nm (UV-B+) or blocking all radiation below 320 nm (UV-B(-)), the effect of UV-B+ and UV-B- light on expression of each of the presently known seven members of soybean chalcone synthase (CHS) gene family in dark-grown seedlings was analyzed. Dark expression was detectable already in 18 h dark-germinating embryos, with progressive increases on successive days, suggesting that chs belongs to a class of genes expressed very early during germination, and that the expression at this stage is either constitutive or induced by non-light-dependent factors present in the seed or made available following imbibition. Exposure of 18 h dark-germinating embryos to UV-B- or to UV-B+ light did not lead to an increase in chs signal. However, the 24 h dark-germinating embryos showed a distinct effect of UV-B+, interestingly coinciding with the stage when the head of seedlings was in the process of being pushed up above ground by stem elongation, suggesting the possibility of a developmental switch modulating the appearance of UV-B response. The response to UV-B- was most prominent in chs1 and almost silent in chs2, while the up-regulation by UV-B+ was most prominent in chs5 and chs6 and much less so in chs2. Interestingly, chs2 was noted to be the only member of the Gmchs gene family devoid of H-box, raising the possibility that the H-box may be a good indicator of the photo-inducibility of a chs gene. (author)

  9. Comparative study of Chalcone synthase promoters across plant families

    Directory of Open Access Journals (Sweden)

    Francisco Buitrago

    2009-10-01

    Full Text Available Estudio comparativo de promotores de la Chalcón Sintasa en diferentes familias de plantas In the post – genomic era the understanding of gene regulation has become a challenge and a research priority. In this research, we performed a comparative study of the regulator sequences of the chalcone synthase gene across plant families. Twenty-two sequences of chalcone synthase promoters were compared considering three regulator Cis elements: G-Box, H-Box and TATA Box. Our results show that these Cis elements are conserved among species and even at the family level. However, in some species all of the Cis elements were not found, showing that the expression and regulation of these promoters via the Cis elements can be variable. Additionally, a comparison between promoters from a species with a chalcone synthase multigene family showed that the duplicate genes are variable in the composition of the Cis elements, suggesting that these genes could be expressing in different ways. Key Words: Promoter; Chalcone synthase; Cis elements; Floral expression. Resumen En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los

  10. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters.

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  11. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  12. Cloning and Sequence Analyzing of Chalcone Synthase Gene in Loropetalum chinense var.Rubrum%红花檵木CHS基因的克隆与序列分析

    Institute of Scientific and Technical Information of China (English)

    许威; 于晓英; 陈己任; 符红艳; 胡博文; 陈彦斌; 李达

    2013-01-01

    查尔酮合酶(chalcone synthase,CHS)是进入类黄酮和花色素苷次生代谢的第1个关键酶.根据植物查尔酮合成酶保守区序列设计引物,以红花檵木Loropetalurn chinense var.Rubrum)大叶红的嫩叶为材料,用RT-PCR方法,分离得到了一个查尔酮合成酶基因的eDNA(GenBank登录号为JQ609678),将该基因命名为Lc vrCHS1.该序列长927 bp,编码232个氨基酸残基.其核苷酸序列与GenBank已登录的同样来源的核桃、山茶属植物CHS序列同源性达83%,与其他科植物(绣球花、葡萄、桃、马铃薯、甘草、领春木属)CHS序列同源性也达到80%以上;其编码的氨基酸序列与山茶属、葡萄、鳄梨、洋梨、沙梨、映山红CHS基因编码的氨基酸序列同样具有高度同源性,同源性高达98%.%Chalcone synthase (chalcone synthase, CHS) is the key enzyme that catalyzes the first step in flavonoids biosynthesis and anthocyanins secondary metabolites. A full-length cDNA encoding CHS was cloned from the young leaves of Loropetalurn chinense var. rubrum by RT-PCR using specific primers based on the highly conserved sequences of plant CHS that had already known. Blast search revealed that it was a new gene, and was named as LcvrCHSl (GenBank accession: JQ609678). The sequence was 927 bp, encoding 232 amino acid residues. It had 83% sequence homology with walnut and camellia that had been logged in GenBank; with other genus plants (hydrangea, grapes, peaches, potatoes, licorice, Euptelea genus), CHS sequence homology was also more than 80%; with other plants (camellia, grapes, avocados, bartlett pear, sand pear, azalea), CHS sequence also had high homology, up to 98% homology.

  13. Trans-chalcone and quercetin down-regulate fatty acid synthase gene expression and reduce ergosterol content in the human pathogenic dermatophyte Trichophyton rubrum

    OpenAIRE

    Bitencourt, Tamires Aparecida; Komoto, Tatiana Takahasi; Massaroto, Bruna Gabriele; Miranda, Carlos Eduardo Saraiva; Beleboni, Rene Oliveira; Marins, Mozart; Fachin, Ana Lúcia

    2013-01-01

    Background Fatty acid synthase (FAS) is a promising antifungal target due to its marked structural differences between fungal and mammalian cells. The aim of this study was to evaluate the antifungal activity of flavonoids described in the scientific literature as FAS inhibitors (quercetin, trans-chalcone, ellagic acid, luteolin, galangin, and genistein) against the dermatophyte Trichophyton rubrum and their effects on fatty acid and ergosterol synthesis. Methods The antifungal activity of th...

  14. Genome-Wide Identification, Characterization and Expression Analysis of the Chalcone Synthase Family in Maize

    OpenAIRE

    Yahui Han; Ting Ding; Bo Su; Haiyang Jiang

    2016-01-01

    Members of the chalcone synthase (CHS) family participate in the synthesis of a series of secondary metabolites in plants, fungi and bacteria. The metabolites play important roles in protecting land plants against various environmental stresses during the evolutionary process. Our research was conducted on comprehensive investigation of CHS genes in maize (Zea mays L.), including their phylogenetic relationships, gene structures, chromosomal locations and expression analysis. Fourteen CHS gen...

  15. A new member of the chalcone synthase (CHS family in sugarcane

    Directory of Open Access Journals (Sweden)

    Miriam G.G. Contessotto

    2001-12-01

    Full Text Available Sequences from the sugarcane expressed sequence tag (SUCEST database were analyzed based on their identities to genes encoding chalcone-synthase-like enzymes. The sorghum (Sorghum bicolor chalcone-synthase (CHS, EC 2.3.1.74 protein sequence (gi|12229613 was used to search the SUCEST database for clusters of sequencing reads that were most similar to chalcone synthase. We found 121 reads with homology to sorghum chalcone synthase, which we were then able to sort into 14 clusters which themselves were divided into two groups (group 1 and group 2 based on the similarity of their deduced amino acid sequences. Clusters in group 1 were more similar to the sorghum enzyme than those in group 2, having the consensus sequence of the active site of chalcone and stilbene synthase. Analysis of gene expression (based on the number of reads from a specific library present in each group indicated that most of the group 1 reads were from sugarcane flower and root libraries. Group 2 clusters were more similar to the amino acid sequence of an uncharacterized pathogen-induced protein (PI1, gi|9855801 from the S. bicolor expressed sequence tag (EST database. The group 2 clusters sequences and PI1 proteins are 90% identical, having two amino acid changes at the chalcone and stilbene synthase consensi but conserving the cysteine residue at the active site. The PI1 EST has not been previously associated with chalcone synthase and has a different consensus sequence from the previously described chalcone synthase of sorghum. Most of the group 2 reads were from libraries prepared from sugarcane roots and plants infected with Herbaspirillum rubrisubalbicans and Gluconacetobacter diazotroficans. Our results indicate that we have identified a sugarcane chalcone synthase similar to the pathogen-induced PI1 protein found in the sorghum cDNA libraries, and it appears that both proteins represent new members of the chalcone and stilbene synthase super-family.Seqüências do

  16. Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens

    OpenAIRE

    Mahiran Basri; Raja Noor Zaliha Raja Abdul Rahman; Abu Bakar Salleh; Iffah Izzati Zakaria

    2012-01-01

    PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving ...

  17. Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen.

    OpenAIRE

    Mo, Y; Nagel, C.; Taylor, L P

    1992-01-01

    Chalcone synthase catalyzes the initial step of that branch of the phenylpropanoid pathway that leads to flavonoids. A lack of chalcone synthase activity has a pleiotropic effect in maize and petunia mutants: pollen fertility as well as flavonoid synthesis is disrupted. Both maize and petunia mutants are self-sterile due to a failure to produce a functional pollen tube. The finding that the mutant pollen is partially functional on wild-type stigmas led to the isolation and identification of k...

  18. Biochemical, immunological, and immunocytochemical evidence for the association of chalcone synthase with endoplasmic reticulum membranes.

    OpenAIRE

    Hrazdina, G; Zobel, A M; Hoch, H. C.

    1987-01-01

    Chalcone synthase [naringenin-chalcone synthase; malonyl-CoA:4-coumaroyl-CoA malonyltransferase (cyclizing), E.C. 2.3.1.74], the key enzyme of flavonoid pathways that was believed to be soluble, has been localized on ribosome-bearing endoplasmic reticulum membranes in the epidermis of buckwheat (Fagopyrum esculentum M.) hypocotyls. Enzyme activity measurement and immunoblots of buckwheat hypocotyl homogenates that were fractionated on linear sucrose density gradients and developed with a spec...

  19. 番茄查尔酮合成酶基因的鉴定及生物信息学分析%Identification and Bioinformatics Analysis of Chalcone Synthase Genes in Tomato

    Institute of Scientific and Technical Information of China (English)

    阮美颖; 杨悦俭; 万红建; 叶青静; 王荣青; 姚祝平; 周国治; 俞锞; 袁伟; 刘云飞

    2013-01-01

      类黄酮(Flavonoids)是植物体内一类重要的次生代谢产物,它以结合态(黄酮苷)或自由态(黄酮苷元)形式存在于水果、蔬菜、豆类和茶叶等许多植物中,对植物的生长发育有着重要的调节作用。查尔酮合成酶(Chalcone synthase, CHS, EC2.3.1.74)是植物类黄酮合成途径的第一个关键酶,在调控类黄酮的生物合成以及类黄酮的成分起着决定作用。本研究基于番茄全基因组测序数据,利用生物信息学方法,鉴定了查尔酮合成酶基因家族成员,分析其内含子-外显子的结构特征、系统发育关系,序列结构的保守性以及染色体上的分布。研究表明:查尔酮合成酶(SlCHS)是含有8个成员的多家族基因,蛋白质序列编码位于160(SlCHS05)~438(SlCHS08)个氨基酸之间;相似性在33.7%(SlCHS02和SlCHS06)~92.0%(SlCHS04和SlCHS07)之间,表明这些序列之间具有较高的遗传多样性;此外,结构分析发现这些基因均含有较少的内含子(0~2个);序列比对表明这些基因具有较高的保守性;它们不均匀分布在番茄的1、5、6、9和12号染色体上。该研究不仅有助于未来了解该基因家族的进化起源提供参考,而且可为我们进一步分析该基因家族成员的功能奠定基础。%Flavonoids are a kind of important secondary metabolites in plants. Usually, it was found in fruits, vegetables, beans, tea and many other plants as combination (flavonoid glycosides) or free states (flavonoid glyco-sides) form. It has important role in regulating plant growth and development. Chalcone synthase, the first key synthase during the process of flavonoids synthesis, plays an important role in plant growth and development. Based on the whole tomato genome sequence, we investigated gene members of the chalcone synthase family with genome database and bioinformatics analysis. We identified 8 chalcone synthase genes with protein sequence length varying

  20. Attenuation of Mycobacterium tuberculosis by Disruption of a mas-Like Gene or a Chalcone Synthase-Like Gene, Which Causes Deficiency in Dimycocerosyl Phthiocerol Synthesis

    OpenAIRE

    Sirakova, Tatiana D.; Dubey, Vinod S.; Cynamon, Michael H.; Kolattukudy, Pappachan E.

    2003-01-01

    Tuberculosis is one of the leading preventable causes of death. Emergence of drug-resistant tuberculosis makes the discovery of new targets for antimycobacterial drugs critical. The unique mycobacterial cell wall lipids are known to play an important role in pathogenesis, and therefore the genes responsible for their biosynthesis offer potential new targets. To assess the possible role of some of the genes potentially involved in cell wall lipid synthesis, we disrupted a mas-like gene, msl7, ...

  1. UV-induction of chalcone synthase mRNA in cell suspension cultures of Petroselinum hortense

    OpenAIRE

    Kreuzaler, Fritz; Ragg, Hermann; Fautz, Erich; David N Kuhn; Hahlbrock, Klaus

    1983-01-01

    DNAs complementary to poly(A)+ mRNAs from UV-irradiated cell suspension cultures of parsley (Petroselinum hortense) were inserted into pBR322 and used to transform Escherichia coli strain RR1. A clone containing a DNA complementary to chalcone synthase mRNA was identified by hybrid-selected and hybrid-arrested translation. Large and rapid changes in the amount of chalcone synthase mRNA in response to irradiation of the cells was detected by RNA blot hybridization experiments. The pattern of c...

  2. Genome-Wide Identification, Characterization and Expression Analysis of the Chalcone Synthase Family in Maize.

    Science.gov (United States)

    Han, Yahui; Ding, Ting; Su, Bo; Jiang, Haiyang

    2016-01-01

    Members of the chalcone synthase (CHS) family participate in the synthesis of a series of secondary metabolites in plants, fungi and bacteria. The metabolites play important roles in protecting land plants against various environmental stresses during the evolutionary process. Our research was conducted on comprehensive investigation of CHS genes in maize (Zea mays L.), including their phylogenetic relationships, gene structures, chromosomal locations and expression analysis. Fourteen CHS genes (ZmCHS01-14) were identified in the genome of maize, representing one of the largest numbers of CHS family members identified in one organism to date. The gene family was classified into four major classes (classes I-IV) based on their phylogenetic relationships. Most of them contained two exons and one intron. The 14 genes were unevenly located on six chromosomes. Two segmental duplication events were identified, which might contribute to the expansion of the maize CHS gene family to some extent. In addition, quantitative real-time PCR and microarray data analyses suggested that ZmCHS genes exhibited various expression patterns, indicating functional diversification of the ZmCHS genes. Our results will contribute to future studies of the complexity of the CHS gene family in maize and provide valuable information for the systematic analysis of the functions of the CHS gene family. PMID:26828478

  3. In situ localization of chalcone synthase mRNA in pea root nodule development.

    NARCIS (Netherlands)

    Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.

    1992-01-01

    In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it

  4. Co-suppression in transgenic Petunia hybrida expressing chalcone synthase A (chsA)

    Institute of Scientific and Technical Information of China (English)

    LI; Yan; (

    2001-01-01

    [1]Napoli, C., Lemieux, C., Jorgensen, R., Introduction of a chimeric chalone synthase gene into petunia results in reversible cosuppession of homologous genes in trans, The Plant Cell, 1990, 2: 279-289.[2]Van der Krol, A.R., Mur, L.A., Beld, M. M. et al., Flavonnoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression, The Plant Cell, 1990, 2: 291-299.[3]Manika, P.B., Bhadra, U., Birchler, J., Cosuppression in Drosophila: gene silencing of Alcohol dehydrogenase by White-Adh transgene is Polycomb dependent, Cell, 1997, 90: 479-498.[4]de Carvalho Niebel, F., Frendo, P., Van Montagu, M. et al., Post-transcriptional cosuppression of ?-1,3-glucanase transgene expression in homozygous plants, EMBO J., 1992, 11: 2595-2602.[5]Van Blokland, R., Van der Geest, N., Mol, J. N. M. et al., Transgene-mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RNA turnover, The Plant Cell, 1994, 6: 861-877.[6]Stam, M., Mol, J. N. M., Kooter, J. M., The silence of genes in transgenic plants, Annals of Bot., 1997, 79: 3-12.[7]Vaucheret, H., Beclin, C., Elmayan, T. et al., Transgene-induced gene silencing in plants, Plant J., 1998, 16(6): 651-659.[8]Shao, L., Li, Y., Yang, M. Z. et al., Transformation of Petunia hybrida with chalcone synthase A (chsA) resulting flower colour alteration and male sterility, Acta Botanica Sinica (in Chinese), 1996, 38(7): 517-524.[9]Koes, R. E., Spelt, C. E., Mol, J. N. M., The chalcone synthase multigene family of Petunia hybrida (V30): differential, light-regulated expression during flower development and UV light induction, Plant Mol. Biol., 1989, 12: 213-225.[10]Drews, G. N., Beals, T. P., Bul, A. Q. et al., Regional and cell-specific expression patterns during petal development, The Plant Cell, 1992, 4: 1383-1404.[11]Martin, C., Gerats, T., Control of pigment biosynthesis genes during petal development, The

  5. Elicitor rapidly induces chalcone synthase mRNA in Phaseolus vulgaris cells at the onset of the phytoalexin defense response

    OpenAIRE

    Ryder, Thomas B.; Cramer, Carole L; Bell, John N.; Robbins, Mark P.; Dixon, Richard A.; Lamb, Chris J.

    1984-01-01

    DNAs complementary to poly(A)+ RNA present in elicitor-treated cells of Phaseolus vulgaris L. were inserted into pBR325 and used to transform Escherichia coli strain JA221. A clone was identified that contained sequences complementary to mRNA encoding chalcone synthase, a regulatory enzyme of phenylpropanoid biosynthesis, which catalyzes the first reaction of a branch pathway specific to flavonoid and isoflavonoid biosynthesis. Rapid, marked but transient increases in chalcone synthase mRNA i...

  6. Cis-regulatory Evolution of Chalcone-Synthase Expression in the Genus Arabidopsis

    OpenAIRE

    de Meaux, J. (Juliette); Pop, A.(National Institute for Physics and Nuclear Engineering, Bucharest, Romania); Mitchell-Olds, T.

    2006-01-01

    The contribution of cis-regulation to adaptive evolutionary change is believed to be essential, yet little is known about the evolutionary rules that govern regulatory sequences. Here, we characterize the short-term evolutionary dynamics of a cis-regulatory region within and among two closely related species, A. lyrata and A. halleri, and compare our findings to A. thaliana. We focused on the cis-regulatory region of chalcone synthase (CHS), a key enzyme involved in the synthesis of plant sec...

  7. Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens

    Directory of Open Access Journals (Sweden)

    Mahiran Basri

    2012-08-01

    Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.

  8. Catechol-based substrates of chalcone synthase as a scaffold for novel inhibitors of PqsD.

    OpenAIRE

    Allegretta, Giuseppe; Weidel, Elisabeth; Empting, Martin; Hartmann, Rolf W.

    2015-01-01

    A new strategy for treating Pseudomonas aeruginosa infections could be disrupting the Pseudomonas Quinolone Signal (PQS) quorum sensing (QS) system. The goal is to impair communication among the cells and, hence, reduce the expression of virulence factors and the formation of biofilms. PqsD is an essential enzyme for the synthesis of PQS and shares some features with chalcone synthase (CHS2), an enzyme expressed in Medicago sativa. Both proteins are quite similar concerning the size of the ac...

  9. Transcriptional activation of the parsley chalcone synthase promoter in heterologous pea and yeast systems.

    Science.gov (United States)

    Kalbin; Strid; Frohnmeyer

    1999-11-01

    Introduction by electroporation of different parsley (Petroselinum crispum) CHS-promoter/beta-glucuronidase(GUS)-reporter constructs into pea (Pisum sativum L.) protoplasts leads to a high constitutive GUS-expression and to the loss of the light-inducibility seen in the homologous parsley protoplast system. These results indicate that Unit 1 of the parsley CHS-promoter is only partly responsible for the GUS-expression detected. Instead, additional cis-elements, which are located downstream within 100 bp from the transcriptional start site, mediate the de-repression in pea protoplasts. In contrast, in yeast (Saccharomyces cerevisiae) cells, the GUS expression from the heterologous CHS/GUS construct is controlled by elements between Unit 1 and -100 bp. In both pea and yeast cells, transcription factors different from those regulating UV-responsiveness in parsley, are probably mediating the constitutive expression from the heterologous construct. The results with pea protoplasts imply that protoplastation of pea leaf cells itself induces de-repression as a result of stress to the protoplasts. This notion was strengthened by the finding that mRNA levels of the endogenous chalcone synthase were drastically increased as the result of the protoplastation procedure. PMID:10580282

  10. Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in flavonoid biosynthetic pathway.

    Directory of Open Access Journals (Sweden)

    Wei Sun

    Full Text Available Chalcone synthase (CHS catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1 encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants.

  11. Cloning,Expression Analysis and Promoter Isolation of Chalcone-synthase Gene from Fruits of Nane,Prunus salicina Lindl.var.cordata%油果实中查尔酮合成酶基因 PsCHS 的克隆表达分析及其启动子的分离

    Institute of Scientific and Technical Information of China (English)

    姜翠翠; 王玉珍; 叶新福

    2016-01-01

    Chalcone-synthase (CHS,EC 2.3.1.74)is an important enzyme involved inflavonoids synthesis pathway in plants.This study aimed to investigate the gene structure and expression profile of CHS gene in the fruits of nane (Prunus salicina Lindl.var.cordata).A full-length cDNA sequence harboring a CHS gene,named PsCHS ,was successfully separated from a normalized full-length cDNA library of matured nane fruits.The up-stream promoter sequence of PsCHS was separated by genome walking strategy using primer pair designed byPsCHS sequence.The length of PsCHS was 1 442 bp with ORF of 1 176 bp and deduced amino acid of 392 aa.From the prediction by an online software,the promoter sequence of PsCHS have typical structure element TATA-box and CAAT-box, photon-response element, anaerote-induced element, endosperm-related element, MYB-bingding element and hormone-response element,etc.RT-PCR indicated that PsCHS had higher expression level at the earlier stage of development of the fruit,especially 40 d after blossom,then decreased to a lower level at the maturing stage. PsCHS seperated in this study was a member of the CHS gene family.Since CHS is a key enzyme involved in flavonoid biosynthesis pathway,PsCHS might act with a regulatory role in biosynthesis of flavonoids.%从成熟果实均一化全长 cDNA 文库中分离了编码 CHS 基因的全长 cDNA 序列,命名为 PsCHS ,根据其序列设计引物,采用 Genome Walking 方法从基因组 DNA 中分离获得 PsCHS 基因上游的调控序列,命名为 PsCHSp ,PsCHS 基因全长1442 bp,其中 ORF 1176 bp,编码392个氨基酸;采用 APA-Walking 技术,获得该基因的5′端调控区,经在线软件预测,启动子序列含有典型的结构特征元件 TATA-box 和 CAAT-box,还包含光响应元件、厌氧诱导元件、胚乳表达相关元件、MYB 结合位点以及激素响应元件;RT-PCR 结果显示,PsCHS 基因在果实发育的前期表达量较高,花后40 d 表达量最高,随

  12. CHS基因起源初探及其在被子植物中的进化分析%A Preliminary Study on the Origin and Evolution of Chalcone Synthase (CHS) Gene in Angiosperms

    Institute of Scientific and Technical Information of China (English)

    黄金霞; 瞿礼嘉; 杨继; 银好; 顾红雅

    2004-01-01

    利用PCR与TAlL-PCR方法,从半月苔(Lunularia cructata(L.)Dum.ex Lindb)中获得了一段长约l 000 bp的基因片段,它与已知的CHS基因在核苷酸水平上的相似性大于56%,在氨基酸水平上的相似性大于60%,所推断的氨基酸序列中酶反应的4个催化位点与已知晶体结构的紫花苜蓿MCHS2A上的催化位点相同,首次证明了苔类植物中可能存在类CHS基因,将CHS基因的起源时间推到苔藓类植物出现之前.以该序列和两种蕨类植物(Psilotumnudum(L.)Griseb.和Equisetum arvense L.)的CHS序列作为外类群,应用邻接法、最大简约法和最大似然法分别构建了被子植物的CHS的分子系统树.结果表明,大部分科中的CHS分布在不同的分支上,而十字花科、可科和禾本科各自聚成一个单系类群.以邻接树为依据,对茄科、旋花科和菊科的CHS基因进行了相对碱基替换速率的检测,发现这三个科内或科间序列的替换速率不一致.被子植物的CHS基因在基因拷贝数目、碱基替换速率以及重复/丢失事件的发生上都存在较大的差异,这种差异可能与被子植物的生活史、生活环境、花的特性以及对外界的防御系统等的多样性相关.%By using Thermal Asymmetric Interlaced PCR (TAIL-PCR) method, a DNA fragment of about 1 000 bp was amplified and cloned from a liverwort species (Lunularia cruciata (L.) Dum. ex Lindb). The nucleotide sequence of this fragment and its deduced amino acid sequence shared about 56% and 60% identity with those of exon 2 of CHS genes from vascular plants respectively. The four characteristic catalyzing sites of CHS were found conserved in the deduced amino acid sequences of the fragment when compared with other CHS sequences. This is the first report of cloning a CHS-like gene from liverworts,suggesting that the origin of CHS genes may predate liverworts. Using the CHS-like sequence from L.cruciata and CHS sequences from two fern-alien species, Psilotum

  13. Changes in Phytochemical Synthesis, Chalcone Synthase Activity and Pharmaceutical Qualities of Sabah Snake Grass (Clinacanthus nutans L.) in Relation to Plant Age

    OpenAIRE

    Ali Ghasemzadeh; Alireza Nasiri; Jaafar, Hawa Z. E.; Ali Baghdadi; Izham Ahmad

    2014-01-01

    In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old). The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74) was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF) production were observed between the three plant growth periods and the different plant parts. The highest conten...

  14. Differential induction of chalcone synthase mRNA activity at the onset of phytoalexin accumulation in compatible and incompatible plant-pathogen interactions

    OpenAIRE

    Bell, John N.; Dixon, Richard A.; Bailey, John A.; Rowell, Pat M.; Lamb, Chris J.

    1984-01-01

    Changes in the mRNA activity of chalcone synthase, the first enzyme of phenylpropanoid metabolism specific to flavonoid/isoflavonoid biosynthesis, have been investigated in relation to expression of the phytoalexin defense response in race-cultivar specific interactions between hypocotyls of Phaseolus vulgaris and the partially biotrophic fungus Colletotrichum lindemuthianum, causal agent of anthracnose. In an incompatible interaction (host resistant) there is an early but localized increase ...

  15. Involvement of Salicylic Acid on Antioxidant and Anticancer Properties, Anthocyanin Production and Chalcone Synthase Activity in Ginger (Zingiber officinale Roscoe) Varieties

    OpenAIRE

    Ehsan Karimi; Jaafar, Hawa Z. E.; Ali Ghasemzadeh

    2012-01-01

    The effect of foliar application of salicylic acid (SA) at different concentrations (10−3 M and 10−5 M) was investigated on the production of secondary metabolites (flavonoids), chalcone synthase (CHS) activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231) in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC) analysis showed that application of SA induced t...

  16. The tomato terpene synthase gene family

    NARCIS (Netherlands)

    V. Falara; T.A. Akhtar; T.T.H. Nguyen; E.A. Spyropoulou; P.M. Bleeker; I. Schauvinhold; Y. Matsuba; M.E. Bonini; A.L. Schilmiller; R.L. Last; R.C. Schuurink; E. Pichersky

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28

  17. The tomato terpene synthase gene family

    OpenAIRE

    Falara, V.; Akhtar, T.A.; NGUYEN, T. T. H.; Spyropoulou, E.A.; Bleeker, P.M.; Schauvinhold, I.; Matsuba, Y.; Bonini, M.E.; Schilmiller, A.L.; Last, R.L.; Schuurink, R. C.; Pichersky, E

    2011-01-01

    Compounds of the terpenoid class play many roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of Solanum lycopersicum (cultivated tomato) contains 40 terpene synthase (TPS) genes, including 28 which are functional or potentially functional. Of these 28 TPS genes, 25 were expressed in at least some parts of the plant. The enzymatic functions of eight of the TPS proteins were previously r...

  18. A mutation in the rice chalcone isomerase gene causes the golden hull and internode 1 phenotype.

    Science.gov (United States)

    Hong, Lilan; Qian, Qian; Tang, Ding; Wang, Kejian; Li, Ming; Cheng, Zhukuan

    2012-07-01

    The biosynthesis of flavonoids, important secondary plant metabolites, has been investigated extensively, but few mutants of genes in this pathway have been identified in rice (Oryza sativa). The rice gold hull and internode (gh) mutants exhibit a reddish-brown pigmentation in the hull and internode and their phenotype has long been used as a morphological marker trait for breeding and genetic study. Here, we characterized that the gh1 mutant was a mutant of the rice chalcone isomerase gene (OsCHI). The result showed that gh1 had a Dasheng retrotransposon inserted in the 5′ UTR of the OsCHI gene, which resulted in the complete loss of OsCHI expression. gh1 exhibited golden pigmentation in hulls and internodes once the panicles were exposed to light. The total flavonoid content in gh1 hulls was increased threefold compared to wild type. Consistent with the gh1 phenotype, OsCHI transcripts were expressed in most tissues of rice and most abundantly in internodes. It was also expressed at high levels in panicles before heading, distributed mainly in lemmas and paleae, but its expression decreased substantially after the panicles emerged from the sheath. OsCHI encodes a protein functionally and structurally conserved to chalcone isomerases in other species. Our findings demonstrated that the OsCHI gene was indispensable for flux of the flavonoid pathway in rice. PMID:22286805

  19. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    OpenAIRE

    Jagielska, Elżbieta; Płucienniczak, Andrzej; Dąbrowska, Magdalena; Dowierciał, Anna; Rode, Wojciech

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene...

  20. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo;

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...... affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes....

  1. Involvement of Salicylic Acid on Antioxidant and Anticancer Properties, Anthocyanin Production and Chalcone Synthase Activity in Ginger (Zingiber officinale Roscoe Varieties

    Directory of Open Access Journals (Sweden)

    Ehsan Karimi

    2012-11-01

    Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of

  2. Isolation and characterization of a chalcone isomerase gene promoter from potato cultivars.

    Science.gov (United States)

    Chen, M; Zhu, W J; You, X; Liu, Y D; Kaleri, G M; Yang, Q

    2015-01-01

    Chalcone isomerase (CHI) is a key enzyme involved in anthocyanin metabolism. Previous research on CHI has mainly focused on cDNA cloning and gene expression. In the current study, the 1425-bp potato CHI promoter (PCP) was isolated from four potato cultivars (Heijingang, Zhongshu 7, Désirée, and Favorita) using PCR and DNA sequencing. The PCP contained many cis-regulatory elements (CREs) related to anthocyanin metabolism, tissue specificity, light response, stress, and hormone induction. Of the PCP CREs identified, 19 were common to those found in the higher plants examined, based on plant CRE databases. Multiple sequence alignment showed six single nucleotide variation sites in PCP among the potato cultivars examined, resulting in changes in the number of CREs connected with tissue specificity, anthocyanin metabolism, and light response. The 665-bp PCP fragments from Favorita and 1425-bp PCP fragments from Heijingang were used to construct plant expression vectors, which may be a useful tool for biological engineering. A transient expression assay demonstrated that the two PCP fragments from Heijingang could direct the expression of a green fluorescent protein gene in onion epidermis and a β-glucuronidase gene in all potato tuber tissues with different colors, suggesting that the single nucleotide variation in the PCP did not affect its activity, and that silencing of the CHI gene in Favorita may be attributed to other regulatory factors. PMID:26782538

  3. Tissue localization of u.v.-B-screening pigments and of chalcone synthase mRNA in needles of Scots pine seedlings

    International Nuclear Information System (INIS)

    Epidermal tissue was isolated from Scots pine (Pinus sylvestris L.) needles by enzymatic digestion in order to study tissue distribution of u.v.-B-screening pigments. Up to 90% of the needle content of a group of diacylated flavonol glycosides that were structurally closely related was found in the epidermal layer. Among these metabolites, 3'',6''-di-para-coumaroyl-isoquercitrin and 3'',6''-di-para-coumaroyl-astragalin were the main u.v.-B-induced compounds in cotyledons and primary needles, respectively. However, catechin and astragalin (kaempferol 3-glucoside), two non-acylated flavonoid metabolites, were only observed in total needle extracts, and at levels independent of u.v.-B treatment. According to this metabolite distribution, the mRNA of chalcone synthase, the key enzyme to flavonoids, was found in epidermal and mesophyll as well as vascular tissues. The major alkaliextractable wall-bound phenolic metabolites, astragalin, 4-coumaric acid, and ferulic acid, a minor component of the cell wall, were also found exclusively in the epidermal layer. These compounds were not stimulated by u.v.-B irradiation within the experimental period. Staining of needle cross sections and epidermal layer preparations with Naturstoffreagenz A confirmed the specific localization of wall-bound astragalin in the outer wall of the epidermal layer. Model calculations of u.v.-B absorptions at 300 nm of soluble and cell-wall-bound metabolites of the epidermal layer revealed an almost complete shielding of the mesophyll tissue from u.v.-B radiation

  4. 4'-Acetoamido-4-hydroxychalcone, a chalcone derivative, inhibits glioma growth and invasion through regulation of the tropomyosin 1 gene

    International Nuclear Information System (INIS)

    Research highlights: → 4'-Acetoamido-4-hydroxychalcone (AHC) has anti-cancer property for glioma. → 4'-Acetoamido-4-hydroxychalcone (AHC) increased tropomyosin expreesion through activattion of PKA signaling. → 4'-Acetoamido-4-hydroxychalcone (AHC) inhibits glioma cell migration and invasion. → In vivo administration of 4'-acetoamido-4-hydroxychalcone (AHC) reduced tumor growth. -- Abstract: Chalcones are precursors of flavonoids and have been shown to have anti-cancer activity. Here, we identify the synthetic chalcone derivative 4'-acetoamido-4-hydroxychalcone (AHC) as a potential therapeutic agent for the treatment of glioma. Treatment with AHC reduced glioma cell invasion, migration, and colony formation in a concentration-dependent manner. In addition, AHC inhibited vascular endothelial growth factor-induced migration, invasion, and tube formation in HUVECs. To determine the mechanism underlying the inhibitory effect of AHC on glioma cell invasion and migration, we investigated the effect of AHC on the gene expression change and found that AHC affects actin dynamics in U87MG glioma cells. In actin cytoskeleton regulating system, AHC increased tropomyosin expression and stress fiber formation, probably through activation of PKA. Suppression of tropomyosin expression by siRNA or treatment with the PKA inhibitor H89 reduced the inhibitory effects of AHC on glioma cell invasion and migration. In vivo experiments also showed that AHC inhibited tumor growth in a xenograft mouse tumor model. Together, these data suggest that the synthetic chalcone derivative AHC has potent anti-cancer activity through inhibition of glioma proliferation, invasion, and angiogenesis and is therefore a potential chemotherapeutic candidate for the treatment of glioma.

  5. Changes in phytochemical synthesis, chalcone synthase activity and pharmaceutical qualities of sabah snake grass (Clinacanthus nutans L.) in relation to plant age.

    Science.gov (United States)

    Ghasemzadeh, Ali; Nasiri, Alireza; Jaafar, Hawa Z E; Baghdadi, Ali; Ahmad, Izham

    2014-01-01

    In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old). The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74) was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF) production were observed between the three plant growth periods and the different plant parts. The highest contents of TF (6.32 mg/g dry weight [DW]) and total phenolic (TP) (18.21 mg/g DW) were recorded in 6-month-old buds. Among the flavonoids isolated in this study the most important ones based on concentration were from high to low as follows: catechin > quercetin > kaempferol > luteolin. Production of phenolic acids increased from 1 to 6 months, but after 6 months up to 1 year of age, they decreased significantly. The highest contents of caffeic acid (0.307 mg/g DW) and gallic acid (5.96 mg/g DW) were recorded in 1-year and 6-month-old buds, respectively. The lowest and highest activity of CHS was recorded in 1-month and 6-month-old buds with values of 3.6 and 9.5 nkat/mg protein, respectively. These results indicate that the increment in flavonoids and phenolic acids in 6-month-old buds can be attributed to an increase in CHS activity. The highest 1,1-diphenyl-2-picrylhydrazyl (DPPH) activity was observed in the extract of 1-year-old buds followed by 6-month-old buds, with 50% of free radical scavenging (IC50) values of 64.6 and 73.5 µg/mL, respectively. Interestingly, a ferric reducing antioxidant power (FRAP) assay showed a higher activity in 6-month-old buds (488 μM of Fe(II)/g) than in 1-year-old buds (453 μM of Fe(II)/g), in contrast to the DPPH result. Significant correlations (p < 0.05) were observed between CHS enzyme activity and FRAP activity, TF, catechin, and kaempferol content. Extracts of 6-month-old bud exhibited a significant in vitro anticancer activity against

  6. Changes in Phytochemical Synthesis, Chalcone Synthase Activity and Pharmaceutical Qualities of Sabah Snake Grass (Clinacanthus nutans L. in Relation to Plant Age

    Directory of Open Access Journals (Sweden)

    Ali Ghasemzadeh

    2014-10-01

    Full Text Available In the current study, changes in secondary metabolite synthesis and the pharmaceutical quality of sabah snake grass leaves and buds were considered in relation to plant age (1 month, 6 months, and 1 year old. The activity of the enzyme chalcone synthase (CHS, EC 2.3.1.74 was measured, as it is a key enzyme for flavonoid production. Significant differences in total flavonoid (TF production were observed between the three plant growth periods and the different plant parts. The highest contents of TF (6.32 mg/g dry weight [DW] and total phenolic (TP (18.21 mg/g DW were recorded in 6-month-old buds. Among the flavonoids isolated in this study the most important ones based on concentration were from high to low as follows: catechin > quercetin > kaempferol > luteolin. Production of phenolic acids increased from 1 to 6 months, but after 6 months up to 1 year of age, they decreased significantly. The highest contents of caffeic acid (0.307 mg/g DW and gallic acid (5.96 mg/g DW were recorded in 1-year and 6-month-old buds, respectively. The lowest and highest activity of CHS was recorded in 1-month and 6-month-old buds with values of 3.6 and 9.5 nkat/mg protein, respectively. These results indicate that the increment in flavonoids and phenolic acids in 6-month-old buds can be attributed to an increase in CHS activity. The highest 1,1-diphenyl-2-picrylhydrazyl (DPPH activity was observed in the extract of 1-year-old buds followed by 6-month-old buds, with 50% of free radical scavenging (IC50 values of 64.6 and 73.5 µg/mL, respectively. Interestingly, a ferric reducing antioxidant power (FRAP assay showed a higher activity in 6-month-old buds (488 μM of Fe(II/g than in 1-year-old buds (453 μM of Fe(II/g, in contrast to the DPPH result. Significant correlations (p < 0.05 were observed between CHS enzyme activity and FRAP activity, TF, catechin, and kaempferol content. Extracts of 6-month-old bud exhibited a significant in vitro anticancer activity

  7. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.;

    2005-01-01

    silencing. The metabolite profiles of the transgenic lines were examined for unintended effects of the modification. An apparently major effect on the glucosinolate composition was shown to result from an unusual genetic variation in the ecotype and not from the modification. The modification did produce a...

  8. Chalcone Synthase Gene Lineage Diversification confirms allopolyploid evolutionary relationships of European Rostrate Violets

    NARCIS (Netherlands)

    Hof, van den K.; Berg, van den R.G.; Gravendeel, B.

    2008-01-01

    Phylogenetic relationships among and within the subsections of the genus Viola are still far from resolved. We present the first organismal phylogeny of predominantly western European species of subsection Rostratae based on the plastid trnS¿trnG intron and intergenic spacer and the nuclear low-copy

  9. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B;

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar t...... into plasmid vectors under control of the lac and tac promoters. These constructs direct the synthesis of catalytically active enzyme to the extent of 2% of total soluble protein....

  10. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  11. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    OpenAIRE

    YAMADA, YUUKI; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2015-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowe...

  12. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode polyketides important in pathogenicity. PMID:27388157

  13. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  14. Differential Expression of Anthocyanin Biosynthetic Genes in Relation to Anthocyanin Accumulation in the Pericarp of Litchi Chinensis Sonn

    OpenAIRE

    Yong-Zan Wei; Fu-Chu Hu; Gui-Bing Hu; Xiao-Jing Li; Xu-Ming Huang; Hui-Cong Wang

    2011-01-01

    Litchi has diverse fruit color phenotypes, yet no research reflects the biochemical background of this diversity. In this study, we evaluated 12 litchi cultivars for chromatic parameters and pigments, and investigated the effects of abscisic acid, forchlorofenron (CPPU), bagging and debagging treatments on fruit coloration in cv. Feizixiao, an unevenly red cultivar. Six genes encoding chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase...

  15. 4'-Acetoamido-4-hydroxychalcone, a chalcone derivative, inhibits glioma growth and invasion through regulation of the tropomyosin 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Ku, Bo Mi [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of); Ryu, Hyung Won [Division of Applied Life Science (BK21 Program), EB-NCRC, Institute of Agriculture Life Science, Graduate School of Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Lee, Yeon Kyung; Ryu, Jinhyun; Jeong, Joo Yeon; Choi, Jungil [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of); Cho, Hee Jun [Department of Microbiology, Research Institute of Life Science, College of Natureal Sciences, Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Park, Ki Hun, E-mail: khpark@gnu.ac.kr [Division of Applied Life Science (BK21 Program), EB-NCRC, Institute of Agriculture Life Science, Graduate School of Gyeongsang National University, Jinju 660-701 (Korea, Republic of); Kang, Sang Soo, E-mail: kangss@gnu.ac.kr [Department of Anatomy and Neurobiology, Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju 660-751 (Korea, Republic of)

    2010-11-19

    Research highlights: {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) has anti-cancer property for glioma. {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) increased tropomyosin expreesion through activattion of PKA signaling. {yields} 4'-Acetoamido-4-hydroxychalcone (AHC) inhibits glioma cell migration and invasion. {yields} In vivo administration of 4'-acetoamido-4-hydroxychalcone (AHC) reduced tumor growth. -- Abstract: Chalcones are precursors of flavonoids and have been shown to have anti-cancer activity. Here, we identify the synthetic chalcone derivative 4'-acetoamido-4-hydroxychalcone (AHC) as a potential therapeutic agent for the treatment of glioma. Treatment with AHC reduced glioma cell invasion, migration, and colony formation in a concentration-dependent manner. In addition, AHC inhibited vascular endothelial growth factor-induced migration, invasion, and tube formation in HUVECs. To determine the mechanism underlying the inhibitory effect of AHC on glioma cell invasion and migration, we investigated the effect of AHC on the gene expression change and found that AHC affects actin dynamics in U87MG glioma cells. In actin cytoskeleton regulating system, AHC increased tropomyosin expression and stress fiber formation, probably through activation of PKA. Suppression of tropomyosin expression by siRNA or treatment with the PKA inhibitor H89 reduced the inhibitory effects of AHC on glioma cell invasion and migration. In vivo experiments also showed that AHC inhibited tumor growth in a xenograft mouse tumor model. Together, these data suggest that the synthetic chalcone derivative AHC has potent anti-cancer activity through inhibition of glioma proliferation, invasion, and angiogenesis and is therefore a potential chemotherapeutic candidate for the treatment of glioma.

  16. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    OpenAIRE

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide a...

  17. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  18. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  19. Gene silencing and homology-dependent gene silencing in Arabidopsis: genetic modifiers and DNA methylation.

    OpenAIRE

    Furner, I J; Sheikh, M. A.; Collett, C E

    1998-01-01

    Transgenes inserted into the plant genome can become inactive (gene silencing) or result in silencing of homologous cellular genes [homology-dependent gene silencing (HDG silencing)]. In an earlier study we reported HDG silencing of chalcone synthase (CHS) in Arabidopsis. This study concerns genetic revertants of one of the CHS HDG-silencing transgenic homozygotes. Two monogenic recessive trans-acting mutations (hog1 and ddm1) that impair gene silencing and HDG silencing were identified. Thes...

  20. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg;

    predicted to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis...

  1. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca...

  2. Dihydropteroate Synthase and Novel Dihydrofolate Reductase Gene Mutations in Strains of Pneumocystis jirovecii from South Africa

    OpenAIRE

    Robberts, F. J. L.; Chalkley, L J; Weyer, K.; Goussard, P.; Liebowitz, L. D.

    2005-01-01

    Dihydropteroate synthase (DHPS) gene mutations have raised concerns about emerging sulfonamide resistance in Pneumocystis jirovecii. DHPS and dihydrofolate reductase (DHFR) gene products were amplified in clinical specimens from South African patients. One of 53 DHPS genes sequenced contained the double mutation Thr55Ala Pro57Ser. DHFR gene mutations detected were Ala67Val and the new mutations Arg59Gly and C278T.

  3. Isolation and partial characterization of the gene for goose fatty acid synthase.

    Science.gov (United States)

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  4. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    Science.gov (United States)

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  5. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  6. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene

    OpenAIRE

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_0003...

  7. Nucleotide sequence of a soybean chalcone synthase gene with a possible role in ultraviolet-B sensitivity, Gmchs6

    International Nuclear Information System (INIS)

    Recent trends in stratospheric ozone depletion and projected increases in solar UV-B radiation (280-320 nm) have intensified studies of the ecological and physiological effects of increased levels of UV-B on higher plants (Caldwell, 1981; Worrest and Caldwell, 1986). Soybean (Glycine max L. Merr) is among the most extensively studied plants because it is a key crop of worldwide importance and because its potential susceptibility to increased levels of solar UV-B has been amply documented (Teramura et al., 1990, and refs. therein). From such studies, a pair of cultivars of contrasting sensitivity to UV-B has been identified. Williams is tolerant to supplemental UV-B fluences simulating a 25% ozone depletion, whereas Essex is sensitive to the same fluences, resulting in reduction of seed yield by 20 to 25%. The possibility that this may be due to differences in UV-B-absorbing compounds has also been noted

  8. A cryptic type I polyketide synthase (cpk) gene cluster in Streptomyces coelicolor A3(2)

    OpenAIRE

    Pawlik, Krzysztof; Kotowska, Magdalena; Chater, Keith F.; Kuczek, Katarzyna; Takano, Eriko

    2007-01-01

    The chromosome of Streptomyces coelicolor A3(2), a model organism for the genus Streptomyces, contains a cryptic type I polyketide synthase (PKS) gene cluster which was revealed when the genome was sequenced. The ca. 54-kb cluster contains three large genes, cpkA, cpkB and cpkC, encoding the PKS subunits. In silico analysis showed that the synthase consists of a loading module, five extension modules and a unique reductase as a terminal domain instead of a typical thioesterase. All acyltransf...

  9. Post-Transcriptional Silencing of Flavonol Synthase mRNA in Tobacco Leads to Fruits with Arrested Seed Set

    OpenAIRE

    Monika Mahajan; Paramvir Singh Ahuja; Sudesh Kumar Yadav

    2011-01-01

    Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS) encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols...

  10. Isoflavone synthase genes in legumes and non-leguminous plants

    Czech Academy of Sciences Publication Activity Database

    Pičmanová, Martina; Koblovská, R.; Lapčík, O.; Honys, David

    Washington, D.C: IEEE Computer Society, 2012 - (Sloan, K.), s. 344-347 ISBN 978-0-7695-4706-0. [International Conference on Biomedical Engineering and Biotechnology /2012/. Macau (CN), 28.05.2012-30.05.2012] R&D Projects: GA ČR GA525/09/0994; GA ČR(CZ) GAP501/11/1462; GA MŠk(CZ) OC10054 Institutional support: RVO:61389030 Keywords : legumes * non-leguminous plants * isoflavone synthase Subject RIV: EF - Botanics

  11. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  12. Allotopic Expression of a Gene Encoding FLAG Tagged-subunit 8 of Yeast Mitochondrial ATP Synthase

    Directory of Open Access Journals (Sweden)

    I MADE ARTIKA

    2006-03-01

    Full Text Available Subunit 8 of yeast mitochondrial ATP synthase is a polypeptide of 48 amino acids encoded by the mitochondrial ATP8 gene. A nuclear version of subunit 8 gene has been designed to encode FLAG tagged-subunit 8 fused with a mitochondrial signal peptide. The gene has been cloned into a yeast expression vector and then expressed in a yeast strain lacking endogenous subunit 8. Results showed that the gene was successfully expressed and the synthesized FLAG tagged-subunit 8 protein was imported into mitochondria. Following import, the FLAG tagged-subunit 8 protein assembled into functional mitochondrial ATP synthase complex. Furthermore, the subunit 8 protein could be detected using anti-FLAG tag monoclonal antibody.

  13. Chromosome mapping of the GD3 synthase gene (SIAT8) in human and mouse

    Energy Technology Data Exchange (ETDEWEB)

    Matsuda, Yoichi; Saito, Toshiyuki [National Inst. of Radiological Sciences, Chiba (Japan); Nara, Kiyomitsu [Tokyo Metropolitan Inst. of Medical Science (Japan)] [and others

    1996-02-15

    This article reports on the genetic mapping of the human and mouse GD3 synthase gene (SIAT8) using fluorescence in situ hybridization and interspecific backcross analysis. The human gene was localized to human chromosome 12p12.1-p11.2; the mouse homologue was localized to mouse chromosome 6, which has been shown to be syntenic with the short arm of human chromosome 12, suggesting a common evolution. 16 refs., 1 fig.

  14. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  15. Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

    OpenAIRE

    Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A; Lamb, Christopher J.

    1988-01-01

    To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled...

  16. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  17. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  18. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Jia-Hong Zhu

    2015-02-01

    Full Text Available Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7 of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production.

  19. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  20. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  1. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  2. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea

    OpenAIRE

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A.; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-01-01

    Background Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. Methods A pediatric ...

  3. Coexpression of glutamine synthetase and carbamoylphosphate synthase I genes in pancreatic hepatocytes of rat.

    OpenAIRE

    Yeldandi, A. V.; X. D. Tan; Dwivedi, R S; Subbarao, V; Smith, D. D.; Scarpelli, D. G.; Rao, M S; Reddy, J K

    1990-01-01

    In the mammalian liver the distribution of ammonia-detoxifying enzymes, glutamine synthetase (GS) and carbamoylphosphate synthase I (ammonia) (CPS-I), is mutually exclusive in that these enzymes are expressed in two distinct populations of hepatocytes that are zonally demarcated in the liver acinus. In the present study we examined the distribution of GS and CPS-I in pancreatic hepatocytes to ascertain if the expression of these two genes in these hepatocytes is also mutually exclusive. Multi...

  4. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    OpenAIRE

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Druzhinina, Irina S.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion...

  5. Diversifying Selection on Flavanone 3-Hydroxylase and Isoflavone Synthase Genes in Cultivated Soybean and Its Wild Progenitors

    OpenAIRE

    Hao Cheng; Jiao Wang; Shanshan Chu; Hong-Lang Yan; Deyue Yu

    2013-01-01

    Soybean isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2) and Flavanone 3-hydroxylase (F3H2) genes from 33 soybean accessions, including 17 cult...

  6. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. (Mount Sinai School of Medicine, New York, NY (United States))

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  7. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    Science.gov (United States)

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  8. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    Directory of Open Access Journals (Sweden)

    Liu Ping-Li

    2012-11-01

    Full Text Available Abstract Background Chrysanthemyl diphosphate synthase (CDS is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS.

  9. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    Science.gov (United States)

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  10. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  11. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    Science.gov (United States)

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  12. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Indian Academy of Sciences (India)

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  13. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    Science.gov (United States)

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  14. ATP synthase of yeast mitochondria. Isolation of subunit j and disruption of the ATP18 gene.

    Science.gov (United States)

    Arnold, I; Pfeiffer, K; Neupert, W; Stuart, R A; Schägger, H

    1999-01-01

    The subunit composition of the mitochondrial ATP synthase from Saccharomyces cerevisiae was analyzed using blue native gel electrophoresis and high resolution SDS-polyacrylamide gel electrophoresis. We report here the identification of a novel subunit of molecular mass of 6,687 Da, termed subunit j (Su j). An open reading frame of 127 base pairs (ATP18), which encodes for Su j, was identified on chromosome XIII. Su j does not display sequence similarity to ATP synthase subunits from other organisms. Data base searches, however, identified a potential homolog from Schizosaccharomyces pombe with 51% identity to Su j of S. cerevisiae. Su j, a small protein of 59 amino acid residues, has the characteristics of an integral inner membrane protein with a single transmembrane segment. Deletion of the ATP18 gene encoding Su j led to a strain (Deltasu j) completely deficient in oligomycin-sensitive ATPase activity and unable to grow on nonfermentable carbon sources. The presence of Su j is required for the stable expression of subunits 6 and f of the F0 membrane sector. In the absence of Su j, spontaneously arising rho- cells were observed that lacked also ubiquinol-cytochrome c reductase and cytochrome c oxidase activities. We conclude that Su j is a novel and essential subunit of yeast ATP synthase. PMID:9867807

  15. A transgenic wheat with a stilbene synthase gene resistant to powdery mildew obtained by biolistic method

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Stilbene, a kind of phytoalexin, plays an important role in resistance to fungal and bacterial infection in plants. It strongly inhibits the growth of fungi and sprout of spore. Stilbene synthase gene (Vst1) obtained from grapevine has been transferred into common spring wheat Jinghong 5 by using the biolistic transformation method. Five transgenic plants (T0) were obtained from the bombarded 2014 immature embryos. One immune plantlet and 3 plantlets with mid-resistance to powdery mildew were identified from the transgenic plants of T3 generation which came from 2 T0 transgenic plants.

  16. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    OpenAIRE

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 ...

  17. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  18. Molecular cloning and seasonal expression of oyster glycogen phosphorylase and glycogen synthase genes

    OpenAIRE

    Bacca, Helene; Huvet, Arnaud; Fabioux, Caroline; Daniel, Jean-yves; Delaporte, Maryse; Pouvreau, Stephane; van Wormhoudt, A.; Moal, Jeanne

    2005-01-01

    To investigate the control at the mRNA level of glycogen metabolism in the cupped oyster Crassostrea gigas, we report in the present paper the cloning and characterization of glycogen phosphorylase and synthase cDNAs (Cg-GPH and Cg-GYS, respectively, transcripts of main enzymes for glycogen use and storage), and their first expression profiles depending on oyster tissues and seasons. A strong expression of both genes was observed in the labial palps and the gonad in accordance with specific c...

  19. Cloning,Characterization,and Gene Annotation of Cellulose Synthase Genes from Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    BALASUBRAMANI G; AMUDHA J; KATEGERI I S; KHADI B M

    2008-01-01

    @@ The mechanistic basis of cellulose biosynthesis in plants has gained ground during last decade or so.The isolation of plant eDNA clones encoding cotton homologs of the bacterial cellulose synthase catalytic subunit was a significant achievement,which promises the elucidation of cellulose biosynthesis.

  20. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  1. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.)

    Indian Academy of Sciences (India)

    Fupeng Li; Chaoyun Hao; Lin Yan; Baoduo Wu; Xiaowei Qin; Jianxiong Lai; Yinghui Song

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  2. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    Science.gov (United States)

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  3. Endothelial nitric oxide synthase gene polymorphisms (G894T in diabetes mellitus in Egypt

    Directory of Open Access Journals (Sweden)

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-06-01

    Full Text Available Objective: Diabetic nephropathy (DN is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS gene with the development of diabetic nephropathy (DN among Egyptian patients with type 1,2 diabetes mellitus in Egypt. Methods: Study subjects comprised 86 patients of type 2 diabetes with nephropathy,23 patients of type 1 diabetes with nephropathy and 46 patients of type 2 diabetes without nephropathy. G894T genotypes was determined by SSP- PCR analysis. Results: Mutant T allele, GT and TT genotypes of G894TSNP had no significant frequencies in type 1,2 diabetic patients with nephropathy compared to those without nephropathy.. Conclusion: These findings indicate that G894T polymorphism of eNOS gene may be not considered as genetic risk factors for DN among Egyptian type1, 2 diabetic patients. Abbreviations: T2DM: type 2 diabetes mellitus ­ DN: diabetic nephropathy eNOS : Endothelial nitric oxide synthase:­ SNP: single nucleotide polymorphism- SSP-PCR: sequence specific primer- polymerase chain reaction

  4. A New Farnesyl Diphosphate Synthase Gene from Taxus media Rehder: Cloning, Characterization and Functional Complementation

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hua Liao; Min Chen; Yi-Fu Gong; Zhu-Gang Li; Kai-Jing Zuo; Peng Wang; Feng Tan; Xiao-Fen Sun; Ke-Xuan Tang

    2006-01-01

    Farnesyl diphosphate synthase (FPS; EC 2.5.1.10) catalyzes the production of 15-carbon farnesyl diphosphate which is a branch-point intermediate for many terpenoids. This reaction is considered to be a ratelimiting step in terpenoid biosynthesis. Here we report for the first time the cloning of a new full-length cDNA encoding farnesyl diphosphate synthase from a gymnosperm plant species, Taxus media Rehder,designated as TmFPS1. The full-length cDNA of TmFPS1 (GenBank accession number: AY461811) was 1 464bp with a 1 056-bp open reading frame encoding a 351-amino acid polypeptide with a calculated molecular weight of 40.3 kDa and a theoretical pl of 5.07. Bioinformatic analysis revealed that TmFPS1 contained all five conserved domains of prenyltransferases, and showed homology to other FPSs of plant origin. Phylogenetic analysis showed that farnesyl diphosphate synthases can be divided into two groups: one of prokaryotic origin and the other of eukaryotic origin. TmFPS1 was grouped with FPSs of plant origin. Homologybased structural modeling showed that TmFPS1 had the typical spatial structure of FPS, whose most prominent structural feature is the arrangement of 13 core helices around a large central cavity in which the catalytic reaction takes place. Our bioinformatic analysis strongly suggests that TmFPS1 is a functional gene. Southern blot analysis revealed that TmFPS1 belongs to a small FPS gene family in T. media. Northern blot analysis indicated that TmFPS1 is expressed in all tested tissues, including the needles, stems and roots of T. media. Subsequently, functional complementation with TmFPS1 in a FPS-deficient mutant yeast demonstrated that TmFPS1 did encode farnesyl diphosphate synthase, which rescued the yeast mutant.This study will be helpful in future investigations aiming at understanding the detailed role of FPS in terpenoid biosynthesis flux control at the molecular genetic level.

  5. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    Science.gov (United States)

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; PmEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  6. Associations between nitric oxide synthase genes and exhaled NO-related phenotypes according to asthma status.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Bouzigon

    Full Text Available BACKGROUND: The nitric oxide (NO pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs of NO synthase genes (NOS and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma and blood eosinophil counts. METHODOLOGY: SNPs (N = 121 belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA. Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (Fe(NO, plasma and exhaled breath condensate (EBC nitrite-nitrate levels (NO2-NO3 and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. PRINCIPAL FINDINGS: In non-asthmatics, after correction for multiple comparisons, we found significant associations of Fe(NO levels with three SNPs in NOS3 and NOS2 (P ≤ 0.002, and of EBC NO2-NO3 level with NOS2 (P = 0.002. In asthmatics, a single significant association was detected between Fe(NO levels and one SNP in NOS3 (P = 0.004. Moreover, there was significant heterogeneity of NOS3 SNP effect on Fe(NO between asthmatics and non-asthmatics (P = 0.0002 to 0.005. No significant association was found between any SNP and NO2-NO3 plasma levels or blood eosinophil counts. CONCLUSIONS: Variants in NO synthase genes influence Fe(NO and EBC NO2-NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid.

  7. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    Science.gov (United States)

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  8. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    Directory of Open Access Journals (Sweden)

    Shigang Zheng

    Full Text Available Resveratrol (Res is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS, existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering.

  9. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  10. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  11. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  12. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  13. Molecular Cloning and Characterization of Citrate Synthase Gene in Rice( Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shan-shan; MING Feng; LU Qun; GUO Bin; SHEN Da-leng

    2005-01-01

    The full-length OsCS encoding citrate synthase was isolated from rice (Oryza sativa L. subsp. japonica). OsCS is 1477-bp long and encodes a 474 amino acid polypeptide. Its putative protein sequence is highly identical to Daucus carota, Nicotiana tabacum,Beta vulgaris subsp., Arabidopsis thaliana, and Citrus junos (>70%). The deduced amino-terminal sequence of OsCS showes characteristics of mitochondrial targeting signal. Southern blot analysis using ORF of the OsCS as the probe indicated that this gene exists in multiple copies in rice genome. The band with predicated size of 82 kD was detected by Western blot after being induced by 0.4 mmol/L IPTG.

  14. Mutational Analysis of Pneumocystis jirovecii Dihydropteroate Synthase and Dihydrofolate Reductase Genes in HIV-Infected Patients in China

    OpenAIRE

    Deng, Xilong; Zhuo, Li; Lan, Yun; Dai, Zhaoxia; Chen, Wan-shan; Cai, Weiping; Kovacs, Joseph A.; Ma, Liang; Tang, Xiaoping

    2014-01-01

    We investigated Pneumocystis jirovecii dihydropteroate synthase (DHPS) and dihydrofolate reductase (DHFR) genes for mutations in 25 Chinese HIV-infected patients with P. jirovecii pneumonia. We identified DHPS mutations in 3 (12%) patients and DHFR mutations in 1 (4%) patient. The prevalence of DHPS and DHFR mutations in China remains low, as it does in other developing countries.

  15. Synthetic Chalcones with Potent Antioxidant Ability on H2O2-Induced Apoptosis in PC12 Cells

    Directory of Open Access Journals (Sweden)

    Jian-Zhang Wu

    2014-10-01

    Full Text Available Chalcone derivatives (E-3-(4-hydroxy-3-methoxyphenyl-1-(4-methoxyphenyl prop-2-en-1-one and (E-3-(4-hydroxyphenyl-1-(4-methoxyphenyl prop-2-en-1-one (Compounds 1 and 2 have been demonstrated to be potent anti-inflammatory agents in our previous study. In light of the relationship of intracellular mechanisms between anti-inflammatories and antioxidants, we further designed and synthesized a series of chalcone derivatives based on 1 and 2, to explore their antioxidant efficacy. The majority of the derivatives exhibited strong protective effects on PC12 (PC12 rat pheochromocytoma cells exposed to H2O2, and all compounds were nontoxic. A preliminary structure-activity relationship was proposed. Compounds 1 and 1d ((E-2-methoxy-4-(3-(4-methoxyphenyl-3-oxoprop-1-en-1-yl phenyl acrylate exerted the action in a good dose-dependent manner. Quantitative RT-PCR (qRT-PCR and western blot analysis showed that 1 and 1d significantly improve the expression of nuclear factor erythroid 2 p45-related factor 2 (Nrf2-dependent antioxidant genes g-Glutamylcysteine Ligase Catalytic Subunit (GCLC and heme oxygenase-1 (HO-1 and their corresponding proteins (γ-glutamyl cysteine synthase (γ-GCS and HO-1 in PC12 cells. Inhibition of GCLC and HO-1 by specific inhibitors, l-buthionine-S-sulfoximine (BSO and zinc protoporphyrin (ZnPP, respectively, partially reduce the protective effect of 1 and 1d. These data present a series of novel chalcone analogs, especially compounds 1 and 1d, as candidates for treating oxidative stress-related disease by activating the Nrf2-antioxidant responsive element (ARE pathway.

  16. Synthetic Chalcones with Potent Antioxidant Ability on H2O2-Induced Apoptosis in PC12 Cells

    Science.gov (United States)

    Wu, Jian-Zhang; Cheng, Chan-Chan; Shen, Lai-Lai; Wang, Zhan-Kun; Wu, Shou-Biao; Li, Wu-Lan; Chen, Su-Hua; Zhou, Rong-Ping; Qiu, Pei-Hong

    2014-01-01

    Chalcone derivatives (E)-3-(4-hydroxy-3-methoxyphenyl)-1-(4-methoxyphenyl) prop-2-en-1-one and (E)-3-(4-hydroxyphenyl)-1-(4-methoxyphenyl) prop-2-en-1-one (Compounds 1 and 2) have been demonstrated to be potent anti-inflammatory agents in our previous study. In light of the relationship of intracellular mechanisms between anti-inflammatories and antioxidants, we further designed and synthesized a series of chalcone derivatives based on 1 and 2, to explore their antioxidant efficacy. The majority of the derivatives exhibited strong protective effects on PC12 (PC12 rat pheochromocytoma) cells exposed to H2O2, and all compounds were nontoxic. A preliminary structure-activity relationship was proposed. Compounds 1 and 1d ((E)-2-methoxy-4-(3-(4-methoxyphenyl)-3-oxoprop-1-en-1-yl) phenyl acrylate) exerted the action in a good dose-dependent manner. Quantitative RT-PCR (qRT-PCR) and western blot analysis showed that 1 and 1d significantly improve the expression of nuclear factor erythroid 2 p45-related factor 2 (Nrf2)-dependent antioxidant genes g-Glutamylcysteine Ligase Catalytic Subunit (GCLC) and heme oxygenase-1 (HO-1) and their corresponding proteins (γ-glutamyl cysteine synthase (γ-GCS) and HO-1) in PC12 cells. Inhibition of GCLC and HO-1 by specific inhibitors, l-buthionine-S-sulfoximine (BSO) and zinc protoporphyrin (ZnPP), respectively, partially reduce the protective effect of 1 and 1d. These data present a series of novel chalcone analogs, especially compounds 1 and 1d, as candidates for treating oxidative stress-related disease by activating the Nrf2-antioxidant responsive element (ARE) pathway. PMID:25318055

  17. Effect of estrogen on gene expression of fatty acid synthase in periosteum

    Institute of Scientific and Technical Information of China (English)

    ZHENG Rui-min; LIN Shou-qing; LIU Yong; HUANG Man-ting; GONG Wei-yan; WU Zhi-hong

    2009-01-01

    Background Estrogen deficiency contributes to postmenopausal osteoporosis.Periosteum might be a potential target of estrogen,but the underlying mechanism at gene level is far from being elucidated.The objective of this study was to investigate the correlation between estrogen and fatty acid synthase(FAS)expression in periosteum.Methods Human periosteum cells were cultured in vitro.Expressed genes in the substrated cDNA library were verified using semi-quantitative PCR and real-time PCR.The expression of FAS in periosteum of ovarectomized(OVX)SD rats was investigated.Results FAS gene was most significantly expressed in the subtracted cDNA library of periosteal cells screened by semi-quantitative PCR.Low FAS expression was verified by real-time PCR in the estrogen exposed human periosteum rather than in the control.The estradiol levels were(20.81±12.62)pg/ml,(19.64±4.35)pg/ml and(13.47+1.84)pg/ml in the sham group,the control,and the OVX group,respectively.The estradiol levels in the OVX group was significantly lower(P=0.0386).The FAS gene expression in periosteum in the OVX group,sham group,and control group was 3.09±1.97,1.33±0.47 and 1.51±1.32,respectively.The gene expression in the OVX group was significantly higher (P=0.0372).Conclusion Estrogen modulates FAS gene expression in in vitro human perisoteum as well as in in vivo rat periosteum.

  18. Expression of an (E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    OpenAIRE

    Xiudao Yu; Yongjun Zhang; Youzhi Ma; Zhaoshi Xu; Genping Wang; Lanqin Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E)-β-farnesene (EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piper...

  19. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  20. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  1. Relationship Between Polymorphism of Cystathionine beta Synthase Gene and Congenital Heart Disease in Chinese Nuclear Families

    Institute of Scientific and Technical Information of China (English)

    XIAO-MING SONG; XIAO-YING ZHENG; WEN-LI ZHU; LEI HUANG; YONG LI

    2006-01-01

    Objective To study the relationship between polymorphism of cystathionine beta synthase (CBS) gene and development of congenital heart disease (CHD). Methods One hundred and twenty-seven CHD case-parent triads were recruited from Liaoning Province as patient group, and 129 healthy subjects without family history of birth defect were simultaneously recruited as control group together with their biological parents. For all subjects the polymorphism of CBS gene G919A locus was examined by PCR-ARMS method. Results The frequencies of three genotypes (w/w, w/m, and m/m) in control group were 27.2%, 58.4%, and 14.4%, respectively, with no significant difference in gender. A significant difference in the allele frequency was found between CHD patients and controls, the wild allele frequency was 67.9% in patients and 55.7% in controls.CHD parents' genotype distribution was significantly different from that in controls. Further comparison of each type of CHD showed that genotype frequencies in several CHD subtypes were significantly different from those in their corresponding controls. The results of TDT analysis showed that no allele transmission disequilibrium existed in CHD nuclear families.Conclusions CBS gene G919A mutation is associated with the development of CHD, and the mutated allele may decrease the risk of CHD.

  2. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    International Nuclear Information System (INIS)

    11β-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11β-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression

  3. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    Science.gov (United States)

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  4. Genomic Distance between Thymidylate Synthase and Dihydrofolate Reductase Genes Does Not Correlate With Phylogenetic Evolution in Bacteria

    OpenAIRE

    Vitor Hugo Moreau

    2010-01-01

    Problem statement: Dihydrofolate Reductase (DHFR) and Thymidylate Synthase (TS) exist as bifunctional enzymes coded into unique polypeptide chain in protozoans. Bifunctional DHFR-TS is associated with an increase in the enzymatic activity by channeling the substrate between the active sites. In some bacteria, DHFR and TS genes are neighbors in the genome, whereas in others, they are located millions of base pairs apart. Gene neighboring gained importance in evolution because it was found to p...

  5. Acid sphingomyelinase gene knockout ameliorates hyperhomocysteinemic glomerular injury in mice lacking cystathionine-β-synthase.

    Directory of Open Access Journals (Sweden)

    Krishna M Boini

    Full Text Available Acid sphingomyelinase (ASM has been implicated in the development of hyperhomocysteinemia (hHcys-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs and Asm mouse gene by cross breeding Cbs(+/- and Asm(+/- mice. Given that the homozygotes of Cbs(-/-/Asm(-/- mice could not survive for 3 weeks. Cbs(+/-/Asm(+/+, Cbs(+/-/Asm(+/- and Cbs(+/-/Asm(-/- as well as their Cbs wild type littermates were used to study the role of Asm(-/- under a background of Cbs(+/- with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs(+/- mice with different copies of Asm gene compared to Cbs(+/+ mice with different Asm gene copies. Cbs(+/-/Asm(+/+ mice had significantly increased renal Asm activity, ceramide production and O(2.(- level compared to Cbs(+/+/Asm(+/+, while Cbs(+/-/Asm(-/- mice showed significantly reduced renal Asm activity, ceramide production and O(2.(- level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs(+/-/Asm(-/- mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs(+/-/Asm(-/- mice compared to Cbs(+/-/Asm(+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O(2.(- production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or corresponding enzyme

  6. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    Science.gov (United States)

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (Phaplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  7. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  9. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  10. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    Science.gov (United States)

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  11. Genes encoding the alpha, gamma, delta, and four F0 subunits of ATP synthase constitute an operon in the cyanobacterium Anabaena sp. strain PCC 7120.

    OpenAIRE

    McCarn, D F; R A Whitaker; Alam, J; Vrba, J M; Curtis, S E

    1988-01-01

    A cluster of genes encoding subunits of ATP synthase of Anabaena sp. strain PCC 7120 was cloned, and the nucleotide sequences of the genes were determined. This cluster, denoted atp1, consists of four F0 genes and three F1 genes encoding the subunits a (atpI), c (atpH), b' (atpG), b (atpF), delta (atpD), alpha (aptA), and gamma (atpC) in that order. Closely linked upstream of the ATP synthase subunit genes is an open reading frame denoted gene 1, which is equivalent to the uncI gene of Escher...

  12. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    Science.gov (United States)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P mercury exposure significantly enhanced the mRNA expression of SsPCS (P metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  13. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  14. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    Science.gov (United States)

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  15. Polymorphism of thymidylate synthase gene associated with its protein expression in human colon cancer

    Institute of Scientific and Technical Information of China (English)

    Kai-Huan Yu; Wei-Xing Wang; You-Ming Ding; Hui Li; Ze-Sheng Wang

    2008-01-01

    AIM: To correlate the polymorphisms in the 5'-untranslated region with thymidylate synthase (TS) protein expression in Han Chinese colonic neoplasms.METHODS: Adenocarcinoma samples were from 68 patients who received no treatment before surgery. Tandem repeat length of TS gene was determined by PCR amplification of genomic DNA. Intratumoral TS protein expression was studied immunohistochemically in corresponding sections from paraffin-embedded primary foci. Immunoreactivity was semiquantitatively evaluated by immunoreactivity score (IRS).RESULTS: Double-(2R) and triple-repeated (3R) sequences of the TS gene were found in the cancer tissues. Three genotypes of TS were found: 2R/2R (n = 6), 2R/3R (n = 22) and 3R/3R (n = 40). Patients who were homozygous for triple-repeated (3R/3R) sequences showed significantly higher IRS of TS than patients who were homozygous for double-repeated (2R/2R) sequences or heterozygous patients (2R/3R): 5.73 ± 3.25 vs 2.17 ± 1.47 or 3.77 ± 2.64, P = 0.008 or P = 0.015. But no statistical significance of IRS in cancer tissues was observed between 2R/3R genotype and 2R/2R genotype.CONCLUSION: There is a relationship between TS genotype and TS protein expression in clinical specimens. The data might offer an advantage for selection of Chinese cancer patients to receive fluoropyrimidines treatment.

  16. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    Science.gov (United States)

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  17. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  18. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    Science.gov (United States)

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  19. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    Science.gov (United States)

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  20. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  1. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1(G) while these sequence features did not exist in front of trpE 2. The β-galactosidase activity of an A. brasilense strain carrying a trpE 2-lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1(G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1(G)- and trpE 2- mutants demonstrated that TrpE1(G) fusion protein is feedback inhibited by tryptophan while TrpE2 protein is not. We also found that both trpE 1(G) and trpE 2 gene products were involved in IAA synthesis

  2. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available BACKGROUND: RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail. METHODOLOGY/PRINCIPAL FINDINGS: In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought. CONCLUSIONS/SIGNIFICANCE: RDR1 is regulated by a much broader range of phytohormones than previously thought

  3. Heterocyclic chalcone analogues as potential anticancer agents.

    Science.gov (United States)

    Sharma, Vikas; Kumar, Vipin; Kumar, Pradeep

    2013-03-01

    Chalcones, aromatic ketones and enones acting as the precursor for flavonoids such as Quercetin, are known for their anticancer effects. Although, parent chalcones consist of two aromatic rings joined by a three-carbon α,β-unsaturated carbonyl system, various synthetic compounds possessing heterocyclic rings like pyrazole, indole etc. are well known and proved to be effective anticancer agents. In addition to their use as anticancer agents in cancer cell lines, heterocyclic analogues are reported to be effective even against resistant cell lines. In this connection, we hereby highlight the potential of various heterocyclic chalcone analogues as anticancer agents with a brief summary about therapeutic potential of chalcones, mechanism of anticancer action of various chalcone analogues, and current and future prospects related to the chalcones-derived anticancer research. Furthermore, some key points regarding chalcone analogues have been reviewed by analyzing their medicinal properties. PMID:22721390

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. Polymorphism of Methionine Synthase Gene in Nuclear Families of Congenital Heart Disease

    Institute of Scientific and Technical Information of China (English)

    WEN-LI ZHU; JUN CHENG; JING-JING DAO; RU-BING ZHAO; LI-YING YAN; SHU-QING LI; AND YONG LI

    2004-01-01

    Objective To investgate the relation of methionine synthase (MS) gene variation with congenital heart disease (CHD) phenotype. Methods One hundred and ninety three CHD patients (94 males and 99 females) and their biological parents (nuclear families) in Liaoning Province were selected as the case group, and another 104 normal persons (60 males and 44 females) and their parents without family history of birth defects as the control group. For all subjects the polymorphism of MS gene A2756G locus was examined by PCR-RFLP method. Results In offspring of the control group the frequencies of MS genotype (+/-) and allele (+) were 10.7% and 5.3%, without existence of homozygote. The MS genotype distribution and allele frequencies of CHD patients and their mothers were not significantly different from the control (P > 0.05). The frequency of allele (+)in case fathers (5.0 %) was apparently lower than that in the control (9.1%, P=0.060), and the odds ratio (OR) was 0.53 (95% CI: 0.25-1.09). There was no difference in parents' genotype combination between the two groups, and in genotype distribution among different types of CHD. Analysis of genetic transmission indicated that mutation allele (+) existed transmission disequilibrium in CHD nuclear families. The percentage of allele (+) transmitted from parents was lower than that allele (-)with OR 0.26 (95% CI: 0.11-0.60). Conclusion MS gene variation in parents is associated with occurrence of CHD in offspring, and mutation allele (+) in parents may be related with the decrease of CHD risk in offspring.

  6. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    Science.gov (United States)

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  7. Epidemiology and clinical relevanceof Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations*

    Directory of Open Access Journals (Sweden)

    Matos O.

    2010-09-01

    Full Text Available A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS mutations in patients with P. jirovecii pneumonia (PcP, in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  8. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    Science.gov (United States)

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  9. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manflensis

    Institute of Scientific and Technical Information of China (English)

    Shu-Yan Cui; Yu-Xian Xia

    2009-01-01

    Trehalose plays an important role in protecting organisms from various stresses.Trehalose-6-phosphate synthase (TPS) is the key enzyme in trehalose synthesis, but in in-sects only a few TPS genes have been identified and their function has not been well characterized. To better understand the function of TPS in insects, a complete TPS com-plementary DNA (eDNA) clone was obtained from the fat body of the locust Locusta migratoria manilensis (GenBank accession number: EU 131894). The full-length cDNA is 2 806 bp, including an open reading frame of 2 442 bp, which encodes an 813 amino acids protein with a calculated molecular weight of 91 976 Daltons and an isoelectric point of 6.14. The deduced amino acid sequence is highly similar to other published insect TPS and its C-terminal also has a region homologous to trehalose phosphate phsophatase (TPP).Semi-quantitative analysis indicated that the TPS transcript was expressed not only in fat body, but also in gut, hemolymph and leg muscle. These data may facilitate studies of TPS function in insects and improve our understanding of trehalose metabolism.

  10. RNA Interference-mediated Silencing of Phytochelatin Synthase Gene Reduce Cadmium Accumulation in Rice Seeds

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Phytochelatins (PCs) play an important role in heavy metal resistance and accumulation. To reduce the accumulation of cadmium (Cd) in rice seeds, the expression of phytochelatin synthase (PCS) gene OsPCS1 was suppressed by RNA interference (RNAi). A hairpin construct of a PCS fragment was designed in the pRNAi-OsPCS1 under the control of ZMM1, a seed-specific promoter from maize. The construct was introduced into rice (japonica) through Agrobacterium tumefaciens. The RNAi rice plantlets were selected and cultivated in pots exposured to 10 mg/kg Cd. The transcriptional level of OsPCS1 declined in seeds of some RNAi rice compared to the wild type. As a result Cd accumulation was reduced by about half in the seeds of RNAi rice. As expected, no apparent difference of growth appeared between RNAi and wild-type plants. The results suggest that this new approach can be used to control heavy metal accumulation in crops.

  11. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    International Nuclear Information System (INIS)

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-κB) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes

  12. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content

    OpenAIRE

    Ampomah-Dwamena, C.; Driedonks, N.J.W.; Lewis, D; Shumskaya, M.; Chen, X Y; Wurtzel, E.T.; Espley, R.V.; Allan, A.C.

    2015-01-01

    Background Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genom...

  13. Nucleotide Variability in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene from Eleusine indica (L.) Gaertn

    OpenAIRE

    J.L. Chong; R. Wickneswari; Ismail, B. S.; S. Salmijah

    2008-01-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to pr...

  14. Molecular Cloning, Expression, and Characterization of the Genes Encoding the Two Essential Protein Components of Micrococcus luteus B-P 26 Hexaprenyl Diphosphate Synthase

    OpenAIRE

    Shimizu, Naoto; Koyama, Tanetoshi; Ogura, Kyozo

    1998-01-01

    The structural genes encoding the two essential components A and B of hexaprenyl diphosphate synthase, which produce the precursor of the prenyl side chain of menaquinone-6, were cloned from Micrococcus luteus B-P 26.

  15. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  16. Expression of an(E)-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Institute of Scientific and Technical Information of China (English)

    Xiudao; Yu; Yongjun; Zhang; Youzhi; Ma; Zhaoshi; Xu; Genping; Wang; Lanqin; Xia

    2013-01-01

    Aphids are major agricultural pests that cause significant yield losses in crop plants each year.(E)-β-farnesene(EβF) is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint(Mentha × piperita), two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint(Mentha asiatica). Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d-1g-1of fresh tissue. Tritrophic interactions involving peach aphids(Myzus persicae), and predatory lacewing(Chrysopa septempunctata) larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  17. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  18. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    Science.gov (United States)

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  19. Elevated Gene Expression in Chalcone Synthase Enzyme Suggests an Increased Production of Flavonoids in Skin and Synchronized Red Cell Cultures of North American Native Grape Berries

    OpenAIRE

    Davis, Gina; Ananga, Anthony; Krastanova, Stoyanka; Sutton, Safira; Ochieng, Joel W.; Leong, Stephen; Tsolova, Violetka

    2012-01-01

    Anthocyanins are antioxidants and are among the natural products synthesized via the flavonoid biosynthesis pathway. Anthocyanins have been recommended for dietary intake in the prevention of cardiovascular diseases, cancer, and age-related conditions such as Alzheimer's disease or dementia. With an increasingly aging population in many parts of the world, strategies for the commercial production of in vitro synchronized red cell cultures as natural antioxidants will be a significant contribu...

  20. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  1. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    Science.gov (United States)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  2. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    Science.gov (United States)

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  3. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    Science.gov (United States)

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  4. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis

    Indian Academy of Sciences (India)

    Balachandran Karpaga Raja Sundari; Modhumita Ghosh Dasgupta

    2014-08-01

    Cellulose synthases (CesA) represent a group of -1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  5. Polymorphisms in the endothelial nitric oxide synthase gene in thalidomide embryopathy.

    Science.gov (United States)

    Vianna, Fernanda Sales Luiz; Fraga, Lucas Rosa; Tovo-Rodrigues, Luciana; Tagliani-Ribeiro, Alice; Biondi, Flavia; Maximino, Claudia Marques; Sanseverino, Maria Teresa Vieira; Hutz, Mara Helena; Schuler-Faccini, Lavínia

    2013-11-30

    Thalidomide is one of the most potent teratogens known to humans. It is currently used for many clinical situations such as treatment of leprosy reactions and multiple myeloma. However, the teratogenic mechanisms by which it produces morphological defects still remain unclear. One of the hypotheses is the blockage of angiogenesis by reduction of nitric oxide (NO). In this study, we evaluated two functional polymorphisms of the endothelial nitric oxide synthase (eNOS) gene which is a constitutively expressed enzyme responsible for production of NO. The promoter -786T>C exon 7 (896G>T) polymorphisms were genotyped using real-time PCR for 28 individuals with thalidomide embryopathy (TE), 27 first-degree relatives of these individuals, and 68 individuals from the general population. Their allele, genotypic, and haplotypic frequencies were compared. A significant difference was observed in the -786T>C polymorphism genotypes (p=0.03) between the groups affected by TE and those unaffected (non-relatives). The TT genotype of the 896G>T polymorphism was observed in 10.7% of those affected and 2.9% of those unaffected, but the difference was not statistically significant (p=0.09). The haplotypic analysis indicated that the wild haplotype -786T/896G was distributed differently in the affected and unaffected groups (p=0.004). These results indicate that the individuals with TE have a higher frequency of alleles associated with lower expression of eNOS, indicating that this may be a genotype susceptible to TE. PMID:24055736

  6. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    Science.gov (United States)

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  7. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    International Nuclear Information System (INIS)

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases

  8. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  9. Accumulation of the chalcone isosalipurposide in primary leaves of barley flavonoid mutants indicates a defective chalcone isomerase

    International Nuclear Information System (INIS)

    Mutants defective in flavonoid biosynthesis have become increasingly useful in elucidating the potential functions of these compounds in plants. To define the role of flavonoids as UV-B protectants in barley, we have screened part of the collection of proanthocyanidin-free barley mutants at the Carlsberg Research Laboratory, Copenhagen, Denmark. The four mutants ant 30–245, ant 30–272, ant 30–287 and ant 30–310 showed drastically reduced flavonoid levels in the primary leaf as compared to their corresponding parent varieties, and in addition accumulated a new mutant-specific phenolic compound which was identified as the chalcone glucoside isosalipurposide. Results from diallelic crosses indicate that all four mutants belong to the same new complementation group, which is designated as the Ant 30 locus. This gene has not earlier been described in barley. The data presented suggest a defective chalcone isomerase gene for the observed flavonoid pattern in leaves of ant 30 mutants. (author)

  10. Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis.

    Science.gov (United States)

    Fujii, I; Mori, Y; Watanabe, A; Kubo, Y; Tsuji, G; Ebizuka, Y

    1999-08-01

    The Colletotrichum lagenarium PKS1 gene was expressed in the heterologous fungal host, Aspergillus oryzae, under the starch-inducible alpha-amylase promoter to identify the direct product of polyketide synthase (PKS) encoded by the PKS1 gene. The main compound produced by an A. oryzae transformant was isolated and characterized to be 1,3,6,8-tetrahydroxynaphthalene (T4HN) as its tetraacetate. Since the PKS1 gene was cloned from C. lagenarium to complement the nonmelanizing albino mutant, T4HN was assumed to be an initial biosynthetic intermediate, and thus the product of the PKS reaction, but had not been isolated from the fungus. The production of T4HN by the PKS1 transformant unambiguously identified the gene to encode a PKS of pentaketide T4HN. In addition, tetraketide orsellinic acid and pentaketide isocoumarin were isolated, the latter being derived from a pentaketide monocyclic carboxylic acid, as by-products of the PKS1 PKS reaction. Production of the pentaketide carboxylic acid provided insights into the mechanism for the PKS1 polyketide synthase reaction to form T4HN. PMID:10501004

  11. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    Science.gov (United States)

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  12. Polyketide synthases from poison hemlock (Conium maculatum L.).

    Science.gov (United States)

    Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

    2015-11-01

    Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. PMID:26260860

  13. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress

    Indian Academy of Sciences (India)

    D. W. Xie; X. N. Wang; L. S. Fu; J. Sun; W. Zheng; Z. F. Li

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat–rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae.

  14. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    OpenAIRE

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two differ...

  15. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Institute of Scientific and Technical Information of China (English)

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  16. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    Science.gov (United States)

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  17. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  18. Relationships between endothelial nitric oxide synthase gene polymorphisms and osteoporosis in postmenopausal women

    Institute of Scientific and Technical Information of China (English)

    Shun-zhi LIU; Hong YAN; Wei-kun HOU; Peng XU; Juan TUN; Li-fang TIAN; Bo-feng ZHU; Jie MA; She-min LU

    2009-01-01

    Objective: To investigate the relationships between endothelial nitric oxide synthases (eNOS) G894T and 27 bp-variable number tandem repeat (VNTR) gene polymorphisms and osteoporosis in the postmenopausal women of Chinese Han nationality. Methods: In the present study, 281 postmenopausal women from Xi'an urban area in West China were recruited, and divided into osteoporosis, osteopenia, and normal groups according to the diagnostic criteria of osteoporosis proposed by World Health Organization (WHO). The bone mineral density (BMD) values of lumbar vertebrae and left hips were determined by QDR-2000 dual energy X-ray absorptiometry. Blood samples were tested for plasma biochemical indicators including testosterone, estradiol, calcitonin, osteocalcin, and procollagen type I amino-terminal propeptide by enzyme-linked immunosorbent assay (ELISA), tartrate-resistant acid phosphatase by spectrophotometric method, and the content of nitric oxide by Griess method. Genome DNA was extracted from whole blood, and G894T polymorphism of eNOS gene was analyzed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and 27 bp-VNTR polymorphism of eNOS gene was genotyped by PCR method. Then the relationships between genotypes and biochemical indicators, genotypes and osteoporosis, and haplotypes and osteoporosis were analyzed. Results: The average BMD values of the femoral neck, ward's triangle and lumbar vertebrae 1~4 (L1~L4) in the subjects with T/T genotype in eNOS G894T locus were significantly higher than those in the subjects with G/T and G/G genotypes (P<0.05). The average BMD of the femoral neck in the subjects with a/a genotype of eNOS 27 bp-VNTR locus was evidently higher than that in the subjects with b/b genotype (P<0.05). The plasma testosterone and osteocalcin concentrations in the subjects of eNOS G894T G/T genotype were evidently higher than those in the subjects of other genotypes (P<0.05); the plasma estradiol

  19. Solvent-Free Synthesis of Chalcones

    Science.gov (United States)

    Palleros, Daniel R.

    2004-01-01

    The synthesis of twenty different chalcones in the absence of solvent is presented. The results indicated that out of the twenty different chalcones investigated seventeen can be obtained in a matter of minutes by mixing the corresponding benzaldehyde and acetophenone in the presence of solid NaOH in a mortar with pestle.

  20. Chalcones: compounds possessing a diversity in applications

    OpenAIRE

    Urmila Berar

    2012-01-01

    Chalcones are a class of α, β- unsaturated carbonyl compounds that form the central core for a variety of naturally occurring biologically active compounds. They exhibit tremendous potential to act as a pharmacological agent. Besides their various pharmacological activities, chalcones have been explored for different optical applications including second harmonic generation materials in non- linear optics, fluorescent probe for sensing different molecules.

  1. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    Science.gov (United States)

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  2. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Science.gov (United States)

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  3. COMPLEMENTATION OF THE AMYLOSE-FREE STARCH MUTANT OF POTATO (SOLANUM-TUBEROSUM) BY THE GENE ENCODING GRANULE-BOUND STARCH SYNTHASE

    NARCIS (Netherlands)

    VANDERLEIJ, FR; VISSER, RGF; OOSTERHAVEN, K; VANDERKOP, DAM; JACOBSEN, E; FEENSTRA, WJ

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  4. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Science.gov (United States)

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  5. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    Science.gov (United States)

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  6. SYNTHESIS AND CHARACTERIZATION OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    OpenAIRE

    Ramesh Dhani; P. Sudheer Kumar; C.A. Abhilash; CH. Jahnavi

    2012-01-01

    Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The name chalcones was given by Kostanecki and Tambor. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of novel heterocyclics with good pharmaceutical profile can be designed. Chalcones have been considered as a magic moiety possessing myriad spectrum of medicinal...

  7. Cloning and Characterization of a Salt Tolerance-Associated Gene Encoding Trehalose-6-Phosphate Synthase in Sweetpotato

    Institute of Scientific and Technical Information of China (English)

    JIANG Tao; ZHAI Hong; WANG Fei-bing; ZHOU Hua-nan; SI Zeng-zhi; HE Shao-zhen; LIU Qing-chang

    2014-01-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in a variety of organisms. In plants, its biosynthesis is catalyzed by two key enzymes:trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP). In the present study, a TPS gene, named IbTPS, was ifrst isolated from sweetpotato (Ipomoea batatas (L.) Lam.) cv. Lushu 3 by rapid ampliifcation of cDNA ends (RACE). The open reading frame (ORF) contained 2 580 nucleotides encoding 859 amino acids with a molecular weight of 97.433 kDa and an isoelectric point (pI) of 5.7. The deduced amino acid sequence showed high identities with TPS of other plants. Real-time quantitative PCR analysis revealed that the expression level of IbTPS gene was signiifcantly higher in stems of Lushu 3 than in its leaves and roots. Subcellular localization analysis in onion epidermal cells indicated that IbTPS gene was located in the nucleus. Transgenic tobacco (cv. Wisconsin 38) plants over-expressing IbTPS gene exhibited signiifcantly higher salt tolerance compared with the control plant. Trehalose and proline content was found to be signiifcantly more accumulated in transgenic tobacco plants than in the wild-type and several stress tolerance related genes were up-regulated. These results suggest that IbTPS gene may enhance salt tolerance of plants by increasing the amount of treahalose and proline and regulating the expression of stress tolerance related genes.

  8. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    Science.gov (United States)

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  9. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  10. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  11. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  12. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  13. Expression in Arabidopsis of a Strawberry Linalool Synthase Gene Under the Control of the Inducible Potato P12 Promoter

    Institute of Scientific and Technical Information of China (English)

    YANG Li-mei; Per Mercke; Joop J A van Loon; FANG Zhi-yuan; Marcel Dicke; Maarten A Jongsma

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FANESl linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The construct pBin-PP12-LIS' was transformed to Arabidopsis thaliana ecotype Columbia O. Kanamycin resistant T0 seedlings were confirmed for the presence and transcription of the LIS' gene by PCR analysis on genomic DNA and by RT-PCR analysis on RNA. Genomic and RT-PCR products were sequenced to confirm correct splicing of the synthetic intron. The expression of active linalool synthase by the PP12-LIS' gene construct in the transgenic lines was assessed by measuring linalool emission using solid phase micro-extraction (SPME) GC-MS measurements after induction with methyl jasmonate. Among 30 tested independent T2 transgenic lines, 10 exhibited linalool production.Linalool expression could be induced by methyl jasmonate treatment, but not by diamondback moth larvae.

  14. T-786c Polymorphism in nitric oxide synthase 3 gene and Nitrit Oxide Level of Diabetic Retinopathy in Javanese Population

    Directory of Open Access Journals (Sweden)

    Putri Widelia Welkriana

    2015-11-01

    Full Text Available AbstractComplication of retinopathy in type 2 DM is caused of lower level of NO. Nitric oxide level is synthesizedfrom L-arginin in reaction that catalyze Nitric oxide synthase (NOS 3. The T-786C mutation in NOS 3 genedecreases the expression of nitric oxide synthase (NOS 3 so decreases NO synthesis. To investigate theassociation between T-786C polymorphism in NOS 3 gene with NO level of diabetic retinopathy patients. Thisstudy was a case control study, consist of 40 patient of type 2 diabetic with DR (case group and 40 patient oftype 2 diabetic without DR (control group of Javanese ethnic. The genotyping of T-786C polymorphism wasperformed by PCR-RLFP. Level of NO was measured by spectrophotometry. Chi square test and odd ratiowere used to analyze the association of the T-786C polymorphism in NOS 3 gene with DR. Differences ofNO level between TT and TC genotypes were analyzed using independent t test. The distribution of T-786Cpolymorphism in NOS 3 gene of DR subjects showed that frequency of TT genotype was 22.5% and TC genotypewas 77.5%. Non DR subjects showed the frequency of TT genotype was 50% and TC genotype was 50%, (p=0.011. Frequency of T allele in DR group was 61.25% and C allele was 38.75%, and frequency of T allele in nonDR group was 75% and C allele was 25%, (p= 0.62. Odd ratio of TC genotype was 3.444(CI; 95% : 0.964-3.735and C allele was 1.898 (CI; 95% : 1.310-9.058. The NO level of TC genotype was 1.43+0.126 and TT genotypewas 11.27+5.87 (p=0.000. Level of NO between RD and non RD showed not different significantly (p=0.160for retinopathy. The T-786C polymorphism of NOS 3 gene is risk factor for retinopathy in type 2 DiabetesMellitus. Individual with TC genotype of NOS 3 gene has lower level of NO than TT genotype.Keywords : Diabetic Retinopathy, Polymorphism, Nitric Oxide, Nitric Oxide Synthase.

  15. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    OpenAIRE

    Domingo, Pere (Domingo Pedrol); Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), ...

  16. Normal Responses to Restraint Stress in Mice Lacking the Gene for Neuronal Nitric Oxide Synthase

    OpenAIRE

    WEISSMAN, BEN A.; Sottas, Chantal M.; HOLMES, MICHAEL; Zhou, Ping; Iadecola, Costantino; HARDY, DIANNE O.; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in...

  17. Factors influencing gene silencing of granule-bound starch synthase in potato

    OpenAIRE

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI has been achieved by transformation with antisense and sense GBSSI constructs. However, the percentages of transformants showing strong silencing were relatively low which implicated that large num...

  18. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    Science.gov (United States)

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  19. Congenital erythropoietic porphyria with two mutations of the uroporphyrinogen III synthase gene (Cys73Arg, Thr228Met

    Directory of Open Access Journals (Sweden)

    Zoran Gucev

    2011-01-01

    Full Text Available Congenital erythropoietic porphyria (CEP is an autosomal recessive inborn error of metabolism that results from the markedly deficient activity of uroporphyrinogen III synthase (UROS. We describe a 14-year-old girl with red urine since infancy, progressive blistering and scarring of the skin, and moderate hemolytic anemia. After years of skin damage, her face is mutilated; she has a bald patch on the scalp, hypertrichosis of the neck, areas of skin darkening, and limited joint movements of the hands. Total urine excretion and fecal total porphyrin were both markedly raised above normal levels. Sequencing of the UROS gene identified two mutations causing CEP (Cys73Arg, Thr228Met. The patient lesions are progressing. Bone marrow transplantation and/or gene therapy are proposed as the next steps in her treatment. In brief, we describe a CEP with confirmed two pathogenic mutations, severe phenotype and discuss the various treatment options available.

  20. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    Science.gov (United States)

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  1. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Science.gov (United States)

    Komoto, Tatiana Takahasi; Bitencourt, Tamires Aparecida; Silva, Gabriel; Beleboni, Rene Oliveira; Marins, Mozart; Fachin, Ana Lúcia

    2015-01-01

    Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.). Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets. PMID:26257814

  2. Gene Expression Response of Trichophyton rubrum during Coculture on Keratinocytes Exposed to Antifungal Agents

    Directory of Open Access Journals (Sweden)

    Tatiana Takahasi Komoto

    2015-01-01

    Full Text Available Trichophyton rubrum is the most common causative agent of dermatomycoses worldwide, causing infection in the stratum corneum, nails, and hair. Despite the high prevalence of these infections, little is known about the molecular mechanisms involved in the fungal-host interaction, particularly during antifungal treatment. The aim of this work was to evaluate the gene expression of T. rubrum cocultured with keratinocytes and treated with the flavonoid trans-chalcone and the glycoalkaloid α-solanine. Both substances showed a marked antifungal activity against T. rubrum strain CBS (MIC = 1.15 and 17.8 µg/mL, resp.. Cytotoxicity assay against HaCaT cells produced IC50 values of 44.18 to trans-chalcone and 61.60 µM to α-solanine. The interaction of keratinocytes with T. rubrum conidia upregulated the expression of genes involved in the glyoxylate cycle, ergosterol synthesis, and genes encoding proteases but downregulated the ABC transporter TruMDR2 gene. However, both antifungals downregulated the ERG1 and ERG11, metalloprotease 4, serine proteinase, and TruMDR2 genes. Furthermore, the trans-chalcone downregulated the genes involved in the glyoxylate pathway, isocitrate lyase, and citrate synthase. Considering the urgent need for more efficient and safer antifungals, these results contribute to a better understanding of fungal-host interactions and to the discovery of new antifungal targets.

  3. Association of Variable Number of Tandem Repeats in Endothelial Nitric Oxide Synthase Gene with Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    S Salimi

    2006-08-01

    Full Text Available Endo-derived nitric oxide (NO is synthesized from L-arginine by endothelium nitric oxide synthase (eNOS. Since reduced NO synthesis has been implicated in the development of coronary atherosclerosis; we hypothesized that polymorphisms of NOS gene might be associated with increased susceptibility to this disorder and coronary artery disease (CAD. We studied the 27 base pair tandem repeat polymorphism in intron4 of the endothelial nitric oxide synthase (eNOS gene in 141 unrelated CAD patients with positive coronary angiograms in Shahid Rajaee Heart Hospital and 159 age matched control subjects without a history of symptomatic CAD. The study protocol was approved by the Iran University of Medical Sciences Ethics Committee. The eNOS gene intron4a/b VNTR polymorphism was analyzed by polymerase chain reaction. The plasma lipids levels and other risk factors were also determined. The genotype frequencies for eNOS4b/b, eNOS4a/b and eNOS4a/a were 68.8, 29.1 and 2.1% in CAD subjects, and 81, 18.4 and 0.6 % in control subjects, respectively. The genotype frequencies differed significantly between the two groups (χ²= 6.38 P= 0.041. The frequency of the allele was 16.7% in CAD subjects and 9.8% in control subjects and was significantly higher in the patients (χ²= 6.18 P= 0.013, odds ratio=1.84. Plasma lipids, except HDL-C were also remarkablely increased in CAD group.

  4. Hydrocellular foam dressing promotes wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis.

    Directory of Open Access Journals (Sweden)

    Takumi Yamane

    Full Text Available BACKGROUND: Hydrocellular foam dressing, modern wound dressing, induces moist wound environment and promotes wound healing: however, the regulatory mechanisms responsible for these effects are poorly understood. This study was aimed to reveal the effect of hydrocellular foam dressing on hyaluronan, which has been shown to have positive effects on wound healing, and examined its regulatory mechanisms in rat skin. METHODOLOGY/PRINCIPAL FINDINGS: We created two full-thickness wounds on the dorsolateral skin of rats. Each wound was covered with either a hydrocellular foam dressing or a film dressing and hyaluronan levels in the periwound skin was measured. We also investigated the mechanism by which the hydrocellular foam dressing regulates hyaluronan production by measuring the gene expression of hyaluronan synthase 3 (Has3, peroxisome proliferator-activated receptor α (PPARα, and CD44. Hydrocellular foam dressing promoted wound healing and upregulated hyaluronan synthesis, along with an increase in the mRNA levels of Has3, which plays a primary role in hyaluronan synthesis in epidermis. In addition, hydrocellular foam dressing enhanced the mRNA levels of PPARα, which upregulates Has3 gene expression, and the major hyaluronan receptor CD44. CONCLUSIONS/SIGNIFICANCE: These findings suggests that hydrocellular foam dressing may be beneficial for wound healing along with increases in hyaluronan synthase 3 and PPARα gene expression in epidermis. We believe that the present study would contribute to the elucidation of the mechanisms underlying the effects of hydrocellular foam dressing-induced moist environment on wound healing and practice evidence-based wound care.

  5. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  6. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T;

    2007-01-01

    Mannan polysaccharides are widespread among plants, where they serve as structural elements in cell walls, as carbohydrate reserves, and potentially perform other important functions. Previous work has demonstrated that members of the cellulose synthase-like A (CslA) family of glycosyltransferases...... from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced in...

  7. Alfalfa Cellulose synthase gene expression under abiotic stress: a Hitchhiker's guide to RT-qPCR normalization.

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    Full Text Available Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L., no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress at various time points (e.g. 0, 24, 72 and 96 h. We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots, under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses.

  8. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  9. Botrytis cinerea virulence is drastically reduced after disruption of chitin synthase class III gene (Bcchs3a).

    Science.gov (United States)

    Soulié, Marie-Christine; Perino, Claude; Piffeteau, Annie; Choquer, Mathias; Malfatti, Pierrette; Cimerman, Agnès; Kunz, Caroline; Boccara, Martine; Vidal-Cros, Anne

    2006-08-01

    Botrytis cinerea is an important phytopathogenic fungus requiring new methods of control. Chitin biosynthesis, which involves seven classes of chitin synthases, could be an attractive target. A fragment encoding one of the class III enzymes was used to disrupt the corresponding Bcchs3a gene in the B. cinerea genome. The resulting mutant exhibited a 39% reduction in its chitin content and an 89% reduction in its in vitro chitin synthase activity, compared with the wild-type strain. Bcchs3a mutant was not affected in its growth in liquid medium, neither in its production of sclerotia, micro- and macroconidia. In contrast, the mutant Bcchs3a was severely impaired in its growth on solid medium. Counterbalancing this defect in radial growth, Bcchs3a mutant presented a large increase in hyphal ramification, resulting in an enhanced aerial growth. Observations by different techniques of microscopy revealed a thick extracellular matrix around the hyphal tips. Moreover, Bcchs3a mutant had a largely reduced virulence on Vitis vinifera and Arabidopsis thaliana leaves. PMID:16882034

  10. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    OpenAIRE

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction se...

  11. Cloning and Expression Analysis of Chalcone Isomerase Gene LhCHI in Oriental Hybrid Lily (Lilium spp.)%东方百合查尔酮异构酶基因 LhCHI的克隆及表达1)

    Institute of Scientific and Technical Information of China (English)

    窦晓莹; 郎利新; 包放; 孔滢; 尚宏忠; 白锦荣; 王乃彦

    2015-01-01

    The gene LhCHI encoding chalcone isomerase (CHI) involved into flavonoids synthesis was cloned from inner tepals of Oriental hybrid lily ‘Sorbonne ’ ( LhCHI, GenBank accession No .KJ784468 ) .The cDNA of LhCHI was obtained by RT-PCR and Rapid Amplification of cDNA Ends techniques .The open reading frame of LhCHI was 702 bp in length, enco-ding a protein polypeptide of 233 amino acids with a predicted molecular weight of 25 kD and a theoretical pI of 4.7.The deduced amino acid sequence of LhCHI shared 83.3%identity with CHI from Tulipa fosteriana, and contained typical con-served catalytic chalcone elements .Quantitative real-time PCR analyzed the expression profiles of LhCHI in different tis-sues.LhCHI was constitutively expressed in root , stem, leaf, bulb, tepal, anther, style and stigma with particularly high expression in flowers .The expression level of LhCHI in later stage flowers is generally higher than that in the early stage flowers.%利用RT-PCR结合RACE的方法从东方百合‘索邦’花被片中克隆了查尔酮异构酶(CHI)基因,命名为LhCHI(GenBank登录号为KJ784468)。该基因开放阅读框702 bp,编码233个氨基酸,预测该蛋白相对分子质量25 KD,等电点( pI)为4.7。同源比对和系统进化分析表明,LhCHI基因编码的氨基酸序列具有查尔酮异构酶典型的催化活性保守位点,与百合科郁金香( Tulipa fosteriana)查尔酮异构酶序列一致性为83.3%。半定量PCR和荧光实时定量PCR分析结果表明,LhCHI基因在百合的根、茎、叶片、鳞茎、开放花被片、花药以及柱头中均有表达,花器官中相对表达量较高,花发育后期的柱头、花柱、花被片等组织中LhCHI基因表达水平普遍高于花发育早期。

  12. Dietary chalcones with chemopreventive and chemotherapeutic potential.

    Science.gov (United States)

    Orlikova, Barbora; Tasdemir, Deniz; Golais, Frantisek; Dicato, Mario; Diederich, Marc

    2011-05-01

    Chalcones are absorbed in the daily diet and appear to be promising cancer chemopreventive agents. Chalcones represent an important group of the polyphenolic family, which includes a large number of naturally occurring molecules. This family possesses an interesting spectrum of biological activities, including antioxidative, antibacterial, anti-inflammatory, anticancer, cytotoxic, and immunosuppressive potential. Compounds of this family have been shown to interfere with each step of carcinogenesis, including initiation, promotion and progression. Moreover, numerous compounds from the family of dietary chalcones appear to show activity against cancer cells, suggesting that these molecules or their derivatives may be considered as potential anticancer drugs. This review will focus primarily on prominent members of the chalcone family with an 1,3-diphenyl-2-propenon core structure. Specifically, the inhibitory effects of these compounds on the different steps of carcinogenesis that reveal interesting chemopreventive and chemotherapeutic potential will be discussed. PMID:21484163

  13. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    Science.gov (United States)

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  14. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    Science.gov (United States)

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  15. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  16. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    Science.gov (United States)

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  17. Transformation of Brassica napus canola cultivars with Arabidopsis thaliana acetohydroxyacid synthase genes and analysis of herbicide resistance.

    Science.gov (United States)

    Miki, B L; Labbé, H; Hattori, J; Ouellet, T; Gabard, J; Sunohara, G; Charest, P J; Iyer, V N

    1990-10-01

    A survey of selected crop species and weeds was conducted to evaluate the inhibition of the enzyme acetohydroxyacid synthase (AHAS) and seedling growth in vitro by the sulfonylurea herbicides chlorsulfuron, DPX A7881, DPX L5300, DPX M6316 and the imidazolinone herbicides AC243,997, AC263,499, AC252,214. Particular attention was given to the Brassica species including canola cultivars and cruciferous weeds such as B. kaber (wild mustard) and Thlaspi arvense (stinkweed). Transgenic lines of B. napus cultivars Westar and Profit, which express the Arabidopsis thaliana wild-type AHAS gene or the mutant gene csr1-1 at levels similar to the resident AHAS genes, were generated and compared. The mutant gene was essential for resistance to the sulfonylurea chlorsulfuron but not to DPX A7881, which appeared to be tolerated by certain Brassica species. Cross-resistance to the imidazolinones did not occur. The level of resistance to chlorsulfuron in transgenic canola greatly exceeded the levels that were toxic to the Brassica species or cruciferous weeds. Direct selection of transgenic lines with chlorsulfuron sprayed at field levels under greenhouse conditions was achieved. PMID:24221001

  18. Glycosylation defects and virulence phenotypes of Leishmania mexicana phosphomannomutase and dolicholphosphate-mannose synthase gene deletion mutants.

    Science.gov (United States)

    Garami, A; Mehlert, A; Ilg, T

    2001-12-01

    Leishmania parasites synthesize an abundance of mannose (Man)-containing glycoconjugates thought to be essential for virulence to the mammalian host and for viability. These glycoconjugates include lipophosphoglycan (LPG), proteophosphoglycans (PPGs), glycosylphosphatidylinositol (GPI)-anchored proteins, glycoinositolphospholipids (GIPLs), and N-glycans. A prerequisite for their biosynthesis is an ample supply of the Man donors GDP-Man and dolicholphosphate-Man. We have cloned from Leishmania mexicana the gene encoding the enzyme phosphomannomutase (PMM) and the previously described dolicholphosphate-Man synthase gene (DPMS) that are involved in Man activation. Surprisingly, gene deletion experiments resulted in viable parasite lines lacking the respective open reading frames (DeltaPMM and DeltaDPMS), a result against expectation and in contrast to the lethal phenotype observed in gene deletion experiments with fungi. L. mexicana DeltaDPMS exhibits a selective defect in LPG, protein GPI anchor, and GIPL biosynthesis, but despite the absence of these structures, which have been implicated in parasite virulence and viability, the mutant remains infectious to macrophages and mice. By contrast, L. mexicana DeltaPMM are largely devoid of all known Man-containing glycoconjugates and are unable to establish an infection in mouse macrophages or the living animal. Our results define Man activation leading to GDP-Man as a virulence pathway in Leishmania. PMID:11689705

  19. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  20. Aurone synthase is a catechol oxidase with hydroxylase activity and provides insights into the mechanism of plant polyphenol oxidases

    OpenAIRE

    Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette

    2016-01-01

    Catechol oxidases and tyrosinases belong to the family of polyphenol oxidases (PPOs). In contrast to tyrosinases, catechol oxidases were so far defined to lack hydroxylase activity toward monophenols. Aurone synthase (AUS1) is a plant catechol oxidase that specializes in the conversion of chalcones to aurones (flower pigments). We evidence for the first time, to our knowledge, hydroxylase activity for a catechol oxidase (AUS1) toward its natural monophenolic substrate (chalcone). The presente...

  1. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    Science.gov (United States)

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  2. A New Geranylated Chalcone from Andrographis lobelioides.

    Science.gov (United States)

    Sumalatha, Manne; Rammohan, Aluru; Gunasekar, Duvvuru; Deville, Alexandre; Bodo, Bernard

    2016-01-01

    A new O-geranylated chalcone, 2'-hydroxy-2-methoxy-4'-O-[(E)-3,7-dimethyl-2,6-octadienyl] chalcone (1), together with three known flavones, 5-hydroxy-7,2'-dimethoxyflavone (2), skullcapflavone I (3) and echioidin (4), were isolated from the leaves of Andrographis lobelioides. The structure of 1 and the known compounds (2-4) were achieved by extensive 1D and 2D NMR spectral and chemical studies. PMID:26996025

  3. Structural Antitumoral Activity Relationships of Synthetic Chalcones

    OpenAIRE

    Cesar Echeverria; Juan Francisco Santibañez; Oscar Donoso-Tauda; Escobar, Carlos A.; Rodrigo Ramirez-Tagle

    2009-01-01

    Relationships between the structural characteristic of synthetic chalcones and their antitumoral activity were studied. Treatment of HepG2 cells for 24 h with synthetic 2’-hydroxychalcones resulted in apoptosis induction and dose-dependent inhibition of cell proliferation. The calculated reactivity indexes and the adiabatic electron affinities using the DFT method including solvent effects, suggest a structure-activity relationship between the Chalcones structure and the apoptosis in Hep...

  4. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  5. Structural and functional changes of mitochondrial ATP synthase caused by mtDNA 9205delTA mutation in ATP6 gene

    Czech Academy of Sciences Publication Activity Database

    Ješina, Pavel; Tesařová, M.; Fornůsková, D.; Vojtíšková, Alena; Pecina, Petr; Kaplanová, Vilma; Hansíková, H.; Zeman, J.; Houštěk, Josef

    2006-01-01

    Roč. 29, S1 (2006), s. 117-117. ISSN 0141-8955. [International Congress of Inborn Errors of Metabolism /10./. 12.09.2006-16.09.2006, Chiba] R&D Projects: GA MZd NR7790 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP synthase * ATP6 gene * mitochondria Subject RIV: CE - Biochemistry

  6. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri; Hay-Schmidt, Anders; Jansen-Olesen, Inger; Gupta, Saurabh; Olesen, Jes

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene...

  7. Functional Promiscuity of Two Divergent Paralogs of Type III Plant Polyketide Synthases.

    Science.gov (United States)

    Pandith, Shahzad A; Dhar, Niha; Rana, Satiander; Bhat, Wajid Waheed; Kushwaha, Manoj; Gupta, Ajai P; Shah, Manzoor A; Vishwakarma, Ram; Lattoo, Surrinder K

    2016-08-01

    Plants effectively defend themselves against biotic and abiotic stresses by synthesizing diverse secondary metabolites, including health-protective flavonoids. These display incredible chemical diversity and ubiquitous occurrence and confer impeccable biological and agricultural applications. Chalcone synthase (CHS), a type III plant polyketide synthase, is critical for flavonoid biosynthesis. It catalyzes acyl-coenzyme A thioesters to synthesize naringenin chalcone through a polyketidic intermediate. The functional divergence among the evolutionarily generated members of a gene family is pivotal in driving the chemical diversity. Against this backdrop, this study was aimed to functionally characterize members of the CHS gene family from Rheum emodi, an endangered and endemic high-altitude medicinal herb of northwestern Himalayas. Two full-length cDNAs (1,179 bp each), ReCHS1 and ReCHS2, encoding unique paralogs were isolated and characterized. Heterologous expression and purification in Escherichia coli, bottom-up proteomic characterization, high-performance liquid chromatography-electrospray ionization-tandem mass spectrometry analysis, and enzyme kinetic studies using five different substrates confirmed their catalytic potential. Phylogenetic analysis revealed the existence of higher synonymous mutations in the intronless divergents of ReCHS. ReCHS2 displayed significant enzymatic efficiency (Vmax/Km) with different substrates. There were significant spatial and altitudinal variations in messenger RNA transcript levels of ReCHSs correlating positively with metabolite accumulation. Furthermore, the elicitations in the form of methyl jasmonate, salicylic acid, ultraviolet B light, and wounding, chosen on the basis of identified cis-regulatory promoter elements, presented considerable differences in the transcript profiles of ReCHSs. Taken together, our results demonstrate differential propensities of CHS paralogs in terms of the accumulation of flavonoids and

  8. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  9. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  10. Monoamine oxidase inhibitory activities of heterocyclic chalcones.

    Science.gov (United States)

    Minders, Corné; Petzer, Jacobus P; Petzer, Anél; Lourens, Anna C U

    2015-11-15

    Studies have shown that natural and synthetic chalcones (1,3-diphenyl-2-propen-1-ones) possess monoamine oxidase (MAO) inhibition activities. Of particular importance to the present study is a report that a series of furanochalcones acts as MAO-B selective inhibitors. Since the effect of heterocyclic substitution, other than furan (and more recently thiophene, piperidine and quinoline) on the MAO inhibitory properties of the chalcone scaffold remains unexplored, the aim of this study was to synthesise and evaluate further heterocyclic chalcone analogues as inhibitors of the human MAOs. For this purpose, heterocyclic chalcone analogues that incorporate pyrrole, 5-methylthiophene, 5-chlorothiophene and 6-methoxypyridine substitution were examined. Seven of the nine synthesised compounds exhibited IC50 values heterocyclic chalcones are reversible and competitive MAO inhibitors. 4h, however, may exhibit tight-binding to MAO-B, a property linked to its thiophene moiety. We conclude that high potency chalcones such as 4h represent suitable leads for the development of MAO-B inhibitors for the treatment of Parkinson's disease and possibly other neurodegenerative disorders. PMID:26432037

  11. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole;

    2002-01-01

    unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially......Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been...

  12. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  13. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae.

    Science.gov (United States)

    Müller, Christian; Hansen, Kim; Szabo, Peter; Nielsen, Jens

    2003-03-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3.4-22.5 g kg(-1) biomass) and the power-law model adequately described the rheological properties. In the cultivations there were pellets, clumps, and freely dispersed hyphal elements. The different morphological fractions were quantified using image analysis. The apparent viscosity of the fermentation broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. PMID:12514801

  14. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  15. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    OpenAIRE

    Wen-Kai Xia; Tian-Bo Ding; Jin-Zhi Niu; Chong-Yu Liao; Rui Zhong; Wen-Jia Yang; Bin Liu; Wei Dou; Jin-Jun Wang

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic ...

  16. Citrate-release-mediated aluminum resistance is coupled to the inducible expression of mitochondrial citrate synthase gene in Paraserianthes falcataria.

    Science.gov (United States)

    Osawa, Hiroki; Kojima, Katsumi

    2006-05-01

    Aluminum (Al) resistance in some leguminous plants is achieved by enhanced citrate release from roots. Enhancement requires several hours for complete activation and is postulated to involve Al-responsive genes or components. We examined the mechanism of Al-induced citrate release by studying the relationship between citrate release and expression of the mitochondrial citrate synthase (mCS) gene in three leguminous trees. Root elongation in Leucaena leucocephala (Lam.) de Wit was arrested within 24 h by 30 microM Al, whereas root elongation in Paraserianthes falcataria (L.) Neilson and Acacia mangium Willd. was inhibited mangium maintained enhanced release and accumulation of citrate for at least 28 days in response to Al treatment. Aluminum increased the accumulation of mCS transcripts in P. falcataria roots, but not in L. leucocephala roots, and thus up-regulation decreased following removal of Al. Lanthanum did not alter the expression level of mCS. Aluminum increased mCS activity concomitantly with enhanced mCS gene expression in P. falcataria, whereas it did not affect mCS activity in L. leucocephala. Aluminum content in root apices of P. falcataria was increased by cycloheximide, supporting the idea that de novo synthesis of proteins is a prerequisite for Al resistance. Our findings suggest that Al-inducible expression of mCS coupled with enhanced citrate release mediates Al resistance in P. falcataria. PMID:16452070

  17. Role of Plant Fatty acid Elongase (3 keto acyl-CoA Synthase gene in Cuticular Wax Biosynthesis

    Directory of Open Access Journals (Sweden)

    Uppala Lokesh

    2013-12-01

    Full Text Available Plant surfaces are ensheathed by cuticular wax, amorphous intra-cuticular embedded in cutin polymer and crystalloid epi-cuticular that imparts a whitish appearance, confers drought resistance by reducing stomatal transpiration and also protects from U.V Radiation, phytophagous insects etc. Very long chain fatty acids acts as precursors for cuticular wax bio-synthesis. Wax bio-synthesis begins with fatty acid synthesis in the plastid (de novo synthesis of C16 and C18 and elongation of fatty acids in endoplasmic reticulum (C20 – C34 by four distinct enzymes 3-ketoacyl-CoA synthase, 3-ketoacyl-CoA reductase, 3-hydroxacyl-CoA dehydratase, trans-2,3-enoyl-CoA reductase (KCS, KCR, HCD, ECR. The KCS, a fatty acid elongase, determines the chain length and substrate specificity of the condensation reaction, a rate limiting step and the subsequent elongated products alkanes, aldehydes, primary alcohols, secondary alcohols, ketones and wax esters. 21 KCS genes were annotated in Arabidopsis thaliana Genome of which some KCSs were identified involved in cuticle formation (CER6 (CUT1, KCS1, KCS2, (DAISY, KCS20 and FDH.The current review will focus on the bio-chemical, genetic and molecular approaches on KCSs genes, predominantly KCS1 in plants particularly useful in identifying and characterizing gene products involved in wax bio-synthesis, secretion and function for developing transgenic crops that combat various stresses. INTRODUCTION

  18. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    Science.gov (United States)

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  19. Cloning and characterization of the gene encoding β-amyrin synthase in the glycyrrhizic acid biosynthetic pathway in Glycyrrhiza uralensis

    Directory of Open Access Journals (Sweden)

    Honghao Chen

    2013-12-01

    Full Text Available Glycyrrhiza uralensis is considered to be one of the most important herbs in traditional Chinese medicine due to its numerous pharmacological effects particularly its ability to relieve cough and act as a mucolytic. Based on previous research, these effects are mediated by a number of active ingredients, especially glycyrrhizic acid (GA. In the present study, a gene encoding β-amyrin synthase (β-AS involved in GA biosynthesis in G. uralensis has been cloned and expressed in Saccharomyces cerevisiae. The cloned enzyme showed similar activity to native enzymes isolated from other Glycyrrhiza species to catalyze the conversion of 2,3-oxidosqualene into β-amyrin. In fact the β-AS gene is particularly important in the GA biosynthetic pathway in G. uralensis. The complete sequence of the enzyme was determined and a phylogenetic tree based on the β-AS gene of G. uralensis and 20 other species was created. This showed that Glycyrrhiza glabra had the closest kinship with G. uralensis. The results of this work will be useful in determining how to improve the efficacy of G. uralensis by improving its GA content and in exploring the biosynthesis of GA in vitro.

  20. Geranyl diphosphate synthase from mint

    Science.gov (United States)

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  1. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  2. Tobacco streak virus (strain dahlia) suppresses post-transcriptional gene silencing of flavone synthase II in black dahlia cultivars and causes a drastic flower color change.

    OpenAIRE

    Deguchi, Ayumi; Tatsuzawa, Fumi; Hosokawa, Munetaka; Doi, Motoaki; Ohno, Sho

    2015-01-01

    Tobacco streak virus suppressed post-transcriptional gene silencing and caused a flower color change in black dahlias, which supported the role of cyanidin-based anthocyanins for black flower appearance. Black flower color of dahlia (Dahlia variabilis) has been attributed, in part, to the high accumulation of cyanidin-based anthocyanins that occurs when flavone synthesis is reduced because of post-transcriptional gene silencing (PTGS) of flavone synthase II (DvFNS). There are also purple-flow...

  3. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    Science.gov (United States)

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  4. The crtE gene in Erwinia herbicola encodes geranylgeranyl diphosphate synthase.

    OpenAIRE

    Math, S K; Hearst, J E; Poulter, C. D.

    1992-01-01

    A cluster of genes essential for the biosynthesis of carotenoids in Erwinia herbicola has been isolated and characterized [Armstrong, G.A., Alberti, M. & Hearst, J. E. (1990) Proc. Natl. Acad. Sci. USA 87, 9975-9979]. Related gene clusters are found in other carotenoid-producing bacteria. Two of these genes, crtB and crtE, have been assigned to enzymes responsible for conversion of geranylgeranyl diphosphate (GGPP) to prephytoene diphosphate and prephytoene diphosphate to phytoene, respective...

  5. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    Science.gov (United States)

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-01-01

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain. PMID:26782579

  6. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  7. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  8. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα)8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys)3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  9. Relationship between gene expression of nitric oxide synthase and androgens in rat corpus cavernosum

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To cladfy the dependence of neural nitric oxide synthase mRNA (nNOSmRNA) and endothelial nitric oxide synthase mRNA (eNOSmRNA) on androgens (testosterone [T] and dihydrotestosterone [DHT]). Methods 160 male Sprague Dawley (SD) rats were divided into Groups A (56 rats, 5 weeks old), B (50 rets,10 weeks old) and C (54 rats, 58 weeks old). Groups A, B and C were all subdivided respectively into five Subgroups. Subgroup 1: intact osntrels; Subgroup 2: castrated; Subgroup 3: castrated with testosterone ubdecanoate 25 mg/kg·mon-1, intramuscular injection, Subgroup 4: castrated with testosterone undecanoate 50 mg/kg·mon-1, intramuscular injection and Subgroup 5: treated with finaeteride 4.5 mg/kg·day-1, orally. Four and ten weeks after treatments described above, one half of the rats were killed. Serum samples were token for measurements of T, free testosterone (FT) and DHT by raclioimmunoassay. Penile samples were treated with liquid nitrogen and then stored at-80℃. nNOSmRNA and eNOSmRNA were detected by semiquantitative reveres-transcription polymerase chain reaction (RT-PCR) and Dot blot. Resulte There was no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 in all Groups A, B and C. The expression of penile eNOSmRNA of Group A was significantly increased (4 weeks model) (P<0.05) or increased (10 weeks model) (P>0.05) in Subgroup 2 or 5 compared with those in Subgroup 1.There wes no significant difference between Subgroup 1 and Subgroup 2 or Subgroup 5 of Group B in 4 weeks model (P>0.05). There was an elevation when animals were castrated or treated with finasteride in the 10 weeks model.The expreseion of penile eNOSmRNA of Group C was significantly increased (10 weeks model) (P<0.05) or increased (4 weeks model) in Subgroup 2 compared with those in Subgroup 1.The production of eNOSmRNA in Subgroup 5 was also increased (including 4- and 10-week models). When T was supplied for castration, the penile eNOSmRNA was desreased to

  10. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  11. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  12. Relationship of endothelial nitric oxide synthase gene polymorphism with blood pressure,lipid profile and blood glucose level

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    To study the relationship of the polymorphism of endothelial nitric oxide synthase(eNOS)gene and blood pressure,lipid profiles and blood glucose level.By using PCR-RFLP,the eNOS Glu298Asp gene polymorphism was detected in 184 patients with essential hypertension and 196 matched healthy individuals with normal blood pressure.Taking into account eNOS Glu298Asp polymorphisms,the relationship of blood pressure with triglycerides(TG),total cholesterol(TC),high density lipoprotein(HDL),low density lipoprotein(LDL)and blood glucose level was analyzed.The distribution of eNOS Glu298Asp polymorphism had no significant difference between different blood pressure groups and gender groups,but there was a significant difference between different age groups,diastolic blood pressure groups or BMI groups(P<0.05).Asp/Asp genotype significantly increased the risk of hypertension in individuals with serum TC above 5.4 mmol/L(P=0.03,OR=2.65).eNOSGlu298Asp polymorphism and serum lipid could synergistically modulate the blood pressure,eNOS Asp/Asp genotype could significantly increase the risk of hypertension in individuals with serum TC over 5.4 mmol/L,eNOS Glu298Asp in combination with serum TC could be used to predict the risk of hypertension.

  13. Structural analysis of the promoter of tomato 1-aminocyclopropane-1-carboxylate synthase 6 gene(Le-ACS6)

    Institute of Scientific and Technical Information of China (English)

    LIN JingYu; FAN Rong; WAN XiaoRong; CHARNG Yeeyung; WANG NingNing

    2007-01-01

    Ethylene plays an important role in the regulation of many growth and developmental processes of higher plants. In tomato, Le-ACS6, a member of the ACC synthase multigene family involved in system 1 ethylene biosynthesis during fruit ripening, is subject to negative feedback regulation by ethylene. To identify the cis-elements that are responsible for the negative feedback control, we established an in vitro transient assay system employing particle bombardment on mature-green tomato fruit pericarp to examine the expression of a luciferase (LUC) reporter gene driven by a 5'-serially deleted Le-ACS6 promoter. The results localized putative cis-elements required for negative ethylene-response between -347 and -266 upstream from the translational start site ATG. Several lines of stable transformation of the Le-ACS6 promoter and GUS reporter fusion gene containing internal deletion from -347 to -266 were generated. The expression pattern of the GUS reporter showed that removal of the nucleotides from -347 to -266 completely eliminated the response of the Le-ACS6 promoter to exogenous ethylene.

  14. Expression of the Grifola frondosa Trehalose Synthase Gene and Improvement of Drought-Tolerance in Sugarcane (Saccharum officinarum L.)

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Trehalose is a nonreducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances stress tolerance to abiotic stresses in organisms. We report here the expression of a Grifola frondosa trehalose synthase (TSase) gene for improving drought tolerance in sugarcane (Saccharum officinarum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and transferred into sugarcane by Agrobacterium tumefaciens EHA105. The transgenic plants accumulated high levels of trehalose, up to 8.805-12.863 mg/g fresh weight, whereas it was present at undetectable level in nontransgenic plants. It has been reported that transgenic plants transformed with Escherichia coli TPS (trehalose-6-phosphatesynthase) and/or TPP (trehalose-6-phosphate phosphatase) are severely stunted and have root morphologic alterations. Interestingly, our transgenic sugarcane plants had no obvious morphological changes and no growth inhibition in the field. Trehalose accumulation in 35S-35S: TSase plants resulted in increased drought tolerance, as shown by the drought and the drought physiological indexes, such as the rate of bound water/free water, plasma membrane permeability, malondialdehyde content, chlorophyll a and b contents,and activity of SOD and POD of the excised leaves. These results suggest that transgenic plants transformed with the TSase gene can accumulate high levels of trehalose and have enhanced tolerance to drought.

  15. Exclusion of the neuronal nitric oxide synthase gene and the human achaete-scute homologue 1 gene as candidate loci for spinal cerebellar ataxia 2 (SCA2)

    Energy Technology Data Exchange (ETDEWEB)

    Twells, R.; Xu, W. [Imperial College, London (United Kingdom)]|[Institute of Animal Physiology and Genetics Research, Babraham, Cambridge (United Kingdom); Ball, D. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)] [and others

    1994-09-01

    The autosomal dominant ataxias are a heterogeneous group of disorders, characterized by progressive degeneration of the cerebellum, pons and inferior olives, as well as the spinal cord. We previously mapped the spinal cerebellar ataxia 2 locus (SCA2) to chromosome 12q23-24.1 in a large Cuban founder population, flanked by the markers D12S58 and PLA2. Anticipation is a common feature of this disorder and therefore we have examined genes in this region which contain trinucleotide repeat motifs as candidate loci for SCA2. The neuronal nitric oxide synthase gene (NOS) has recently been assigned to chromosome 12q24.2-24.3 by fluorescent in situ hybridization. Neuronal NOS is responsible for the production of nitric oxide, a neurotransmitter expressed in high levels in the cerebellum as well as other regions of the nervous system. We report here the identification and analysis of an (AAT){sub n} repeat motif in an intronic region of the neuronal NOS gene, genetic mapping data and its exclusion from being involved in SCA2. We also report the exclusion of the human achaete-scute homologue 1 gene (HASH1), instrumental in neurosensory development in mouse, from being involved in SCA2 by the analysis of a proximal (CAG){sub n} repeat motif in the Cuban pedigrees, and its genetic location on chromosome 12q.

  16. The role of sugars and sugar metabolism genes (sucrose synthase) in arabidopsis thaliana seed development

    OpenAIRE

    Odunlami, Benjamin Oladipo

    2009-01-01

    Seed development in Arabidopsis thaliana, has been studied at several levels. However, little has been done to study the role of sugar metabolism genes in seed pod development in this species. As the fertilized egg progresses to a mature seed, the sugars composition during different stages of the developing changes. These changes are related to metabolic processes in the developing seeds, but also to the activity of sucrose- converting and transporting genes, active at the interphase between ...

  17. Normal responses to restraint stress in mice lacking the gene for neuronal nitric oxide synthase.

    Science.gov (United States)

    Weissman, Ben A; Sottas, Chantal M; Holmes, Michael; Zhou, Ping; Iadecola, Costantino; Hardy, Dianne O; Ge, Ren-Shan; Hardy, Matthew P

    2009-01-01

    The hormonal changes associated with immobilization stress (IMO) include a swift increase in corticosterone (CORT) concentration and a decrease in circulating testosterone (T) levels. There is evidence that the production of the short-lived neuromodulator nitric oxide (NO) is increased during stress in various tissues, including the brain. NO also suppresses the biosynthesis of T. Both the inducible and the neuronal isoforms of NO synthase (iNOS and nNOS, respectively) have been implicated in this suppression, but the evidence has not been conclusive. We used adult wild-type (WT) and nNOS knockout male mice (nNOS-/-) to assess the respective roles of CORT and nNOS-derived NO in stress mediated inhibition of T production. Animals were assigned to either basal control or 3-hour IMO groups. No difference in basal plasma and testicular T levels were observed between WT and nNOS-/-, although testicular weights of mutant mice were slightly lower compared to WT animals. The plasma contents of luteinizing hormone (LH) and CORT in unstressed mice of both genotypes were similar. Exposure to 3 hours of IMO increased plasma CORT and decreased T concentrations in mice of both genotypes. However, comparable levels of plasma LH and testicular nitrite and nitrate (NOx), NO stable metabolites, were detected in control and stressed WT and nNOS-/- mice. Adrenal concentrations of NOx declined after IMO, but the reduction was not statistically significant. These findings implicate CORT rather than NO generated by nNOS in the rapid stress-induced suppression of circulating T. PMID:19304728

  18. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  19. Polymorphisms in thymidylate synthase gene and susceptibility to breast cancer in a Chinese population: a case-control analysis

    Directory of Open Access Journals (Sweden)

    Liu Jiyong

    2006-05-01

    Full Text Available Abstract Background Accumulative evidence suggests that low folate intake is associated with increased risk of breast cancer. Polymorphisms in genes involved in folate metabolism may influence DNA methylation, nucleotide synthesis, and thus individual susceptibility to cancer. Thymidylate synthase (TYMS is a key enzyme that participates in folate metabolism and catalyzes the conversion of dUMP to dTMP in the process of DNA synthesis. Two potentially functional polymorphisms [a 28-bp tandem repeat in the TYMS 5'-untranslated enhanced region (TSER and a 6-bp deletion/insertion in the TYMS 3'-untranslated region (TS 3'-UTR] were suggested to be correlated with alteration of thymidylate synthase expression and associated with cancer risk. Methods To test the hypothesis that polymorphisms of the TYMS gene are associated with risk of breast cancer, we genotyped these two polymorphisms in a case-control study of 432 incident cases with invasive breast cancer and 473 cancer-free controls in a Chinese population. Results We found that the distribution of TS3'-UTR (1494del6 genotype frequencies were significantly different between the cases and controls (P = 0.026. Compared with the TS3'-UTR del6/del6 wild-type genotype, a significantly reduced risk was associated with the ins6/ins6 homozygous variant genotype (adjusted OR = 0.58, 95% CI = 0.35–0.97 but not the del6/ins6 genotype (OR = 1.09, 95% CI = 0.82–1.46. Furthermore, breast cancer risks associated with the TS3'-UTR del6/del6 genotype were more evident in older women, postmenopausal subjects, individuals with a younger age at first-live birth and individuals with an older age at menarche. However, there was no evidence for an association between the TSER polymorphism and breast cancer risks. Conclusion These findings suggest that the TS3'-UTR del6 polymorphism may play a role in the etiology of breast cancer. Further larger population-based studies as well as functional evaluation of the

  20. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Science.gov (United States)

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. PMID:22699157

  1. Association study of the endothelial nitric oxide synthase gene polymorphisms with essential hypertension in northern Han Chinese

    Institute of Scientific and Technical Information of China (English)

    ZHAO Qi; SU Shao-yong; CHEN Shu-feng; LI Biao; GU Dong-feng

    2006-01-01

    Background Nitric oxide (NO) synthesized by endothelial nitric oxide synthase (eNOS) plays an important role in both the regulation of endothelial function and the control of blood pressure. Up to now, there has been conflicting data regarding the association between three clinically relevant polymorphisms (T-786C, intron4b/a and G894T) of the eNOS gene and essential hypertension.Methods To examine the contribution of the three eNOS gene polymorphisms to the development of hypertension in the northern Han Chinese, a case-control study including 503 hypertensive cases and 490 age-,gender-, and area-matched controls recruited from the International Collaborative Study of Cardiovascular Disease in Asia (InterASIA) was conducted. Genotyping was performed by polymerase chain reaction (PCR) or PCR-restriction fragment length polymorphism (RFLP).Results The T-786C and intron4b/a polymorphisms were observed in significant linkage disequilibrium (D'=0.87, P<0.001). The minor allele frequencies of these three polymorphisms in healthy controls were much lower than those of Caucasians (9.3% vs 39.6%-42.0%, 8.9% vs 15.0%- 16.0% and 10.9% vs 34.5%-34.9%for -786C, intron4a and 894T, respectively). Genotype distributions and allele frequencies of the three polymorphisms did not differ between cases and controls (all P > 0.05). In addition, none of the eight estimated haplotypes significantly increased or decreased the risk of hypertension before or after adjustment for several known risk factors.Conclusion The study results suggest that the three eNOS gene polymorphisms are unlikely to be major genetic susceptibility factors for essential hypertension in the northern Han Chinese population.

  2. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    Science.gov (United States)

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  3. Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India

    OpenAIRE

    Nishank, Sudhansu Sekhar

    2013-01-01

    Background and Objective Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphisms- eNOS 4a/b, eNOS 894G>T (rs1799983) and eNOS-786 T>C (rs2070744) and plasma nitrite...

  4. ENDOTHELIAL NITRIC OXIDE SYNTHASE (ENOS) GENE POLYMORPHISM IS ASSOCIATED WITH AGE ONSET OF MENARCHE IN SICKLE CELL DISEASE FEMALES OF INDIA

    OpenAIRE

    Sudhansu Sekhar Nishank

    2013-01-01

    ABSTRACT   Background and Objective :  Females with sickle cell disease (SCD) often show late onset of menarche. In transgenic sickle cell mouse, deficiency of gene encoding endothelial nitric oxide synthase (eNOS) has been reported to be associated with late onset of menarche. Thus to explore the possible association of eNOS gene polymorphism with age of onset of menarche in SCD females, 3 important eNOS gene polymorphism- eNOS 4a/b, eNOS 894G>T and eNOS-786 T>C  and  plasma ...

  5. SYNTHESIS AND CHARACTERIZATION OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Ramesh Dhani

    2012-12-01

    Full Text Available Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The name chalcones was given by Kostanecki and Tambor. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of novel heterocyclics with good pharmaceutical profile can be designed. Chalcones have been considered as a magic moiety possessing myriad spectrum of medicinal activities. Diversity of biological response profile has attracted considerable interest of several researchers across the globe to explore this skeleton for its assorted therapeutic significance. By using different synthetic methods new chalcone derivatives were synthesized and characterized by physicochemical analysis. Chalcone is a lead nucleus for future developments to get effective compounds.

  6. Production of copolyesters of 3-hydroxybutyrate and medium-chain-length 3-hydroxyalkanoates by E. coli containing an optimized PHA synthase gene

    Directory of Open Access Journals (Sweden)

    Gao Xue

    2012-09-01

    Full Text Available Abstract Background Microbial polyhydroxyalkanoates (PHA are biopolyesters consisting of diverse monomers. PHA synthase PhaC2Ps cloned from Pseudomonas stutzeri 1317 is able to polymerize short-chain-length (scl 3-hydroxybutyrate (3HB monomers and medium-chain-length (mcl 3-hydroxyalkanoates (3HA with carbon chain lengths ranging from C6 to C12. However, the scl and mcl PHA production in Escherichia coli expressing PhaC2Ps is limited with very low PHA yield. Results To improve the production of PHA with a wide range of monomer compositions in E. coli, a series of optimization strategies were applied on the PHA synthase PhaC2Ps. Codon optimization of the gene and mRNA stabilization with a hairpin structure were conducted and the function of the optimized PHA synthase was tested in E. coli. The transcript was more stable after the hairpin structure was introduced, and western blot analysis showed that both codon optimization and hairpin introduction increased the protein expression level. Compared with the wild type PhaC2Ps, the optimized PhaC2Ps increased poly-3-hydroxybutyrate (PHB production by approximately 16-fold to 30% of the cell dry weight. When grown on dodecanoate, the recombinant E. coli harboring the optimized gene phaC2PsO with a hairpin structure in the 5’ untranslated region was able to synthesize 4-fold more PHA consisting of 3HB and medium-chain-length 3HA compared to the recombinant harboring the wild type phaC2Ps. Conclusions The levels of both PHB and scl-mcl PHA in E. coli were significantly increased by series of optimization strategies applied on PHA synthase PhaC2Ps. These results indicate that strategies including codon optimization and mRNA stabilization are useful for heterologous PHA synthase expression and therefore enhance PHA production.

  7. Cloning and Characterisation of the Gene Encoding 3-Hydroxy-3-Methylglutaryl-CoA Synthase in Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Yu-Jia Liu

    2014-11-01

    Full Text Available Tripterygium wilfordii is a traditional Chinese medical plant used to treat rheumatoid arthritis and cancer. The main bioactive compounds of the plant are diterpenoids and triterpenoids. 3-Hydroxy-3-methylglutaryl-CoA synthase (HMGS catalyses the reaction of acetoacetyl-CoA to 3-hydroxy-3-methylglutaryl-CoA, which is the first committed enzyme in the mevalonate (MVA pathway. The sequence information of HMGS in Tripterygium wilfordii is a basic resource necessary for studying the terpenoids in the plant. In this paper, full-length cDNA encoding HMGS was isolated from Tripterygium wilfordii (abbreviated TwHMGS, GenBank accession number: KM978213. The full length of TwHMGS is 1814 bp, and the gene encodes a protein with 465 amino acids. Sequence comparison revealed that TwHMGS exhibits high similarity to HMGSs of other plants. The tissue expression patterns revealed that the expression level of TwHMGS is highest in the stems and lowest in the roots. Induced expression of TwHMGS can be induced by MeJA, and the expression level is highest 4 h after induction. The functional complement assays in the YML126C knockout yeast demonstrated that TwHMGS participates in yeast terpenoid biosynthesis.

  8. A Sweetpotato Geranylgeranyl Pyrophosphate Synthase Gene, IbGGPS, Increases Carotenoid Content and Enhances Osmotic Stress Tolerance in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wei Chen

    Full Text Available Sweetpotato highly produces carotenoids in storage roots. In this study, a cDNA encoding geranylgeranyl phyrophosphate synthase (GGPS, named IbGGPS, was isolated from sweetpotato storage roots. Green fluorescent protein (GFP was fused to the C-terminus of IbGGPS to obtain an IbGGPS-GFP fusion protein that was transiently expressed in both epidermal cells of onion and leaves of tobacco. Confocal microscopic analysis determined that the IbGGPS-GFP protein was localized to specific areas of the plasma membrane of onion and chloroplasts in tobacco leaves. The coding region of IbGGPS was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana to obtain transgenic plants. High performance liquid chromatography (HPLC analysis showed a significant increase of total carotenoids in transgenic plants. The seeds of transgenic and wild-type plants were germinated on an agar medium supplemented with polyethylene glycol (PEG. Transgenic seedlings grew significantly longer roots than wild-type ones did. Further enzymatic analysis showed an increased activity of superoxide dismutase (SOD in transgenic seedlings. In addition, the level of malondialdehyde (MDA was reduced in transgenics. qRT-PCR analysis showed altered expressions of several genes involved in the carotenoid biosynthesis in transgenic plants. These data results indicate that IbGGPS is involved in the biosynthesis of carotenoids in sweetpotato storage roots and likely associated with tolerance to osmotic stress.

  9. Identification of genes coding for putative wax ester synthase/diacylglycerol acyltransferase enzymes in terrestrial and marine environments.

    Science.gov (United States)

    Lanfranconi, Mariana P; Alvarez, Adrián F; Alvarez, Héctor M

    2015-12-01

    Synthesis of neutral lipids such as triacylglycerols (TAG) and wax esters (WE) is catalyzed in bacteria by wax ester synthase/diacylglycerol acyltransferase enzymes (WS/DGAT). We investigated the diversity of genes encoding this enzyme in contrasting natural environments from Patagonia (Argentina). The content of petroleum hydrocarbons in samples collected from oil-producing areas was measured. PCR-based analysis covered WS/DGAT occurrence in marine sediments and soil. No product was obtained in seawater samples. All clones retrieved from marine sediments affiliated with gammaproteobacterial sequences and within them, most phylotypes formed a unique cluster related to putative WS/DGAT belonging to marine OM60 clade. In contrast, soils samples contained phylotypes only related to actinomycetes. Among them, phylotypes affiliated with representatives largely or recently reported as oleaginous bacteria, as well as with others considered as possible lipid-accumulating bacteria based on the analysis of their annotated genomes. Our study shows for the first time that the environment could contain a higher variety of ws/dgat than that reported from bacterial isolates. The results of this study highlight the relevance of the environment in a natural process such as the synthesis and accumulation of neutral lipids. Particularly, both marine sediments and soil may serve as a useful source for novel WS/DGAT with biotechnological interest. PMID:26228353

  10. Functional analyses of a flavonol synthase - like gene from Camellia nitidissima reveal its roles in flavonoid metabolism during floral pigmentation

    Indian Academy of Sciences (India)

    Xing-Wen Zhou; Zheng-Qi Fan; Yue Chen; Yu-Lin Zhu; Ji-Yuan Li; Heng-Fu Yin

    2013-09-01

    The flavonoids metabolic pathway plays central roles in floral coloration, in which anthocyanins and flavonols are derived from common precursors, dihydroflavonols. Flavonol synthase (FLS) catalyses dihydroflavonols into flavonols, which presents a key branch of anthocyanins biosynthesis. The yellow flower of Camellia nitidissima Chi. is a unique feature within the genus Camellia, which makes it a precious resource for breeding yellow camellia varieties. In this work, we characterized the secondary metabolites of pigments during floral development of C. nitidissima and revealed that accumulation of flavonols correlates with floral coloration. We first isolated CnFLS1 and showed that it is a FLS of C. nitidissima by gene family analysis. Second, expression analysis during floral development and different floral organs indicated that the expression level of CnFLS1 was regulated by developmental cues, which was in agreement with the accumulating pattern of flavonols. Furthermore, over-expression of CnFLS1 in Nicotiana tabacum altered floral colour into white or light yellow, and metabolic analysis showed significant increasing of flavonols and reducing of anthocyanins in transgenic plants. Our work suggested CnFLS1 plays critical roles in yellow colour pigmentation and is potentially a key point of genetic engineering toward colour modification in Camellia.

  11. Tumor necrosis factor alpha augments nitric oxide-dependent macrophage cytotoxicity against Entamoeba histolytica by enhanced expression of the nitric oxide synthase gene.

    OpenAIRE

    Lin, J. Y.; Seguin, R; K. Keller; Chadee, K

    1994-01-01

    Nitric oxide (NO measured as nitrite, NO2-) is the major effector molecule produced by activated macrophages for in vitro cytotoxicity against Entamoeba histolytica trophozoites. In this study, we determine whether tumor necrosis factor alpha (TNF-alpha) produced by activated bone marrow-derived macrophages (BMM) is involved in the induction of the inducible NO synthase gene (mac-NOS) for NO-dependent amebicidal activity. TNF-alpha alone did not directly induce macrophage NO2- production to k...

  12. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid

    OpenAIRE

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2012-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of...

  13. Cloning, Sequencing, and Functional Analysis of an Iterative Type I Polyketide Synthase Gene Cluster for Biosynthesis of the Antitumor Chlorinated Polyenone Neocarzilin in “Streptomyces carzinostaticus”

    OpenAIRE

    OTSUKA, Miyuki; Ichinose, Koji; Fujii, Isao; Ebizuka, Yutaka

    2004-01-01

    Neocarzilins (NCZs) are antitumor chlorinated polyenones produced by “Streptomyces carzinostaticus” var. F-41. The gene cluster responsible for the biosynthesis of NCZs was cloned and characterized. DNA sequence analysis of a 33-kb region revealed a cluster of 14 open reading frames (ORFs), three of which (ORF4, ORF5, and ORF6) encode type I polyketide synthase (PKS), which consists of four modules. Unusual features of the modular organization is the lack of an obvious acyltransferase domain ...

  14. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    OpenAIRE

    Mary Scruggs; Leigh Hawkins; Rowena Kelley; Peter Ma; Sonya Baird; Paul Williams; Gary Windham; Hamed K. Abbas; Richard Baird

    2008-01-01

    A polymerase chain reaction (PCR) based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme), a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS) gene (FUM1- previously FUM5) responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, ...

  15. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal

    OpenAIRE

    D. Ndiaye; Daily, J. P.; Sarr, O.; Ndir, O.; Gaye, O.; Mboup, S.; Wirth, D F

    2005-01-01

    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in P. falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analyzed from patients...

  16. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    Science.gov (United States)

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  17. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-08-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  18. Small RNA Derived from the Virulence Modulating Region of the Potato spindle tuber viroid Silences callose synthase Genes of Tomato Plants[OPEN

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Brosseau, Chantal; Giguère, Tamara; Sano, Teruo; Moffett, Peter; Perreault, Jean-Pierre

    2015-01-01

    The tomato (Solanum lycopersicum) callose synthase genes CalS11-like and CalS12-like encode proteins that are essential for the formation of callose, a major component of pollen mother cell walls; these enzymes also function in callose formation during pathogen infection. This article describes the targeting of these callose synthase mRNAs by a small RNA derived from the virulence modulating region of two Potato spindle tuber viroid variants. More specifically, viroid infection of tomato plants resulted in the suppression of the target mRNAs up to 1.5-fold, depending on the viroid variant used and the gene targeted. The targeting of these mRNAs by RNA silencing was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Viroid mutants incapable of targeting callose synthase mRNAs failed to induce typical infection phenotypes, whereas a chimeric viroid obtained by swapping the virulence modulating regions of a mild and a severe variant of Potato spindle tuber viroid greatly affected the accumulation of viroids and the severity of disease symptoms. These data provide evidence of the silencing of multiple genes by a single small RNA derived from a viroid. PMID:26290537

  19. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  20. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  1. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases.

    Science.gov (United States)

    Lim, Yan Ping; Go, Maybelle K; Yew, Wen Shan

    2016-01-01

    Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs) using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalcone synthase in plants to novel PKSs in bacteria and fungi. To date, at least 15 families of type III PKSs have been characterized, highlighting the utility of PKSs in the development of natural product libraries for therapeutic development. PMID:27338328

  2. Coincidence of cleavage sites of intron endonuclease I-TevI and critical sequences of the host thymidylate synthase gene.

    Science.gov (United States)

    Edgell, David R; Stanger, Matthew J; Belfort, Marlene

    2004-11-01

    To maximize spread of their host intron or intein, many homing endonucleases recognize nucleotides that code for important and conserved amino acid residues of the target gene. Here, we examine the cleavage requirements for I-TevI, which binds a stretch of thymidylate synthase (TS) DNA that codes for functionally critical residues in the TS active site. Using an in vitro selection scheme, we identified two base-pairs in the I-TevI cleavage site region as important for cleavage efficiency. These were confirmed by comparison of I-TevI cleavage efficiencies on mutant and on wild-type substrates. We also showed that nicking of the bottom strand by I-TevI is not affected by mutation of residues surrounding the bottom-strand cleavage site, unlike other homing endonucleases. One of these two base-pairs is universally conserved in all TS sequences, and is identical with a previously identified cleavage determinant of I-BmoI, a related GIY-YIG endonuclease that binds a homologous stretch of TS-encoding DNA. The other base-pair is conserved only in a subset of TS genes that includes the I-TevI, but not the I-BmoI, target sequence. Both the I-TevI and I-BmoI cleavage site requirements correspond to functionally critical residues involved in an extensive hydrogen bond network within the TS active site. Remarkably, these cleavage requirements correlate with TS phylogeny in bacteria, suggesting that each endonuclease has individually adapted to efficiently cleave distinct TS substrates. PMID:15491609

  3. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  4. The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis.

    Science.gov (United States)

    Meguro, K; Igarashi, K; Yamamoto, M; Fujita, H; Sassa, S

    1995-08-01

    Using antisense technology, the effects of suppressed gene expression of the erythroid-specific delta-aminolevulinate (ALA) synthase (ALAS-E) on heme synthesis, expression of mRNAs encoding an erythroid-specific transcription factor NF-E2, other heme pathway enzymes, and beta-globin were examined in murine erythroleukemia (MEL) cells. In MEL cells in which an antisense ALAS-E RNA was expressed (AS clone), sense ALAS-E mRNA levels in both untreated and dimethylsulfoxide (DMSO)-treated cells were decreased compared with their respective controls. Heme synthesis in AS clones was decreased in proportion to the suppressed levels of ALAS-E mRNA. In addition, mRNAs for ALA dehydratase, porphobilinogen deaminase, ferrochelatase (FeC), and beta-globin were also decreased in AS clones. There was a strong correlation between the level of ALAS-E mRNA and most of the mRNAs of the heme pathway enzymes and beta-globin. There was a decrease in the mRNA level of p45, but not of mafK, which are the large and the small subunits of NF-E2, respectively, in AS clones. Treatment of AS cells with hemin and ALA in the presence of DMSO partially restored the suppressed mRNA levels for beta-globin and FeC and heme content, respectively. These findings thus indicate that heme formation, which is determined by the level of ALAS-E, plays an essential role on gene expression of many proteins necessary for erythroid development. PMID:7620186

  5. Genomic structure and sequence polymorphism of E,E-alphafarnesene synthase gene in apples (Malus domestica Borkh.)

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Primer pairs were designed to amplify the genomic DNA sequence of the alpha-farnesene synthase (AFS) gene by PCR.The PCR products were sequenced,spliced and compared to Cdna sequences in the GenBank (accession No.AY182241).The genomic sequence and intron-exon organization of the AFS gene were thus obtained.The AFS genomic sequence has been registered in the GenBank (accession No.DQ901739).It has 6 introns and 7 exons,encoding a protein of 576 amino acids.The sizes of the 6 introns were 108 bp,113 bp,>1000 bp,125 bp,220 bp and 88 bp,and their phases were 0,1,2,2,0,0,respectively.The sizes of the deduced amino acids of the 7 exons were 57,89,127,73,48,83 and 99,respectively.The AFS protein contained three motifs:the RR(X8)W motif encoded by a sequence in exon 1,and the RxR motif and DDxxD motif encoded by two sequences in exon 4.After comparing the AFS genomic sequence (accession No.DQ901739) to the Cdna sequence (accession No.AY523409) in the GenBank,it was found that there were 6 single-nucleotide polymorphisms between the two sequences,four of which caused mutations at the amino acid level.Interestingly,one amino acid mutation (291R→G) was found in the RxR motif,and further investigation is needed to determine whether the alpha-farnesene synthesis ability and superficial scald susceptibility of apples are influenced by this amino acid mutation and other mutations.

  6. Overexpression of a Potato Sucrose Synthase Gene in Cotton Accelerates Leaf Expansion,Reduces Seed Abortion, and Enhances Fiber Production

    Institute of Scientific and Technical Information of China (English)

    Shou-Min Xu; Elizabeth Brill; Danny J.Llewellyn; Robert T.Furbank; Yong-Ling Ruan

    2012-01-01

    Sucrose synthase (Sus) is a key enzyme in the breakdown of sucrose and is considered a biochemical marker for sink strength,especially in crop species,based on mutational and gene suppression studies.It remains elusive,however,whether,or to what extent,increase in Sus activity may enhance sink development.We aimed to address this question by expressing a potato Sus gene in cotton where Sus expression has been previously shown to be critical for normal seed and fiber development.Segregation analyses at T1 generation followed by studies in homozygous progeny lines revealed that increased Sus activity in cotton (1) enhanced leaf expansion with the effect evident from young leaves emerging from shoot apex; (2) improved early seed development,which reduced seed abortion,hence enhanced seed set,and (3) promoted fiber elongation.In young leaves of Sus overexpressing lines,fructose concentrations were significantly increased whereas,in elongating fibers,both fructose and glucose levels were increased.Since hexoses contribute little to osmolality in leaves,in contrast to developing fibers,it is concluded that high Sus activity promotes leaf development independently of osmotic regulation,probably through sugar signaling.The analyses also showed that doubling the Sus activity in 0-d cotton seeds increased their fresh weight by about 30%.However,further increase in Sus activity did not lead to any further increase in seed weight,indicating an upper limit for the Sus overexpression effect.Finally,based on the observed additive effect on fiber yield from increased fiber length and seed number,a new strategy is proposed to increase cotton fiber yield by improving seed development as a whole,rather than solely focusing on manipulating fiber growth.

  7. Effect of Dexamethasone on Nitric Oxide Synthase and Caspase-3 Gene Expressions in Endotoxemia in Neonate Rat Brain

    Institute of Scientific and Technical Information of China (English)

    HUA WANG; YU-BIN WU; XIU-HUA DU

    2005-01-01

    Objective To investigate the gene and protein expressions of three isoforms of nitric oxide synthase (NOS) and gene expression of Caspase-3, and effect of dexamethasone on them in neonatal rats with lipopolysaccharide (LPS)-induced endotoxemic brain damage. Methods Expressions of the three isoforms of NOS and caspase-3 mRNA in the brain were investigated by RT-PCR in postnatal 7-day wistar rats with acute endotoxemia by intraperitoneal administration of LPS. Regional distributions of NOSs were examined by immunohistochemical technique. Results nNOS and Caspase-3 mRNA were obviously detected. eNOS mRNA was faintly expressed, but iNOS mRNA was undetectable in the control rat brain. The expressions of NOS mRNA of three isoforms were weak 2 h after LPS (5 mg/mg) delivery, peaked at 6 h, and thereafter, reduced gradually up to 24 h. The expression intensity was in the order of nNOS> iNOS> eNOS. Widespread nNOS, scattered eNOS distribution and negative iNOS were identified in the control rat brain and all isoforms of NOS could be induced by LPS which reached the apex at 24 h in the order of nNOS> iNOS> eNOS as detected by immunostaining. Although Caspase-3 mRNA could be found in all groups, DNA fragmentation was only seen at 6 h and 24 h. The expressions of NOS and Caspase-3 mRNA were inhibited in the rat brain when dexamethasone was administrated. Conclusion LPS-induced NO production induces apoptosis of neurons through mechanism involving the Caspase-3 activation, which may play an important role in the pathogenesis of brain damage during endotoxemia, and neuro-protective effects of dexamethasone may be partially realized by inhibiting the expression of NOS mRNA.

  8. De Novo Sequencing and Analysis of the Safflower Transcriptome to Discover Putative Genes Associated with Safflor Yellow in Carthamus tinctorius L.

    Science.gov (United States)

    Liu, Xiuming; Dong, Yuanyuan; Yao, Na; Zhang, Yu; Wang, Nan; Cui, Xiyan; Li, Xiaowei; Wang, Yanfang; Wang, Fawei; Yang, Jing; Guan, Lili; Du, Linna; Li, Haiyan; Li, Xiaokun

    2015-01-01

    Safflower (Carthamus tinctorius L.), an important traditional Chinese medicine, is cultured widely for its pharmacological effects, but little is known regarding the genes related to the metabolic regulation of the safflower's yellow pigment. To investigate genes related to safflor yellow biosynthesis, 454 pyrosequencing of flower RNA at different developmental stages was performed, generating large databases.In this study, we analyzed 454 sequencing data from different flowering stages in safflower. In total, 1,151,324 raw reads and 1,140,594 clean reads were produced, which were assembled into 51,591 unigenes with an average length of 679 bp and a maximum length of 5109 bp. Among the unigenes, 40,139 were in the early group, 39,768 were obtained from the full group and 28,316 were detected in both samples. With the threshold of "log2 ratio ≥ 1", there were 34,464 differentially expressed genes, of which 18,043 were up-regulated and 16,421 were down-regulated in the early flower library. Based on the annotations of the unigenes, 281 pathways were predicted. We selected 12 putative genes and analyzed their expression levels using quantitative real time-PCR. The results were consistent with the 454 sequencing results. In addition, the expression of chalcone synthase, chalcone isomerase and anthocyanidin synthase, which are involved in safflor yellow biosynthesis and safflower yellow pigment (SYP) content, were analyzed in different flowering periods, indicating that their expression levels were related to SYP synthesis. Moreover, to further confirm the results of the 454 pyrosequencing, full-length cDNA of chalcone isomerase (CHI) and anthocyanidin synthase (ANS) were cloned from safflower petal by RACE (Rapid-amplification of cDNA ends) method according to fragment of the transcriptome. PMID:26516840

  9. De Novo Sequencing and Analysis of the Safflower Transcriptome to Discover Putative Genes Associated with Safflor Yellow in Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Xiuming Liu

    2015-10-01

    Full Text Available Safflower (Carthamus tinctorius L., an important traditional Chinese medicine, is cultured widely for its pharmacological effects, but little is known regarding the genes related to the metabolic regulation of the safflower’s yellow pigment. To investigate genes related to safflor yellow biosynthesis, 454 pyrosequencing of flower RNA at different developmental stages was performed, generating large databases.In this study, we analyzed 454 sequencing data from different flowering stages in safflower. In total, 1,151,324 raw reads and 1,140,594 clean reads were produced, which were assembled into 51,591 unigenes with an average length of 679 bp and a maximum length of 5109 bp. Among the unigenes, 40,139 were in the early group, 39,768 were obtained from the full group and 28,316 were detected in both samples. With the threshold of “log2 ratio ≥ 1”, there were 34,464 differentially expressed genes, of which 18,043 were up-regulated and 16,421 were down-regulated in the early flower library. Based on the annotations of the unigenes, 281 pathways were predicted. We selected 12 putative genes and analyzed their expression levels using quantitative real time-PCR. The results were consistent with the 454 sequencing results. In addition, the expression of chalcone synthase, chalcone isomerase and anthocyanidin synthase, which are involved in safflor yellow biosynthesis and safflower yellow pigment (SYP content, were analyzed in different flowering periods, indicating that their expression levels were related to SYP synthesis. Moreover, to further confirm the results of the 454 pyrosequencing, full-length cDNA of chalcone isomerase (CHI and anthocyanidin synthase (ANS were cloned from safflower petal by RACE (Rapid-amplification of cDNA ends method according to fragment of the transcriptome.

  10. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    OpenAIRE

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of...

  11. A novel 3-base deletion (IVS3+2_4delTGG of the hydroxymethylbilane synthase gene in a Brazilian patient with acute intermittent porphyria

    Directory of Open Access Journals (Sweden)

    Georgina Severo Ribeiro

    2007-01-01

    Full Text Available Acute intermittent porphyria (AIP, OMIM 176000 is an autosomal dominant metabolic disease caused by mutations in the gene encoding hydroxymethylbilane synthase (HMBS; EC 4.3.1.8; formely named porphobilinogen deaminase, PBGD, mapped to chromosome 11q23.3. We describe a novel mutation of the HMBS gene, a de novo 3-base deletion in the splicing donor site of intron 3 (IVS3+2_4delTGG in a woman affected by AIP. RT-PCR analysis revealed an abnormal HMBS mRNA, compatible with exon 3 skipping.

  12. An intron in the thymidylate synthase gene of Bacillus bacteriophage beta 22: evidence for independent evolution of a gene, its group I intron, and the intron open reading frame.

    Science.gov (United States)

    Bechhofer, D H; Hue, K K; Shub, D A

    1994-11-22

    The thymidylate synthase gene (thy) (EC 2.1.1.45) of Bacillus subtilis bacteriophage beta 22 has a self-splicing, group I intron inserted into a highly conserved region of the coding sequence. The intron is very similar to one that is inserted 21 bp further downstream in the homologous thymidylate synthase gene (td) of Escherichia coli bacteriophage T4. In contrast, the amino acid sequences of the bacteriophage thymidylate synthases are highly divergent. The beta 22 intron has a fragmentary open reading frame (ORF) that encodes a putative helix-turn-helix DNA-binding motif, similar to one at the carboxyl terminus of the homing endonuclease (I-TevI) encoded by the T4 td intron. The td ORF and the thy ORF fragments are inserted into different regions of their respective intron structures. These results suggest that the thymidylate synthase genes, their introns, and their respective intron-ORFs all have separate evolutionary histories and that the acquisition of the intron could not have occurred by a simple homing event. PMID:7972121

  13. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    Directory of Open Access Journals (Sweden)

    Rizk El-Baz(1; Azza Ismail(2 ; Maher Amer(2; Mai Elshahat(3; Amira Kazamel(2; Ahmad Settin

    2012-10-01

    Full Text Available Background: Enzymes of the Glutathione S-transferase system (GST modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR is a crucial mediator for the cellular effects of vitamin D and additionally interacts with other cell-signaling pathways that influence cancer development. Objectives: To check for the association of polymorphisms of GST, eNOS3 and VDR genes with the susceptibility and severity of breast cancer in Egyptian cases. Subjects: This work included 100 cases with breast cancer and 100 healthy individuals. The mean age of cases was 48.31±11.40 years. They included 100 females.Methods: DNA was amplified using PCR-RFLP for detection of polymorphisms related to eNOS3 and VDR , also DNA was amplified using PCR-SSP for detection of polymorphisms related to GST and calculating the odds ratios and their 95% confidence intervals.Results: Total cases showed high significant frequency of eNOS3-786 CC (P<0.05, OR=18.58 genotypes, GSTT1(null (OR = 2.68; CI 95%=1.51-4.75; p=0.001. These were considered risk genotypes for disease susceptibility. On the other hand, total cases showed low significant frequency with homozygosity for eNOS3-786 TT (P=0.01 and the GSTT1 gene was present in 42.0% of the cancers and in 66.0% of controls (OR = 0.37; CI 95%= 0.21-0.66; p=0.001. These may be considered low risk genotypes. No significant difference in frequencies of null and present genotypes of GSTM1 and VDR FOKI in total cases compared to controls. Conclusions: Polymorphisms related to eNOS3-786, GSTT1 and VDR FOKI genes may be considered genetic markers for BC among Egyptian cases. This may have potential impact on family counselling as well as future management plans.

  14. Down regulation of ethylene biosynthesis in apples. Cloning and sequencing of the partial ACC synthase gene in the McIntosh cultivar

    International Nuclear Information System (INIS)

    Ethylene is a plant hormone that regulates many aspects of plant growth, development and senescence. 1-aminocyclopropane-1-carboxylate (ACC) synthase has been identified as the key enzyme in the biosynthesis of ethylene. Down regulation of ethylene biosynthesis via transformation with the antisense ACC synthase gene (as has already been proved with tomato) might lengthen the storability of apple. To produce the antisense gene of the apple, RNA was isolated from the McIntosh cultivar and the cDNA synthesized. The cDNA template was amplified by polymerase chain reaction (PCR) using ACC specific primers that have been found to be highly conserved in several plant species. PCR resulted in a 1.1 kb DNA band, which was cloned and sequenced. Sequenced analysis of the McIntosh clones (K1, G1, G2, G3, G4) showed a similarity of 63.5-71.6% with the apple ACC synthase known so far and found comparable homology with the ACC syntheses of other plant species in the databank. 8 refs, 2 tabs

  15. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    Science.gov (United States)

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  16. Nitric oxide synthase inhibitors can antagonize neurogenic and calcitonin gene-related peptide induced dilation of dural meningeal vessels

    Science.gov (United States)

    Akerman, S; Williamson, D J; Kaube, H; Goadsby, P J

    2002-01-01

    The detailed pathophysiology of migraine is beginning to be understood and is likely to involve activation of trigeminovascular afferents. Clinically effective anti-migraine compounds are believed to have actions that include peripheral inhibition of calcitonin gene-related peptide (CGRP) release from trigeminal neurones, or preventing dural vessel dilation, or both. CGRP antagonists can block both neurogenic and CGRP-induced dural vessel dilation. Nitric oxide (NO) can induce headache in migraine patients and often triggers a delayed migraine. The initial headache is thought to be caused via a direct action of the NO–cGMP pathway that causes vasodilation by vascular smooth muscle relaxation, while the delayed headache is likely to be a result of triggering trigeminovascular activation. Nitric oxide synthase (NOS) inhibitors are effective in the treatment of acute migraine. The present studies used intravital microscopy to examine the effects of specific NOS inhibitors on neurogenic dural vasodilation (NDV) and CGRP-induced dilation. The non-specific and neuronal NOS (nNOS) inhibitors were able to partially inhibit NDV, while the non-specific and endothelial NOS (eNOS) inhibitors were able to partially inhibit the CGRP induced dilation. There was no effect of the inducible NOS (iNOS) inhibitor. The data suggest that the delayed headache response triggered by NO donors in humans may be due, in part, to increased nNOS activity in the trigeminal system that causes CGRP release and dural vessel dilation. Further, eNOS activity in the endothelium causes NO production and smooth muscle relaxation by direct activation of the NO–cGMP pathway, and may be involved in the initial headache response. PMID:12183331

  17. In vivo gene transfer of endothelial nitric oxide synthase decreases portal pressure in anaesthetised carbon tetrachloride cirrhotic rats

    Science.gov (United States)

    Van de Casteele, M; Omasta, A; Janssens, S; Roskams, T; Desmet, V; Nevens, F; Fevery, J

    2002-01-01

    Background: Portal hypertension in cirrhosis results from enhanced intrahepatic resistance to an augmented inflow. The former is partly due to an imbalance between intrahepatic vasoconstriction and vasodilatation. Enhanced endothelin-1 and decreased activity of hepatic constitutive endothelial nitric oxide synthase (NOS 3) was reported in carbon tetrachloride (CCl4) cirrhotic rat liver. Aims: To study whether an increase in hepatic NOS 3 could be obtained in the CCl4 cirrhotic rat liver by in vivo cDNA transfer and to investigate a possible effect on portal pressure. Methods: Hepatic NOS 3 immunohistochemistry and western blotting were used to measure the amount of NOS 3 protein. Recombinant adenovirus, carrying cDNA encoding human NOS 3, was injected into the portal vein of CCl4 cirrhotic rats. Cirrhotic controls received carrier buffer, naked adenovirus, or adenovirus carrying the lac Z gene. Results: NOS 3 immunoreactivity and amount of protein (western blotting) were significantly decreased in CCl4 cirrhotic livers. Following cDNA transfer, NOS 3 expression and the amount of protein were partially restored. Portal pressure was 11.4 (1.6) mm Hg in untreated cirrhotic (n=9) and 11.8 (0.6) in lac Z transfected (n=4) cirrhotic rats but was reduced to 7.8 (1.0) mm Hg (n=9) five days after NOS 3 cDNA transfer. No changes were observed in systemic haemodynamics, in liver tests or urinary nitrates, or in NOS 3 expression in lung or kidney, indicating a highly selective transfer. Conclusions: NOS 3 cDNA transfer to cirrhotic rat liver is feasible and the increase in hepatic NOS 3 leads to a marked decrease in portal hypertension without systemic effects. These data indicate a major haemodynamic role of intrahepatic NOS 3 in the pathogenesis of portal hypertension in CCl4 cirrhosis. PMID:12171971

  18. Novel alleles of 31-bp VNTR polymorphism in the human cystathionine -synthase (CBS) gene were detected in healthy Asians

    Indian Academy of Sciences (India)

    Yik-Yuen Gan; Chuan-Fei Chen

    2010-12-01

    A 31-bp variable number of tandem repeats (VNTR) polymorphism of the cystathionine -synthase (CBS) gene was earlier reported in Caucasians of predominantly European descent and Indo–Caucasoid populations.We report here for the first time, the detection of allele 20, which was absent in Caucasian and Indo–Caucasoid populations, as a common allele present in Singaporean Chinese (6.25%), Indians (11.7%), and Malays (11.5%). Hence, allele 20 might be a specific allele for Asian populations. A relatively common allele 19 found in the Caucasian and Indo–Caucasoid populations (10.4%–10.6%) was absent in the Asian samples of this study. Therefore, allele 19 might be a specific allele for the Caucasian populations. A novel and rare allele 13, which was not reported before in the Caucasian and Indo–Caucasoid populations, was found in 0.5% of Singaporean Chinese as genotype 13/17 heterozygotes. The presence of alleles 13 and 20 were verified by DNA sequencing. There were five new genotypes (13/17, 16/20, 17/20, 18/20 and 20/20) not reported before in the Caucasian and Indo–Caucasoid populations, detected in this study. Nine genotypes (15/18, 16/18, 16/21, 17/19, 18/19, 18/21, 19/19, 19/21 and 21/21) which were present in the Caucasian and/or Indo–Caucasoid populations were absent in this study. Our results showed that CBS 31-bp VNTR polymorphism has a distinct genetic difference in allele and genotype frequencies between the European Caucasians, Indo–Caucasoid and Asian populations.

  19. Expression of Biphenyl Synthase Genes and Formation of Phytoalexin Compounds in Three Fire Blight-Infected Pyrus communis Cultivars

    Science.gov (United States)

    Chizzali, Cornelia; Swiddan, Asya K.; Abdelaziz, Sahar; Gaid, Mariam; Richter, Klaus; Fischer, Thilo C.; Liu, Benye; Beerhues, Ludger

    2016-01-01

    Pear (Pyrus communis) is an economically important fruit crop. Drops in yield and even losses of whole plantations are caused by diseases, most importantly fire blight which is triggered by the bacterial pathogen Erwinia amylovora. In response to the infection, biphenyls and dibenzofurans are formed as phytoalexins, biosynthesis of which is initiated by biphenyl synthase (BIS). Two PcBIS transcripts were cloned from fire blight-infected leaves and the encoded enzymes were characterized regarding substrate specificities and kinetic parameters. Expression of PcBIS1 and PcBIS2 was studied in three pear cultivars after inoculation with E. amylovora. Both PcBIS1 and PcBIS2 were expressed in ‘Harrow Sweet’, while only PcBIS2 transcripts were detected in ‘Alexander Lucas’ and ‘Conference’. Expression of the PcBIS genes was observed in both leaves and the transition zone of the stem; however, biphenyls and dibenzofurans were only detected in stems. The maximum phytoalexin level (~110 μg/g dry weight) was observed in the transition zone of ‘Harrow Sweet’, whereas the concentrations were ten times lower in ‘Conference’ and not even detectable in ‘Alexander Lucas’. In ‘Harrow Sweet’, the accumulation of the maximum phytoalexin level correlated with the halt of migration of the transition zone, whereby the residual part of the shoot survived. In contrast, the transition zones of ‘Alexander Lucas’ and ‘Conference’ advanced down to the rootstock, resulting in necrosis of the entire shoots. PMID:27410389

  20. Tetrahydrodipicolinate N-succinyltransferase and dihydrodipicolinate synthase from Pseudomonas aeruginosa: structure analysis and gene deletion.

    Directory of Open Access Journals (Sweden)

    Robert Schnell

    Full Text Available The diaminopimelic acid pathway of lysine biosynthesis has been suggested to provide attractive targets for the development of novel antibacterial drugs. Here we report the characterization of two enzymes from this pathway in the human pathogen Pseudomonas aeruginosa, utilizing structural biology, biochemistry and genetics. We show that tetrahydrodipicolinate N-succinyltransferase (DapD from P. aeruginosa is specific for the L-stereoisomer of the amino substrate L-2-aminopimelate, and its D-enantiomer acts as a weak inhibitor. The crystal structures of this enzyme with L-2-aminopimelate and D-2-aminopimelate, respectively, reveal that both compounds bind at the same site of the enzyme. Comparison of the binding interactions of these ligands in the enzyme active site suggests misalignment of the amino group of D-2-aminopimelate for nucleophilic attack on the succinate moiety of the co-substrate succinyl-CoA as the structural basis of specificity and inhibition. P. aeruginosa mutants where the dapA gene had been deleted were viable and able to grow in a mouse lung infection model, suggesting that DapA is not an optimal target for drug development against this organism. Structure-based sequence alignments, based on the DapA crystal structure determined to 1.6 Å resolution revealed the presence of two homologues, PA0223 and PA4188, in P. aeruginosa that could substitute for DapA in the P. aeruginosa PAO1ΔdapA mutant. In vitro experiments using recombinant PA0223 protein could however not detect any DapA activity.

  1. Chalcone derivatives as potential antifungal agents: Synthesis, and antifungal activity

    OpenAIRE

    Deepa Gupta; Jain, D. K.

    2015-01-01

    Much research has been carried out with the aim to discover the therapeutic values of chalcone derivatives. Chalcones possess wide range of pharmacological activity such as antibacterial, antimalarial, antiprotozoal, antitubercular, anticancer, and antifungal agents etc. The presence of reactive α,β-unsaturated keto group in chalcones is found to be responsible for their biological activity. The rapid developments of resistance to antifungal agents, led to design, and synthesize the new antif...

  2. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  3. Plant defense genes are regulated by ethylene

    International Nuclear Information System (INIS)

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase [4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12], enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes

  4. Plant defense genes are regulated by ethylene

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  5. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase

    Science.gov (United States)

    Sellem, Carole H.; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H.; Sainsard-Chanet, Annie

    2016-01-01

    Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8–15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before. PMID:27442014

  6. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    Science.gov (United States)

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  7. CHALCONE AS A VERSATILE MOIETY FOR DIVERSE PHARMACOLOGICAL ACTIVITIES

    Directory of Open Access Journals (Sweden)

    Hatish Prashar*, Anshul Chawla, Anil Kumar Sharma and Rajeev Kharb

    2012-07-01

    Full Text Available Chalcones are 1, 3-diphenyl-2-propene-1-one, consist of two aromatic rings linked by a three carbon α, β-unsaturated carbonyl system. The chemistry of chalcones has generated intensive scientific studies throughout the world. Especially interest has been focused on the synthesis and biodynamic activities of chalcones. These are considered to be precursors of flavonoids and isoflavonoids. The aim of this review is to summarize chalcones and their diverse pharmacological activities like anticancer, antimicrobial, analgesic and antiviral activities etc.

  8. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C; Pedersen, O

    1995-01-01

    treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well as...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...... activator glucose 6-phosphate (p=0.01). However, despite significant increases in both insulin-stimulated non-oxidative glucose metabolism and muscle glycogen synthase activation in gliclazide-treated patients no changes were found in levels of glycogen synthase mRNA or immunoreactive protein in muscle. In...

  9. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  10. Differential accumulation of plant defense gene transcripts in a compatible and an incompatible plant-pathogen interaction.

    OpenAIRE

    Bell, J N; Ryder, T B; Wingate, V P; Bailey, J.A.; Lamb, C. J.

    1986-01-01

    Phenylalanine ammonia-lyase and chalcone synthase catalyze the first reaction of phenylpropanoid biosynthesis and the first reaction of a branch pathway specific for flavonoid-isoflavonoid biosynthesis, respectively. These enzymes are key control elements in the synthesis of kievitone, phaseollin, and related isoflavonoid-derived phytoalexins. RNA blot hybridization with 32P-labeled cDNA sequences was used to demonstrate marked accumulation of phenylalanine ammonia-lyase and chalcone synthase...

  11. Role of nuclear factor-κB and heme oxygenase-1 in the mechanism of action of an anti-inflammatory chalcone derivative in RAW 264.7 cells

    OpenAIRE

    Alcaraz, María José; Vicente, Ana María; Araico, Amparo; Dominguez, José N; Terencio, María Carmen; Ferrándiz, María Luisa

    2004-01-01

    The synthetic chalcone 3′,4′,5′,3,4,5-hexamethoxy-chalcone (CH) is an anti-inflammatory compound able to reduce nitric oxide (NO) production by inhibition of inducible NO synthase protein synthesis. In this work, we have studied the mechanisms of action of this compound.CH (10–30 μM) prevents the overproduction of NO in RAW 264.7 macrophages stimulated with lipopolysaccharide (1 μg ml−1) due to the inhibition of nuclear factor κB (NF-κB) activation.We have shown that treatment of cells with C...

  12. Five new prenylated chalcones from Desmodium renifolium.

    Science.gov (United States)

    Li, Yan-Ping; Yang, Yu-Chun; Li, Yin-Ke; Jiang, Zhi-Yong; Huang, Xiang-Zhong; Wang, Wei-Guang; Gao, Xue-Mei; Hu, Qiu-Fen

    2014-06-01

    Five unusual new prenylated chalcones, renifolins D-H (1-5), were isolated from whole Desmodium renifolium plants. All of their structures were determined by spectroscopic methods including 1D and 2D NMR. All of the isolates were evaluated for cytotoxicity using five tumor cell lines. Compounds 2 and 3 exhibited cytotoxicity against A549 cells, with IC50 values of 2.8 and 2.2 μM, respectively. PMID:24704553

  13. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    OpenAIRE

    Hiroshi Ishida; Radharaman Ray; Jack Amnuaysirikul; Keiko Ishida; Prabhati Ray

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of N...

  14. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  15. Modification of a viral satellite DNA-based gene silencing vector and its application to leaf or flower color change in Petunia hybrida

    Institute of Scientific and Technical Information of China (English)

    TAO Xiaorong; QIAN Yajuan; ZHOU Xueping

    2006-01-01

    Virus-induced gene silencing offers a powerful reverse-genetic tool for the study of gene function in plants. We have previously reported effective gene silencing of plant genes using a viral satellite DNA associated with Tomato yellow leaf curl China virus (TYLCCNV). In this study, we further modified the viral satellite DNA-based vector. The modified vector can induce sulfu (Su) gene silencing as effective as the original vector in Nicotiana benthamiana plants, but the new system simplifies procedures for construction of vector derivative. Furthermore, a fragment of petunia Su or chalcone synthase (CHS) endogenous gene was inserted into the modified vector. When petunia plants were agro- inoculated with the modified vector carrying a Su or CHS gene, the Su silenced plants started to appear yellowing in veins of systemically infected upper leaves two weeks after agroinoculation, while the CHS silenced plants started to show flower color change one month after agroinoculation and later single-color flowers became mosaic.

  16. Accumulation of Kaempferitrin and Expression of Phenyl-Propanoid Biosynthetic Genes in Kenaf (Hibiscus cannabinus

    Directory of Open Access Journals (Sweden)

    Shicheng Zhao

    2014-10-01

    Full Text Available Kenaf (Hibiscus cannabinus is cultivated worldwide for its fiber; however, the medicinal properties of this plant are currently attracting increasing attention. In this study, we investigated the expression levels of genes involved in the biosynthesis of kaempferitrin, a compound with many biological functions, in different kenaf organs. We found that phenylalanine ammonia lyase (HcPAL was more highly expressed in stems than in other organs. Expression levels of cinnamate 4-hydroxylase (HcC4H and 4-coumarate-CoA ligase (Hc4CL were highest in mature leaves, followed by stems and young leaves, and lowest in roots and mature flowers. The expression of chalcone synthase (HcCHS, chalcone isomerase (HcCHI, and flavone 3-hydroxylase (HcF3H was highest in young flowers, whereas that of flavone synthase (HcFLS was highest in leaves. An analysis of kaempferitrin accumulation in the different organs of kenaf revealed that the accumulation of this compound was considerably higher (>10-fold in leaves than in other organs. On the basis of a comparison of kaempferitrin contents with the expression levels of different genes in different organs, we speculate that HcFLS plays an important regulatory role in the kaempferitrin biosynthetic pathway in kenaf.

  17. Chalcone derivatives as potential antifungal agents: Synthesis, and antifungal activity

    Directory of Open Access Journals (Sweden)

    Deepa Gupta

    2015-01-01

    Full Text Available Much research has been carried out with the aim to discover the therapeutic values of chalcone derivatives. Chalcones possess wide range of pharmacological activity such as antibacterial, antimalarial, antiprotozoal, antitubercular, anticancer, and antifungal agents etc. The presence of reactive α,β-unsaturated keto group in chalcones is found to be responsible for their biological activity. The rapid developments of resistance to antifungal agents, led to design, and synthesize the new antifungal agents. The derivatives of chalcones were prepared using Claisen-Schmidt condensation scheme with appropriate tetralone and aldehyde derivatives. Ten derivatives were synthesized and were biologically screened for antifungal activity. The newly synthesized derivatives of chalcone showed antifungal activity against fungal species, Microsporum gypseum. The results so obtained were superior or comparable to ketoconazole. It was observed that none of the compounds tested showed positive results for fungi Candida albicans nor against fungi Aspergillus niger. Chalcone derivatives showed inhibitory effect against M. gypseum species of fungus. It was found that among the chalcone derivatives so synthesized, two of them, that is, 4-chloro derivative, and unsubstituted derivative of chalcone showed antifungal activity superior to ketoconazole. Thus, these can be the potential new molecule as antifungal agent.

  18. Chalcone derivatives as potential antifungal agents: Synthesis, and antifungal activity.

    Science.gov (United States)

    Gupta, Deepa; Jain, D K

    2015-01-01

    Much research has been carried out with the aim to discover the therapeutic values of chalcone derivatives. Chalcones possess wide range of pharmacological activity such as antibacterial, antimalarial, antiprotozoal, antitubercular, anticancer, and antifungal agents etc. The presence of reactive α,β-unsaturated keto group in chalcones is found to be responsible for their biological activity. The rapid developments of resistance to antifungal agents, led to design, and synthesize the new antifungal agents. The derivatives of chalcones were prepared using Claisen-Schmidt condensation scheme with appropriate tetralone and aldehyde derivatives. Ten derivatives were synthesized and were biologically screened for antifungal activity. The newly synthesized derivatives of chalcone showed antifungal activity against fungal species, Microsporum gypseum. The results so obtained were superior or comparable to ketoconazole. It was observed that none of the compounds tested showed positive results for fungi Candida albicans nor against fungi Aspergillus niger. Chalcone derivatives showed inhibitory effect against M. gypseum species of fungus. It was found that among the chalcone derivatives so synthesized, two of them, that is, 4-chloro derivative, and unsubstituted derivative of chalcone showed antifungal activity superior to ketoconazole. Thus, these can be the potential new molecule as antifungal agent. PMID:26317075

  19. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid.

    Science.gov (United States)

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2013-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of cellulose in higher plants. The hybrid Acacia auriculiformis x Acacia mangium represents an important source of tree cellulose for forest-based product manufacturing, with enormous economic potential. In this work, we isolate the first cellulose synthase gene, designated AaxmCesA1, from this species. The isolated full-length AaxmCesA1 cDNA encodes a polypeptide of 1,064 amino acids. Sequence analyses revealed that AaxmCesA1 cDNA possesses the key motif characteristics of a CesA protein. AaxmCesA1 shares more than 75 % amino acid sequence identity with CesA proteins from other plant species. Subsequently, the full-length AaxmCesA1 gene of 7,389 bp with partial regulatory and 13 intron regions was also isolated. Relative gene expression analysis by quantitative PCR in different tissues of the Acacia hybrid, suggests the involvement of the AaxmCesA1 gene in primary cell wall synthesis of rapidly dividing young root cells. Similarity analyses using Blast algorithms also suggests a role in primary cell wall deposition in the Acacia hybrid. Southern analysis predicts that AaxmCesA1 is a member of a multigene family with at least two isoforms in the genome of the Acacia hybrid. PMID:24415841

  20. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  1. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  2. Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiple genome-wide duplication events.

    Science.gov (United States)

    Cheng, Jun; Khan, Muhammad Awais; Qiu, Wen-Ming; Li, Jing; Zhou, Hui; Zhang, Qiong; Guo, Wenwu; Zhu, Tingting; Peng, Junhua; Sun, Fengjie; Li, Shaohua; Korban, Schuyler S; Han, Yuepeng

    2012-01-01

    Starch is one of the major components of cereals, tubers, and fruits. Genes encoding granule-bound starch synthase (GBSS), which is responsible for amylose synthesis, have been extensively studied in cereals but little is known about them in fruits. Due to their low copy gene number, GBSS genes have been used to study plant phylogenetic and evolutionary relationships. In this study, GBSS genes have been isolated and characterized in three fruit trees, including apple, peach, and orange. Moreover, a comprehensive evolutionary study of GBSS genes has also been conducted between both monocots and eudicots. Results have revealed that genomic structures of GBSS genes in plants are conserved, suggesting they all have evolved from a common ancestor. In addition, the GBSS gene in an ancestral angiosperm must have undergone genome duplication ∼251 million years ago (MYA) to generate two families, GBSSI and GBSSII. Both GBSSI and GBSSII are found in monocots; however, GBSSI is absent in eudicots. The ancestral GBSSII must have undergone further divergence when monocots and eudicots split ∼165 MYA. This is consistent with expression profiles of GBSS genes, wherein these profiles are more similar to those of GBSSII in eudicots than to those of GBSSI genes in monocots. In dicots, GBSSII must have undergone further divergence when rosids and asterids split from each other ∼126 MYA. Taken together, these findings suggest that it is GBSSII rather than GBSSI of monocots that have orthologous relationships with GBSS genes of eudicots. Moreover, diversification of GBSS genes is mainly associated with genome-wide duplication events throughout the evolutionary course of history of monocots and eudicots. PMID:22291904

  3. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    Science.gov (United States)

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  4. Cloning and enzymology analysis of farnesyl pyrophosphate synthase gene from a superior strain of Artemisia annua L

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A cDNA(af1) encoding farnesyl pyrophosphate synthase AaFPS1 (FPS, EC2.5.1.1/EC2.5.1.10) from a high yield Artemisia annua strain 025 has been cloned from its cDNA library. Sequence analysis showed that the cDNA encoded a protein of 343 amino acid (aa) residues with molecular weight of 39 kD. Deduced aa sequence of the cDNA was similar to FPS from other plants, yeast and mammals, containing 5 conserved domains found in both prenyl transferase and polyprenyl synthase. The expression of the cDNA in Escherichia coli showed measurable specific activity of FPS in vitro. The enzyme was purified by ion exchange chromatography and its kinetics was measured. These results would further promote the molecular regulation of artemisinin biosynthesis.

  5. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439. ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant ostatní: Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.058, year: 2010

  6. Molecular characterization of glutathione S-transferase, endothelial nitric oxide synthase and Vitamin D receptor genes in breast cancer cases

    OpenAIRE

    Rizk El-Baz(1); Azza Ismail(2) ; Maher Amer(2); Mai Elshahat(3); Amira Kazamel(2); Ahmad Settin

    2012-01-01

    Background: Enzymes of the Glutathione S-transferase system (GST) modulate the effects of exposure to several cytotoxic and genotoxic agents. Nitric oxide (NO) is constitutively synthesized in the endothelium by endothelial nitric oxide synthase (eNOS) and acts as a pleiotropic regulator involved in carcinogenesis. Vitamin D levels may influence breast cancer development. The vitamin D receptor (VDR) is a crucial mediator for the cellular effects of vitamin D and additionally interacts with o...

  7. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)

    OpenAIRE

    Dullat Harpreet K; Hamberger Britta; Jancsik Sharon; Ralph Steven G; Weisshaar Sabrina; Keeling Christopher I; Bohlmann Jörg

    2011-01-01

    Abstract Background In conifers, terpene synthases (TPSs) of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs) and full-length cDNAs in sev...

  8. Multiple phenotypic changes in mice after knockout of the B3gnt5 gene, encoding Lc3 synthase--a key enzyme in lacto-neolacto ganglioside synthesis

    Directory of Open Access Journals (Sweden)

    McLendon Roger E

    2010-11-01

    Full Text Available Abstract Background Ganglioside biosynthesis occurs through a multi-enzymatic pathway which at the lactosylceramide step is branched into several biosynthetic series. Lc3 synthase utilizes a variety of galactose-terminated glycolipids as acceptors by establishing a glycosidic bond in the beta-1,3-linkage to GlcNaAc to extend the lacto- and neolacto-series gangliosides. In order to examine the lacto-series ganglioside functions in mice, we used gene knockout technology to generate Lc3 synthase gene B3gnt5-deficient mice by two different strategies and compared the phenotypes of the two null mouse groups with each other and with their wild-type counterparts. Results B3gnt5 gene knockout mutant mice appeared normal in the embryonic stage and, if they survived delivery, remained normal during early life. However, about 9% developed early-stage growth retardation, 11% died postnatally in less than 2 months, and adults tended to die in 5-15 months, demonstrating splenomegaly and notably enlarged lymph nodes. Without lacto-neolacto series gangliosides, both homozygous and heterozygous mice gradually displayed fur loss or obesity, and breeding mice demonstrated reproductive defects. Furthermore, B3gnt5 gene knockout disrupted the functional integrity of B cells, as manifested by a decrease in B-cell numbers in the spleen, germinal center disappearance, and less efficiency to proliferate in hybridoma fusion. Conclusions These novel results demonstrate unequivocally that lacto-neolacto series gangliosides are essential to multiple physiological functions, especially the control of reproductive output, and spleen B-cell abnormality. We also report the generation of anti-IgG response against the lacto-series gangliosides 3'-isoLM1 and 3',6'-isoLD1.

  9. The barley genome sequence assembly reveals three additional members of the CslF (1,3;1,4-β-glucan synthase gene family.

    Directory of Open Access Journals (Sweden)

    Miriam Schreiber

    Full Text Available An important component of barley cell walls, particularly in the endosperm, is (1,3;1,4-β-glucan, a polymer that has proven health benefits in humans and that influences processability in the brewing industry. Genes of the cellulose synthase-like (Csl F gene family have been shown to be involved in (1,3;1,4-β-glucan synthesis but many aspects of the biosynthesis are still unclear. Examination of the sequence assembly of the barley genome has revealed the presence of an additional three HvCslF genes (HvCslF11, HvCslF12 and HvCslF13 which may be involved in (1,3;1,4-β-glucan synthesis. Transcripts of HvCslF11 and HvCslF12 mRNA were found in roots and young leaves, respectively. Transient expression of these genes in Nicotiana benthamiana resulted in phenotypic changes in the infiltrated leaves, although no authentic (1,3;1,4-β-glucan was detected. Comparisons of the CslF gene families in cereals revealed evidence of intergenic recombination, gene duplications and translocation events. This significant divergence within the gene family might be related to multiple functions of (1,3;1,4-β-glucans in the Poaceae. Emerging genomic and global expression data for barley and other cereals is a powerful resource for characterising the evolution and dynamics of complete gene families. In the case of the CslF gene family, the results will contribute to a more thorough understanding of carbohydrate metabolism in grass cell walls.

  10. Effects of a subconvulsive dose of kainic acid on the gene expressions of the arginine vasopressin, oxytocin and neuronal nitric oxide synthase in the rat hypothalamus.

    Science.gov (United States)

    Yoshimura, Mitsuhiro; Ohkubo, Jun-ichi; Hashimoto, Hirofumi; Matsuura, Takanori; Maruyama, Takashi; Onaka, Tatsushi; Suzuki, Hideaki; Ueta, Yoichi

    2015-10-01

    Arginine vasopressin (AVP) synthesis in the hypothalamo-neurohypophysial system (HNS) is up-regulated by kainic acid (KA)-induced seizure in rats. However, it remains unknown whether a subconvulsive dose of KA affects the HNS. Here we examined the effects of subcutaneous (s.c.) administration of a low dose of KA (4 mg/kg) on the gene expressions of the AVP, oxytocin (OXT) and neuronal nitric oxide synthase (nNOS) in the supraoptic (SON) and paraventricular nuclei (PVN) of the rat hypothalamus, using in situ hybridization histochemistry. The expression of the AVP gene in the SON and PVN was judged to be up-regulated in KA-treated rats in comparison with saline-treated rats as controls. Next, the expression of the OXT gene was significantly increased in the SON at 6-24h and in the PVN at 6 and 12h after s.c. administration of KA. Finally, the expression of the nNOS gene was significantly increased in the SON and PVN at 3 and 6h after s.c. administration of KA. These results suggest that up-regulation of the gene expressions of the AVP, OXT and nNOS in the rat hypothalamus may be differentially affected by peripheral administration of a subconvulsive dose of KA. PMID:26003742

  11. An antileishmanial chalcone from Chinese licorice roots

    DEFF Research Database (Denmark)

    Christensen, S B; Ming, C; Andersen, L;

    1994-01-01

    A bioassay guided fractionation of an extract of Chinese licorice roots led to the isolation of (E)-1-[2,4-dihydroxy-3-(3-methyl-2-butenyl)phenyl]-3-[4- hydroxy-3-(3-methyl-2-butenyl]phenyl-2-propen-1-one, which in vitro showed potent antileishmanial activity. In addition, the novel chalcone (E)-1......-[2,4-dihydroxy-3-(3-methyl-2- butenyl)phenyl]-3-(2,2-dimethyl-8-hydroxy-2H-benzopyran-6-yl)-2-prope n-1-one was isolated from the roots. The latter compound only showed antileishmanial activity at high concentrations....

  12. ANTIMICROBIAL SCREENING OF SOME NOVEL SUBSTITUTED CHALCONE DERIVATIVES

    Directory of Open Access Journals (Sweden)

    Ramesh Dhani

    2012-10-01

    Full Text Available Chalcone is an aromatic ketone that forms the central core for the variety of important biological compounds, which are collectively known as chalcones. The derivatives of chalcones with an annular nitrogen atom in the phenyl ring were reported to have a wide range of biologically activities, such as antibacterial, anti-tuberculostatic and anti- inflammatory. The chalcones, two aromatic rings are linked by an aliphatic three carbon chain which bears a very good synthon so that variety of novel heterocyclics with good pharmaceutical profile can be designed. Chalcones have been considered as a magic moiety possessing myriad spectrum of medicinal activities. Diversity of biological response profile has attracted considerable interest of several researchers across the globe to explore this skeleton for its assorted therapeutic significance. The synthesized chalcone derivatives were screened for antimicrobial activity by comparing with the standard drug of ciprofloxacin on two gram positive and two gram negative strains, the synthesized compounds, by using Disc-diffusion method. Chalcone is a lead nucleus for future developments to get effective compounds.

  13. Starch phosphorylation in potato tubers is influenced by allelic variation in the genes encoding glucan water dikinase, starch branching enzymes I and II, and starch synthase III

    Directory of Open Access Journals (Sweden)

    Margaret Ann Carpenter

    2015-03-01

    Full Text Available Starch phosphorylation is an important aspect of plant metabolism due to its role in starch degradation. Moreover, the degree of phosphorylation of starch determines its physicochemical properties and is therefore relevant for industrial uses of starch. Currently, starch is chemically phosphorylated to increase viscosity and paste stability. Potato cultivars with elevated starch phosphorylation would make this process unnecessary, thereby bestowing economic and environmental benefits. Starch phosphorylation is a complex trait which has been previously shown by antisense gene repression to be influenced by a number of genes including those involved in starch synthesis and degradation. We have used an association mapping approach to discover genetic markers associated with the degree of starch phosphorylation. A diverse collection of 193 potato lines was grown in replicated field trials, and the levels of starch phosphorylation at the C6 and C3 positions of the glucosyl residues were determined by mass spectrometry of hydrolyzed starch from tubers. In addition, the potato lines were genotyped by amplicon sequencing and microsatellite analysis, focusing on candidate genes known to be involved in starch synthesis. As potato is an autotetraploid, genotyping included determination of allele dosage. Significant associations (p<0.001 were found with SNPs in the glucan water dikinase (GWD, starch branching enzyme I (SBEI and the starch synthase III (SSIII genes, and with a SSR allele in the SBEII gene. SNPs in the GWD gene were associated with C6 phosphorylation, whereas polymorphisms in the SBEI and SBEII genes were associated with both C6 and C3 phosphorylation and the SNP in the SSIII gene was associated with C3 phosphorylation. These allelic variants have potential as genetic markers for starch phosphorylation in potato.

  14. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae

    Directory of Open Access Journals (Sweden)

    Wen-Kai Xia

    2014-02-01

    Full Text Available Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor, which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult. When larvae were exposed to diflubenzuron (DFB for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB.

  15. Exposure to diflubenzuron results in an up-regulation of a chitin synthase 1 gene in citrus red mite, Panonychus citri (Acari: Tetranychidae).

    Science.gov (United States)

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  16. Metabolic Engineering of Plant-derived (E)-β-farnesene Synthase Genes for a Novel Type of Aphid-resistant Genetically Modified Crop Plants

    Institute of Scientific and Technical Information of China (English)

    Xiu-Dao Yu; John Pickett; You-Zhi Ma; Toby Bruce; Johnathan Napier; Huw D.Jones; Lan-Qin Xia

    2012-01-01

    Aphids are major agricultural pests that cause significant yield losses of crop plants each year.Excessive dependence on insecticides for long-term aphid control is undesirable because of the development of insecticide resistance,the potential negative effects on non-target organisms and environmental pollution.Transgenic crops engineered for resistance to aphids via a non-toxic mode of action could be an efficient alternative strategy.(E)-β-Farnesene (EβF) synthases catalyze the formation of EβF,which for many pest aphids is the main component of the alarm pheromone involved in the chemical communication within these species.EβF can also be synthesized by certain plants but is then normally contaminated with inhibitory compounds.Engineering of crop plants capable of synthesizing and emitting EβF could cause repulsion of aphids and also the attraction of natural enemies that use EβF as a foraging cue,thus minimizing aphid infestation.In this review,the effects of aphids on host plants,plants' defenses against aphid herbivory and the recruitment of natural enemies for aphid control in an agricultural setting are briefly introduced.Furthermore,the plant-derived EβF synthase genes cloned to date along with their potential roles in generating novel aphid resistance via genetically modified approaches are discussed.

  17. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  18. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin

    OpenAIRE

    Kumar-Roine, Shilpa; Matsui, Mariko; Chinain, M. (Mireille); Laurent, Dominique; Pauillac, S

    2008-01-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was qu...

  19. Endothelial Nitric Oxide Synthase (−786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia

    Science.gov (United States)

    Vilas-Boas, Wendell; Figueiredo, Camylla V. B.; Pitanga, Thassila N.; Carvalho, Magda O. S.; Santiago, Rayra P.; Santana, Sânzio S.; Guarda, Caroline C.; Zanette, Angela M. D.; Cerqueira, Bruno A. V.; Gonçalves, Marilda S.

    2016-01-01

    Sickle cell anemia (SCA) patients have vascular complications, and polymorphisms in endothelin-1 (ET-1) and endothelial nitric oxide synthase (eNOS) genes were associated with ET-1 and nitric oxide disturbance. We investigate the association of ET-1 5665G>T and eNOS −786T>C polymorphisms with soluble adhesion molecules (sVCAM-1 and sICAM-1), biochemical markers, and medical history. We studied 101 SCA patients; carriers of eNOS minor allele (C) had the highest levels of sVCAM-1, and carriers of ET-1 minor allele had more occurrence of acute chest syndrome (ACS). The multivariate analysis suggested the influence of the ET-1 gene on ACS outcome and an association of the eNOS gene with upper respiratory tract infection. We suggest that eNOS and ET-1 gene polymorphisms can influence SCA pathophysiology and that eNOS variant in SCA patients might be important to nitric oxide activity and vascular alteration. We found an association of the ET-1 minor allele in ACS, showing the importance of genetic screening in SCA. PMID:27486304

  20. Syntheses and properties of chalcone derivatives. Chalcone yudotai no gosei to seishitsu

    Energy Technology Data Exchange (ETDEWEB)

    Noguchi, A.; Kato, Y.; Yasui, S. (Nippon Kanko Shikiso Kenkyusho Co. Ltd., Okayama (Japan))

    1991-11-20

    Photoresist is used as a protective film in the photo-etching during manufacturing semiconductor devices. A technique of mixing light absorbers is proposed to prevent reduction in its resolution because of halation. As the light absorbing materials, mono-azo and polymethine coloring agents of certain kinds have been proposed. This paper describes syntheses of eleven chalcone derivatives for the purpose of developing ultraviolet light absorbers for the photoresist, and discussions on various characteristics required for the primary evaluation, such as absorption spectrum characteristics, solubility, light resistance, and heat resistance. As a result, it was found that the chalcone derivatives with weak donors, such as alkoxyl and hydroxyl groups are useful as absorbers for i-line (365 nm) of mercury vapor lamps. Especially those with hydroxyl groups are promising for the positive type photoresist because they are soluble in alkaline aqueous solution. 8 refs., 3 figs., 3 tabs.

  1. [Chalcones and their heterocyclic analogs as potential antifungal chemotherapeutic agents].

    Science.gov (United States)

    Opletalová, V; Sedivý, D

    1999-11-01

    Chalcones and their heterocyclic analogues show various biological effects, e.g. anti-inflammatory, antitumour, antibacterial, antituberculous, antiviral, antiprotozoal, gastroprotective, and others. The present review discusses in greater detail the fungistatic and fungicide properties of these compounds and presents also their chemical structures. The mechanism of antifungal effects of chalcones and their analogues has not been investigated in greater detail. Due to the presence of a reactive ketovinyl moiety in the molecule the compounds of this type are able to react with the thiol groups of enzymes. It cannot be excluded that chalcones interfere with the normal function of the membranes of fungi and moulds. Further investigation of chemical, physical, and biological properties of chalcones and their analogues could lead to the elucidation of the mechanism of their action and finding of effective fungicidal and fungistatic agents in this group of organic substances. PMID:10748740

  2. Exploring pharmacological significance of chalcone scaffold: a review.

    Science.gov (United States)

    Sahu, N K; Balbhadra, S S; Choudhary, J; Kohli, D V

    2012-01-01

    Chalcones (1,3-diaryl-2-propen-1-ones) and their heterocyclic analogues, belong to the flavonoid family, which possess a number of interesting biological properties such as antioxidant, cytotoxic, anticancer, antimicrobial, antiprotozoal, antiulcer, antihistaminic and anti-inflammatory activities. Several pure chalcones have been approved for clinical use or tested in humans. Clinical trials have shown that these compounds reached reasonable plasma concentration and are well-tolerated. For this reason they are an object of continuously growing interest amongst the scientists. However, much of the pharmacological potential of chalcones is still not utilized. The purpose of this review is to provide an overview of the pharmacological activity of naturally occurring and synthetic chalcones. This review highlights more recent pharmacological screening of these compounds, their mechanisms of action and relevant structure-activity relationships. PMID:22320299

  3. Synthesis and Antimicrobial Evaluation of Some Heterocyclic Chalcone Derivatives

    Directory of Open Access Journals (Sweden)

    Essam Mohamed Sharshira

    2011-03-01

    Full Text Available Some new heterocyclic compounds containing isoxazole, pyrazole and oxadiazole ring systems were prepared from various chalcones. The synthesized compounds have been characterized by elemental analysis and spectral methods. These compounds were screened for their antimicrobial activities.

  4. Synthesis and Antimicrobial Evaluation of Some Heterocyclic Chalcone Derivatives

    OpenAIRE

    Essam Mohamed Sharshira; Nagwa Mohamed Mahrous Hamada

    2011-01-01

    Some new heterocyclic compounds containing isoxazole, pyrazole and oxadiazole ring systems were prepared from various chalcones. The synthesized compounds have been characterized by elemental analysis and spectral methods. These compounds were screened for their antimicrobial activities.

  5. Chalcones and flavonoids as anti-tuberculosis agents.

    Science.gov (United States)

    Lin, Yuh-Meei; Zhou, Yasheen; Flavin, Michael T; Zhou, Li-Ming; Nie, Weiguo; Chen, Fa-Ching

    2002-08-01

    A series of flavonoids, chalcones and chalcone-like compounds were evaluated for inhibitory activity against Mycobacterium tuberculosis H37Rv. Among them, eight compounds exhibited >90% inhibition on the growth of the bacteria at a concentration of 12.5 microg/mL. Chalcones 1-(2-hydroxyphenyl)-3-(3-chlorophenyl)-2-propen-1-one (22) and 1-(2-hydroxyphenyl)-3-(3-iodophenyl)-2-propen-1-one (37) demonstrated 90 and 92% inhibition, respectively. Chalcone-like compounds (heterocyclic ring-substituted 2-propen-1-one) 1-(4-fluorophenyl)-3-(pyridin-3-yl)-2-propen-1-one (48), 1-(3-hydroxyphenyl)-3-(phenanthren-9-yl)-2-propen-1-one (49), 1-(pyridin-3-yl)-3-(phenanthen-9-yl)-2-propen-1-one (50) and 1-(furan-2-yl)-3-phenyl-2-propen-1-one (51) exhibited 98, 97, 96 and 96% inhibition, respectively. The actual minimum inhibitory concentrations (MIC), defined as the lowest concentration inhibiting 99% of the inoculum, for 22, 37, 48, 49, 50 and 51 were 20.3, 31.5, 48.3, >35.7, 6.8 and 19.2, respectively. A hydrophobic substituent on one aromatic ring, and a hydrogen-bonding group on the other aromatic ring resulted in increased anti-TB activity of the chalcones and chalcone-like compounds. Flavones and flavanones are more geometrically constrained than the corresponding chalcone analogues. The decreased activity of the flavones with respect to the chalcones may be due to the confinement of the terminal aromatic rings to the same plane. PMID:12057669

  6. Synthesis and anticonvulsant activity of certain chalcone based pyrazoline compounds

    OpenAIRE

    Sudhakara Rao Gerapati; Kalaichelvan V K; Ganguri Sudhakara Rao

    2015-01-01

    Convulsions are involuntary, violent, spasmodic and prolonged contractions of skeletal muscles. That means a patient may have epilepsy without convulsions and vice versa. Epilepsy is a common neurological abnormality affecting about 1% of the world population. The primary objectives of these synthesized compounds are to suppress seizures and provide neuroprotection by minimizing the effects from seizure attacks. Here some of the chalcones and chalcone based various pyrazolines were evaluated ...

  7. Design and synthesis of chalcone-based macrocyclic polyethers

    OpenAIRE

    Subrata Jana

    2015-01-01

    A series of chalcone-based macrocyclic ethers have been synthesized. These macrocyclic ethers contain polyether as well as extended conjugation to the benzene ring to function as fluorescent sensor for cations. The modeling studies show that the chalcone part of the receptors remains partially out of plane from the polyether part and the keto moiety of the receptors always directed outwardly in the receptor itself. This may be changed during the recognition of metal ions. The tendency of the ...

  8. Synthesis and Characterisation of Biologically Potent Novel Chalcone Moieties

    OpenAIRE

    Mahammadali Khanusiya; Z. M Gadhawala

    2016-01-01

    As displaying a dominant biological interest of some amino chalcone derivatives which were synthesized by claisen-schmidt condensation reaction of amino acetophenone with aromatic aldehyde in presence of sodium hydroxide. These chalcones were screened for antifungal activity against candida albicans strain and also for antibacterial activity against staphylococcus epidermidis (G positive) and pseudomonas aeruginosa (G negative) strain by NCCLS method. The synthesized compounds were characteri...

  9. Synthesis, Characterization, and Anticancer Activity of New Benzofuran Substituted Chalcones

    OpenAIRE

    COŞKUN, Demet; Tekin, Suat; SANDAL, Süleyman; Coşkun, Mehmet Fatih

    2016-01-01

    Benzofuran derivatives are of great interest in medicinal chemistry and have drawn considerable attention due to their diverse pharmacological profiles including anticancer activity. Similarly, chalcones, which are common substructures of numerous natural products belonging to the flavonoid class, feature strong anticancer properties. A novel series of chalcones, 3-aryl-1-(5-bromo-1-benzofuran-2-yl)-2-propanones propenones (3a–f), were designed, synthesized, and characterized. In vitro antitu...

  10. Solvent Free Synthesis of Chalcones and their Antibacterial Activities

    OpenAIRE

    K. Rajendra K. Saini; S. Amit Choudhary; Joshi, Yogesh C.; Joshi, P.

    2005-01-01

    The solvent free synthesis of six chalcones was carried out by grinding the piperanal and the acetophenone (unsubstituted, 4-methyl, 4-methoxy, 4-bromo, 4-nitro, 3-chloro) in the presence of solid sodium hydroxide with a mortar and pestle. In general, the chalcones were obtained in high yield and high purity. Minor quantities of Ketol and Michael addition product were easily removed by recrystallization. The result indicates a correlation between the success of the solvent-free synthesis and ...

  11. Synthesis, SAR and antibacterial studies on novel chalcone oxazolidinone hybrids.

    Science.gov (United States)

    Selvakumar, N; Kumar, G Sunil; Azhagan, A Malar; Rajulu, G Govinda; Sharma, Shikha; Kumar, M Sitaram; Das, Jagattaran; Iqbal, Javed; Trehan, Sanjay

    2007-04-01

    With an intention to synergise the antibacterial activity of chalcones and oxazolidinones, several hybrid compounds possessing both chalcone and oxazolidinone moieties were synthesized and tested for antibacterial activity. The hybrid molecules containing heterocycles instead of aromatic ring were found to be active. A SAR study with various heterocycles resulted in a lead molecule 20, which was converted to one of the potent antibacterial compounds 27. PMID:17150281

  12. Synthesis and Characterisation of Biologically Potent Novel Chalcone Moieties

    Directory of Open Access Journals (Sweden)

    Mahammadali Khanusiya

    2016-05-01

    Full Text Available As displaying a dominant biological interest of some amino chalcone derivatives which were synthesized by claisen-schmidt condensation reaction of amino acetophenone with aromatic aldehyde in presence of sodium hydroxide. These chalcones were screened for antifungal activity against candida albicans strain and also for antibacterial activity against staphylococcus epidermidis (G positive and pseudomonas aeruginosa (G negative strain by NCCLS method. The synthesized compounds were characterized by means of their FT-IR and 1HNMR spectral study.[14

  13. AtROS1 overexpression provides evidence for epigenetic regulation of genes encoding enzymes of flavonoid biosynthesis and antioxidant pathways during salt stress in transgenic tobacco.

    Science.gov (United States)

    Bharti, Poonam; Mahajan, Monika; Vishwakarma, Ajay K; Bhardwaj, Jyoti; Yadav, Sudesh Kumar

    2015-09-01

    In plants, epigenetic changes have been identified as regulators of developmental events during normal growth as well as environmental stress exposures. Flavonoid biosynthetic and antioxidant pathways play a significant role in plant defence during their exposure to environmental cues. The aim of this study was to unravel whether genes encoding enzymes of flavonoid biosynthetic and antioxidant pathways are under epigenetic regulation, particularly DNA methylation, during salt stress. For this, a repressor of silencing from Arabidopsis, AtROS1, was overexpressed in transgenic tobacco. Generated transgenics were evaluated to examine the influence of AtROS1 on methylation status of promoters as well as on coding regions of genes encoding enzymes of flavonoids biosynthesis and antioxidant pathways. Overexpression of AtROS1 increases the demethylation levels of both promoters as well as coding regions of genes encoding chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase, flavonol synthase, dihydroflavonol 4-reductase, and anthocyanidin synthase of the flavonoid biosynthetic pathway, and glutathione S-transferase, ascorbate peroxidase, glutathione peroxidase, and glutathione reductase of the antioxidant pathway during control conditions. The level of demethylation was further increased at promoters as well as coding regions of these genes during salt-stress conditions. Transgenic tobacco overexpressing AtROS1 showed tolerance to salt stress that could have been due to the higher expression levels of the genes encoding enzymes of the flavonoid biosynthetic and antioxidant pathways. This is the first comprehensive study documenting the epigenetic regulation of flavonoid biosynthetic and antioxidant pathways during salt-stress exposure of plants. PMID:26116024

  14. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    Science.gov (United States)

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  15. Construction of eukaryotic expression vector encoding ATP synthase lipid-binding protein-like protein gene of Sj and its expression in HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Ouyang Danming; Hu Yongxuan; Li Mulan; Zeng Xiaojun; He Zhixiong; Yuan Caijia

    2008-01-01

    Objective: To clone and construct the recombinant plasmid containing ATP synthase lipid-binding protein-like protein gene of Schistosoma japonicum,(SjAslp) and transfer it into mammalian cells to express the objective protein. Methods: By polymerase chain reaction (PCR) technique, SjAslp was amplified from the constructed recombinant plasmid pBCSK+/SjAslp, and inserted into cloning vector pUCm-T. Then, SjAslp was subcloned into an eukaryotic expression vector pcDNA3.1(+). After identifying it by PCR, restrictive enzymes digestion and DNA sequencing, the recombinant plasmid was transfected into HeLa cells using electroporation, and the expression of the recombinant protein was analyzed by immunocytochemical assay. Resnlts: The specific gene fragment of 558 bp was successfully amplified. The DNA vaccine of SjAslp was successfully constructed. Immunocytochemical assay showed that SjAslp was expressed in the cytoplasm of HeLa cells. Conclusion: SjAslp gene can be expressed in eukaryotic system, which lays the foundation for development of the SjAslp DNA vaccine against schitosomiasis.

  16. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    Science.gov (United States)

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed. PMID:27072286

  17. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  18. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Science.gov (United States)

    Mahajan, Monika; Ahuja, Paramvir Singh; Yadav, Sudesh Kumar

    2011-01-01

    Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS) encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS) is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi) through post-transcriptional gene silencing (PTGS) of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin) content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin) was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA) at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  19. Expression of agsA, one of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger, is induced in response to cell wall stress

    NARCIS (Netherlands)

    Damveld, R.A.; Kuyk, P.A. van; Arentshorst, M.; Klis, F.M.; Hondel, C.A.M.J.J. van den; Ram, A.F.J.

    2005-01-01

    1,3-α-d-Glucan is an important component of the cell wall of filamentous fungi. We have identified a family of five 1,3-α-d-glucan synthase-encoding genes in Aspergillus niger. The agsA gene was sequenced and the predicted protein sequence indicated that the overall domain structure of 1,3-α-d-gluca

  20. Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection

    OpenAIRE

    Mehdy, Mona C.; Lamb, Christopher J.

    1987-01-01

    The environmentally regulated synthesis of phenylpropanoid natural products was studied by examining the expression of the gene encoding chalcone isomerase (CHI). This enzyme catalyzes a step common to the synthesis of flavonoid pigments and isoflavonoid phytoalexins. A λgt11 library was constructed using mRNA from cell cultures of bean (Phaseolus vulgaris L.) treated with fungal elicitor. Two positive clones were obtained by screening 105 recombinants with an antiserum to purified bean CHI. ...

  1. Genetic Transformation of Tobacco with the Trehalose Synthase Gene from Grifola frondosa Fr. Enhances the Resistance to Drought and Salt in Tobacco

    Institute of Scientific and Technical Information of China (English)

    Shu-Zhen ZHANG; Ben-Peng YANG; Cui-Lian FENG; Huo-Long TANG

    2005-01-01

    Trehalose is a non-reducing disaccharide of glucose that functions as a protectant in the stabilization of biological structures and enhances the tolerance of organisms to abiotic stress. In the present study, we report on the expression of the Grifolafrondosa Fr. trehalose synthase (TSase) gene for manipulating abiotic stress tolerance in tobacco (Nicotiana tabaccum L.). The expression of the transgene was under the control of two tandem copies of the CaMV35S promoter and was transferred into tobacco by Agrobacterium tumefaciens EHA105. Compared with non-transgenic plants, transgenic plants were able to accumulate high levels of products of trehalose, which were increased up to 2.126-2.556 mg/g FW, although levels were undetectable in non-transgenic plants. This level of trehalose in transgenic plants was 400-fold higher than that of transgenic tobacco plants cotransformed with Escherichia coli TPS and TPP on independent expression cassettes, twofold higher than that of transgenic rice plants transformed with a bifunctional fusion gene (TPSP) of the trehalose-6-phosphate (T-6-P) synthase (TPS) and T-6-P phosphatase (TPP) of E. coli, and 12-fold higher than that of transgenic tobacco plants transformed the yeast TPS1 gene.It has been reported that transgenic plants with E. coli TPS and/or TPP were severely stunted and had morphological alterations of their roots. Interestingly, our transgenic plants have obvious morphological changes, including thick and deep-coloured leaves, but show no growth inhibition; moreover, these morphological changes can restore to normal type in T2 progenies. Trehalose accumulation in 35S-35S:TSase plants resulted in increased tolerance to drought and salt, as shown by the results of tests on drought, salt tolerance, and drought physiological indices, such as water content in excised leaves, malondialdehyde content, chlorophyll a and b contents, and the activity of superoxide dismutase and peroxidase in excised leaves. These results

  2. Biosynthesis of P(3HB-co-3HV-co-3HHp terpolymer by Cupriavidus necator PHB-4 transformant harboring the highly active PHA synthase gene of Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Rathi, D-N.

    2013-01-01

    Full Text Available Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly activepolyhydroxyalkanoate synthase gene (phaC of a locally isolated Chromobacterium sp. USM2 for its ability toincorporate 3-hydroxyheptanoate (3HHp monomer.Methodology and results: A mixture of fructose and sodium heptanoate fed to the culture gave rise to poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxyheptanoate, [P(3HB-co-3HV-co-3HHp] terpolymer synthesis, withtraces of 3HHp monomers confirmed through gas chromatography (GC, proton (1H and carbon (13C NMR spectra.Conclusion, significance and impact of study: This study has revealed that the PHA synthase of Chromobacteriumsp. USM2 has a broad range of substrate specificity. The synthase is able to polymerize 3-hydroxyalkanoate monomershaving 4–7 carbon atoms.

  3. Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

    International Nuclear Information System (INIS)

    Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α-32P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

  4. In vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoterIn vitro tolerance to Botrytis cinerea of grapevine 41B rootstock in transgenic plants expressing the stilbene synthase Vst1 gene under the control of a pathogen‐inducible PR 10 promoter

    OpenAIRE

    Coutos-Thévenot, Pierre; Poinssot, Benoît; Bonomelli, A.; Yean, H.; Breda, C; Buffard, D; Esnault, R.; Hain, R; Boulay, M.

    2001-01-01

    Resveratrol is a major phytoalexin in grapevine but its synthesis in response to phytopathogen attack decreases with grape berry ripening, A chimeric gene combining an alfalfa PR 10 promoter and Vst1 (Vitis stilbene synthase 1) gene was introduced into the genome of 41B rootstock, Transgenic plants were analysed for resveratrol production in leaves infected with Botrytis using an in vitro test. Among the 50 transgenic lines analysed, some exhibited a production lower than the non-transgenic c...

  5. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  6. SYNTHESIS, CHARACTERIZATION AND BIOLOGICAL ACTIVITY OF SOME NOVEL ARYL AND HETROARYL CHALCONE ANALOGUES

    OpenAIRE

    Tribhuvan Singh; R Lavanya; Srikanth Merugu; P.Sudhakar; Syeda Sana Yasmeen

    2012-01-01

    A new series of Heterocyclic chalcones showed diversified biological activities. In view of potential biological activities of Heterocyclic chalcones derivative were prepared by claisen-Schmidt condensation technique. The compound were screened for anti-inflammatory and antibacterial activity.

  7. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    International Nuclear Information System (INIS)

    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RLOTAF/Ac12RLOTAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  8. Expression characteristics of CS-ACS1, CS-ACS2 and CS-ACS3, three members of the 1-aminocyclopropane-1-carboxylate synthase gene family in cucumber (Cucumis sativus L.) fruit under carbon dioxide stress.

    Science.gov (United States)

    Mathooko, F M; Mwaniki, M W; Nakatsuka, A; Shiomi, S; Kubo, Y; Inaba, A; Nakamura, R

    1999-02-01

    We investigated the expression pattern of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes, CS-ACS1, CS-ACS2 and CS-ACS3 in cucumber (Cucumis sativus L.) fruit under CO2 stress. CO2 stress-induced ethylene production paralleled the accumulation of only CS-ACS1 transcripts which disappeared upon withdrawal of CO2. Cycloheximide inhibited the CO2 stress-induced ethylene production but superinduced the accumulation of CS-ACS1 transcript. At higher concentrations, cycloheximide also induced the accumulation of CS-ACS2 and CS-ACS3 transcripts. In the presence of CO2 and cycloheximide, the accumulation of CS-ACS2 transcript occurred within 1 h, disappeared after 3 h and increased greatly upon withdrawal of CO2. Inhibitors of protein kinase and types 1 and 2A protein phosphatases which inhibited and stimulated, respectively, CO2 stress-induced ethylene production had little effect on the expression of these genes. The results presented here identify CS-ACS1 as the main ACC synthase gene responsible for the increased ethylene biosynthesis in cucumber fruit under CO2 stress and suggest that this gene is a primary response gene and its expression is under negative control since it is expressed by treatment with cycloheximide. The results further suggest that the regulation of CO2 stress-induced ethylene biosynthesis by reversible protein phosphorylation does not result from enhanced ACC synthase transcription. PMID:10202812

  9. SYNTHESIS AND ANTIMICROBIAL ACTIVITY OF SOME CHALCONE DERIVATIVES AND THEIR COPPERCOMPLEXES

    OpenAIRE

    P. M. Rachmale

    2012-01-01

    In the present investigation, 4-chloro acetophenone on condensation with 2-nitro benzaldehydes in methanolic NaOH solution yielded the corresponding chalcone. These chalcone were further reacted with Isonicotyl hydrazide and semicarbazide in ethanol which led to the formation of chalcone Isonicotyl hydrazone and chalcone semicarbazone derivatives respectively. The newly synthesized derivatives and there copper complexes were characterized on the basis of their chemical properties and spect...

  10. The antileishmanial activity of novel oxygenated chalcones and their mechanism of action

    DEFF Research Database (Denmark)

    Zhai, L; Chen, M; Blom, J;

    1999-01-01

    Our previous studies have shown that licochalcone A, an oxygenated chalcone, has antileishmanial and antimalarial activities, and alters the ultrastructure and function of the mitochondria of Leishmania spp. parasites. The present study was designed to investigate the antileishmanial activity...... and the mechanism of action of a group of new oxygenated chalcones. The tested oxygenated chalcones inhibited the in-vitro growth of Leishmania major promastigotes and Leishmania donovani amastigotes. Treatment of hamsters infected with L. donovani with intraperitoneal administration of two oxygenated chalcones...

  11. Identification and function of a polyketide synthase gene responsible for 1,8-dihydroxynaphthalene-melanin pigment biosynthesis in Ascochyta rabiei.

    Science.gov (United States)

    Akamatsu, Hajime O; Chilvers, Martin I; Stewart, Jane E; Peever, Tobin L

    2010-08-01

    Ascochyta rabiei produces and accumulates one of the well-known fungal polyketides, 1,8-dihydroxynaphthalene-melanin pigment (DHN-melanin), in asexual and sexual fruiting bodies. Degenerate PCR primers were used to isolate an ArPKS1 of A. rabiei encoding a polypeptide with high similarity to polyketide synthase (PKS) involved in biosynthesis of DHN-melanin in other ascomycetous fungi. Site-directed mutagenesis of ArPKS1 in A. rabiei generated melanin-deficient pycnidial mutants but caused no significant reduction of pathogenicity to chickpea. Pycnidiospores in ArPKS1-mutant pycnidia showed higher sensitivity to UV light exposure compared to pycnidiospores in melanized pycnidia of the wild-type progenitor isolate. Integration of an orthologous PKS1 gene from Bipolaris oryzae into the genome of the mutants complemented the dysfunctional ArPKS1 gene. This study demonstrated that A. rabiei uses a DHN-melanin pathway for pigmentation of pycnidia and this molecule may protect pycnidiospores from UV irradiation. PMID:20473673

  12. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions. PMID:27442340

  13. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. PMID:26466878

  14. Genetic variants in inducible nitric oxide synthase gene are associated with the risk of radiation-induced lung injury in lung cancer patients receiving definitive thoracic radiation

    International Nuclear Information System (INIS)

    Background and purpose: Nitric oxide (NO), mainly synthesized by inducible nitric oxide synthase (NOS2) in pathological conditions, plays an important role in cytotoxicity, inflammation and fibrosis. Elevations in exhaled NO after thoracic radiation have been reported to predict radiation-induced lung injury (RILI). This study examined whether genetic variations in NOS2 gene is associated with the risk of RILI. Material and methods: A cohort of 301 patients between 2009 and 2011 were genotyped for 21 single nucleotide polymorphisms (SNPs) in the NOS2 gene by the Sequenom MassArray system. Kaplan–Meier cumulative probability was used to assess RILI risk and Cox proportional hazards analyses were performed to evaluate the effect of NOS2 genotypes on RILI. Results: Multivariate analysis found that three SNPs (rs2297518, rs1137933 and rs16949) in NOS2 were significantly associated with risk of RILI ⩾ 2 (P value = 0.001, 0.000092, 0.001, respectively) after adjusting for other covariates. Their associations were independent of radiation dose and mean lung dose. Further haplotype analysis indicated that the ATC haplotype of three SNPs is associated with reducing the risk of developing RILI. Conclusion: Our results demonstrate that genetic variants of NOS2 may serve as a reliable predictor of RILI in lung cancer patients treated with thoracic radiation

  15. Adenoviral gene transfer of endothelial nitric-oxide synthase (eNOS) partially restores normal pulmonary arterial pressure in eNOS-deficient mice

    Science.gov (United States)

    Champion, Hunter C.; Bivalacqua, Trinity J.; Greenberg, Stanley S.; Giles, Thomas D.; Hyman, Albert L.; Kadowitz, Philip J.

    2002-01-01

    It has been shown that mice deficient in the gene coding for endothelial nitric-oxide synthase (eNOS) have increased pulmonary arterial pressure and pulmonary vascular resistance. In the present study, the effect of transfer to the lung of an adenoviral vector encoding the eNOS gene (AdCMVeNOS) on pulmonary arterial pressure and pulmonary vascular resistance was investigated in eNOS-deficient mice. One day after intratracheal administration of AdCMVeNOS to eNOS−/− mice, there was an increase in eNOS protein, cGMP levels, and calcium-dependent conversion of l-arginine to l-citrulline in the lung. The increase in eNOS protein and activity in eNOS−/− mice was associated with a reduction in mean pulmonary arterial pressure and pulmonary vascular resistance when compared with values in eNOS-deficient mice treated with vehicle or a control adenoviral vector coding for β-galactosidase, AdCMVβgal. These data suggest that in vivo gene transfer of eNOS to the lung in eNOS−/− mice can increase eNOS staining, eNOS protein, calcium-dependent NOS activity, and cGMP levels and partially restore pulmonary arterial pressure and pulmonary vascular resistance to near levels measured in eNOS+/+ mice. Thus, the major finding in this study is that in vivo gene transfer of eNOS to the lung in large part corrects a genetic deficiency resulting from eNOS deletion and may be a useful therapeutic intervention for the treatment of pulmonary hypertensive disorders in which eNOS activity is reduced. PMID:12237402

  16. A myo-inositol-1-phosphate synthase gene, IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic sweet potato.

    Science.gov (United States)

    Zhai, Hong; Wang, Feibing; Si, Zengzhi; Huo, Jinxi; Xing, Lei; An, Yanyan; He, Shaozhen; Liu, Qingchang

    2016-02-01

    Myo-inositol-1-phosphate synthase (MIPS) is a key rate limiting enzyme in myo-inositol biosynthesis. The MIPS gene has been shown to improve tolerance to abiotic stresses in several plant species. However, its role in resistance to biotic stresses has not been reported. In this study, we found that expression of the sweet potato IbMIPS1 gene was induced by NaCl, polyethylene glycol (PEG), abscisic acid (ABA) and stem nematodes. Its overexpression significantly enhanced stem nematode resistance as well as salt and drought tolerance in transgenic sweet potato under field conditions. Transcriptome and real-time quantitative PCR analyses showed that overexpression of IbMIPS1 up-regulated the genes involved in inositol biosynthesis, phosphatidylinositol (PI) and ABA signalling pathways, stress responses, photosynthesis and ROS-scavenging system under salt, drought and stem nematode stresses. Inositol, inositol-1,4,5-trisphosphate (IP3 ), phosphatidic acid (PA), Ca(2+) , ABA, K(+) , proline and trehalose content was significantly increased, whereas malonaldehyde (MDA), Na(+) and H2 O2 content was significantly decreased in the transgenic plants under salt and drought stresses. After stem nematode infection, the significant increase of inositol, IP3 , PA, Ca(2+) , ABA, callose and lignin content and significant reduction of MDA content were found, and a rapid increase of H2 O2 levels was observed, peaked at 1 to 2 days and thereafter declined in the transgenic plants. This study indicates that the IbMIPS1 gene has the potential to be used to improve the resistance to biotic and abiotic stresses in plants. PMID:26011089

  17. Over-expression of Catharanthus roseus tryptophan decarboxylase and strictosidine synthase in rol gene integrated transgenic cell suspensions of Vinca minor.

    Science.gov (United States)

    Verma, Priyanka; Sharma, Abhishek; Khan, Shamshad Ahmad; Shanker, Karuna; Mathur, Ajay K

    2015-01-01

    Tryptophan decarboxylase (TDC) and strictosidine synthase (STR) genes from Catharanthus roseus have been successfully over-expressed in the rol gene integrated cell suspensions of V. minor. Thirty seconds SAAT (sonication-assisted Agrobacterium transformation) treatment of plant cell suspension with LBA1119 having construct () generated three stable TDC + STR over-expressing cell lines--PVG1, PVG2, and PVG3. The transgenes were confirmed by β-glucuronidase GUS histochemical assay and PCR amplification of rol genes/GUS gene. All the three cell suspension lines were found to be slow growing. In comparison to the control cell suspensions (GI = 241.0 ± 5.8), PVG3 cell line registered a growth index (GI) of 208.0 ± 10.0 followed by PVG1 (GI = 140.0 ± 14.2) and PVG2 (GI = 85.0 ± 9.6). The PVG3 cell line was also up-scaled in the 5-l stirred tank bioreactor with GI of 745.6 ± 35.3 under optimized parameters. Only PVG3 line registered a twofold increase in total alkaloid content (2.1 ± 0.1% dry wt.) and showed vincamine presence (0.003 ± 0.001% dry wt.) which was further enhanced at the bioreactor level (2.7 ± 0.3 and 0.005 ± 0.001% dry wt., respectively). Real-time (RT) qPCR analysis of PVG3 showed more than sevenfold to eightfold increase in TDC and STR expression [relative quantity value (RQ) = 7.6 ± 0.8 (TDC); RQ = 8.5 ± 0.9 (STR)]. PMID:25106473

  18. Dermal exposure of Eisenia andrei earthworms: Effects of heavy metals on metallothionein and phytochelatin synthase gene expressions in coelomocytes.

    Science.gov (United States)

    Homa, Joanna; Rorat, Agnieszka; Kruk, Jerzy; Cocquerelle, Claude; Plytycz, Barbara; Vandenbulcke, Franck

    2015-06-01

    Parameters such as total number of coelomocytes, riboflavin content in coelomocytes, expression of genes implied in metal homeostasis, and detoxification mechanisms can be used as biomarkers to assess the impact of metals on annelids. Defense biomarkers (detoxification gene expressions and coelomocyte parameters) were investigated in the ecotoxicologically important species Eisenia andrei following in vivo exposure to 5 different metals (zinc, copper, nickel, lead, and cadmium) at known concentrations. Coelomocyte numbers and riboflavin content were not affected by metallic exposure, but metal-specific gene expression variations were evidenced. PMID:25693738

  19. Novel Structural and Functional Motifs in cellulose synthase (CesA) Genes of Bread Wheat (Triticum aestivum, L.)

    OpenAIRE

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Gill, Kulvinder; Singh, Jaswinder

    2016-01-01

    Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix s...

  20. Synthesis and Biological Evaluation of Retinoid-Chalcones as Inhibitors of Colon Cancer Cell Growth

    Science.gov (United States)

    Based on the observed anticancer activity of chalcones and retinoids, a novel class of retinoid-chalcone hybrids were designed and synthesized. As part of our ongoing studies to discover natural product based anticancer compounds, the retinoid-chalcone hybrids were tested against the colon cancer ce...

  1. Disruption of Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase does not affect growth in glucose but impairs growth at high temperature.

    Directory of Open Access Journals (Sweden)

    Carmen-Lisset Flores

    Full Text Available We have cloned the Yarrowia lipolytica TPS1 gene encoding trehalose-6-P synthase by complementation of the lack of growth in glucose of a Saccharomyces cerevisiae tps1 mutant. Disruption of YlTPS1 could only be achieved with a cassette placed in the 3' half of its coding region due to the overlap of its sequence with the promoter of the essential gene YlTFC1. The Yltps1 mutant grew in glucose although the Y. lipolytica hexokinase is extremely sensitive to inhibition by trehalose-6-P. The presence of a glucokinase, insensitive to trehalose-6-P, that constitutes about 80% of the glucose phosphorylating capacity during growth in glucose may account for the growth phenotype. Trehalose content was below 1 nmol/mg dry weight in Y. lipolytica, but it increased in strains expressing YlTPS1 under the control of the YlTEF1 promoter or with a disruption of YALI0D15598 encoding a putative trehalase. mRNA levels of YlTPS1 were low and did not respond to thermal stresses, but that of YlTPS2 (YALI0D14476 and YlTPS3 (YALI0E31086 increased 4 and 6 times, repectively, by heat treatment. Disruption of YlTPS1 drastically slowed growth at 35°C. Homozygous Yltps1 diploids showed a decreased sporulation frequency that was ascribed to the low level of YALI0D20966 mRNA an homolog of the S. cerevisiae MCK1 which encodes a protein kinase that activates early meiotic gene expression.

  2. Synthesis, Characterization, and Anticancer Activity of New Benzofuran Substituted Chalcones

    Directory of Open Access Journals (Sweden)

    Demet Coşkun

    2016-01-01

    Full Text Available Benzofuran derivatives are of great interest in medicinal chemistry and have drawn considerable attention due to their diverse pharmacological profiles including anticancer activity. Similarly, chalcones, which are common substructures of numerous natural products belonging to the flavonoid class, feature strong anticancer properties. A novel series of chalcones, 3-aryl-1-(5-bromo-1-benzofuran-2-yl-2-propanones propenones (3a–f, were designed, synthesized, and characterized. In vitro antitumor activities of the newly synthesized (3a–f and previously synthesized (3g–j chalcone compounds were determined by using human breast (MCF-7 and prostate (PC-3 cancer cell lines. Antitumor properties of all compounds were determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Cell viability assay for the tested chalcone compounds was performed and the log⁡IC50 values of the compounds were calculated after 24-hour treatment. Our results indicate that the tested chalcone compounds show antitumor activity against MCF-7 and PC-3 cell lines (p<0.05.

  3. Differential expression of MYB gene (OgMYB1) determines color patterning in floral tissue of Oncidium Gower Ramsey.

    Science.gov (United States)

    Chiou, Chung-Yi; Yeh, Kai-Wun

    2008-03-01

    The yellow coloration pattern in Oncidium floral lip associated with red sepal and petal tissues is an ideal model to study coordinate regulation of anthocyanin synthesis. In this study, chromatography analysis revealed that the red coloration in floral tissues was composed of malvidin-3-O-galactoside, peonidin-3-O-glucoside, delphinidin-3-O-glucoside and cyanidin-3-O-glucoside compounds. By contrary, these pigments were not detected in yellow lip tissue. Four key genes involved in anthocyanin biosynthetic pathway, i.e. chalcone synthase (OgCHS), chalcone isomerase (OgCHI), dihydroflavonol 4-reductase (OgDFR) and anthocyanidin synthase (OgANS) were isolated and their expression patterns were characterized. Northern blot analysis confirmed that although they are active during floral development, OgCHI and OgDFR genes are specifically down-regulated in yellow lip tissue. Bombardment with OgCHI and OgDFR genes into lip tissue driven by a flower-specific promoter, Pchrc (chromoplast-specific carotenoid-associated gene), demonstrated that transient expression of these two genes resulted in anthocyanin production in yellow lip. Further analysis of a R2R3 MYB transcription factor, OgMYB1, revealed that although it is actively expressed during floral development, it is not expressed in yellow lip tissue. Transient expression of OgMYB1 in lip tissues by bombardment can also induce formation of red pigments through the activation of OgCHI and OgDFR transcription. These results demonstrate that differential expression of OgMYB1 is critical to determine the color pattern of floral organ in Oncidium Gower Ramsey. PMID:18161007

  4. Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

    Science.gov (United States)

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-01-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  5. cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

    Directory of Open Access Journals (Sweden)

    Krittaya Supathaweewat

    2013-10-01

    Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

  6. Over-expression of BvMTSH, a fusion gene for maltooligosyltrehalose synthase and maltooligosyltrehalose trehalohydrolase, enhances drought tolerance in transgenic rice.

    Science.gov (United States)

    Joo, Joungsu; Choi, Hae Jong; Lee, Youn Hab; Lee, Sarah; Lee, Choong Hwan; Kim, Chung Ho; Cheong, Jong-Joo; Choi, Yang Do; Song, Sang Ik

    2014-01-01

    Plant abiotic stress tolerance has been modulated by engineering the trehalose synthesis pathway. However, many stress-tolerant plants that have been genetically engineered for the trehalose synthesis pathway also show abnormal development. The metabolic intermediate trehalose 6-phosphate has the potential to cause aberrations in growth. To avoid growth inhibition by trehalose 6-phosphate, we used a gene that encodes a bifunctional in-frame fusion (BvMTSH) of maltooligosyltrehalose synthase (BvMTS) and maltooligosyltrehalose trehalohydrolase (BvMTH) from the nonpathogenic bacterium Brevibacterium helvolum. BvMTS converts maltooligosaccharides into maltooligosyltrehalose and BvMTH releases trehalose. Transgenic rice plants that over-express BvMTSH under the control of the constitutive rice cytochrome c promoter (101MTSH) or the ABA-inducible Ai promoter (105MTSH) show enhanced drought tolerance without growth inhibition. Moreover, 101MTSH and 105MTSH showed an ABA-hyposensitive phenotype in the roots. Our results suggest that over-expression of BvMTSH enhances drought-stress tolerance without any abnormal growth and showes ABA hyposensitive phenotype in the roots. PMID:24209631

  7. Genome-wide identification and expression profile analysis of citrus sucrose synthase genes: investigation of possible roles in the regulation of sugar accumulation.

    Directory of Open Access Journals (Sweden)

    Mohammad Zahidul Islam

    Full Text Available Sucrose synthase (Sus (EC 2.4.1.13 is a key enzyme for the sugar accumulation that is critical to form fruit quality. In this study, extensive data-mining and PCR amplification confirmed that there are at least six Sus genes (CitSus1-6 in the citrus genome. Gene structure and phylogeny analysis showed an evolutionary consistency with other plant species. The six Sus genes contain 12-15 exons and 11-14 introns and were evenly distributed into the three plant Sus groups (CitSus1 and CitSus2 in the Sus I group, CitSus3 and CitSus6 in the Sus II group, and CitSus4 and CitSus5 in the Sus III group. Transcripts of these six CitSus genes were subsequently examined. For tissues and organs, CitSus1 and 2 were predominantly expressed in fruit juice sacs (JS whereas CitSus3 and 4 were predominantly expressed in early leaves (immature leaves, and CitSus5 and 6 were predominantly expressed in fruit JS and in mature leaves. During fruit development, CitSus5 transcript increased significantly and CitSus6 transcript decreased significantly in fruit JS. In the fruit segment membrane (SM, the transcript levels of CitSus2 and 5 were markedly higher and the abundant levels of CitSus3 and 6 gradually decreased. Moreover, transcript levels of CitSus1-4 examined were higher and the CitSus5 transcript level was lower in the fruit SM than in fruit JS, while CitSus6 had a similar transcript level in fruit JS and SM. In addition, transcripts of CitSus1-6 responded differently to dehydration in mature leaves or to mild drought stress in fruit JS and SM. Finally, the possible roles of Sus genes in the regulation of sugar accumulation are discussed; however, further study is required.

  8. Second harmonic generation and crystal growth of new chalcone derivatives

    Science.gov (United States)

    Patil, P. S.; Dharmaprakash, S. M.; Ramakrishna, K.; Fun, Hoong-Kun; Sai Santosh Kumar, R.; Narayana Rao, D.

    2007-05-01

    We report on the synthesis, crystal structure and optical characterization of chalcone derivatives developed for second-order nonlinear optics. The investigation of a series of five chalcone derivatives with the second harmonic generation powder test according to Kurtz and Perry revealed that these chalcones show efficient second-order nonlinear activity. Among them, high-quality single crystals of 3-Br-4'-methoxychalcone (3BMC) were grown by solvent evaporation solution growth technique. Grown crystals were characterized by X-ray powder diffraction (XRD), laser damage threshold, UV-vis-NIR and refractive index measurement studies. Infrared spectroscopy, thermogravimetric analysis and differential thermal analysis measurements were performed to study the molecular vibration and thermal behavior of 3BMC crystal. Thermal analysis does not show any structural phase transition.

  9. Widespread Occurrence and Genomic Context of Unusually Small Polyketide Synthase Genes in Microbial Consortia Associated with Marine Sponges

    OpenAIRE

    Fieseler, L.; Hentschel, Ute; Grozdanov, L.; Schirmer, A; Wen, G; Platzer, M; Hrvatin, S.; Butzke, D.; Zimmermann, K.; Piel, J.

    2007-01-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge ...

  10. Synthesis of Novel Chalcones as Acetylcholinesterase Inhibitors

    Directory of Open Access Journals (Sweden)

    Thanh-Dao Tran

    2016-07-01

    Full Text Available A new series of benzylaminochalcone derivatives with different substituents on ring B were synthesized and evaluated as inhibitors of acetylcholinesterase. The study is aimed at identification of novel benzylaminochalcones capable of blocking acetylcholinesterase activity for further development of an approach to Alzheimer’s disease treatment. These compounds were produced in moderate to good yields via Claisen-Schmidt condensation and subjected to an in vitro acetylcholinesterase inhibition assay, using Ellman’s method. The in silico docking procedure was also employed to identify molecular interactions between the chalcone compounds and the enzyme. Compounds with ring B bearing pyridin-4-yl, 4-nitrophenyl, 4-chlorophenyl and 3,4-dimethoxyphenyl moieties were discovered to exhibit significant inhibitory activities against acetylcholinesterase, with IC50 values ranging from 23 to 39 µM. The molecular modeling studies are consistent with the hypothesis that benzylaminochalcones could exert their effects as dual-binding-site acetylcholinesterase inhibitors, which might simultaneously enhance cholinergic neurotransmission and inhibit β-amyloid aggregation through binding to both catalytic and peripheral sites of the enzyme. These derivatives could be further developed to provide novel leads for the discovery of new anti-Alzheimer drugs in the future.

  11. Synthesis of Chalcones with Anticancer Activities

    Directory of Open Access Journals (Sweden)

    Syam Mohan

    2012-05-01

    Full Text Available Several chalcones were synthesized and their in vitro cytotoxicity against various human cell lines, including human breast adenocarcinoma cell line MCF-7, human lung adenocarcinoma cell line A549, human prostate cancer cell line PC3, human adenocarcinoma cell line HT-29 (colorectal cancer and human normal liver cell line WRL-68 was evaluated. Most of the compounds being active cytotoxic agents, four of them with minimal IC50 values were chosen and studied in detail with MCF-7 cells. The compounds 1, 5, 23, and 25 were capable in eliciting apoptosis in MCF-7 cells as shown by multiparameter cytotoxicity assay and caspase-3/7, -8, and -9 activities (p < 0.05. The ROS level showed 1.3-fold increase (p < 0.05 at the low concentrations used and thus it was concluded that the compounds increased the ROS level eventually leading to apoptosis in MCF-7 cells through intrinsic as well as extrinsic pathways.

  12. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  13. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  14. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...... gene product had no PRPP synthase activity. In contrast, expression of five pairwise combinations of PRS genes resulted in the formation of active PRPP synthase. These combinations were PRS1 PRS2, PRS1 PRS3, and PRS1 PRS4, as well as PRS5 PRS2 and PRS5 PRS4. None of the remaining five possible pairwise...... combinations of PRS genes appeared to produce active enzyme. Extract of an E. coli strain containing a plasmid-borne PRS1 gene and a chromosome-borne PRS3 gene contained detectable PRPP synthase activity, whereas extracts of strains containing PRS1 PRS2, PRS1 PRS4, PRS5 PRS2, or PRS5 PRS4 contained no...

  15. Design and synthesis of chalcone-based macrocyclic polyethers

    Directory of Open Access Journals (Sweden)

    Subrata Jana

    2015-12-01

    Full Text Available A series of chalcone-based macrocyclic ethers have been synthesized. These macrocyclic ethers contain polyether as well as extended conjugation to the benzene ring to function as fluorescent sensor for cations. The modeling studies show that the chalcone part of the receptors remains partially out of plane from the polyether part and the keto moiety of the receptors always directed outwardly in the receptor itself. This may be changed during the recognition of metal ions. The tendency of the fluorophore, to be out of plane, increases with increasing the ring size.

  16. Synthesis and Biological Evaluation of Chalcone Derivatives Linked Triazoles

    OpenAIRE

    Ashvin D. Panchal; Prashant D. Kunjadia; Patel, Pravinkumar M.

    2011-01-01

    In this work, an attempt was made to synthesize chalcone 3-(Substitutedphenyl)-N-(4H-1, 2, 4-triazol-4-yl)acrylamide by condensation of substitutedbenzaldehyde with N-(4H-1,2,4-triazol-4-yl)acetamide under basic conditions. A simple condensation reaction of substitutedbenzaldehyde and N-(4H-1, 2, 4-triazol-4-yl)acetamide using Sodium hydroxide as a base was carried out for the study. The synthesized chalcone derivative was characterized by FTIR, 1H-NMR & 13C-NMR and studied for their Antimicr...

  17. A critical update on endothelial nitric oxide synthase gene variations in women with idiopathic recurrent spontaneous abortion: genetic association study, systematic review and meta-analyses.

    Science.gov (United States)

    Pereza, N; Peterlin, B; Volk, M; Kapović, M; Ostojić, S

    2015-05-01

    A number of case-control studies investigated the association between idiopathic recurrent spontaneous abortion (IRSA) and variations in the gene encoding endothelial nitric oxide synthase (NOS3), but yielded contradictory results. Our aim was to test the association of the NOS3 variable number of tandem repeats (VNTR) in intron 4 and +894 G/T single-nucleotide polymorphism (SNP) with IRSA in Slovenian women (148 IRSA and 149 control women), conduct a systematic review of literature on the association between NOS3 gene variations and IRSA, and perform meta-analyses of studies that met the inclusion criteria, defined by virtue of the European Society for Human Reproduction and Embryology evidence-based guidelines for recurrent spontaneous abortion. Genotyping was performed using PCR and restriction fragment length polymorphism methods. The systematic review of literature (English language) was conducted using PubMed and Scopus databases, to 1 November 2014. We determined no association of IRSA with the VNTR in intron 4 and +894 G/T SNP in Slovenian women. Furthermore, 16 case-control studies were identified on the association between 15 NOS3 gene variations and IRSA. However, significant inconsistencies exist in the selection criteria of patients and controls between studies. The meta-analysis of VNTR in intron 4 was performed on five studies (894 patients, 944 controls), whereas the meta-analysis of +894 G/T SNP included six studies (1111 patients, 1121 controls). The association with IRSA was significant for the +894 G/T SNP under the dominant genetic model (GT+TT versus GG) based on fixed (odds ratio (OR) = 1.54, 95% confidence interval (CI) = 1.28-1.86, P = <0.01) and random effects models (OR = 1.54, 95% CI = 1.03-2.31, P = 0.03). In conclusion, the GT and TT genotypes of the +894 G/T SNP in women might contribute to a predisposition to IRSA. Additional genetic association and functional studies in different populations with larger numbers of participants and a

  18. Gene cloning, structural gene and promoter identification, and active assay of the phosphatidylcholine synthase of Pseudomonas sp. strain 593.

    Science.gov (United States)

    He, Huoguang; Wu, Bin; Xiong, Min; Li, Yang; Wu, Wenhua; Wang, Xingguo

    2011-10-01

    Pseudomonas sp. strain 593, a soil bacterium, is able to use exogenous choline to synthesize phosphatidylcholine via phosphatidylcholine synthase (Pcs). A 2020 bp DNA fragment that hybridized to a Pcs probe was cloned. This fragment contained a large open reading frame (ORF) with two potential ATG start sites that would encode for 293 and 231 amino acid proteins. Fragments containing the two ORFs encoded Pcs when they were inserted into the expression vector pET23a and expressed under the control of the T7 promoter in Escherichia coli BL21(DE3) pLysS. However, when the two ORFs were inserted into the cloning vector pMD18-T and expressed without control of the plasmid promoter in E. coli DH5α, only the larger clone exhibited Pcs activity. This suggested that the larger fragment contained a native promoter driving expression of the smaller ORF. A promoter activity assay, in which DNA fragments were inserted into the promoter-probe plasmid pCB182 and β-galactosidase activity of E. coli transformants was tested, demonstrated that a promoter is indeed present in the DNA region. All results together indicate that the 696 bp ORF, not the larger 897 bp ORF, encodes the Pcs in Pseudomonas sp. strain 593 and carries a promoter in front of its 5' terminus. PMID:21939372

  19. Mutant dihydrofolate reductase-thymidylate synthase genes in pyrimethamine-resistant Plasmodium falciparum with polymorphic chromosome duplications.

    Science.gov (United States)

    Tanaka, M; Gu, H M; Bzik, D J; Li, W B; Inselburg, J

    1990-08-01

    We have identified dihydrofolate reductase (DHFR) gene point mutations and chromosomal changes in pyrimethamine-resistant mutants selected in vitro of Plasmodium falciparum strain FCR3. A pyrimethamine-resistant derivative of the pyrimethamine-sensitive strain FCR3, FCR3-D8, that had been grown in the absence of pyrimethamine for an extended time, was grown in two concentrations of pyrimethamine, and surviving drug-resistant parasites were subcloned. One selected mutant, FCR3-D81, that grew at 1 X 10(-6) M pyrimethamine, contained a single point mutation in the DHFR domain which caused an amino acid change (Phe to Ser) at amino acid 223, whereas another mutant, FCR3-D85, that grew at 5 X 10(-6) M pyrimethamine had that same mutation and an additional point mutation that changed amino acid 54 (Asp to Asn). The selection of FCR3-D85, whose nucleotide sequence was identical to that previously reported for FCR3-D8, confirmed that the original FCR3-D8 parasite population had changed during extended growth in vitro in the absence of drug pressure. FCR3-D81 and FCR3-D85 cells contained different pairs of polymorphic chromosomes that hybridized to a DHFR-TS probe as well as to three other chromosome 4 specific DNAs, indicating that at least part of chromosome 4 had been duplicated and that these parasites were aneuploid with 15 rather than 14 chromosomes. The mutant DHFR-TS genes were diploid. We consider the roles of the polymorphic chromosome duplications and DHFR point mutation(s) as causes of pyrimethamine resistance. PMID:2233901

  20. A cluster of three genes (dapA, orf2, and dapB) of Brevibacterium lactofermentum encodes dihydrodipicolinate synthase, dihydrodipicolinate reductase, and a third polypeptide of unknown function.

    OpenAIRE

    Pisabarro, A; Malumbres, M; Mateos, L M; Oguiza, J A; Martín, J F

    1993-01-01

    The dapA and dapB genes, encoding, respectively, dihydrodipicolinate synthase and dihydrodipicolinate reductase, the two first enzymes of the lysine branch of the aspartic amino acid family, were cloned from the DNA of the amino acid-producing bacterium Brevibacterium lactofermentum. The two genes were clustered in a 3.5-kb Sau3AI-BamHI fragment but were separated by an open reading frame of 750 nucleotides. The protein encoded by this open reading frame had little similarity to any protein i...

  1. Optional exon in the 5'-untranslated region of 3-hydroxy-3-methylglutaryl coenzyme A synthase gene: conserved sequence and splicing pattern in humans and hamsters

    International Nuclear Information System (INIS)

    3-Hydroxy-3-methylglutaryl coenzyme A synthase (hydroxymethylglutaryl-CoA synthase, EC 4.1.3.5) is a negatively regulated enzyme in the synthetic pathway for cholesterol, isopentenyl tRNA, and other isoprenoids. The 5'-untranslated region of the mRNA for Chinese hamster hydroxymethylglutaryl-CoA synthase contains an optional exon of 59 nucleotides located 10 nucleotides upstream of the translation start site. About 50% of the mRNAs contain this exon, and the other 50% lack it owing to differential intron splicing. The authors show that the two transcripts are found in similar ratios in multiple tissues of the Syrian hamster, including the brain. The relative amounts of the two transcripts in brain and liver are constant from day 0 to day 75 of life. A similar alternative splicing pattern for hydroxymethylglutaryl-CoA synthase was observed in three human tissues: cultured fibroblasts, fetal adrenal gland, and fetal liver. A cDNA for human synthase had 90% homology to the hamster sequence in the region corresponding to the optional exon. This sequence contains a 20 out of 26 nucleotide match with the sequence immediately upstream of the initiator AUG codon in the mRNA for hamster hydroxymethylglutaryl-CoA reductase, the enzyme that follows the synthase in the isoprenoid biosynthetic pathway. These findings raise the possibility that the optional exon plays an important, conserved functional role in humans and hamsters

  2. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-01-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  3. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1.

    Science.gov (United States)

    Brunetti, Patrizia; Zanella, Letizia; Proia, Alessandra; De Paolis, Angelo; Falasca, Giuseppina; Altamura, Maria Maddalena; Sanità di Toppi, Luigi; Costantino, Paolo; Cardarelli, Maura

    2011-11-01

    Previous studies demonstrated that expression of the Arabidopsis phytochelatin (PC) biosynthetic gene AtPCS1 in Nicotiana tabacum plants increases the Cd tolerance in the presence of exogenous glutathione (GSH). In this paper, the Cd tolerance of Arabidopsis plants over-expressing AtPCS1 (AtPCSox lines) has been analysed and the differences between Arabidopsis and tobacco are shown. Based on the analysis of seedling fresh weight, primary root length, and alterations in root anatomy, evidence is provided that, at relatively low Cd concentrations, the Cd tolerance of AtPCSox lines is lower than the wild type, while AtPCS1 over-expressing tobacco is more tolerant to Cd than the wild type. At higher Cd concentrations, Arabidopsis AtPCSox seedlings are more tolerant to Cd than the wild type, while tobacco AtPCS1 seedlings are as sensitive as the wild type. Exogenous GSH, in contrast to what was observed in tobacco, did not increase the Cd tolerance of AtPCSox lines. The PC content in wild-type Arabidopsis at low Cd concentrations is more than three times higher than in tobacco and substantial differences were also found in the PC chain lengths. These data indicate that the differences in Cd tolerance and in its dependence on exogenous GSH between Arabidopsis and tobacco are due to species-specific differences in the endogenous content of PCs and GSH and may be in the relative abundance of PCs of different length. PMID:21841172

  4. Ultrastructural and morphological changes in Leishmania (Viannia) braziliensis treated with synthetic chalcones.

    Science.gov (United States)

    de Mello, Tatiane F P; Cardoso, Bruna M; Bitencourt, Heriberto R; Donatti, Lucélia; Aristides, Sandra M A; Lonardoni, Maria V C; Silveira, Thais G V

    2016-01-01

    Cutaneous leishmaniasis has an estimated incidence of 1.5 million new cases per year and the treatment options available are old, expensive, toxic, and difficult to administer. Chalcones have shown good activity against several species of Leishmania. However few studies have discussed the mechanisms of action and drug target of this group of compounds in Leishmania. The synthetic chalcones that were evaluated in the present study were previously shown to exhibit activity against Leishmania (Viannia) braziliensis. The objective of the present study was to identify ultrastructural and morphological changes in L. (V.) braziliensis after treatment with three synthetic chalcones (1-3). Promastigotes were treated with chalcones 1-3 and evaluated by transmission and scanning electron microscopy. Cellular and nuclear morphology of the parasites, changes in membrane permeability, and DNA fragmentation in agarose electrophoresis gel were also investigated after exposure to synthetic chalcones. All three synthetic chalcones (1-3) induced ultrastructural alterations in mitochondria, intense vacuolization, two nuclei with rounding of parasites, and cellular and nuclear shrinkage. Chalcones 1-3 also induced no changes in membrane permeability, and presence of nucleosome-sized DNA fragments. Synthetic chalcones 1-3 induced ultrastructural and morphological changes, suggesting that chalcones 1-3 induce apoptosis-like cell death. Further studies should be conducted to elucidate other aspects of the action of these chalcones against Leishmania spp. and their use for the treatment of cutaneous leishmaniasis. PMID:26632504

  5. A new chalcone from the aerial roots of Ficus microcarpa

    Institute of Scientific and Technical Information of China (English)

    Hui Xu; Xiang Min Wang; Xing Wei; Jing Yuan Li; Ke Liu

    2009-01-01

    A new flavonoid with chalcone skeleton was isolated from the dried aerial roots of Ficus microcarpa.The structure of the compound was elucidated on the basis of spectral methods including ID and 2D NMR.The new compound showed weak inhibitory effect on nitric oxide production and cytotoxicity against K562 and PC3 ceils.

  6. Synthesis and Characterization of a-Bromo Chalcone Derivatives

    Institute of Scientific and Technical Information of China (English)

    BUDAK Yakup; CEYLAN Mustafa

    2009-01-01

    a-Bromo chalcones containing 2-thiene ring were prepared in good yields by the condensation of 1-(thien-3-yl)ethanone with aromatic aldehydes,followed by bromination with bromine and selective dehydrobromination with triethyl amine at room temperature.

  7. ANDROECHIN, A NEW CHALCONE GLUCOSIDE FROM ANDROGRAPHIS ECHIOIDES

    Institute of Scientific and Technical Information of China (English)

    B.JAYAPRAKASAM; D.GUNASEKAR; K.V.RAO; A.BLOND; B.BODO

    2001-01-01

    A new chalcone glucoside, androechin, and a known flavone glucoside, echioidinin 5-O-gluco side, were isolated from the whole plant of Andrographis echioides. Androechin was character ized as 2,2',6'-trihydroxy-4'-methoxychalcone 2'-O-,β-D-glucopyranoside by spectral and chemical studies.

  8. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41±5.34μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. PMID:26826492

  9. Versatile Enzyme Expression and Characterization System for Aspergillus nidulans, with the Penicillium brevicompactum Polyketide Synthase Gene from the Mycophenolic Acid Gene Cluster as a Test Case

    DEFF Research Database (Denmark)

    Hansen, Bjarne Gram; Salomonsen, Bo; Nielsen, Morten Thrane;

    2011-01-01

    Assigning functions to newly discovered genes constitutes one of the major challenges en route to fully exploiting the data becoming available from the genome sequencing initiatives. Heterologous expression in an appropriate host is central in functional genomics studies. In this context, filamen...

  10. Adolescent and adult responsiveness to the incentive value of cocaine reward in mice: role of neuronal nitric oxide synthase (nNOS) gene.

    Science.gov (United States)

    Balda, Mara A; Anderson, Karen L; Itzhak, Yossef

    2006-08-01

    A major concern in adolescent psychostimulant abuse is the long-term consequence of this practice, because early drug exposure may cause long-term adaptations, which render the organism more susceptible to drug abuse later in life. The incentive value of drug and natural reward in rodents is commonly assessed by the conditioned place preference (CPP) paradigm, which involves Pavlovian learning. The aims of the present study were to investigate: a) the acquisition, expression, maintenance and reinstatement of cocaine CPP from periadolescence (PD24-45) through adulthood (PD70); b) potential sexual dimorphism in adolescence and adulthood in response to cocaine-induced CPP; and c) the role of the neuronal nitric oxide synthase (nNOS) gene in long-term neural plasticity underlying responsiveness to cocaine and cocaine-associated cues. Adolescent wild type (WT) mice acquired significant cocaine (20 mg/kg) CPP that was maintained from PD24 through PD43. Upon extinction, CPP was reinstated in adulthood (PD70) following a priming injection of cocaine (5 mg/kg). In contrast, cocaine CPP acquired between PD26 and PD31 in adolescent nNOS knockout (KO) mice, was neither maintained nor reinstated by cocaine. There was no sexual dimorphism in adolescent WT and KO mice. Genotype differences and sexual dimorphism were observed in adult mice. Cocaine CPP in adult WT males (PD89-94) was maintained for 4 weeks post training, and subsequently reinstated by cocaine priming; the magnitude of CPP in adult WT males was lower than in female counterparts. CPP in adult KO males (PD88-93) was neither maintained nor reinstated by cocaine priming; in contrast, CPP in adult KO females was not significantly different from adult WT females. Results suggest that the nNOS gene is essential during adolescence of both sexes for the development of long-term neural plasticity underlying responsiveness to the incentive value of cocaine reward. Sexual dimorphism in response to cocaine CPP emerges in

  11. Methylation affects transposition and splicing of a large CACTA transposon from a MYB transcription factor regulating anthocyanin synthase genes in soybean seed coats.

    Directory of Open Access Journals (Sweden)

    Gracia Zabala

    Full Text Available We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-r(m is homozygous for a mutable allele (r(m that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-r(m line had a 13 kb CACTA subfamily transposon insertion (designated TgmR* at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3 to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-r(m progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element.

  12. Synthesis of Urea based Chalcone Derivatives and Evaluate its Biological Activity

    OpenAIRE

    Arpita Desai; Vyas, K. B.; Rajarshi N. Patel; K. S. Nimavat

    2016-01-01

    Chalcones have been the center of attraction for researchers from several decades due to nits innumerous therapeutic application, Efforts have been done in my research to synthesized chalcones and their derivatives that further reacts with various substituted aldehyde to give corresponding substituted chalcone derivatives. Now these derivatives on condensation with Guanidine nitrate gives the vast range of phenyl pyrimidine amine Derivatives. Structure elucidation of synthesized compound had ...

  13. IN VITRO SOLUBLE EPOXIDE HYDROLASE ENZYME INHIBITORY ACTIVITY OF SOME NOVEL CHALCONE DERIVATIVES

    OpenAIRE

    Kuppusamy Asokkumar; Lokeswari Prathyusha Tangella; Muthusamy Umamaheshwari; Thirumalaisamy Shivashanmugam; Varadharajan Subhadradevi; Puliyath Jagannath; Arumugam Madeswaran

    2012-01-01

    Objective Soluble epoxide hydrolase (sEH) belongs to the α/β -hydrolase superfamily, a subclass of α/β proteins. Chalcones are chemical compounds that show hopeful obliging efficacy in controlling numerous diseases. The main objective of the study is to evaluate the sEH inhibitory activity of some synthesized chalcone derivatives and identification of its mode of inhibition. Methods Four different chalcone derivatives (PC-1 to PC-4) were selected for synthesis by Claisen-Schmidt method. The i...

  14. Preparing Students for Research: Synthesis of Substituted Chalcones as a Comprehensive Guided-Inquiry Experience

    Science.gov (United States)

    Vyvyan, James R.; Pavia, Donald L.; Lampman, Gary M.; Kriz, George S., Jr.

    2002-09-01

    A guided inquiry experiment involving the synthesis and characterization of substituted benzalacetophenones (chalcones) is described. The chalcones are produced in the aldol condensation of substituted benzaldehydes with substituted acetophenones. Each student is assigned a different target chalcone and conducts online and printed literature searches on the target. After completing the synthesis and purification of their product, the students compare their data with those found in the literature.

  15. Biochemistry: Acetohydroxyacid Synthase

    Directory of Open Access Journals (Sweden)

    Pham Ngoc Chien

    2010-02-01

    Full Text Available Acetohydroxyacid synthase (AHAS, EC 2.2.1.6; formerly known as acetolactate synthase, ALS is a thiamin-and FAD-dependent enzyme which catalyses the first common step in the biosynthesis of the branched-chain amino acids (BCAA isoleucine, leucine and valine. The enzyme is inhibited by several commercial herbicides and has been studied over the last 20 to 30 years. A short introductory note about acetohydroxyacid synthase has been provided.

  16. Synthesis of novel chalcone derivatives and their stabilization effect of spiropyran in PMMA films

    Institute of Scientific and Technical Information of China (English)

    Zheng Kai Si; Qing Zhang; Min Zhao Xue; Yuan Yuan Zhu; Liang Ming; Qiao Rong Sheng; Yan Gang Liu

    2011-01-01

    Three novel bis-chalcone derivatives with different alkyldioxy spacers were synthesized and dispersed into polymethyl methacrylate (PMMA) chloroform solution with 6-nitro-1'-ethyl-3',3'-dimethylspiro-2H-1-benzopyran-2,2'-indoline (ESP) to prepare photochromic PMMA films in a facile way. After irradiation with 365 nm UV light, the photocrosslinking reaction between chalcone units was proved to retard the decolorization of merocyanine form of the photochromic spiropyran effectively, as results of the steric hindrance produced by photocycloaddition of chalcone groups. It has been found that the bis-chalcone molecule with the shortest spacer has the most effective stabilizing effect on retardation of decoloration of spiropyran.

  17. Synthesis, spectral correlation and insect antifeedant activities of some 2-benzimidazole chalcones

    Directory of Open Access Journals (Sweden)

    P. Janaki

    2016-01-01

    Full Text Available Some substituted styryl 2-benzimidazole ketones have been synthesised by fly-ash:H2SO4 catalysed aldol condensation of 2-benzimidazole methyl ketone and various substituted benzaldehydes in microwave oven. The yields of these chalcones are more than 70%. The purities of synthesised benzimidazole chalcones were checked by their physical constants and spectral data earlier published in the literature. The spectral frequencies of these chalcones have been correlated with Hammett substituent constants, F and R parameters. From the results of statistical analyses the effects of substituent on the group frequencies were discussed. The insect antifeedant activities of these chalcones have been studied using Dethler’s method.

  18. Synthesis, characterization and evaluation of antioxidant activities of some novel chalcones analogues

    OpenAIRE

    Lahsasni, Siham Abdelrahmane; Al Korbi, Faeza Hamad; Aljaber, Nabilah Abdel-Aziz

    2014-01-01

    Background Chalcone, an important intermediate of flavonoid synthetic pathway, has been shown to exhibit diverse biological and pharmacological activities such as anti- cancer, antioxidant, anti-inflammatory, etc. Results In this study, a novel series of chalcones fatty acid esters 5b-e and 6b-e have been synthesized via the reaction of the respective chalcones with either palmitic or stearic acid. Another related class of compounds comprising 2,3-disubstituted chalcones 7b-d and 8b(b’)-d as ...

  19. Catalytic Hydrogenation Reaction of Naringin-Chalcone. Study of the Electrochemical Reaction

    OpenAIRE

    B. A. López de Mishima; H. T. Mishima; A. N. Giannuzzo; M. A. Nazareno

    2000-01-01

    The electrocatalytic hydrogenation reaction of naringin derivated chalcone is studied. The reaction is carried out with different catalysts in order to compare with the classic catalytic hydrogenation.

  20. SYNTHESIS AND ANTIMICROBIAL ACTIVITY OF SOME CHALCONE DERIVATIVES AND THEIR COPPERCOMPLEXES

    Directory of Open Access Journals (Sweden)

    P. M. Rachmale

    2012-03-01

    Full Text Available In the present investigation, 4-chloro acetophenone on condensation with 2-nitro benzaldehydes in methanolic NaOH solution yielded the corresponding chalcone. These chalcone were further reacted with Isonicotyl hydrazide and semicarbazide in ethanol which led to the formation of chalcone Isonicotyl hydrazone and chalcone semicarbazone derivatives respectively. The newly synthesized derivatives and there copper complexes were characterized on the basis of their chemical properties and spectroscopic data such as IR, NMR and UV. All newly synthesized compounds were evaluated for their antibacterial activities against E. coli and S. aureus also for antifungal activities against P. notatum.

  1. Spectroscopic studies on the interaction between chalcone and bovine serum albumin

    International Nuclear Information System (INIS)

    The interaction between chalcone and bovine serum albumin (BSA) has been studied by spectroscopic techniques under physiological condition. By the analysis of fluorescence spectrum and fluorescence intensity, it was observed that the chalcone has a strong ability to quench the intrinsic fluorescence with BSA through a static quenching procedure and non-radiation energy transfer were the main reasons for the fluorescence quenching. The association constants of chalcone with BSA were determined at different temperatures based on fluorescence quenching results. The positive entropy change and enthalpy change indicated that the interaction of chalcone and BSA was driven mainly by hydrophobic forces. The process of binding was a spontaneous process in which Gibbs free energy change was negative. The distance, r, between donor (BSA) and acceptor (chalcone) was obtained according to the Forster's theory of non-radiation energy transfer. The UV–vis, CD, FT-IR, synchronous and 3-D spectral results revealed the changes in the secondary structure of BSA upon interaction with chalcone. The effects of some common metal ions on binding of BSA–chalcone complex were also investigated. -- Highlights: • We explored the interaction between chalcone and BSA by fluorescence spectroscopy. • The fluorescence quenching mechanism was static quenching. • The binding constants and thermodynamic parameters were calculated. • The interaction is driven mainly by hydrophobic force. • The binding of chalcone to BSA induced changes in the secondary structure of BSA

  2. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    Directory of Open Access Journals (Sweden)

    Mary Scruggs

    2008-04-01

    Full Text Available A polymerase chain reaction (PCR based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme, a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS gene (FUM1- previously FUM5 responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, and 12 of other Fusarium species. In addition, 13 species of other fungal genera, from four phyla, were tested as negative controls. Among the four sets, primer set B consistently amplified a 419- bp fragment from the DNA 96% of all F. verticillioides strains and 83% of F. proliferatum. All other fungi tested were negative using primer set B. A total of 38% of the F. verticillioides strains grown on a selective liquid medium produced fumonisin and 92% formed the toxin on standard rice medium. When fumonisin formed in culture, PCR assay using primer set B detected every strain of F. verticillioides, but only amplified 80% of F. proliferatum strains that produced the toxin. PCR detection was consistent at 100 pg/μl concentration of genomic DNA from 4 F. verticillioides strains, but varied at 10 pg/μl. Two duplicate greenhouse tests using artificially inoculated maize plants, had greater levels of F. verticillioides detected after re-evaluting using primer set B than from culturing of the tissues. The molecular protocols described in this study requires only 1 day for completion compared to approximately 10 days for cultural work and morphological determination. In conclusion, conventional PCR assay using primer set B provides a sensitive and accurate detection assay that can be used as a primary or secondary confirmation method for identification and occurrence of F. verticillioides within the maize tissues. However, studies using primer set B for

  3. Long-term memory of visually cued fear conditioning: roles of the neuronal nitric oxide synthase gene and cyclic AMP response element-binding protein.

    Science.gov (United States)

    Kelley, J B; Anderson, K L; Altmann, S L; Itzhak, Y

    2011-02-01

    Nitric oxide (NO) produced by neuronal nitric oxide synthase (nNOS) has a role in late-phase long-term potentiation (LTP) and long-term memory (LTM) formation. Our recent studies implicated NO signaling in contextual and auditory cued fear conditioning. The present study investigated the role of NO signaling in visually cued fear conditioning. First, visually cued fear conditioning was investigated in wild-type (WT) and nNOS knockout (KO) mice. Second, the effects of pharmacological modulators of NO signaling on the acquisition of visually cued fear conditioning were investigated. Third, plasma levels of corticosterone were measured to determine a relationship between physiological and behavioral responses to fear conditioning. Fourth, levels of extracellular signal-related kinase (ERK1/2) and cyclic AMP response element binding protein (CREB) phosphorylation, downstream of NO signaling, were determined in the amygdala as potential correlates of fear learning. Mice underwent single or multiple (4) spaced trainings that consisted of a visual cue (blinking light) paired with footshock. WT mice acquired cued and contextual LTM following single and multiple trainings. nNOS KO mice acquired neither cued nor contextual LTM following a single training; however, multiple trainings improved contextual but not cued LTM. The selective nNOS inhibitor S-methyl-thiocitrulline (SMTC) impaired cued and contextual LTM in WT mice. The NO donor molsidomine recovered contextual LTM but had no effect on cued LTM in nNOS KO mice. Re-exposure to the visual cue 24 h posttraining elicited freezing response and a marked increase in plasma corticosterone levels in WT but not nNOS KO mice. The expression of CREB phosphorylation (Ser-133) was significantly higher in naive nNOS KO mice than in WT counterparts, and pharmacological modulators of NO had significant effects on levels of CREB phosphorylation and expression. These findings suggest that visual cue-dependent LTM is impaired in nNOS KO

  4. Chlorobium tepidum mutant lacking bacteriochlorophyll c made by inactivation of the bchK gene, encoding bacteriochlorophyll c synthase

    DEFF Research Database (Denmark)

    Frigaard, Niels-Ulrik; Voigt, Ginny D; Bryant, Donald A

    2002-01-01

    The gene encoding bacteriochlorophyll (BChl) c synthase was identified by insertional inactivation in the photosynthetic green sulfur bacterium Chlorobium tepidum and was named bchK. The bchK mutant of C. tepidum was rusty-orange in color and completely lacked BChl c. Because of the absence of the...... found in the wild type, the bchK mutant should prove valuable for future analyses of the photosynthetic reaction center and of the roles of BChl a in photosynthesis in green bacteria. An evolutionary implication of our findings is that the photosynthetic ancestor of green sulfur bacteria could have...

  5. Co-expression of the carbamoyl-phosphate synthase 1 gene and its long non-coding RNA correlates with poor prognosis of patients with intrahepatic cholangiocarcinoma

    Science.gov (United States)

    MA, SEN-LIN; LI, AI-JUN; HU, ZHAO-YANG; SHANG, FU-SHENG; WU, MENG-CHAO

    2015-01-01

    The mechanisms leading to high rates of malignancy and recurrence of human intrahepatic cholangiocarcinoma (ICC) remain unclear. It is difficult to diagnose and assess the prognosis of patients with ICC in the clinic due to the lack of specific biomarkers. In addition, long non-coding RNAs (lncRNAs) have been reported to serve important roles in certain types of tumorigenesis however a role in ICC remains to be reported. The aim of the current study was to screen for genes and lncRNAs that are abnormally expressed in ICC and to investigate their biological and clinicopathological significance in ICC. The global gene and lncRNA expression profiles in ICC were measured using bioinformatics analysis. Carbamoyl-phosphate synthase 1 (CPS1) and its lncRNA CPS1 intronic transcript 1 (CPS1-IT1) were observed to be upregulated in ICC. The expression of CPS1 and CPS1-IT1 was measured in 31 tissue samples from patients with ICC and a number of cell lines. The effects of CPS1 and CPS1-IT1 on the proliferation and apoptosis of the ICC-9810 cell line were measured. In addition, the clinicopathological features and survival rates of patients with ICC with respect to the gene and lncRNA expression status were analyzed. CPS1 and CPS1-IT1 were co-upregulated in ICC tissues compared with non-cancerous tissues. Knockdown of CPS1 andor CPS1-IT1 reduced the proliferation and increased the apoptosis of ICC-9810 cells. Additionally, clinical analysis indicated that CPS1 and CPS1-IT1 were associated with poor liver function and reduced survival rates when the relative expression values were greater than 4 in cancer tissues. The comparisons between the high CPS1 expression group and the low expression group indicated significant differences in international normalized ratio (P=0.048), total protein (P=0.049), indirect bilirubin (P=0.025), alkaline phosphatase (P=0.003) and disease-free survival (P=0.034). In addition, there were differential trends in CA19-9 (P=0.068), globulin (P=0

  6. Methods for transient assay of gene function in floral tissues

    Directory of Open Access Journals (Sweden)

    Pathirana Nilangani N

    2007-01-01

    Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to

  7. Flavonoid Biosynthesis Genes Putatively Identified in the Aromatic Plant Polygonum minus via Expressed Sequences Tag (EST Analysis

    Directory of Open Access Journals (Sweden)

    Zamri Zainal

    2012-02-01

    Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.

  8. Synthesis and Cytotoxicity of Chalcones and 5-Deoxyflavonoids

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    2013-01-01

    Full Text Available Chalcones 1~8 and 5-deoxyflavonoids 9~22 were synthesized in good yields by aldol condensation, Algar-Flynn-Oyamada reaction, glycosidation, and deacetylation reaction, respectively, starting from 2-acetyl phenols substituted by methoxy or methoxymethoxy group and appropriately benzaldehydes substituted by methoxy, methoxymethoxy group, or chlorine. Among them, 13 and 17~22 are new compounds. The cytotoxicity bioassays of these chalcones and 5-deoxyflavonoids were screened using the sulforhodamine B (SRB protein staining method, and the results showed that compounds 2, 4, 5, 6, 10, 15, and 19 exhibited moderate cytotoxicity against the cancer cell line of MDA-MB-231, U251, BGC-823, and B16 in comparison with control drugs (HCPT, Vincristine, and Taxol.

  9. Synthesis and Biological Evaluation of Chalcone Derivatives Linked Triazoles

    Directory of Open Access Journals (Sweden)

    Ashvin D. Panchal

    2011-10-01

    Full Text Available In this work, an attempt was made to synthesize chalcone 3-(Substitutedphenyl-N-(4H-1, 2, 4-triazol-4-ylacrylamide by condensation of substitutedbenzaldehyde with N-(4H-1,2,4-triazol-4-ylacetamide under basic conditions. A simple condensation reaction of substitutedbenzaldehyde and N-(4H-1, 2, 4-triazol-4-ylacetamide using Sodium hydroxide as a base was carried out for the study. The synthesized chalcone derivative was characterized by FTIR, 1H-NMR & 13C-NMR and studied for their Antimicrobial and Antifungal activities and compared with the standard drugs, some compound of the series exhibited promising anti-microbial and anti-fungal activity compared to standard drugs.

  10. Anti-inflammatory cyclohexenyl chalcone derivatives in Boesenbergia pandurata.

    Science.gov (United States)

    Tuchinda, Patoomratana; Reutrakul, Vichai; Claeson, Per; Pongprayoon, Ubonwan; Sematong, Tuanta; Santisuk, Thawatchai; Taylor, Walter C

    2002-01-01

    The cyclohexenyl chalcone derivative [(-)-hydroxypanduratin A], together with the previously known panduratin A, sakuranetin, pinostrobin, pinocembrin, and dihydro-5,6-dehydrokawain were isolated from the chloroform extract of the red rhizome variety of Boesenbergia pandurata (Robx.) Schltr. [currently known as Boesenbergia rotunda (L.) Mansf., Kulturpfl.]. Their structures were assigned on the basis of their spectroscopic data. (-)-Hydroxypanduratin A and (-)-panduratin A showed significant topical anti-inflammatory activity in the assay of TPA-induced ear edema in rats. PMID:11809452

  11. Growth, characterization and nonlinear optical property of chalcone derivative

    Science.gov (United States)

    Indira, J.; Karat, P. Prakash; Sarojini, B. K.

    2002-07-01

    The synthesis of chalcone derivative compound is reported. The compound showed second harmonic generation conversion efficiency in powder form. Solubility of 1-(4-methoxyphenyl)-3-(phenyl)-2-propen-1-one in acetone was studied. Single crystals of the same compound was grown by slow evaporation technique using acetone as the solvent. Large crystal of size 55×33×5 mm 3 was obtained. The microhardness of the crystal was measured by Vickers hardness method.

  12. Synthesis and Antimicrobial Activity of Some Chalcone Derivatives

    OpenAIRE

    Prasad, Y. Rajendra; Rao, A. Lakshmana; Rambabu, R.

    2008-01-01

    In an effort to develop antimicrobial agents, a series of chalcones were prepared by Claisen-Schmidt condensation of appropriate acetophenones with appropriate aromatic aldehydes in the presence of aqueous solution of potassium hydroxide and ethanol at room temperature. The synthesized compounds were characterized by means of their IR, 1H-NMR spectral data and elemental analysis. All the compounds were tested for their antibacterial and antifungal activities by the cup plate method.

  13. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Science.gov (United States)

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming

    2016-01-01

    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato. PMID:27540389

  14. Solvent-dependent regioselective oxidation of trans-chalcones using aqueous hydrogen peroxide

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Wang; Jiabin, Yang; Lushen, Li, E-mail: jimin@seu.edu.cn [Southeast University, Nanjing (China). School of Biological Science and Medical Engineering; Jin, Cai; Chunlong, Sun; Min, Ji [Southeast University, Nanjing (China). School of Chemistry and Chemical Engineering

    2013-03-15

    A novel method for regioselective oxidation of trans-chalcones with hydrogen peroxide in acetonitrile to afford cinnamic acids is reported. Only trans-b-arylacrylic acids were observed. A wide range of functionalized products can be effectively produced from various chalcones in good to excellent yields. (author)

  15. Synthesis and In Vitro Cytotoxic Activity of Novel Chalcone-Like Agents

    Directory of Open Access Journals (Sweden)

    Bahram letafat

    2013-11-01

    We described synthesis and cytotoxic activity of poly-functionalized 3-benzylidenechroman-4-ones as new chalcone-like agents. These compounds can be considered as conformationally constrained congeners of chalcones to tolerate the poly-functionalization on the core structures for further optimization.

  16. Synthesis of Chiral Chalcone Derivatives Catalyzed by the Chiral Cinchona Alkaloid Squaramide

    Directory of Open Access Journals (Sweden)

    Dandan Xie

    2014-11-01

    Full Text Available An effective method has been developed for the preparation of novel chiral chalcone derivatives under mild conditions from the easily accessible starting materials nitromethane and chalcone derivatives 2. The corresponding products were obtained in moderate yields with excellent enantioselectivities (up to 99%.

  17. SYNTHESIS, CHARACTERIZATION AND BIOLOGICAL ACTIVITY OF SOME NOVEL ARYL AND HETROARYL CHALCONE ANALOGUES

    Directory of Open Access Journals (Sweden)

    Tribhuvan Singh

    2012-07-01

    Full Text Available A new series of Heterocyclic chalcones showed diversified biological activities. In view of potential biological activities of Heterocyclic chalcones derivative were prepared by claisen-Schmidt condensation technique. The compound were screened for anti-inflammatory and antibacterial activity.

  18. SYNTHESIS AND GREEN BROMINATION OF SOME CHALCONES AND THEIR ANTIMICROBIAL SCREENING

    OpenAIRE

    Mayur R. Adokar

    2013-01-01

    Chalcones are the versatile molecules having the structural flexibility which permits structural transformations into flavonoids, flavanones, pyrazoles, oxazoles, pyrimidines etc. Changes in their structure have offered the development of new medicinal agents having improved pharmacological potency. Their derivatives have attracts increasing attention due to numerous pharmacological potential. In the present communication we report the synthesis of chalcones from various acetophenone derivat...

  19. SYNTHESIS AND IR, NMR CARACTERISATION OF NEW P-(N,N-DIPHENYLAMINO) CHALCONES

    OpenAIRE

    Sîrbu Dumitru; Marin Ion

    2011-01-01

    This article reports on the high yield synthesis and novel chalcones with isothiocyanate and imidazol groups. The synthesis was started from N,N-diphenilamine and finished with 4-(N,N-diphenylamino)-4’-(2-thioxo-imidazolidin-4-one)-chalcone, where the cheap and accessible reagents were used.

  20. Synthesis of Chiral Chalcone Derivatives Catalyzed by the Chiral Cinchona Alkaloid Squaramide

    OpenAIRE

    Dandan Xie; Ying Xie; Yan Ding; Jian Wu; Deyu Hu

    2014-01-01

    An effective method has been developed for the preparation of novel chiral chalcone derivatives under mild conditions from the easily accessible starting materials nitromethane and chalcone derivatives 2. The corresponding products were obtained in moderate yields with excellent enantioselectivities (up to 99%).

  1. Discovery and structure activity relationships of 2-pyrazolines derived from chalcones from a pest management perspective

    Science.gov (United States)

    Synthesis of chalcones and 2-pyrazoline derivatives has been an active field of research due to the established pharmacological effects of these compounds. In this study, a series of chalcone (1a-i), 2-pyrazoline-1-carbothioamides (2a-i) and 2-pyrazoline-1-carboxamide derivatives (3a-g) were synthes...

  2. Mapping of the genes encoding human inducible and endothelial nitrix oxide synthase (NOS2 and NOS3) to the pericentric region of chromosome 17 and to chromosome 7, respectively

    Energy Technology Data Exchange (ETDEWEB)

    Xu, W.; Liu, L.; Emson, P. (Babraham Institute, Cambridge (United Kingdom)); Charles, I.G.; Moncada, S. (Wellcome Research Labs., Kent (United Kingdom)); Gorman, P.; Sheer, D. (Imperial Cancer Research Fund, London (United Kingdom))

    1994-05-15

    Nitric oxide (NO) is an important molecular messenger regulating the functions of a wide variety of cells and tissues. NO is synthesized from L-arginine by a variety of isoforms of the enzyme nitric oxide synthase (NOS). The authors have used Southern blotting analysis on DNAs obtained from a panel of human-rodent hybrid cell lines to map the gene encoding the inducible NOS (NOS2) to chromosome 17cen-17q11 and the gene encoding the endothelial form of NOS (NOS3) to chromosome 7. Fluorescence in situ hybridization using a NOS2 probe gave several signals in the 17p11-q11 pericentromeric region. 10 refs., 2 figs., 1 tab.

  3. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    International Nuclear Information System (INIS)

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I212121, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8

  4. Green synthesis of chalcones derivatives as intermediate of flavones and their antibacterial activities

    Science.gov (United States)

    VH, Elfi Susanti; Matsjeh, Sabirin; Wahyuningsih, Tutik Dwi; Mustofa, Redjeki, Tri

    2016-02-01

    Four chalcones derivatives have been synthesized from 3,4-dimethoxybenzaldehyde and acetophenone derivatives (2-hydroxy acetophenone, 2,4-dihydroxy acetophenone, 2,5-dihydroxy acetophenone and 2,6-dihydroxy acetophenone). The synthesis of these chalcones were conducted by Claisen-Schmidt condensation using grinding techniques at room temperature in the absence of solvents. The chalcones were prepared by grinding together equivalent amount of the approriate hydroxyacetophenone and 3,4-dimethoxybenzaldehyde in the presence of solid sodium hydroxide. Grinding techniques for synthesis of the chalcones derivatives is simple, efficient and environmentally benign compared to conventional methods. Then, the four chalcones derivatives undergo cyclization reactions to produce four flavones after reacted with iodine. The synthesized compounds were characterized by spectrometry (IR, 1H-NMR, 13C-NMR and MS).

  5. Green synthesis of chalcones derivatives as intermediate of flavones and their antibacterial activities

    International Nuclear Information System (INIS)

    Four chalcones derivatives have been synthesized from 3,4-dimethoxybenzaldehyde and acetophenone derivatives (2-hydroxy acetophenone, 2,4-dihydroxy acetophenone, 2,5-dihydroxy acetophenone and 2,6-dihydroxy acetophenone). The synthesis of these chalcones were conducted by Claisen-Schmidt condensation using grinding techniques at room temperature in the absence of solvents. The chalcones were prepared by grinding together equivalent amount of the approriate hydroxyacetophenone and 3,4-dimethoxybenzaldehyde in the presence of solid sodium hydroxide. Grinding techniques for synthesis of the chalcones derivatives is simple, efficient and environmentally benign compared to conventional methods. Then, the four chalcones derivatives undergo cyclization reactions to produce four flavones after reacted with iodine. The synthesized compounds were characterized by spectrometry (IR, 1H-NMR, 13C-NMR and MS)

  6. Green synthesis of chalcones derivatives as intermediate of flavones and their antibacterial activities

    Energy Technology Data Exchange (ETDEWEB)

    VH, Elfi Susanti, E-mail: elsantivh@yahoo.com; Redjeki, Tri, E-mail: tri-redjeki@yahoo.com [Universitas Sebelas Maret, Ir Sutami 36A Surakarta Indonesia, 57126 (Indonesia); Matsjeh, Sabirin, E-mail: sabirin-mara@yahoo.com; Wahyuningsih, Tutik Dwi, E-mail: mustofajogya@yahoo.co.id [Department of Chemistry FMJPA Universitas Gadjah Mada, Jl Sekip Utara, Yogyakarta Indonesia 55281 (Indonesia); Mustofa, E-mail: tutikdw@hotmail.com [Faculty of Medicine, Universitas Gadjah Mada, Yogyakarta Jl. Sekip Utara Yogyakarta Indonesia, 55281 (Indonesia)

    2016-02-08

    Four chalcones derivatives have been synthesized from 3,4-dimethoxybenzaldehyde and acetophenone derivatives (2-hydroxy acetophenone, 2,4-dihydroxy acetophenone, 2,5-dihydroxy acetophenone and 2,6-dihydroxy acetophenone). The synthesis of these chalcones were conducted by Claisen-Schmidt condensation using grinding techniques at room temperature in the absence of solvents. The chalcones were prepared by grinding together equivalent amount of the approriate hydroxyacetophenone and 3,4-dimethoxybenzaldehyde in the presence of solid sodium hydroxide. Grinding techniques for synthesis of the chalcones derivatives is simple, efficient and environmentally benign compared to conventional methods. Then, the four chalcones derivatives undergo cyclization reactions to produce four flavones after reacted with iodine. The synthesized compounds were characterized by spectrometry (IR, {sup 1}H-NMR, {sup 13}C-NMR and MS)

  7. 百合花青素苷合成酶基因片段的克隆及表达分析%Molecular Cloning and Expression Analysis of Anthocyanidin Synthase Gene Fragment in Lilium

    Institute of Scientific and Technical Information of China (English)

    王瑜; 崔金腾; 张克中; 贾月慧

    2013-01-01

    In order to obtain anthocyanidin synthase (ANS) gene from Lilium. degenerate primers were designed based on sequences blast of ANS genes from other species, and the fragment of ANS gene in Lilium was cloned by homology cloning method. The gene fragment was 701 bp encoding 233 amino acid proteins. Sequence alignment revealed that, the deduced amino acid sequence was 86%, 81% and 77% identical to Tulipa gesnerian, Iris hollandica and Prunus avium, respectively. The ANS expressed at different levels with the highest in petal, the second in leaf and stem. However, there' s no expression in bulb. ANS fragment was successfully cloned from Lilium through this research. This lays a solid foundation for cloning the full length cDNA sequence.%为了克隆百合花青素苷合成酶基因(anthocyanidin synthase,ANS),通过已报道的其他物种的ANS基因保守序列设计简并引物,采用同源克隆的方法成功克隆得到了百合ANS基因片段,该片段长701 bp,编码233个氨基酸残基.根据蛋白比对结果,百合ANS基因编码的氨基酸序列与郁金香、荷兰鸢尾、甜樱桃的一致性分别为86%、81%、77%.采用半定量RT-PCR法分析表明,该基因在百合花瓣中的表达水平最高,叶和茎次之,鳞茎中不表达.本研究从百合中分离得到了ANS基因片段,为后续获得基因全长打下了基础.

  8. Comparative transcriptome analysis of genes involved in anthocyanin biosynthesis in the red and yellow fruits of sweet cherry (Prunus avium L..

    Directory of Open Access Journals (Sweden)

    Hairong Wei

    Full Text Available Fruit color is one of the most important economic traits of the sweet cherry (Prunus avium L.. The red coloration of sweet cherry fruit is mainly attributed to anthocyanins. However, limited information is available regarding the molecular mechanisms underlying anthocyanin biosynthesis and its regulation in sweet cherry.In this study, a reference transcriptome of P. avium L. was sequenced and annotated to identify the transcriptional determinants of fruit color. Normalized cDNA libraries from red and yellow fruits were sequenced using the next-generation Illumina/Solexa sequencing platform and de novo assembly. Over 66 million high-quality reads were assembled into 43,128 unigenes using a combined assembly strategy. Then a total of 22,452 unigenes were compared to public databases using homology searches, and 20,095 of these unigenes were annotated in the Nr protein database. Furthermore, transcriptome differences between the four stages of fruit ripening were analyzed using Illumina digital gene expression (DGE profiling. Biological pathway analysis revealed that 72 unigenes were involved in anthocyanin biosynthesis. The expression patterns of unigenes encoding phenylalanine ammonia-lyase (PAL, 4-coumarate-CoA ligase (4CL, chalcone synthase (CHS, chalcone isomerase (CHI, flavanone 3-hydroxylase (F3H, flavanone 3'-hydroxylase (F3'H, dihydroflavonol 4-reductase (DFR, anthocyanidin synthase (ANS and UDP glucose: flavonol 3-O-glucosyltransferase (UFGT during fruit ripening differed between red and yellow fruit. In addition, we identified some transcription factor families (such as MYB, bHLH and WD40 that may control anthocyanin biosynthesis. We confirmed the altered expression levels of eighteen unigenes that encode anthocyanin biosynthetic enzymes and transcription factors using quantitative real-time PCR (qRT-PCR.The obtained sweet cherry transcriptome and DGE profiling data provide comprehensive gene expression information that lends insights

  9. Genetic organization of the cellulose synthase operon in Acetobacter xylinum.

    OpenAIRE

    Wong, H C; Fear, A L; Calhoon, R D; Eichinger, G H; Mayer, R; Amikam, D; Benziman, M; Gelfand, D H; Meade, J H; Emerick, A W

    1990-01-01

    An operon encoding four proteins required for bacterial cellulose biosynthesis (bcs) in Acetobacter xylinum was isolated via genetic complementation with strains lacking cellulose synthase activity. Nucleotide sequence analysis indicated that the cellulose synthase operon is 9217 base pairs long and consists of four genes. The four genes--bcsA, bcsB, bcsC, and bcsD--appear to be translationally coupled and transcribed as a polycistronic mRNA with an initiation site 97 bases upstream of the co...

  10. Genetic polymorphisms in vitamin D receptor, vitamin D-binding protein, Toll-like receptor 2, nitric oxide synthase 2, and interferon-γ genes and its association with susceptibility to tuberculosis

    Directory of Open Access Journals (Sweden)

    A.C.C.S. Leandro

    2009-04-01

    Full Text Available Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10, nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP. The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

  11. Identification of a 467 bp Promoter of Maize Phosphatidylinositol Synthase Gene (ZmPIS) Which Confers High-Level Gene Expression and Salinity or Osmotic Stress Inducibility in Transgenic Tobacco

    Science.gov (United States)

    Zhang, Hongli; Hou, Jiajia; Jiang, Pingping; Qi, Shoumei; Xu, Changzheng; He, Qiuxia; Ding, Zhaohua; Wang, Zhiwu; Zhang, Kewei; Li, Kunpeng

    2016-01-01

    Salinity and drought often affect plant growth and crop yields. Cloning and identification of salinity and drought stress inducible promoters is of great significance for their use in the genetic improvement of crop resistance. Previous studies showed that phosphatidylinositol synthase is involved in plant salinity and drought stress responses but its promoter has not been characterized by far. In the study, the promoter (pZmPIS, 1834 bp upstream region of the translation initiation site) was isolated from maize genome. To functionally validate the promoter, eight 5′ deletion fragments of pZmPIS in different lengths were fused to GUS to produce pZmPIS::GUS constructs and transformed into tobacco, namely PZ1–PZ8. The transcription activity and expression pattern obviously changed when the promoter was truncated. Previous studies have demonstrated that NaCl and PEG treatments are usually used to simulate salinity and drought treatments. The results showed that PZ1–PZ7 can respond well upon NaCl and PEG treatments, while PZ8 not. PZ7 (467 bp) displayed the highest transcription activity in all tissues of transgenic tobacco amongst 5′ deleted promoter fragments, which corresponds to about 20 and 50% of CaMV35S under normal and NaCl or PEG treatment, respectively. This implied that PZ7 is the core region of pZmPIS which confers high-level gene expression and NaCl or PEG inducible nature. The 113 bp segment between PZ7 and PZ8 (-467 to -355 bp) was considered as the key sequence for ZmPIS responding to NaCl or PEG treatment. GUS transient assay in tobacco leaves showed that this segment was sufficient for the NaCl or PEG stress response. Bioinformatic analysis revealed that the 113 bp sequence may contain new elements that are crucial for ZmPIS response to NaCl or PEG stress. These results promote our understanding on transcriptional regulation mechanism of ZmPIS and the characterized PZ7 promoter fragment would be an ideal candidate for the overexpression of

  12. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    Directory of Open Access Journals (Sweden)

    Ritland Carol

    2009-08-01

    Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

  13. Screening of UV-B-induced genes from apple peels by SSH: possible involvement of MdCOP1-mediated signaling cascade genes in anthocyanin accumulation.

    Science.gov (United States)

    Peng, Ting; Saito, Takanori; Honda, Chikako; Ban, Yusuke; Kondo, Satoru; Liu, Ji-Hong; Hatsuyama, Yoshimichi; Moriguchi, Takaya

    2013-07-01

    Suppression subtractive hybridization (SSH) was employed to identify candidate genes involved in red coloration in apple peel with the ultraviolet (UV)-B-treated 'Mutsu'. After reverse Northern blotting verification, nearly 80 clones were successfully sequenced. Large portions of the expressed sequence tags (ESTs) are well characterized anthocyanin biosynthesis-related genes, such as chalcone synthase (11A5), flavonol synthase (12F3), anthocyanidin synthase (11H5) and UDP-glycosyl transferase (14A12) whose presence proved the success of SSH. Eight ESTs were selected for quantitative real-time polymerase chain reaction analysis and their expressions were all elevated in 'Induction', further confirming the reliability of the SSH library. One EST, 11F4 (CONSTITUTIVE PHOTOMORPHOGENIC 1: COP1) with putative function in light signal relay was further analyzed in 'Mutsu' and 'Tsugaru', along with MdHY5 (ELONGATED HYPOCOTYL 5: the downstream target of COP1), MdMYB22 (a possible flavonol-specific activator under the regulation of HY5, belonging to the SG7/PRODUCTION OF FLAVONOL GLYCOSIDES family) and MdMYBA. Results showed that MdCOP1, MdHY5, MdMYB22 and MdMYBA were all UV-B inducible genes and anthocyanin accumulation occurred after their increased expressions. Moreover, their expressions and anthocyanin content were enhanced under UV-B plus 17°C treatment. The presence of G box, a known consensus binding site of HY5, in the MdMYBA promoter region implicated that it could be regulated by MdHY5, which was verified by the result of the yeast one-hybrid analysis. Our data suggested that UV-B irradiation would induce the utmost upstream light signaling factor, MdCOP1, which activates MdHY5 signaling by binding to the promoter regions of MdMYBs, and finally leads to the red coloration of apple peels. PMID:23171407

  14. Synthesis and Phase Transition Behaviours of New Chalcone Derivatives

    OpenAIRE

    S. T. Ha; Low, Y. W.

    2013-01-01

    A series of new chalcone derivatives with a general formula of C11H27COOC6H4COCH=CHC6H4X where X=F, Cl, Br, and NO2 were well synthesized and crystallized from organic solution. The physical properties as well as the chemical formulations of these compounds were determined by spectroscopic techniques (FTIR, and 1H and 13C NMR). Differential scanning calorimetry (DSC) and polarizing optical microscopy (POM) techniques were employed to study their transition temperatures and mesophase character...

  15. The Preparation of Some Novel Indazole Derivatives by Using Chalcones

    Institute of Scientific and Technical Information of China (English)

    Javad Safaei-Ghomi; Zohreh Alishahi

    2005-01-01

    @@ 1Introduction Indazole and its derivatives have little biological significance and have not been found in natural products due to the difficulty for living organisms to construct an N - N bond. Indazole derivatives exhibit variety of pharmacological properties such as anti-inflammatory, antidepressant, antitumor, antiarthritic and analgesic activities[1]. Different synthetic pathways generate these compounds. For instance, ring closure of pyrazole moiety, addition of hydrazine derivatives to carbonyl compounds[2] and cycloaddition reaction[3]. Herein, we report the synthesis of some new indazole derivatives by using chalcones as starting materials.

  16. Cloning of cycloartenol synthase gene from Eleutherococcus senticosus and its expression analysis%刺五加环阿屯醇合酶基因的克隆及其表达分析

    Institute of Scientific and Technical Information of China (English)

    邢朝斌; 龙月红; 吴鹏; 何闪; 朱金丽; 李宝财

    2012-01-01

    目的 克隆刺五加的环阿屯醇合酶(cycloartenol synthase,CAS)基因,并对其进行生物信息学和表达分析.方法 采用cDNA末端快速扩增(rapid amplification of cDNA ends,RACE)技术克隆刺五加CAS基因的全长cDNA序列.运用生物信息学方法对该基因进行分析,预测其编码蛋白的结构与功能,并通过RT-PCR法检测CAS在不同生长发育时期和不同器官中的表达情况.结果 刺五加CAS基因的cDNA全长为2758bp,开放阅读框长2 277 bp,编码758个氨基酸的蛋白,包含三萜合成酶的标志性序列.CAS蛋白无跨膜区域,定位于细胞质中.RT-PCR的结果显示,刺五加CAS基因在各时期和器官中均有表达,但表达量具有显著差异(P<0.05).其中果实基本成熟期的表达量最高,是最低量萌芽期的1.56倍,各器官中,叶片的表达量最高,是最低量叶柄的1.37倍.结论 首次分离并报道了刺五加的CAS cDNA克隆,并证实其在不同生长发育时期和不同器官中的表达量不同,为进一步研究CAS对刺五加皂苷量的影响和表达调控奠定基础.%Objective To clone cycloartenol synthase (CAS) gene from Eleutherococcus senticosus and analyze its bioinformatics and expression. Methods CAS gene full length cDNA was cloned by rapid amplification of cDNA ends (RACE). CAS gene was analyzed by bioinformatics method, and the structure and function of CAS gene were deduced. The expression of CAS in different organs of E.senticosus at various growing periods was detected by RT-PCR. Results The full length of CAS gene cDNA was 2 758 bp containing a 2 277 bp open reading frame (ORF) that encoded a protein of 758 amino acids includinng triterpene synthase signature sequence. Without transmembrane domain, CAS gene was located in cytoplasm. RT-PCR result showed that CAS gene expressed in different organs of E. senticosus at various growing periods showed significant difference (P < 0.05). The highest content of the expression showed up when the

  17. Synthesis and bioevaluation of substituted chalcones, coumaranones and other flavonoids as anti-HIV agents.

    Science.gov (United States)

    Cole, Amy L; Hossain, Sandra; Cole, Alex M; Phanstiel, Otto

    2016-06-15

    A series of chalcone, flavone, coumaranone and other flavonoid compounds were screened for their anti HIV-1 activity in two cell culture models using TZM-bl and PM1 cells. Within the systems evaluated, the most promising compounds contained either an α- or β-hydroxy-carbonyl motif within their structure (e.g., 8 and 9). Efficacious substituents were identified and used to design new HIV inhibitors with increased potency and lower cytotoxicity. Of the scaffolds evaluated, specific chalcones were found to provide the best balance between anti-HIV potency and low host cell toxicity. Chalcone 8l was shown to inhibit different clinical isolates of HIV in a dose-dependent manner (e.g., IC50 typically⩽5μM). Inhibition of HIV infection experiments using TZM-bl cells demonstrated that chalcone 8l and flavonol 9c had IC50 values of 4.7μM and 10.4μM, respectively. These insights were used to design new chalcones 8o and 8p. Rewardingly, chalcones 8o and 8p (at 10μM) each gave >92% inhibition of viral propagation without impacting PM1 host cell viability. Inhibition of viral propagation significantly increased (60-90%) when PM1 cells were pre-incubated with chalcone 8o, but not with the related flavonol 9c. These results suggested that chalcone 8o may be of value as both a HIV prophylactic and therapy. In summary, O-benzyl-substituted chalcones were identified as promising anti-HIV agents for future investigation. PMID:27161874

  18. CSD2, CSD3, and CSD4, genes required for chitin synthesis in Saccharomyces cerevisiae: the CSD2 gene product is related to chitin synthases and to developmentally regulated proteins in Rhizobium species and Xenopus laevis.

    OpenAIRE

    Bulawa, C E

    1992-01-01

    In Saccharomyces cerevisiae, chitin forms the primary division septum and the bud scar in the walls of vegetative cells. Three chitin synthetic activities have been detected. Two of them, chitin synthase I and chitin synthase II, are not required for synthesis of most of the chitin present in vivo. Using a novel screen, I have identified three mutations, designated csd2, csd3, and csd4, that reduce levels of chitin in vivo by as much as 10-fold without causing any obvious perturbation of cell...

  19. Stability of photochromism in new bifunctional copolymers containing spiropyran and chalcone moiety in the side chain

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Dong Hoon; Ban, Si Young; Kim, Jae Hong [Kyunghee Univ., Suwon (Korea, Republic of)

    2003-04-01

    We synthesized three copolymers bearing photochromic spiropyran dye and chalcone moiety in the side chain for studying the dynamic properties of their photochromism. They contain methacrylate-spiropyran (MA-spiropyran) and methacrylate-chalcone) (MA-chalcone) with the different concentration. The photosensitivity of the newly synthesized copolymers was investigated by using UV-Vis absorption spectroscopy. We absorbed photodimerization and phtochromic behavior under UV irradiation at the same time. The effect of photocrosslink on the rate and stability of photochromism in three copolymers was considered in this study. This study might be helpful to design photochromic materials for irreversible optical memory by virtue of photocrosslinking reaction.

  20. Stability of photochromism in new bifunctional copolymers containing spiropyran and chalcone moiety in the side chain

    International Nuclear Information System (INIS)

    We synthesized three copolymers bearing photochromic spiropyran dye and chalcone moiety in the side chain for studying the dynamic properties of their photochromism. They contain methacrylate-spiropyran (MA-spiropyran) and methacrylate-chalcone) (MA-chalcone) with the different concentration. The photosensitivity of the newly synthesized copolymers was investigated by using UV-Vis absorption spectroscopy. We absorbed photodimerization and phtochromic behavior under UV irradiation at the same time. The effect of photocrosslink on the rate and stability of photochromism in three copolymers was considered in this study. This study might be helpful to design photochromic materials for irreversible optical memory by virtue of photocrosslinking reaction

  1. Synthesis and biological evaluation of retinoid-chalcones as inhibitors of colon cancer cell growth

    OpenAIRE

    Mizuno, Cassia S.; Paul, Shiby; Suh, Nanjoo; Rimando, Agnes M.

    2010-01-01

    Based on the observed anticancer activity of chalcones and retinoids, a novel class of retinoid-chalcone hybrids was designed and synthesized. As part of our ongoing studies to discover natural product based anticancer compounds, the retinoid-chalcone hybrids were tested against the colon cancer cell line HT-29. Retinoid like moiety was introduced through Friedel-Crafts alkylation of toluene. Among the synthesized compounds, the cyano derivative (E)-3-(3-oxo-3-(3,5,5,8,8-pentamethyl-5,6,7,8-t...

  2. Synthesis of Urea based Chalcone Derivatives and Evaluate its Biological Activity

    Directory of Open Access Journals (Sweden)

    Arpita Desai

    2016-05-01

    Full Text Available Chalcones have been the center of attraction for researchers from several decades due to nits innumerous therapeutic application, Efforts have been done in my research to synthesized chalcones and their derivatives that further reacts with various substituted aldehyde to give corresponding substituted chalcone derivatives. Now these derivatives on condensation with Guanidine nitrate gives the vast range of phenyl pyrimidine amine Derivatives. Structure elucidation of synthesized compound had been made on the basis of element analysis, 1H NMR Spectra studies. The microbial activity of the synthesized compounds has been studied against the species bacillus subtillis, staphylococcus aureus, Escherichia coli, and salmonella typhi.

  3. Chalcones from Chinese liquorice inhibit proliferation of T cells and production of cytokines

    DEFF Research Database (Denmark)

    Barfod, Lea; Kemp, Kåre; Hansen, Majbritt;

    2002-01-01

    Licochalcone A (LicA), an oxygenated chalcone, has been shown to inhibit the growth of both parasites and bacteria. In this study, we investigated the effect of LicA and four synthetic analogues on the activity of human peripheral blood mononuclear cell proliferation and cytokine production. Four...... out of five chalcones tested inhibited the proliferation of lymphocytes measured by thymidine incorporation and by flow cytometry. The production of pro- and anti-inflammatory cytokines from monocytes and T cells was also inhibited by four of five chalcones. Furthermore, intracellular detection of...

  4. Molecular modeling based synthesis and evaluation of in vitro anticancer activity of indolyl chalcones.

    Science.gov (United States)

    Gaur, Rashmi; Yadav, Dharmendra K; Kumar, Shiv; Darokar, Mahendra P; Khan, Feroz; Bhakuni, Rajendra Singh

    2015-01-01

    A series of twenty one chalcone derivatives having indole moiety were synthesized and were evaluated against four human cancer cell lines. Indolyl chalcones 1a, 1b, 1d, 1f-1j, 2c, 2e, 2i showed good anticancer activity. Chalcones 1b and 1d were the most active and selective anticancer agents with IC50 values <1μg/ml and 1.51μg/ml, against WRL-68 cell line, respectively. Molecular mechanism was explored through in silico docking & ADMET studies. PMID:25860176

  5. SYNTHESIS AND GREEN BROMINATION OF SOME CHALCONES AND THEIR ANTIMICROBIAL SCREENING

    Directory of Open Access Journals (Sweden)

    Mayur R. Adokar

    2013-04-01

    Full Text Available Chalcones are the versatile molecules having the structural flexibility which permits structural transformations into flavonoids, flavanones, pyrazoles, oxazoles, pyrimidines etc. Changes in their structure have offered the development of new medicinal agents having improved pharmacological potency. Their derivatives have attracts increasing attention due to numerous pharmacological potential. In the present communication we report the synthesis of chalcones from various acetophenone derivatives with different aromatic aldehydes and green chemistry approach to their bromination with the help of Tetrabutylammonium Tribromide (TBATB. All the synthesized chalcone dibromides were screened for their antimicrobial activity against Aspergillus flavus, Rhizopus sp., Fusarium solani and Aspergillus niger.

  6. Development of fluorescent FeIII sensor based on chalcone

    Energy Technology Data Exchange (ETDEWEB)

    Wei Yanli, E-mail: weiyanli@sxu.edu.cn [Research Center of Environmental Science and Engineering, Shanxi University, Taiyuan 030006 (China); Qin Guojie [Institute of Horticulture, Shanxi Academy of Agriculture Science, Taiyuan 030031 (China); Wang Wenyan; Bian Wei; Shuang Shaomin [Research Center of Environmental Science and Engineering, Shanxi University, Taiyuan 030006 (China); Dong Chuan, E-mail: dc@sxu.edu.cn [Research Center of Environmental Science and Engineering, Shanxi University, Taiyuan 030006 (China)

    2011-08-15

    In this paper, 4-dimethylamino 2,5-dihydroxy chalcone (DMADHC), which exhibits excited state intramolecular charge transfer (ICT) characteristics, was synthesized and characterized. A sensitive optochemical sensor for Fe{sup 3+} ion was developed using DMADHC as fluorescence receptor. The fluorescence of DMADHC was gradually quenched with the addition of Fe{sup 3+} ion, which attributed to the formation of 1:1 complex between DMADHC and Fe{sup 3+} ion. The sensor exhibited excellent selectivity for Fe{sup 3+} ion over a large number of cation ions such as alkali, alkaline earth and transitional metal ions with a linear range of 3.984x10{sup -7}-1.135x10{sup -5} and a limit of detection of 8.223x10{sup -8} mol/L. On this basis, the sensor was preliminary applied to the determination of the content of iron ions in multi-vitamin tablet with satisfied results and the recoveries were in the 95-100% interval, and precision (n=5) was better than 5%. - Highlights: > A fluorescence receptor, 4-dimethylamino 2,5-dihydroxy chalcone was synthesis by one-step reaction. > Its intramolecular charge transfer fluorescence characteristics could be blocked by Fe{sup 3+} ion. > Based on this, an optochemical sensor for Fe{sup 3+} ion was developed. > Importantly, our proposed method is particularly useful for determination of Fe{sup 3+} ion in real sample.

  7. Synthesis and anticonvulsant activity of certain chalcone based pyrazoline compounds

    Directory of Open Access Journals (Sweden)

    Sudhakara Rao Gerapati

    2015-09-01

    Full Text Available Convulsions are involuntary, violent, spasmodic and prolonged contractions of skeletal muscles. That means a patient may have epilepsy without convulsions and vice versa. Epilepsy is a common neurological abnormality affecting about 1% of the world population. The primary objectives of these synthesized compounds are to suppress seizures and provide neuroprotection by minimizing the effects from seizure attacks. Here some of the chalcones and chalcone based various pyrazolines were evaluated for anticonvulsant activity. Their structures have been elucidated on the basis of elemental analyses and spectroscopic studies (IR, 1H-NMR & Mass spectroscopy. A preliminary evaluation of the prepared compounds has indicated that some of them exhibit moderate to significant anticonvulsant activity compared to a diazepam standard1-3.  All compounds were tested for their anticonvulsant activity using maximal electroshock induced convulsions (MES in mice at a dose level of 4 mg/kg.b.w. The compounds  Ph1, Ph2 , Py2 ,Py3 and Py4 have shown  to  good anticonvulsant activity when doses are administered as 25mg/ kg.b.w  , reduced the phases of seizures severity and  found to be active and also  increased survival rate. Remaining compounds are less efficacious.

  8. Combinatorial synthesis and antibacterial evaluation of an indexed chalcone library.

    Science.gov (United States)

    Ansari, Farzana Latif; Nazir, Samina; Noureen, Humaira; Mirza, Bushra

    2005-12-01

    A 120-membered chalcone library has been designed and prepared from six differently substituted acetophenones (A1-A6) and 20 benzaldehydes (B1-B20). The library was subjected to biological studies targeted against six bacterial strains. For the identification of the most-active member(s) of the library, the so-called indexed or positional-scanning method was applied. Six out of 26 sub-libraries, i.e., AL1-AL6, were synthesized by keeping the acetophenone moiety A fixed and using equimolar quantities of the 20 different benzaldehydes. The remaining 20 sub-libraries BL1-BL20 were prepared by keeping the benzaldehyde B component fixed and varying the six acetophenones (Table 1). The bactericidal activities of the resulting sub-libraries were tested and used as indices to the rows or columns of a two-dimensional matrix. Finally, parallel synthesis of 24 specific members with the highest-expected antibacterial activities, present in two sub-libraries, was carried out. These chalcones were screened again, and the results were exploited for establishing the structure-activity relationship (SAR) and the identification of the lead compound, which turned out to be 1,3-bis(2-hydroxyphenyl)prop-2-en-1-one (A2B2) in terms of activity towards Staphylococcus aureus and Bacillus subtilis (Tables 5-7). PMID:17191962

  9. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1carboxylate synthase gene expression and volatile compound emission during apple fruit maturation and ripening

    Science.gov (United States)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and ethylene purportedly regulates AAT gene expression. In this study, expession patterns of four apple AAT genes and two ethylene biosynthesis genes were investigated in two apple cultivars with relatively high ...

  10. Gene regulation of anthocyanin biosynthesis in two blood-flesh peach (Prunus persica (L.) Batsch) cultivars during fruit development.

    Science.gov (United States)

    Jiao, Yun; Ma, Rui-juan; Shen, Zhi-jun; Yan, Juan; Yu, Ming-liang

    2014-09-01

    The blood-flesh peach has become popular in China due to its attractive anthocyanin-induced pigmentation and antioxidant properties. In this study, we investigated the molecular mechanisms underlying anthocyanin accumulation by examining the expression of nine genes of the anthocyanin biosynthesis pathway found in the peach mesocarp. Expression was measured at six developmental stages in fruit of two blood-flesh and one white-flesh peach cultivars, using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Results show that the expression of the chalcone synthase (CHS) gene was closely related to anthocyanin accumulation in both of the blood-flesh peaches. In the white-flesh peach, we found that the transcription level of phenylalanine ammonia-lyase (PAL) during fruit development was much lower than that in the blood-flesh peach, even though all other genes of the anthocyanin biosynthesis pathway were highly expressed, suggesting that the PAL gene may be limiting in anthocyanin production in the white-flesh peach. Moreover, the transcription levels of the CHS and UDP-glucose-flavonoid 3-O-glucosyltransferase (UFGT) genes were markedly up-regulated at three days after bag removal (DABR) in the blood-flesh peach, suggesting that CHS and UFGT are the key genes in the process of anthocyanin biosynthesis for both of the blood-flesh peaches. The present study will be of great help in improving understanding of the molecular mechanisms involved in anthocyanin accumulation in blood-flesh peaches. PMID:25183035

  11. Analyses of C-Reactive Protein, Endothelial Nitric Oxide Synthase and Interleukin-6 Gene Polymorphisms in Adolescents with a Family History of Premature Coronary Artery Disease: A Pilot Study

    Science.gov (United States)

    Çelik, Ataç; Özçetin, Mustafa; Ateş, Ömer; Altunkaş, Fatih; Karaman, Kayıhan; Akar, İlker; İnce, İlker; Yalçın, Murat; Karayakalı, Metin; Ceyhan, Köksal; Koç, Fatih

    2015-01-01

    Background: Family history of premature atherosclerosis imposes a high risk to people. The relationship between atherosclerosis and gene polymorphisms of various biomarkers such as Endothelial Nitric Oxide Synthase (eNOS), C-Reactive Protein (CRP), and Interleukin-6 (IL-6) has shown in previous studies. Aims: The major aim of the study was to evaluate the CRP, eNOS, and IL-6 gene polymorphisms in a group of adolescents who have a parental history of early coronary artery disease (CAD). Study Design: Case-control study. Methods: Thirty-six volunteers with a father with obstructive CAD during the first four decades and 46 subjects with a father with normal coronary arteries documented with coronary angiography were included in the study. Polymerase chain reaction-restriction fragment length polymorphism techniques were used to analyze CRP, eNOS, and IL-6 polymorphisms. Results: We did not find any differences between the two groups with regard to age, sex, body mass index, renal functions, systolic and diastolic blood pressures, lipid profile, and fasting glucose, hemoglobin, and high sensitivity CRP. A significant difference was only observed in IL-6-572 G/C genotype distribution and allele frequency between two groups (Pc=0.036 OR=3.48 CI (95%) 1.17–10.32). Conclusion: The present study showed a significant association between the IL-6-572 G/C gene polymorphism (presence of C allele) and adolescents with a parental history of premature CAD. PMID:26740900

  12. Synthesis, crystal growth and studies on non-linear optical property of new chalcones

    Science.gov (United States)

    Sarojini, B. K.; Narayana, B.; Ashalatha, B. V.; Indira, J.; Lobo, K. G.

    2006-09-01

    The synthesis, crystal growth and non-linear optical (NLO) property of new chalcone derivatives are reported. 4-Propyloxy and 4-butoxy benzaldehydes were made to under go Claisen-Schmidt condensation with 4-methoxy, 4-nitro and 4-phenoxy acetophenones to form corresponding chalcones. The newly synthesized compounds were characterized by analytical and spectral data. The Second harmonic generation (SHG) efficiency of these compounds was measured by powder technique using Nd:YAG laser. Among tested compounds three chalcones showed NLO property. The chalcone 1-(4-methoxyphenyl)-3-(4-propyloxy phenyl)-2-propen-1-one exhibited SHG conversion efficiency 2.7 times that of urea. The bulk crystal of 1-(4-methoxyphenyl)-3-(4-butoxyphenyl)-2-propen-1-one (crystal size 65×28×15 mm 3) was grown by slow-evaporation technique from acetone. Microhardness of the crystal was tested by Vicker's microhardness method.

  13. Catalytic Hydrogenation Reaction of Naringin-Chalcone. Study of the Electrochemical Reaction

    Directory of Open Access Journals (Sweden)

    B. A. López de Mishima

    2000-03-01

    Full Text Available The electrocatalytic hydrogenation reaction of naringin derivated chalcone is studied. The reaction is carried out with different catalysts in order to compare with the classic catalytic hydrogenation.

  14. Research progress on nitric oxide synthase gene polymorphisms on systemic diseases and periodontitis%一氧化氮合成酶基因多态性在全身性疾病及牙周炎中的研究进展

    Institute of Scientific and Technical Information of China (English)

    侯海娟; 张洁

    2011-01-01

    一氧化氮合成酶(NOS)可分为3种:神经原性、内皮性和诱生性,NOS基因多态性主要表现在内皮性NOS.本文主要探讨NOS基因多态性与心血管疾病、糖尿病、牙周炎的密切关系.%Three isoforms of nitricoxide synthase (NOS) have been identified: Neuronal form, endothelial form, and inducible form. Endothelial nitric oxide synthase polymorphism is one of the most common forms. This review examines the association nitric oxide synthase gene polymorphisms and diseases including cardiovascular disease, diabetes and periodontitis.

  15. Activation of anthocyanin synthesis genes by white light in eggplant hypocotyl tissues, and identification of an inducible P-450 cDNA

    International Nuclear Information System (INIS)

    Eggplant seedlings (Solanum melongena) grown under red light irradiation showed a normal morphology with green, fully expanded cotyledons. When the seedlings grown under red light were irradiated with ultraviolet-containing white light, anthocyanin synthesis was induced in the hypocotyl tissues, especially when a UV light supplement was added. The accumulation of pigments was closely associated with the expression of genes involved in flavonoid synthesis. These genes include chalcone synthase (CHS) and dihydroflavonol 4-reductase (DFR). Using subtracted probes, which had been enriched for the accumulated mRNA, one white light-responsive cDNA was identified as being a P450 gene by comparison with database sequences. The maximal amino acid homology this cDNA had with other P450s was 36%. This was with CYP71 from avocado (Persea americana). Thus it represents a new P-450 family, which has been named CYP75. The mRNA of this gene was localized in the hypocotyl tissues of eggplant seedlings, which had been white light-irradiated. The transcript was accumulated by changing the light source, as in the case of other flavonoid biosynthesis genes. In delphinidin producing petunia plants, the mRNAs corresponding to the eggplant P-450 and flavonoid biosynthesis genes such as CHS and DFR were most abundant during the mid stage of flower bud development, but could not be detected in leaf tissues. These results suggest that this P-450 gene encodes a hydroxylating enzyme involved in flavonoid biosynthesis. (author)

  16. Optimisation of onion peroxidase-catalysed formation of aureusidin using 2',4',6',3,4-pentahydroxy chalcone as substrate

    Directory of Open Access Journals (Sweden)

    SONIA MOUSSOUNI

    2014-08-01

    Full Text Available Previous investigations demonstrated that crude peroxidase (POD obtained from onion solid wastes has the ability to catalyse the formation of the aurone aureusidin (ARS, using 2´,4´,6´,3,4-pentahydroxy chalcone (PHC as substrate, although this reaction under physiological conditions is mediated by a polyphenol oxidase-like enzyme, called aureusidin synthase (AS. In this study, a crude onion POD preparation was used to study the effect of some critical factors affecting the reaction, including reaction time, pH and temperature. The optimal set of conditions was identified by deploying central composite factorial design and response surface methodology. The results obtained showed that the optimum values for pH and temperature were 5 and 20°C, respectively, while time was found to exert a statistically non-significant effect. These values were the same or very close to optimal conditions found for structurally different onion POD substrates. The outcome was discussed with regard to the applicability of the onion POD as a versatile tool of biocatalysis.

  17. Conjugated Linoleic Acid (CLA) inhibits expression of the Spot 14 (THRSP) and fatty acid synthase genes and impairs the growth of human breast cancer and liposarcoma cells

    OpenAIRE

    Donnelly, Christina; Olsen, Arne M.; Lewis, Lionel D; Eisenberg, Burton L.; Eastman, Alan; Kinlaw, William B

    2009-01-01

    Spot 14 (THRSP, S14) is a nuclear protein involved in the regulation of genes required for fatty acid synthesis in normal and malignant mammary epithelial and adipose cells. Havartine and Bauman reported that conjugated linoleic acid (CLA) inhibits S14 gene expression in bovine mammary and mouse adipose tissues, and reduces milk fat production in cows. We hypothesized that CLA inhibits S14 gene expression in human breast cancer and liposarcoma cells, and that this will retard their growth. Ex...

  18. Evolution of the Chalcone Isomerase Fold from Fatty Acid-Binding to Stereospecific Enzyme

    OpenAIRE

    Ngaki, Micheline N.; Louie, Gordon V.; Philippe, Ryan N.; Manning, Gerard; Pojer, Florence; Bowman, Marianne E.; Li, Ling; Larsen, Elise; Wurtele, Eve Syrkin; Noel, Joseph P.

    2012-01-01

    Specialized metabolic enzymes biosynthesize chemicals of ecological importance, often sharing a pedigree with primary metabolic enzymes 1 . However, the lineage of the enzyme chalcone isomerase (CHI) remained a quandary. In vascular plants, CHI-catalyzed conversion of chalcones to chiral (S)-flavanones is a committed step in the production of plant flavonoids, compounds that contribute to attraction, defense 2 , and development 3 . CHI operates near the diffusion limit with stereospecific con...

  19. Biological and structure-activity evaluation of chalcone derivatives against bacteria and fungi

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Wender A.; Andrade, Carlos Kleber Z.; Napolitano, Hamilton B., E-mail: wender@unb.br, E-mail: ckleber@unb.br [Universidade de Brasilia (LaQMOS/UnB), DF (Brazil). Inst. de Quimica; Vencato, Ivo; Castro, Miriam R.C. de; Camargo, Ademir J. [Universidade Estadual de Goias (UEG), Anapolis, GO (Brazil). Ciencias Exatas e Tecnologicas; Lariucci, Carlito [Universidade Estadual de Goias (UEG), Goiania, GO (Brazil). Inst. de Fisica

    2013-01-15

    The present work describes the antibacterial and antifungal activities of several chalcones obtained by a straight Claisen-Schmidt aldol condensation determined by the minimal inhibitory concentration against different microorganisms (Gram-positive and Gram-negative bacteria and fungi). Solid state crystal structures of seven chalcones were determined by X-ray diffraction (XRD) analysis. Chemometric studies were carried out in order to identify a potential structure activity relationship. (author)

  20. New indolizine-chalcones as potent inhibitors of human farnesyltransferase: Design, synthesis and biological evaluation.

    Science.gov (United States)

    Moise, Iuliana-Monica; Ghinet, Alina; Belei, Dalila; Dubois, Joëlle; Farce, Amaury; Bîcu, Elena

    2016-08-01

    A new family of indolizine-chalcones was designed, synthesized and screened for the inhibitory potential on human farnesyltransferase in vitro to identify potent antitumor agents. The most active compound was phenothiazine 2a, exhibiting an IC50 value in the low nanomolar range, similar to that of known FTI-276, highly potent farnesyltransferase inhibitor. The newly synthesized indolizine-chalcones 2a-d constitute the most efficient inhibitors of farnesyltransferase bearing a phenothiazine unit known to date. PMID:27282741

  1. Synthesis, in vitro antimalarial activity and cytotoxicity of novel 4-aminoquinolinyl-chalcone amides

    OpenAIRE

    Smit, Frans J; N'Da, David D.

    2014-01-01

    A series of 4-aminoquinolinyl-chalcone amides 11–19 were synthesized through condensation of carboxylic acid-functionalized chalcone with aminoquinolines, using 1,10-carbonyldiimidazole as coupling agent. These compounds were screened against the chloroquine sensitive (3D7) and chloroquine resistant (W2) strains of Plasmodium falciparum. Their cytotoxicity towards the WI-38 cell line of normal human fetal lung fibroblast was determined. All compounds were found active, with IC50 v...

  2. Synthesis and Antibacterial Activity of Some Heterocyclic Chalcone Analogues Alone and in Combination with Antibiotics

    OpenAIRE

    Tuong-Ha Do; Thi-Ngoc-Phuong Huynh; Khac-Minh Thai; Cat-Dong Tran; Thanh-Dao Tran; Thi-Thao-Nhu Nguyen

    2012-01-01

    A series of simple heterocyclic chalcone analogues have been synthesized by Claisen Schmidt condensation reactions between substituted benzaldehydes and heteroaryl methyl ketones and evaluated for their antibacterial activity. The structures of the synthesized chalcones were established by IR and 1H-NMR analysis. The biological data shows that compounds p5, f6 and <...

  3. Synthesis and In Vitro Cytotoxic Activity of Novel Chalcone-Like Agents

    OpenAIRE

    Bahram letafat; Raheleh Shakeri; Saeed Emami; Saeedeh Noushini; Negar Mohammadhosseini; Nayyereh Shirkavand; Sussan Kabudanian Ardestani; Maliheh Safavi; Marjaneh Samadizadeh; Aida Letafat; Abbas Shafiee; Alireza Foroumadi

    2013-01-01

      Objective(s): Chalcones and their rigid analogues represent an important class of small molecules having anticancer activities. Therefore, in this study the synthesis and cytotoxic activity of new 3-benzylidenchroman-4-ones were described as rigid chalcone analogues.   Materials and Methods: The reaction of resorcinol with 3-chloropropionic acid in the presence of CF3SO3H was afforded corresponding propiophenone. It was cyclized using 2M NaOH to give 7-hydroxy-4-chroman...

  4. Biological and structure-activity evaluation of chalcone derivatives against bacteria and fungi

    International Nuclear Information System (INIS)

    The present work describes the antibacterial and antifungal activities of several chalcones obtained by a straight Claisen-Schmidt aldol condensation determined by the minimal inhibitory concentration against different microorganisms (Gram-positive and Gram-negative bacteria and fungi). Solid state crystal structures of seven chalcones were determined by X-ray diffraction (XRD) analysis. Chemometric studies were carried out in order to identify a potential structure activity relationship. (author)

  5. Chalcone-Induced Apoptosis through Caspase-Dependent Intrinsic Pathways in Human Hepatocellular Carcinoma Cells

    Science.gov (United States)

    Ramirez-Tagle, Rodrigo; Escobar, Carlos A.; Romero, Valentina; Montorfano, Ignacio; Armisén, Ricardo; Borgna, Vincenzo; Jeldes, Emanuel; Pizarro, Luis; Simon, Felipe; Echeverria, Cesar

    2016-01-01

    Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers worldwide. Chemoprevention of HCC can be achieved through the use of natural or synthetic compounds that reverse, suppress or prevent the development of cancer progression. In this study, we investigated the antiproliferative effects and the mechanism of action of two compounds, 2,3,4′-trimethoxy-2′-hydroxy-chalcone (CH1) and 3′-bromo-3,4-dimethoxy-chalcone (CH2), over human hepatoma cells (HepG2 and Huh-7) and cultured mouse hepatocytes (HepM). Cytotoxic effects were observed over the HepG2 and Huh-7, and no effects were observed over the HepM. For HepG2 cells, treated separately with each chalcone, typical apoptotic laddering and nuclear condensation were observed. Additionally, the caspases and Bcl-2 family proteins activation by using Western blotting and immunocytochemistry were studied. Caspase-8 was not activated, but caspase-3 and -9 were both activated by chalcones in HepG2 cells. Chalcones also induced reactive oxygen species (ROS) accumulation after 4, 8 and 24 h of treatment in HepG2 cells. These results suggest that apoptosis in HepG2 was induced through: (i) a caspase-dependent intrinsic pathway; and (ii) by alterations in the cellular levels of Bcl-2 family proteins, and also, that the chalcone moiety could be a potent candidate as novel anticancer agents acting on human hepatomas. PMID:26907262

  6. Glycogen synthase kinase 3: more than a namesake

    OpenAIRE

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-01-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, τ protein and β catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as...

  7. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    International Nuclear Information System (INIS)

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  8. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  9. Molecular cloning and expression analysis of dihydroflavonol 4-reductase gene in flower organs of Forsythia x intermedia.

    Science.gov (United States)

    Rosati, C; Cadic, A; Duron, M; Renou, J P; Simoneau, P

    1997-10-01

    The expression, during flower development, of the gene encoding the anthocyanin pathway key enzyme dihydroflavonol 4-reductase (DFR) was investigated in floral organs of Forsythia x intermedia cv. 'Spring Glory'. Full-length DFR and partial chalcone synthase (CHS) cDNAs, the gene of interest and a flavonoid pathway control gene respectively, were obtained from petal RNA by reverse transcription PCR. Whereas for CHS northern blot analysis enabled the study of its expression pattern, competitive PCR assays were necessary to quantify DFR mRNA levels in wild-type plants and in petals of 2 transgenic clones containing a CaMV 35S promoter-driven DFR gene of Antirrhinum majus. Results indicated a peak of CHS and DFR transcript levels in petals at the very early stages of anthesis, and different expression patterns in anthers and sepals. In comparison to wild-type plants, transformants showed a more intense anthocyanin pigmentation of some vegetative organs, and a dramatic increase in DFR transcript concentration and enzymatic activity in petals. However, petals of transformed plants did not accumulate any anthocyanins. These results indicate that other genes and/or regulatory factors should be considered responsible for the lack of anthocyanin production in Forsythia petals. PMID:9349254

  10. Impact of L-Carnitine and Cinnamon on Insulin-Like Growth Factor-1 and Inducible Nitric Oxide Synthase Gene Expression in Heart and Brain of Insulin Resistant Rats

    Directory of Open Access Journals (Sweden)

    Mona A. Mohamed

    2010-01-01

    Full Text Available Problem statement: Evaluate the effects of daily administration of L-carnitine and cinnamon extract for two weeks on the expression of Insulin-like Growth Factor-1 (IGF-1 and inducible Nitric Oxide Synthase (iNOS genes in cardiac and brain tissues of rats with Insulin Resistance (IR. Approach: Rats were divided into 4 groups (8 animals each: Group (1 rats fed control diet (60% starch as control while groups (2, 3 and 4 fed high fructose diet (60% fructose. At the beginning of the 3rd week of feeding, rats of group (3 were treated with L-carnitine (300 mg kg-1 body weight/day, i.p. and animals of group (4 received a daily oral dose of cinnamon aqueous extract (0.5 mL rat-1. The animals were maintained in their respective groups for 4 weeks. Results: Feeding high fructose diet causes significant reduction in Insulin Receptor Substrate-1 (IRS-1 (amounted 30.65% and elevation in iNOS expression (reached 51% in the cardiac tissues as compared to control. In brain tissues, the IGF-1 mRNA was reduced in fructose loaded groups (28.81%. Administration of either L-carnitine or cinnamon extract significantly improves the expression of the cardiac studied genes but with no effects on the brain tissues. Conclusion: The present study illustrated that CE was more potent than L-carnitine in improving the IR.

  11. Endothelial Nitric Oxide Synthase T-786C Mutation, Prothrombin Gene Mutation (G-20210-A and Protein S Deficiency Could Lead to Myocardial Infarction in a Very Young Male Adult

    Directory of Open Access Journals (Sweden)

    Milka Klincheva

    2016-01-01

    Full Text Available INTRODUCTION: Myocardial infarction is a rare medical event in young people. The main reasons include congenital coronary abnormalities, coronary artery spasm, and coronary thrombosis due to hypercoagulable states (hereditary and acquired. AIM: We present a case of a young male adult with myocardial infarction caused by a combination of gene mutations and anticoagulation protein deficiency. CASE PRESENTATION: A 19 years old young man was admitted to our hospital complaining of chest pain during the last two weeks. The patient did not have any known cardiovascular risk factors, except a positive family anamnesis. Subacute inferior nonST segment myocardial infarction was diagnosed according to the patient’s history, electrocardiographic and laboratory findings. Coronary angiography revealed suboclusive thrombus in the proximal, medial and distal part of the right coronary artery (TIMI 2. Percutaneous coronary intervention was performed. Anticoagulant and antiagregant therapy (heparin, acetilsalicilic acid and clopidogrel according to protocol was started. The hospital stay was uneventful. Homozygous endothelial nitric oxid synthase (eNOS T-786-C mutation, heterozygote prothrombin gene mutation (G-20210-A, and protein S deficiency were verified from the thrombophilia testing. Other trombophilic tests were normal. Three months after discharge from hospital another coronary angiography was performed. It revealed normal coronary arteries. Four years after the attack, the patient is free of symptoms and another cardiovascular event. CONCLUSION: Combination of genetic mutations and anticoagulation protein deficiency could be a reasonable cause for myocardial infarction in a very young male adult without any other cardiovascular risk factors.

  12. Solvent-free Michael addition reaction of fluorene with chalcon

    Institute of Scientific and Technical Information of China (English)

    Fu Feng

    2011-01-01

    A series of novel Michael addition products of fluorene to chalcone were obtained in the presence of sodium hydroxide under solvent-free condition. The advantages of this procedure were mild reaction conditions, simple protocol, and high yields. The structures of the products were characterized by IR, 1H NMR, MS and X-ray diffraction. The crystal of the new compound 3 h is y= 64.2440(10)°, V = 2.4137(3) nm3, Z= 4, Dc=1.220 g/cm3, μ = 0.286 mm-1, F(000) = 920, R = 0.0656 and wR = 0.1554 for 5664 observed reflection with I > 2σ(I).

  13. Second harmonic chalcone crystal: Synthesis, growth and characterization

    Energy Technology Data Exchange (ETDEWEB)

    D' Silva, E.D., E-mail: deepak.dsilva@gmail.co [Department of studies in Physics, Mangalore University, Mangalagangotri, Mangalore 574199 (India); Narayan Rao, D. [School of Physics, University of Hyderabad, Hyderabad 500046 (India); Philip, Reji [Light and Matter Physics Group, Raman Research Institute, Bangalore 560080 (India); Butcher, Ray J. [Department of Chemistry, Howard University, Washington, DC 20059 (United States); Rajnikant [Department of Physics and Electronics, University of Jammu, Jammu Tawi 180006 (India); Dharmaprakash, S.M. [Department of studies in Physics, Mangalore University, Mangalagangotri, Mangalore 574199 (India)

    2011-05-15

    The novel nonlinear optical chalcone derivative (2E)-3-[4-(methylsulfanyl)phenyl]-1-(3-bromophenyl)prop-2-en-1-one (3Br4MSP) crystals have been grown by slow evaporation technique at ambient temperature. The crystal was subjected to different types of characterization method in order to study its possible application in nonlinear optics. The structure determination of the grown crystal was done by single crystal X-ray diffraction study. The morphology of the crystal is studied. The crystal was subjected to thermal analysis to find its thermal stability. The grown crystals were characterized for their optical transmission and mechanical hardness. The second harmonic generation (SHG) efficiency of the crystal is obtained by classical powdered technique. The laser damage threshold for 3Br4MSP crystal was determined using Q-switched Nd:YAG laser.

  14. Second harmonic chalcone crystal: Synthesis, growth and characterization

    Science.gov (United States)

    D'silva, E. D.; Narayan Rao, D.; Philip, Reji; Butcher, Ray J.; Rajnikant; Dharmaprakash, S. M.

    2011-05-01

    The novel nonlinear optical chalcone derivative (2 E)-3-[4-(methylsulfanyl)phenyl]-1-(3-bromophenyl)prop-2-en-1-one (3Br4MSP) crystals have been grown by slow evaporation technique at ambient temperature. The crystal was subjected to different types of characterization method in order to study its possible application in nonlinear optics. The structure determination of the grown crystal was done by single crystal X-ray diffraction study. The morphology of the crystal is studied. The crystal was subjected to thermal analysis to find its thermal stability. The grown crystals were characterized for their optical transmission and mechanical hardness. The second harmonic generation (SHG) efficiency of the crystal is obtained by classical powdered technique. The laser damage threshold for 3Br4MSP crystal was determined using Q-switched Nd:YAG laser.

  15. Cationic chalcone antibiotics. Design, synthesis, and mechanism of action.

    Science.gov (United States)

    Nielsen, Simon F; Larsen, Mogens; Boesen, Thomas; Schønning, Kristian; Kromann, Hasse

    2005-04-01

    This paper describes how the introduction of "cationic" aliphatic amino groups in the chalcone scaffold results in potent antibacterial compounds. It is shown that the most favorable position for the aliphatic amino group is the 2-position of the B-ring, in particular in combination with a lipophilic substituent in the 5-position of the B-ring. We demonstrate that the compounds act by unselective disruption of cell membranes. Introduction of an additional aliphatic amino group in the A-ring results in compounds that are selective for bacterial membranes combined with a high antibacterial activity against both Gram-positive and -negative pathogens. The most potent compound in this study (78) has an MIC value of 2 muM against methicillin resistant Staphylococus aureus. PMID:15801857

  16. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P; Vestergaard, H; Hansen, Torben; Zierath, J; Pedersen, O

    1994-01-01

    '-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582......, -16, -43, -143, and -250. The three most common variants could be excluded for having major impact on allele-specific GS mRNA expression in muscle. Scanning of GS cDNA revealed one frequent silent polymorphism at codon 342. Moreover, SSCP analysis of approximately 900 bp of the promoter, the 5...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  17. A study on CYP1A inhibitory action of E-2-(4'-methoxybenzylidene)-1-benzosuberone and some related chalcones and cyclic chalcone analogues

    International Nuclear Information System (INIS)

    In vivo investigation of E-2-(4'-methoxybenzylidene)-1-benzosuberone (4a) on the 7,12-dimethylbenz[a]anthracene (DMBA)-induced onco/tumor suppressor gene expressions suggested that inhibition of metabolic activation of DMBA might play a role in the observed activity of the compound. In order to explore this possible biological action we have investigated whether 4a and some of its structurally related analogues had inhibitory effects on the CYP1A enzymes. During our study 7-ethoxyresorufin O-dealkylation activity of CYP1A isoenzymes was measured in liver microsomes prepared from 3-methylcholanthrene treated male rats. Inhibition constants (Ki values) were determined by using different concentrations of 7-ethoxyresorufin and the investigated chalcones (1), E-2-benzylidene-1-indanones (2), -tetralones (3) and -benzosuberones (4). Each compound was found to be a strong competitive inhibitor of the CYP1A enzymes. Their inhibitory activity was comparable with or even higher than that of 7,8-benzoflavone, the known strong CYP1A inhibitor used as reference substance. By proper selection of the substituents on the benzylidene moiety we investigated how the inhibitory activity (Ki value) of 1-4 varied as a function of the ring size (n=0, 5, 6, 7) carbon atoms, and the nature as well as the position of the substituents. To test applicability of the previously set structural requirements for binding of xenobiotics to the CYP1A enzymes we compared some topological, physico-chemical and quantum mechanical parameters of 1-4 with 7-ethoxyresorufin and 7,8-benzoflavone, the investigated CYP1A substrate and inhibitor, respectively

  18. DHEA and non-alcoholic fat liver disease: increased gene expression of peroxisome proliferation-activated receptor γ (PPARγ and fatty acid synthase (FAS

    Directory of Open Access Journals (Sweden)

    Felipe Natali Almeida

    2014-05-01

    Full Text Available Dehydroespiandrosterone (DHEA is associated with improvements in chronic degenerative diseases, including obesity, insulin resistance, and cardiovascular diseases. Nevertheless, it is observed an increase in its concentration in individuals with liver lipid infiltration, but it is not precise if this condition emerges as a cause or a consequence. In this way, we aimed to identify gene expression alterations in lipid and glucose liver metabolism markers, as well as oxidative stress markers. For this purpose, male Wistar rats, 12-14 months old were treated with subcutaneous injections of DHEA (only dose of 10 mg kg-1; and after 7 days, hepatic gene expression by PCR real time were performed for the following genes:  G6Pase, PEPCK, FAS, PPARγ, malic enzyme, ChREBP, LXR, catalase, GPx, iNOS, NADPH oxidase subunits and PCNA. We observed a tendency of reduction in G6Pase gene expression in treated group (p = 0.08. In addition, it was identified an increase in liver PPARγ and FAS gene expressions, two markers of increased activity of lipogenic pathway. We also observed an increase in iNOS gene expression, a known inductor of systemic and hepatic insulin resistance. In conclusion, our data indicates that the treatment with DHEA can be associated with the development of liver lipid infiltration and hepatic insulin resistance.

  19. Enhanced triterpene saponin biosynthesis and root nodulation in transgenic barrel medic (Medicago truncatula Gaertn.) expressing a novel beta-amyrin synthase (AsOXA1) gene.

    Science.gov (United States)

    Confalonieri, Massimo; Cammareri, Maria; Biazzi, Elisa; Pecchia, Paola; Fevereiro, Manuel Pedro Salema; Balestrazzi, Alma; Tava, Aldo; Conicella, Clara

    2009-02-01

    Triterpene saponins are a group of bioactive compounds abundant in the genus Medicago, and have been studied extensively for their biological and pharmacological properties. In this article, we evaluated the effects of the ectopic expression of AsOXA1 cDNA from Aster sedifolius on the production of triterpene saponins in barrel medic (Medicago truncatula Gaertn.). AsOXA1 cDNA encodes beta-amyrin synthase, a key enzyme involved in triterpene saponin biosynthesis. One of the four transgenic lines expressing AsOXA1 accumulated significantly larger amounts of some triterpenic compounds in leaf and root than did control plants. In particular, the leaf exhibited significantly higher levels of bayogenin, medicagenic acid and zanhic acid. The amounts of medicagenic acid and zanhic acid, which represent the core of the M. truncatula leaf saponins, were 1.7 and 2.1 times higher, respectively, than the amounts extracted from the control line. In root, the production of bayogenin, hederagenin, soyasapogenol E and 2beta-hydroxyoleanolic acid was increased significantly. The increase in the total amounts of triterpenic compounds observed in the leaves of transgenic lines correlated with the AsOXA1 expression level. Interestingly, the plants expressing AsOXA1 showed, under different growth conditions, improved nodulation when compared with the control line. Nodulation enhancement was also accompanied by a significant change in the soyasapogenol B content. Our results indicate that the ectopic expression of AsOXA1 in barrel medic leads to a greater accumulation of triterpene saponins and enhanced root nodulation. PMID:19055609

  20. Low prevalence of Pneumocystis pneumonia (PCP but high prevalence of pneumocystis dihydropteroate synthase (dhps gene mutations in HIV-infected persons in Uganda.

    Directory of Open Access Journals (Sweden)

    Steve M Taylor

    Full Text Available Pneumocystis jirovecii pneumonia (PCP is an important opportunistic infection in patients infected with HIV, but its burden is incompletely characterized in those areas of sub-Saharan Africa where HIV is prevalent. We explored the prevalence of both PCP in HIV-infected adults admitted with pneumonia to a tertiary-care hospital in Uganda and of putative P. jirovecii drug resistance by mutations in fungal dihydropteroate synthase (dhps and dihydrofolate reductase (dhfr. In 129 consecutive patients with sputum smears negative for mycobacteria, 5 (3.9% were diagnosed with PCP by microscopic examination of Giemsa-stained bronchoalveolar lavage fluid. Concordance was 100% between Giemsa stain and PCR (dhps and dhfr. PCP was more prevalent in patients newly-diagnosed with HIV (11.4% than in patients with known HIV (1.1%; p = 0.007. Mortality at 2 months after discharge was 29% overall: 28% among PCP-negative patients, and 60% (3 of 5 among PCP-positive patients. In these 5 fungal isolates and an additional 8 from consecutive cases of PCP, all strains harbored mutant dhps haplotypes; all 13 isolates harbored the P57S mutation in dhps, and 3 (23% also harbored the T55A mutation. No non-synonymous dhfr mutations were detected. PCP is an important cause of pneumonia in patients newly-diagnosed with HIV in Uganda, is associated with high mortality, and putative molecular evidence of drug resistance is prevalent. Given the reliability of field diagnosis in our cohort, future studies in sub-Saharan Africa can investigate the clinical impact of these genotypes.