Fusion chain reaction - a chain reaction with charged particles
International Nuclear Information System (INIS)
Peres, A.; Shvarts, D.
1975-01-01
When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 ions.cm -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 ions.cm -3 (140000times the normal solid density). (author)
Chain chemical reactions during matrix devitrification
International Nuclear Information System (INIS)
Barkalov, I.M.
1980-01-01
Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered
Nuclear chain reaction: forty years later
International Nuclear Information System (INIS)
Sachs, R.G.
1984-01-01
The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers
Method of identification of unbranched chain reaction with cross termination of chain
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.
1977-01-01
Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain
Simple model of inhibition of chain-branching combustion processes
Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.
2017-11-01
A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.
Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.
Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro
2018-01-01
Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.
Kobayashi, Takeshi; Kobayashi, Yo; Tabuchi, Masato; Shono, Kumi; Ohno, Yasutaka; Mita, Yuichi; Miyashiro, Hajime
2013-12-11
The all solid-state lithium battery with polyether-based solid polymer electrolyte (SPE) is regarded as one of next-generation lithium batteries, and has potential for sufficient safety because of the flammable-electrolyte-free system. It has been believed that polyether-based SPE is oxidized at the polymer/electrode interface with 4 V class cathodes. Therefore, it has been used for electric devices such as organic transistor, and lithium battery under 3 V. We estimated decomposition reaction of polyether used as SPE of all solid-state lithium battery. We first identified the decomposed parts of polyether-based SPE and the conservation of most main chain framework, considering the results of SPE analysis after long cycle operations. The oxidation reaction was found to occur slightly at the ether bond in the main chain with the branched side chain. Moreover, we resolved the issue by introducing a self-sacrificing buffer layer at the interface. The introduction of sodium carboxymethyl cellulose (CMC) to the 4 V class cathode surface led to the suppression of SPE decomposition at the interface as a result of the preformation of a buffer layer from CMC, which was confirmed by the irreversible exothermic reaction during the first charge, using electrochemical calorimetry. The attained 1500 cycle operation is 1 order of magnitude longer than those of previously reported polymer systems, and compatible with those of reported commercial liquid systems. The above results indicate to proceed to an intensive research toward the realization of 4 V class "safe" lithium polymer batteries without flammable liquid electrolyte.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Roth, S.
2004-01-01
A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
International Nuclear Information System (INIS)
John C. Fisher
2000-01-01
Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan
2016-11-15
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
International Nuclear Information System (INIS)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan
2016-01-01
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu
2016-04-01
A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Tangled nonlinear driven chain reactions of all optical singularities
Vasil'ev, V. I.; Soskin, M. S.
2012-03-01
Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.
The first nuclear chain reaction
International Nuclear Information System (INIS)
Zinn, W.H.
1989-01-01
The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Demonstration and suppression of a radioresistant host-versus-graft reaction
International Nuclear Information System (INIS)
Thierfelder, S.; Roessler, R. v.; Ruppelt, W.
1975-01-01
The possibilities of suppressing and measuring a radioresistant host-versus-graft reaction are described. According to the authors, the host-versus-graft immune reaction may outlast whole-body irradiation at high doses. (BSC/AK) [de
International Nuclear Information System (INIS)
Hata, Kuniki; Katsumura, Yosuke; Urushibara, Ayumi; Yamashita, Shinichi; Lin Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu Haiying
2015-01-01
Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10 8 dm 3 mol -1 s -1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm -3 ) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)
Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Nuclear fission, chain reaction and criticality
International Nuclear Information System (INIS)
Reuss, Paul
2016-01-01
Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes
Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke
2015-01-01
Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
International Nuclear Information System (INIS)
Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N
2009-01-01
The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)
The role of chain carriers in fusion reaction kinetics
International Nuclear Information System (INIS)
Harms, A.A.; Krenciglowa, E.M.
1980-01-01
The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Chain elongation suppression of cyclic block copolymers in lamellar microphase-separated bulk
Matsushita, Y; Iwata, H; Asari, T; Uchida, T; ten Brinke, G; Takano, A
2004-01-01
Chain elongation suppression of cyclic block copolymers in microphase-separated bulk was determined quantitatively. Solvent-cast and annealed films are confirmed to show alternating lamellar structure and their microdomain spacing D increases with increasing total molecular weight M according to the
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
International Nuclear Information System (INIS)
Balogh, Brian.
1991-01-01
Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS
Wigner, E.P.; Weinberg, A.M.
1961-01-24
A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment
International Nuclear Information System (INIS)
Anghaie, S.; Froelich, P.; Monkhorst, H.J.
1990-01-01
In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain
International Nuclear Information System (INIS)
Mattes, W.
1977-01-01
1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction
Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng
2016-08-01
In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Competing irreversible cooperative reactions on polymer chains
International Nuclear Information System (INIS)
Evans, J.W.; Hoffman, D.K.; Burgess, D.R.
1984-01-01
We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated
LENUS (Irish Health Repository)
O'Connor, T M
2012-02-03
BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.
International Nuclear Information System (INIS)
Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping
2013-01-01
Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling
Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite
Energy Technology Data Exchange (ETDEWEB)
Weres, Oleh; Tsao, Leon
1983-01-01
Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.
Reaction of hydrogen sulfide with oxygen in the presence of sulfite
Energy Technology Data Exchange (ETDEWEB)
Weres, O.; Tsao, L.
1983-01-14
Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.
Theoretical study of chain transfer to solvent reactions of alkyl acrylates.
Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud
2014-07-24
This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.
The Analysis of the Adverse Reaction of Traditional Chinese Medicine Tumor Bone Marrow Suppression
Wei, Zhenzhen; Fang, Xiaoyan; Miao, Mingsan
2018-01-01
With the rapid increase of cancer patients, chemotherapy is the main method for the clinical treatment of cancer, but also in the treatment of the adverse reactions--bone marrow suppression is often a serious infection caused by patients after chemotherapy and the important cause of mortality. Chinese medicine has obvious advantages in the prevention and treatment of bone marrow depression after chemotherapy. According to tumor bone marrow suppression after chemotherapy of etiology and pathogenesis of traditional Chinese medicine and China national knowledge internet nearly 10 years of traditional Chinese medicine in the prevention and control of the status of clinical and laboratory research of tumor bone marrow suppression, the author analyzed and summarized its characteristics, so as to provide the basis for treating bone marrow suppression of drug research and development, and promote small adverse reactions of the development and utilization of natural medicine and its preparations.
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin
2016-08-24
A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Antisense-induced suppression of taxoid 14β- hydroxylase gene ...
African Journals Online (AJOL)
Reverse transcription-polymerase chain reaction (RT-PCR) analysis showed that the 14OH mRNA level in transgenic cells dropped dramatically, suggesting that the expression of endogenous14OH gene was significantly suppressed by the exogenous as14OH gene. Correspondingly, the total yield of three major C-14 ...
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
The Ripple Effect: Citation Chain Reactions of a Nobel Prize
DEFF Research Database (Denmark)
Faber Frandsen, Tove; Nicolaisen, Jeppe
2013-01-01
This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum
Directory of Open Access Journals (Sweden)
Ching Giap Tan
2014-09-01
Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Bao, Ting; Wen, Wei; Zhang, Xiuhua; Xia, Qinghua; Wang, Shengfu
2015-08-15
In this work, a novel electrochemical aptasensor was developed for Hg(2+) detection based on exonuclease-assisted target recycling and hybridization chain reaction (HCR) dual signal amplification strategy. The presence of Hg(2+) induced the T-rich DNA partly folded into duplex-like structure via the Hg(2+) mediated T-Hg(2+)-T base pairs, which triggered the activity of exonuclease III (Exo III). Exo III selectively digested the double-strand DNA containing multiple T-Hg(2+)-T base pairs from its 3'-end, the released Hg(2+) participated analyte recycle. With each digestion cycle, a digestion product named as help DNA was obtained, which acted as a linkage between the capture DNA and auxiliary DNA. The presence of help DNA and two auxiliary DNA collectively facilitated successful HCR process and formed long double-stranded DNA. [Ru(NH3)6](3+) was used as redox indicator, which electrostatically bound to the double strands and produced an electrochemical signal. Exo III-assisted target recycling and HCR dual amplification significantly improved the sensitivity for Hg(2+) with a detection limit of 0.12 pM (S/N=3). Furthermore, the proposed aptasensor had a promising potential for the application of Hg(2+) detection in real aquatic sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Transformational leadership: a cascading chain reaction.
Murphy, Lorraine
2005-03-01
Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.
DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations
International Nuclear Information System (INIS)
East, L.V.
1994-05-01
A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.
1993-01-01
OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind
Experimental Study of Na based Titanium Nanofluid-Water Reaction
Energy Technology Data Exchange (ETDEWEB)
Park, Gunyeop; Kim, Soo Jae; Baek, Jehyun; Kim, Hyun Soo; Oh, Sun Ryung; Park, Hyun Sun; Kim, Moo Hwan [POSTECH, Pohang (Korea, Republic of)
2015-10-15
In KALIMER-600, a sodium-cooled fast reactor designed by KAERI, thermal energy is transported from high-temperature liquid Na (526 .deg. C at 0.1 MPa) to low temperature water (230 .deg. C at - 19.5 MPa) through a heat exchanger. If any leakage or rupture occurs during the operation of this heat exchanger, highly pressurized liquid water can penetrate into the liquid Na channels; this contact should instantly cause SWR. As reaction continues, liquid water is soon vaporized by pressure drop and huge amount of reaction heat. This generated water vapor expands large reaction area and increases sodium-water vapor reaction process. Therefore, the rapid generation of reaction product (like H{sub 2}) and water vapor increases the system pressure that can cause the system failure in SFR. To reduce this strong chemical reaction phenomena between Na and water, some we have focused on suppressing the chemical reactivity of liquid Na by dispersing nanoparticles (NPs). For the real application of NaTiNF, the pressure change induced by NaTiNF-water reaction is compared with Na-water reaction in the present study. NaTiNF contains 100nm of Ti NPs at 0.2 vol. %. The reaction rate of NaTiNF-water reaction is also investigated as reaction temperature increases. Sodium-water vapor reaction (SVR) will occur when an SWR accident occurs in SFR. In this manner, NaTiNF-water vapor reaction is experimentally performed for ensuring the suppression of chemical reactivity of NaTiNF in contact with water vapor. In the basic step for reducing risk of an SWR in SFR, we have experimentally verified the suppressed chemical reactivity of liquid sodium using Ti NPs through SWR and SVR experiments. In SWR, Na based titanium nanofluid (NaTiNF) shows lower pressure change than Na. As T{sub R} increases, P{sub max} in Na-water reaction increases while NaTiNF does not. The reaction rate of NaTiNF shows twice slower than that of Na. In SVR, NaTiNF shows slower temperature increase than Na. The distinct
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Directory of Open Access Journals (Sweden)
Fábio Takenori Higa
2013-04-01
Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng
2015-05-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
International Nuclear Information System (INIS)
Han, Cuiping; He, Yan-Bing; Li, Hongfei; Li, Baohua; Du, Hongda; Qin, Xianying; Kang, Feiyu
2015-01-01
Graphical abstract: The Li 4 Ti 5 O 12 (LTO) based batteries have severe gassing behavior due to the strong interfacial reactions between LTO and the electrolyte solution, which hampers the practical application of LTO in high power LIBs. The ZnO coating on LTO particles as a barrier layer can effectively suppress the interfacial reactions between LTO and the electrolyte solution. Simultaneously, the ZnO coating significantly reduces the charge-transfer resistance and increases the lithium ion diffusion coefficient, which leads to great improvement of rate and cyclic performance of LTO electrode. - Highlights: • A ZnO coating layer was constructed on the LTO particles by a chemical process as a barrier layer between LTO and surrounding electrolyte solution. • The ZnO coating can effectively stabilize the electrode/electrolyte interface and suppress interfacial reactions between LTO and electrolyte solution. • The ZnO coating can improve the electronic conductivity and lithium ion diffusion coefficient, which contributes to a great improvement in cyclic and high rate capabilities of LTO electrode. • The ZnO coating on LTO may be an effective method to solve the gassing behavior of LTO based battery and promote its wide application in lithium ion power battery. - Abstract: Li 4 Ti 5 O 12 (LTO) based batteries have severe gassing behavior during charge/discharge and storage process. The interfacial reactions between LTO and electrolyte solution may be the main reason. In this work, the LTO spinel particles are modified with ZnO coating using a chemical process to reduce the surface reactivity of LTO particles. Results show that the ZnO coating can effectively stabilize the electrode/electrolyte interface and suppress the formation of a solid electrolyte interface (SEI) film. Simultaneously, this ZnO modification can improve the electronic conductivity and lithium ion diffusion coefficient, which contributes to a great improvement in cyclic and high rate
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions
Zhang, Hefeng; Qu, Chengke; He, Junpo
2015-01-01
We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b
Malkhandi, Souradip; Yang, Bo; Manohar, Aswin K; Prakash, G K Surya; Narayanan, S R
2013-01-09
Iron-based rechargeable batteries, because of their low cost, eco-friendliness, and durability, are extremely attractive for large-scale energy storage. A principal challenge in the deployment of these batteries is their relatively low electrical efficiency. The low efficiency is due to parasitic hydrogen evolution that occurs on the iron electrode during charging and idle stand. In this study, we demonstrate for the first time that linear alkanethiols are very effective in suppressing hydrogen evolution on alkaline iron battery electrodes. The alkanethiols form self-assembled monolayers on the iron electrodes. The degree of suppression of hydrogen evolution by the alkanethiols was found to be greater than 90%, and the effectiveness of the alkanethiol increased with the chain length. Through steady-state potentiostatic polarization studies and impedance measurements on high-purity iron disk electrodes, we show that the self-assembly of alkanethiols suppressed the parasitic reaction by reducing the interfacial area available for the electrochemical reaction. We have modeled the effect of chain length of the alkanethiol on the surface coverage, charge-transfer resistance, and double-layer capacitance of the interface using a simple model that also yields a value for the interchain interaction energy. We have verified the improvement in charging efficiency resulting from the use of the alkanethiols in practical rechargeable iron battery electrodes. The results of battery tests indicate that alkanethiols yield among the highest faradaic efficiencies reported for the rechargeable iron electrodes, enabling the prospect of a large-scale energy storage solution based on low-cost iron-based rechargeable batteries.
Energy Technology Data Exchange (ETDEWEB)
Malkhandi, S; Yang, B; Manohar, AK; Prakash, GKS; Narayanan, SR
2013-01-09
Iron-based rechargeable batteries, because of their low cost, eco-friendliness, and durability, are extremely attractive for large-scale energy storage. A principal challenge in the deployment of these batteries is their relatively low electrical efficiency. The low efficiency is due to parasitic hydrogen evolution that occurs on the iron electrode during charging and idle stand. In this study, we demonstrate for the first time that linear alkanethiols are very effective in suppressing hydrogen evolution on alkaline iron battery electrodes. The alkanethiols form self-assembled monolayers on the iron electrodes. The degree of suppression of hydrogen evolution by the alkanethiols was found to be greater than 90%, and the effectiveness of the alkanethiol increased with the chain length. Through steady-state potentiostatic polarization studies and impedance measurements on high-purity iron disk electrodes, we show that the self-assembly of alkanethiols suppressed the parasitic reaction by reducing the interfacial area available for the electrochemical reaction. We have modeled the effect of chain length of the alkanethiol on the surface coverage, charge-transfer resistance, and double-layer capacitance of the interface using a simple model that also yields a value for the interchain interaction energy. We have verified the improvement in charging efficiency resulting from the use of the alkanethiols in practical rechargeable iron battery electrodes. The results of battery tests indicate that alkanethiols yield among the highest faradaic efficiencies reported for the rechargeable iron electrodes, enabling the prospect of a large-scale energy storage solution based on low-cost iron-based rechargeable batteries.
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M
2013-03-28
This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.
International Nuclear Information System (INIS)
Leone, S.R.
1988-03-01
Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
International Nuclear Information System (INIS)
Li Linxiang; Abe, Yoshihiro; Kanagawa, Kiyotada; Shoji, Tomoko; Mashino, Tadahiko; Mochizuki, Masataka; Tanaka, Miho; Miyata, Naoki
2007-01-01
Hydroxyl radical formation by Fenton reaction in the presence of an iron-chelating agent such as EDTA was traced by two different assay methods; an electron spin resonance (ESR) spin-trapping method with 5,5-dimethyl-1-pyrroline N-oxide (DMPO), and high Performance liquid chromatography (HPLC)-fluorescence detection with terephthalic acid (TPA), a fluorescent probe for hydroxyl radicals. From the ESR spin-trapping measurement, it was observed that EDTA seemed to suppress hydroxyl radical formation with the increase of its concentration. On the other hand, hydroxyl radical formation by Fenton reaction was not affected by EDTA monitored by HPLC assay. Similar inconsistent effects of other iron-chelating agents such as nitrylotriacetic acid (NTA), diethylenetriamine penta acetic acid (DTPA), oxalate and citrate were also observed. On the addition of EDTA solution to the reaction mixture 10 min after the Fenton reaction started, when hydroxyl radical formation should have almost ceased but the ESR signal of DMPO-OH radicals could be detected, it was observed that the DMPO-OH· signal disappeared rapidly. With the simultaneous addition of Fe(II) solution and EDTA after the Fenton reaction ceased, the DMPO-OH· signal disappeared more rapidly. The results indicated that these chelating agents should enhance the quenching of [DMPO-OH]· radicals by Fe(II), but they did not suppress Fenton reaction by forming chelates with iron ions
Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials
Chapman, Peter Henry
Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are
Sex-dimorphic adverse drug reactions to immune suppressive agents in inflammatory bowel disease
Z. Zelinkova (Zuzana); E. Bultman (Evelien); L. Vogelaar (Lauran); C. Bouziane (Cheima); E.J. Kuipers (Ernst); C.J. van der Woude (Janneke)
2012-01-01
textabstractAIM: To analyze sex differences in adverse drug reactions (ADR) to the immune suppressive medication in inflammatory bowel disease (IBD) patients. METHODS: All IBD patients attending the IBD outpatient clinic of a referral hospital were identifed through the electronic diagnosis
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
Gao, Da-Ming; Kobayashi, Takashi; Adachi, Shuji
2015-01-01
The influence of water-miscible alcohols (methanol, 1-propanol, 2-propanol, and t-butyl alcohol) on the isomerization of glucose to fructose and mannose was investigated under subcritical aqueous conditions (180-200 °C). Primary and secondary alcohols promoted the conversion and isomerization of glucose to afford fructose and mannose with high and low selectivity, respectively. On the other hand, the decomposition (side-reaction) of glucose was suppressed in the presence of the primary and secondary alcohols compared with that in subcritical water. The yield of fructose increased with increasing concentration of the primary and secondary alcohols, and the species of the primary and secondary alcohols tested had little effect on the isomerization behavior of glucose. In contrast, the isomerization of glucose was suppressed in subcritical aqueous t-butyl alcohol. Both the conversion of glucose and the yield of fructose decreased with increasing concentration of t-butyl alcohol. In addition, mannose was not detected in reactions using subcritical aqueous t-butyl alcohol.
Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T
2006-10-01
Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
Huwaë, Sylvia
2017-01-01
Summary of thesis “Different cultures, different selves? Suppression of emotions and reactions to transgressions across cultures”, Sylvia Huwaë People can differ in how they respond to everyday situations. For example, when treated unfairly by someone, some people may express their anger and find it
Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor
International Nuclear Information System (INIS)
Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian
2012-01-01
Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current
de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.
2002-01-01
Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1991-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1993-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
The effect of composition of mixture on rate of radiation initiation of chain reactions
International Nuclear Information System (INIS)
Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.
1977-01-01
The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered
Directory of Open Access Journals (Sweden)
Gumerov Vladislav M.
2015-01-01
Full Text Available Experimental studies determining periods of suppression of thermal decomposition reaction of forest combustible materials was carried out by high-speed, cross-correlation cameras and panoramic techniques PIV and IPI under influence of water steam. Conditions and characteristics of reaction termination of thermal decomposition of forest combustible materials under reaction with steam cloud were defined.
Determination of the number of radicals in the initial chain reactions by mathematical methods
Directory of Open Access Journals (Sweden)
Pejović Branko B.
2009-01-01
Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk
Directory of Open Access Journals (Sweden)
V.K. Jain
2010-02-01
Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.
Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F
2015-01-01
Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Suppression of allergic reactions in ovalbumin-sensitized mice by yam storage proteins dioscorins.
Hsu, Yu-Jhen; Weng, Ching-Feng; Lin, Kuo-Wei; Lin, Kuo-Chih
2013-11-27
To study the biomedical functions of dioscorins isolated from various species of Dioscorea , we investigated their antiallergic potential using an OVA-induced allergy mouse model. All the dioscorins suppressed allergic reactions by decreasing the serum IgE and histamine levels. The serum IFN-γ and IgG2a levels increased in all the dioscorin-treated mice. The spleen cells from the dioscorin-treated mice also exhibited an up-regulation of IFN-γ secretion in response to ConA stimulation. Although dioscorins did not affect the IgG1 levels, the IL-5 levels decreased to basal levels in mice treated with dioscorins of D. alata or D. japonica and in most of the lymphoid cells of the dioscorin-treated mice in response to ConA stimulation. The decrease of IgE and histamine levels was concomitant with an increase in IFN-γ and IgG2a levels and with a decrease in IL-5 levels, suggesting that dioscorins suppressed the OVA-induced allergic reactions, possibly through modulating an imbalanced Th1/Th2 immune response.
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
2009-01-01
On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Kinetics of the Br2-CH3CHO Photochemical Chain Reaction
Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.
1997-01-01
Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.
Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide
2018-04-24
We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.
Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro
2010-06-01
Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).
International Nuclear Information System (INIS)
Nakagawa, Seiko
2015-01-01
Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
Suppression of the stellar enhancement factor and the reaction 85Rb(p,n)85Sr
International Nuclear Information System (INIS)
Rauscher, T.; Kiss, G. G.; Gyuerky, Gy.; Simon, A.; Fueloep, Zs.; Somorjai, E.
2009-01-01
It is shown that a Coulomb suppression of the stellar enhancement factor occurs in many endothermic reactions at and far from stability. Contrary to common assumptions, reaction measurements for astrophysics with minimal impact of stellar enhancement should be preferably performed for those reactions instead of their reverses, despite of their negative Q value. As a demonstration, the cross section of the astrophysically relevant 85 Rb(p,n) 85 Sr reaction has been measured by activation between 2.16≤E c.m. ≤3.96 MeV and the astrophysical reaction rates at p process temperatures for (p,n) as well as (n,p) are directly inferred from the data. Additionally, our results confirm a previously derived modification of a global optical proton potential. The presented arguments are also relevant for other α- and proton-induced reactions in the p, rp, and νp processes.
Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F
2015-10-01
We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
DEFF Research Database (Denmark)
Pattison, D I; Davies, Michael Jonathan
2001-01-01
, absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping
2017-03-15
This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Manju Soman
2014-10-01
Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.
Chain reaction. History of the atomic bomb
International Nuclear Information System (INIS)
Mania, Hubert
2010-01-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
DFT-based prediction of reactivity of short-chain alcohol dehydrogenase
Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.
2017-06-01
The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes
Denisov, E. T.; Shestakov, A. F.
2018-05-01
Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.
DEFF Research Database (Denmark)
Hougs, L; Barington, T; Madsen, HO
1993-01-01
reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Directory of Open Access Journals (Sweden)
Yuqing Wu
2013-01-01
and 20 μg/kg significantly decreased mortality and pulmonary inflammation of septic rats, as well as suppressed CLP-induced elevation of TNF-α and IL-6 and inhibited TLR4/MyD88 expression and NF-κB activation. These results suggest that dexmedetomidine may decrease mortality and inhibit inflammatory reaction in lung tissues of septic rats by suppressing TLR4/MyD88/NF-κB pathway.
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
Higazi, Tarig B.; Zarroug, Isam M. A.; Mohamed, Hanan A.; Mohamed, Wigdan A.; Deran, Tong Chor M.; Aziz, Nabil; Katabarwa, Moses; Hassan, Hassan K.; Unnasch, Thomas R.; Mackenzie, Charles D.; Richards, Frank
2011-01-01
Onchocerciasis remains an important debilitating disease in many areas of Africa, including Sudan. The status of infection transmission in 2007 was assessed in the vectors of two disease foci in Sudan: Abu Hamed in northern Sudan, which has received at least 10 years of annual treatment and Galabat focus in eastern Sudan, where only minor, largely undocumented treatment activity has occurred. Assessment of more than 30,000 black flies for Onchocerca volvulus infectious stage L3 larvae by using an O-150 polymerase chain reaction protocol showed that black fly infectivity rates were 0.84 (95% confidence interval = 0.0497–1.88) per 10,000 flies for Abu Hamed and 6.9 (95% confidence interval = 1.1–16.4) infective flies per 10,000 for Galabat. These results provide entomologic evidence for suppressed Onchocerca volvulus transmission in the Abu Hamed focus and a moderate transmission rate of the parasite in the Galabat focus. PMID:21540385
Bi, Sai; Yue, Shuzhen; Zhang, Shusheng
2017-07-17
Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
International Nuclear Information System (INIS)
Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.
1990-01-01
Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Carlos Alberto Scrideli
2001-09-01
Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-01
The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.
Treff, Nathan R; Scott, Richard T
2013-03-15
Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Directory of Open Access Journals (Sweden)
Miriam YH Ueda
2015-06-01
Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Directory of Open Access Journals (Sweden)
Norbert Haider
1998-01-01
Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.
Energy Technology Data Exchange (ETDEWEB)
Fukuda, Jun [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan); Tsujimura, Seiya [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan)], E-mail: seiya@kais.kyoto-u.ac.jp; Kano, Kenji [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan)], E-mail: kkano@kais.kyoto-u.ac.jp
2008-12-30
This paper describes the characterization of mediated electro-enzymatic electrolysis systems based on NAD-dependent dehydrogenase reactions in the tricarboxylic acid (TCA) cycle. A micro-bulk electrolysis system with a carbon felt anode immersed in an electrolysis solution with a value of about 10 {mu}L was constructed for coulometric analysis of the substrate oxidation. Diaphorase (DI) was used to couple the NAD-dependent dehydrogenase reaction with the anode reaction of a suitable redox mediator. We focused on three types of NAD-dependant dehydrogenases reactions in this research: (1) isocitrate oxidation, in which the standard Gibbs energy change ({delta}G{sup o}') is negative; (2) {alpha}-ketoglutarate oxidation, which involves an electrochemically active coenzyme A (CoA); and (3) malate oxidation, which is thermodynamically unfavorable because of a large positive {delta}G{sup o}' value. The complete electrolysis of isocitrate was easily achieved, supporting the effective re-oxidation of NADH in the diaphorase-catalyzed electrochemical reaction. CoA was unfavorably oxidized at the electrodes in the presence of some mediators. The electrocatalytic oxidation of CoA was suppressed and the quantitative electrochemical oxidation of {alpha}-ketoglutarate was achieved by selecting a suitable mediator with negligibly slow electron transfer kinetics with CoA. The uphill malate oxidation was susceptible to product inhibition in the bioelectrochemical system, although NADH generated in the malate dehydrogenase reaction was immediately oxidized in the electrochemical system. The inhibition was successfully suppressed by linking citrate synthase to quench oxaloacetate and to make the total {delta}G{sup o}' value negative.
International Nuclear Information System (INIS)
Fukuda, Jun; Tsujimura, Seiya; Kano, Kenji
2008-01-01
This paper describes the characterization of mediated electro-enzymatic electrolysis systems based on NAD-dependent dehydrogenase reactions in the tricarboxylic acid (TCA) cycle. A micro-bulk electrolysis system with a carbon felt anode immersed in an electrolysis solution with a value of about 10 μL was constructed for coulometric analysis of the substrate oxidation. Diaphorase (DI) was used to couple the NAD-dependent dehydrogenase reaction with the anode reaction of a suitable redox mediator. We focused on three types of NAD-dependant dehydrogenases reactions in this research: (1) isocitrate oxidation, in which the standard Gibbs energy change (ΔG o ') is negative; (2) α-ketoglutarate oxidation, which involves an electrochemically active coenzyme A (CoA); and (3) malate oxidation, which is thermodynamically unfavorable because of a large positive ΔG o ' value. The complete electrolysis of isocitrate was easily achieved, supporting the effective re-oxidation of NADH in the diaphorase-catalyzed electrochemical reaction. CoA was unfavorably oxidized at the electrodes in the presence of some mediators. The electrocatalytic oxidation of CoA was suppressed and the quantitative electrochemical oxidation of α-ketoglutarate was achieved by selecting a suitable mediator with negligibly slow electron transfer kinetics with CoA. The uphill malate oxidation was susceptible to product inhibition in the bioelectrochemical system, although NADH generated in the malate dehydrogenase reaction was immediately oxidized in the electrochemical system. The inhibition was successfully suppressed by linking citrate synthase to quench oxaloacetate and to make the total ΔG o ' value negative
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
International Nuclear Information System (INIS)
Wang Sufan; Smith, Sean C.
2006-01-01
The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Bio-based supply chains : risks and institutional arrangements
Peerlings, J.H.M.; Ge, L.; Galen, van M.A.
2012-01-01
One of the challenges for the bio-based economy is to achieve production efficiency that can compete with fossil-based products. New scale-efficient product supply chains have to be created, or current supply chains have to be amended to incorporate the biomass supply chain. These new supply chains
Reaction of oxygen with the respiratory chain in cells and tissues.
Chance, B
1965-09-01
This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate
Volkov, R. S.; Zhdanova, A. O.; Kuznetsov, G. V.; Strizhak, P. A.
2018-05-01
Experimental investigations on the characteristic time of suppression of the thermal decomposition reaction of typical forest combustible materials (aspen twigs, birch leaves, spruce needles, pine chips, and a mixture of these materials) and the volume of water required for this purpose have been performed for model fire hotbeds of different areas: SFCM = 0.0003-0.007 m2 and SFCM = 0.045-0.245 m2. In the experiments, aerosol water flows with droplets of size 0.01-0.25 mm were used for the spraying of model fire hotbeds, and the density of spraying was 0.02 L/(m2·s). It was established that the characteristics of suppression of a fire by an aerosol water flow are mainly determined by the sizes of the droplets in this flow. Prognostic estimates of changes in the dispersivity of a droplet cloud, formed from large (as large as 0.5 L) "drops" (water agglomerates) thrown down from a height, have been made. It is shown that these changes can influence the conditions and characteristics of suppression of a forest fire. Dependences, allowing one to forecast the characteristics of suppression of the thermal decomposition of forest combustible materials with the use of large water agglomerates thrown down from an aircraft and aerosol clouds formed from these agglomerates in the process of their movement to the earth, are presented.
Volkov, R. S.; Zhdanova, A. O.; Kuznetsov, G. V.; Strizhak, P. A.
2018-03-01
Experimental investigations on the characteristic time of suppression of the thermal decomposition reaction of typical forest combustible materials (aspen twigs, birch leaves, spruce needles, pine chips, and a mixture of these materials) and the volume of water required for this purpose have been performed for model fire hotbeds of different areas: SFCM = 0.0003-0.007 m2 and SFCM = 0.045-0.245 m2. In the experiments, aerosol water flows with droplets of size 0.01-0.25 mm were used for the spraying of model fire hotbeds, and the density of spraying was 0.02 L/(m2·s). It was established that the characteristics of suppression of a fire by an aerosol water flow are mainly determined by the sizes of the droplets in this flow. Prognostic estimates of changes in the dispersivity of a droplet cloud, formed from large (as large as 0.5 L) "drops" (water agglomerates) thrown down from a height, have been made. It is shown that these changes can influence the conditions and characteristics of suppression of a forest fire. Dependences, allowing one to forecast the characteristics of suppression of the thermal decomposition of forest combustible materials with the use of large water agglomerates thrown down from an aircraft and aerosol clouds formed from these agglomerates in the process of their movement to the earth, are presented.
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION
Directory of Open Access Journals (Sweden)
Honcharova S.Y.
2015-08-01
Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.
Honda, H; Miyagawa, K; Endo, M; Takaku, F; Yazaki, Y; Hirai, H
1993-06-01
We diagnosed a patient with chronic myelogenous leukemia (CML) in chronic phase (CP) on the basis of clinical findings, Ph1 chromosome detected by cytogenetic analysis, and bcr-abl fusion mRNA detected by reverse transcriptase-dependent polymerase chain reaction (RT-PCR). One month after diagnosis, the patient developed extramedullary blast crisis in the lymph nodes, and then medullary blast crisis in the bone marrow, in which different surface markers were shown. Combination chemotherapy with BH-AC, VP16, and mitoxantrone was administered; this resulted in rapid disappearance of the lymphadenopathy, restoration of normal hematopoiesis, and no Ph1 chromosome being detected by cytogenetic analysis. RT-PCR performed to detect the residual Ph1 clone revealed that although the Ph1 clone was preferentially suppressed, it was still residual. The intensive chemotherapy regimen preferentially suppressed the Ph1-positive clone and led to both clinical and cytogenetic remission in this patient with BC of CML; we suggest that RT-PCR is a sensitive and useful method for detecting minimal residual disease during the clinical course of this disease.
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
Class A dioscorins of various yam species suppress ovalbumin-induced allergic reactions.
Yang, Ching-Chi; Lin, Kuo-Chih
2014-06-01
Dioscorins, the primary storage proteins in yam tubers, of different species exhibited varying immunomodulatory activities in mice. We inferred that this might be attributed to the various isoforms in the yam tubers. We aimed to investigate the antiallergic potential of the Class A dioscorins of various yam species using the ovalbumin (OVA)-induced murine allergy model. We purified the recombinant Class A dioscorins (rDioscorins) of various yam species from Escherichia coli and evaluated their antiallergic potential by enzyme-linked immunosorbent assay. The Class A rDioscorins of various yam species suppressed allergic reactions by significantly decreasing the serum IgE and histamine levels. The serum IFN-γ and IgG2a levels significantly increased in all rDioscorin-treated mice. The splenocytes of the rDioscorin-treated mice also exhibited upregulated IFN-γ secretion in response to ConA stimulation. By contrast, the serum IL-5 levels decreased to basal levels in mice treated with Class A rDioscorins and the amount of IL-5 produced by splenocytes decreased in response to ConA stimulation. The Class A rDioscorins suppress allergic reactions, possibly through modulating an imbalanced Th1/Th2 immune response to OVA by promoting Th1 cell responses. Furthermore, the Class A rDioscorins of various yam species exhibited similar immunomodulatory activities in OVA-sensitized mice, which were different from the activities demonstrated by native dioscorins, suggesting that distinct immunomodulatory effects of native dioscorins on mice were attributed to the various isoforms in the yam tubers. The Class A dioscorins of various yam species exhibit antiallergic activity and are potential immunotherapeutic agents for treating IgE-mediated hypersensitivity.
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.
Toyosaki, Toshiyuki
2018-06-01
To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Reaction time for trimolecular reactions in compartment-based reaction-diffusion models
Li, Fei; Chen, Minghan; Erban, Radek; Cao, Yang
2018-05-01
Trimolecular reaction models are investigated in the compartment-based (lattice-based) framework for stochastic reaction-diffusion modeling. The formulae for the first collision time and the mean reaction time are derived for the case where three molecules are present in the solution under periodic boundary conditions. For the case of reflecting boundary conditions, similar formulae are obtained using a computer-assisted approach. The accuracy of these formulae is further verified through comparison with numerical results. The presented derivation is based on the first passage time analysis of Montroll [J. Math. Phys. 10, 753 (1969)]. Montroll's results for two-dimensional lattice-based random walks are adapted and applied to compartment-based models of trimolecular reactions, which are studied in one-dimensional or pseudo one-dimensional domains.
Markov chain aggregation and its applications to combinatorial reaction networks.
Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz
2014-09-01
We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Campbell, J; Lowe, J; Walz, S; Ezzell, J
1993-01-01
We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.
Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942
Energy Technology Data Exchange (ETDEWEB)
Eklund, S [International Atomic Energy Agency, Vienna (Austria)
1962-12-02
On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T
2013-06-01
Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
International Nuclear Information System (INIS)
Miyata, Kenichi; Takagi, Satoshi; Sato, Shigeo; Morioka, Hiroshi; Shiba, Kiyotaka; Minamisawa, Tamiko; Takami, Miho; Fujita, Naoya
2014-01-01
Almost all highly metastatic tumor cells possess high platelet aggregating abilities, thereby form large tumor cell-platelet aggregates in the microvasculature. Embolization of tumor cells in the microvasculature is considered to be the first step in metastasis to distant organs. We previously identified the platelet aggregation-inducing factor expressed on the surfaces of highly metastatic tumor cells and named as Aggrus. Aggrus was observed to be identical to the marker protein podoplanin (alternative names, T1α, OTS-8, and others). Aggrus is frequently overexpressed in several types of tumors and enhances platelet aggregation by interacting with the platelet receptor C-type lectin-like receptor 2 (CLEC-2). Here, we generated a novel single-chain antibody variable region fragment (scFv) by linking the variable regions of heavy and light chains of the neutralizing anti-human Aggrus monoclonal antibody MS-1 with a flexible peptide linker. Unfortunately, the generated KM10 scFv failed to suppress Aggrus-induced platelet aggregation in vitro. Therefore, we performed phage display screening and finally obtained a high-affinity scFv, K-11. K-11 scFv was able to suppress Aggrus-induced platelet aggregation in vitro. Moreover, K-11 scFv prevented the formation of pulmonary metastasis in vivo. These results suggest that K-11 scFv may be useful as metastasis inhibitory scFv and is expected to aid in the development of preclinical and clinical examinations of Aggrus-targeted cancer therapies
Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.
2007-01-01
After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and
Maillard reaction in mild-based foods: nutritional consequences.
Pizzoferrato, L; Manzi, P; Vivanti, V; Nicoletti, I; Corradini, C; Cogliandro, E
1998-02-01
Chemical reactions occurring during industrial treatments or storage foods can lead to the formation of epsilon-deoxyketosyl compounds, the Amadori products. Food protein value can be adversely affected by these reactions, and in particular lysine, an essential amino acid having on its side chain a free amino group, can be converted to nonbioavailable N-substituted lysine or blocked lysine. by acid hydrolysis of epsilon-deoxyketosyl compounds, furosine is formed. In this paper furosine prepared from milk-based commercial products has been evaluated by use of a recently developed HPLC method using a microbore column and phosphate buffer as the mobile phase at controlled temperature. Furosine levels have been used, together with protein, total amino acids, and lysine content, as an estimate of protein quality of a few different products such as cooked-cream dessert, yogurt mousse, white chocolate, milk chocolate, milk chocolate with a soft nougat and caramel center, milk chocolate with a whipped white center, chocolate spread, part-skim milk tablets, milk-based dietetic meals, and baby foods. The protein content of the analyzed products ranged from 34.3 gxkg(-1) (milk nougat) to 188.4 g x kg(-1) (milk tablets). The Maillard reaction caused a loss in available lysine that varied from 2.5% (cooked cream) to 36.2% (condensed milk). The contribution to the lysine average daily requirement is heavily affected by this reaction and varied from 13% (milk tablets and soft nougat) to 61% (dietetic meal). Variable results were also obtained for the other essential amino acids.
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
International Nuclear Information System (INIS)
Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong
2012-01-01
Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
CHAINS-PC, Decay Chain Atomic Densities
International Nuclear Information System (INIS)
1994-01-01
1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.
2008-01-01
Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
ReaDDy--a software for particle-based reaction-diffusion dynamics in crowded cellular environments.
Directory of Open Access Journals (Sweden)
Johannes Schöneberg
Full Text Available We introduce the software package ReaDDy for simulation of detailed spatiotemporal mechanisms of dynamical processes in the cell, based on reaction-diffusion dynamics with particle resolution. In contrast to other particle-based reaction kinetics programs, ReaDDy supports particle interaction potentials. This permits effects such as space exclusion, molecular crowding and aggregation to be modeled. The biomolecules simulated can be represented as a sphere, or as a more complex geometry such as a domain structure or polymer chain. ReaDDy bridges the gap between small-scale but highly detailed molecular dynamics or Brownian dynamics simulations and large-scale but little-detailed reaction kinetics simulations. ReaDDy has a modular design that enables the exchange of the computing core by efficient platform-specific implementations or dynamical models that are different from Brownian dynamics.
Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.
2018-05-01
It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.
New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction
Energy Technology Data Exchange (ETDEWEB)
Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)
1997-09-01
Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
International Nuclear Information System (INIS)
Snieckus, Darius
2000-01-01
'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
Directory of Open Access Journals (Sweden)
Edina Rodrigues Pires
1997-01-01
Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
International Nuclear Information System (INIS)
Liu, Hongying; Bei, Xiaoqiong; Xia, Qiuting; Fu, Yan; Zhang, Shi; Liu, Maochuan; Fan, Kai; Zhang, Mingzhen; Yang, Yong
2016-01-01
We describe a sensitive enzyme-free bioassay for the determination of microRNA-21. It is based on a combination of target-triggered hybridization chain reaction, tagging with CdTe quantum dots (QDs), and anodic stripping voltammetry. Firstly, a thiolated capture hairpin probe SH-HP1 was immobilized on the surface of a gold electrode. HP1 unfolds in the presence of microRNA-21. If hairpin probe 2 (HP2) is present, a HP1-HP2 complex will be formed which possesses an exposed stem of HP2, and microRNA is released in parallel. The released microRNA-21 triggers a hybridization chain reaction and this leads to form an exposed DNA segment of HP2 and cycle use microRNA-21. With the aid of assistant DNA A1 and A2, the exposed DNA segment of HP2 progressed to a long double strand. The strand is rich in CdTe QDs with the help of QDs-A1. Then, the attached QDs were dissolved with HNO 3 to give dissolved Cd(II) ions. Finally, the corresponding electrochemical current response of Cd(II) is monitored by anodic stripping voltammetry and used to quantify the concentration of microRNA-21. More microRNA-21 participated in this reaction increases the number of CdTe QDs, which results in increased electrochemical current. Thus, an ultrasensitive detection of microRNA-21 is accomplished by anodic stripping voltammetry. This gene assay displays a detection limit as low as 33 aM. It can discriminate between complementary DNA sequence and single-base mismatched DNA, indicating its high specificity. (author)
International Nuclear Information System (INIS)
Leone, S.R.
1990-01-01
Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Directory of Open Access Journals (Sweden)
Людмила Мар’янівна Іщенко
2016-11-01
Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe
2009-04-01
The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers
International Nuclear Information System (INIS)
Sun Jiazhen
2003-01-01
Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Reaction pathway towards formation of cobalt single chain magnets and nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)
2010-03-15
With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.
International Nuclear Information System (INIS)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-01-01
Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of
Energy Technology Data Exchange (ETDEWEB)
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn
2017-05-31
Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the
DEFF Research Database (Denmark)
Green, Tina M; Jensen, Andreas K; Holst, René
2016-01-01
We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...... models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B....... This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs...
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.
2016-01-01
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M
2016-01-19
This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
Lingblom, C; Wallander, J; Ingelsten, M; Bergquist, H; Bove, M; Saalman, R; Welin, A; Wennerås, C
2017-03-01
Eosinophilic esophagitis (EoE) is an antigen-driven T cell-mediated chronic inflammatory disease where food and environmental antigens are thought to have a role. Human eosinophils express the immunoregulatory protein galectin-10 and have T cell suppressive capacity similar to regulatory T cells (T regs ). We hypothesized that one function of eosinophils in EoE might be to regulate the T cell-driven inflammation in the oesophagus. This was tested by evaluating the suppressive capacity of eosinophils isolated from the blood of adult EoE patients in a mixed lymphocyte reaction. In addition, eosinophilic expression of forkhead box protein 3 (FOXP3), the canonical transcription factor of T regs , was determined by conventional and imaging flow cytometry, quantitative polymerase chain reaction (qPCR), confocal microscopy and immunoblotting. It was found that blood eosinophils from EoE patients had T cell suppressive capacity, and that a fraction of the eosinophils expressed FOXP3. A comparison of EoE eosinophils with healthy control eosinophils indicated that the patients' eosinophils had inferior suppressive capacity. Furthermore, a higher percentage of the EoE eosinophils expressed FOXP3 protein compared with the healthy eosinophils, and they also had higher FOXP3 protein and mRNA levels. FOXP3 was found in the cytosol and nucleus of the eosinophils from both the patients and healthy individuals, contrasting with the strict nuclear localization of FOXP3 in T regs . To conclude, these findings suggest that the immunoregulatory function of eosinophils may be impaired in EoE. © 2016 British Society for Immunology.
Tunable heat conduction through coupled Fermi-Pasta-Ulam chains
Su, Ruixia; Yuan, Zongqiang; Wang, Jun; Zheng, Zhigang
2015-01-01
We conduct a study on heat conduction through coupled Fermi-Pasta-Ulam (FPU) chains by using classical molecular dynamics simulations. Our attention is dedicated to showing how the phonon transport is affected by the interchain coupling. It has been well accepted that the heat conduction could be impeded by the interchain interaction due to the interface phonon scattering. However, recent theoretical and experimental studies suggest that the thermal conductivity of nanoscale materials can be counterintuitively enhanced by the interaction with the substrate. In the present paper, by consecutively varying the interchain coupling intensity, we observed both enhancement and suppression of thermal transport through the coupled FPU chains. For weak interchain couplings, it is found that the heat flux increases with the coupling intensity, whereas in the case of strong interchain couplings, the energy transport is found to be suppressed by the interchain interaction. Based on the phonon spectral energy density method, we attribute the enhancement of the energy transport to the excited phonon modes (in addition to the intrinsic phonon modes), while the upward shift of the high-frequency phonon branch and the interface phonon-phonon scattering account for the suppressed heat conduction.
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
Deguchi, T; Yasuda, M; Uno, M; Tada, K; Iwata, H; Komeda, H; Maeda, S; Latila, V; Saito, I; Kawada, Y
1996-01-01
We evaluated the performances of a ligase chain reaction (LCR)-based assay and two enzyme immunoassays (Chlamydiazyme and IDEIA) in the detection of Chlamydia trachomatis in urine specimens. We compared the results of testing urine specimens by these assays with those of urethral swab culture by examining samples from 131 men with nongonococcal urethritis. Discrepant results were analyzed by testing urethral swab specimens for C. trachomatis by a PCR-based assay. After the resolution of discrepant results, the sensitivity of urethral swab culture was 85.3%, whereas those of the LCR assay, Chlamydiazyme, and IDEIA with urine specimens were 94.1, 82.4, and 94.1%, respectively. The LCR assay and IDEIA were more sensitive than was urethral swab culture. In addition, the LCR assay, with a sensitivity equal to that of IDEIA, was more specific. Overall, the LCR assay proved to be superior to the enzyme immunoassays in detecting C. trachomatis in urine specimens. Testing urine specimens by LCR assay should be a helpful alternative method for diagnosing C. trachomatis urethral infection in men with nongonococcal urethritis. PMID:8784574
Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei
2017-05-01
All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens
Directory of Open Access Journals (Sweden)
Tatiana M. Pinho
2015-12-01
Full Text Available Aim of study: This work aims to provide an overview of Model Predictive Controllers (MPC applications in supply chains, to describe the forest-based supply chain and to analyse the potential use and benefits of MPC in a case study concerning a biomass supply chain.Area of study: The proposed methods are being applied to a company located in Finland.Material and methods: Supply chains are complex systems where actions and partners’ coordination influence the whole system performance. The increase of competitiveness and need of quick responses to the costumers implies the use of efficient management techniques. The control theory, particularly MPC, has been successfully used as a supply chain management tool. MPC is able to deal with dynamic interactions between the partners and to globally optimize the supply chain performance in the presence of disturbances. However, as far as is authors’ knowledge, there are no applications of this methodology in the forest-based supply chains. This work proposes a control architecture to improve the performance of the forest supply chain. The controller is based on prediction models which are able to simulate the system and deal with disturbances.Main results: The preliminary results enable to evaluate the impacts of disturbances in the supply chain. Thus, it is possible to react beforehand, controlling the schedules and tasks’ allocation, or alert the planning level in order to generate a new plan.Research highlights: Overview of MPC applications in supply chains; forest-based supply chain description; case study presentation: wood biomass supply chain for energy production; MPC architecture proposal to decrease the operation times.Keywords: biomass; forest; Model Predictive Control; planning; supply chain.
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Alpatov, S.V.; Golovanova, Eh.Z.; Gorskaya, E.A.; Dobryanskij, V.M.; Makan'kin, A.M.; Puzynin, V.I.; Samojlov, V.N.; Cheker, A.V.
1996-01-01
The substantiation of choice of the hardware and software for integration in program-technical complex is given. The complex is intended for automation of the physical experiments connected with chain nuclear reaction investigations. The subsystem for energy supplying control of experiment is considered in detail. For building the subsystem the 'client-server' architecture is used. The subsystem includes the work station and VMEbus measuring modules in the net. The description of the programs and result formats are given. 5 refs., 6 figs
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion
Directory of Open Access Journals (Sweden)
Lei Zhang
2014-01-01
Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.
Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E
1992-01-01
Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.
Directory of Open Access Journals (Sweden)
Jennifer A. Scoble
2013-10-01
Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.
Investigating Students' Reasoning about Acid-Base Reactions
Cooper, Melanie M.; Kouyoumdjian, Hovig; Underwood, Sonia M.
2016-01-01
Acid-base chemistry is central to a wide range of reactions. If students are able to understand how and why acid-base reactions occur, it should provide a basis for reasoning about a host of other reactions. Here, we report the development of a method to characterize student reasoning about acid-base reactions based on their description of…
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
On the mechanism of photocatalytic reactions with eosin Y
Directory of Open Access Journals (Sweden)
Michal Majek
2014-04-01
Full Text Available A combined spectroscopic, synthetic, and apparative study has allowed a more detailed mechanistic rationalization of several recently reported eosin Y-catalyzed aromatic substitutions at arenediazonium salts. The operation of rapid acid–base equilibria, direct photolysis pathways, and radical chain reactions has been discussed on the basis of pH, solvent polarity, lamp type, absorption properties, and quantum yields. Determination of the latter proved to be an especially valuable tool for the distinction between radical chain and photocatalytic reactions.
Suppression of expression of muscle-associated proteins by PPARα in brown adipose tissue
International Nuclear Information System (INIS)
Tong, Yuhong; Hara, Atsushi; Komatsu, Makiko; Tanaka, Naoki; Kamijo, Yuji; Gonzalez, Frank J.; Aoyama, Toshifumi
2005-01-01
Peroxisome proliferator-activated receptor α (PPARα) belongs to the steroid/nuclear receptor superfamily. Two-dimensional (2D) SDS-PAGE analysis of brown adipose tissue (BAT) unexpectedly revealed six spots that were present only in PPARα-null mice. Proteomic analysis indicated that these proteins were tropomyosin-1 α chain, tropomyosin β chain, myosin regulatory light chain 2, myosin light chain 3, and parvalbumin α. Analyses of mRNA have revealed that PPARα suppressed the genes encoding these proteins in a synchronous manner in adult wild-type mice. Histological and physiological analyses of BAT showed in adult wild-type mice, a marked suppression of BAT growth concurrent with a prominent decrease in lipolytic and thermogenesis activities. These results suggest that in adult mice, PPARα functions to suppress the expression of the proteins that may be involved in the architecture of BAT, and thus may function in keeping BAT in a quiescent state
Directory of Open Access Journals (Sweden)
Gusti Ayu Yuniati Kencana
2013-07-01
Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique
2015-01-01
In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Entropy-Based Algorithm for Supply-Chain Complexity Assessment
Directory of Open Access Journals (Sweden)
Boris Kriheli
2018-03-01
Full Text Available This paper considers a graph model of hierarchical supply chains. The goal is to measure the complexity of links between different components of the chain, for instance, between the principal equipment manufacturer (a root node and its suppliers (preceding supply nodes. The information entropy is used to serve as a measure of knowledge about the complexity of shortages and pitfalls in relationship between the supply chain components under uncertainty. The concept of conditional (relative entropy is introduced which is a generalization of the conventional (non-relative entropy. An entropy-based algorithm providing efficient assessment of the supply chain complexity as a function of the SC size is developed.
Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases
Directory of Open Access Journals (Sweden)
Sharma J
2010-01-01
Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.
Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh
2015-03-01
Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).
Markov chain aggregation for agent-based models
Banisch, Sven
2016-01-01
This self-contained text develops a Markov chain approach that makes the rigorous analysis of a class of microscopic models that specify the dynamics of complex systems at the individual level possible. It presents a general framework of aggregation in agent-based and related computational models, one which makes use of lumpability and information theory in order to link the micro and macro levels of observation. The starting point is a microscopic Markov chain description of the dynamical process in complete correspondence with the dynamical behavior of the agent-based model (ABM), which is obtained by considering the set of all possible agent configurations as the state space of a huge Markov chain. An explicit formal representation of a resulting “micro-chain” including microscopic transition rates is derived for a class of models by using the random mapping representation of a Markov process. The type of probability distribution used to implement the stochastic part of the model, which defines the upd...
Chain-based communication in cylindrical underwater wireless sensor networks.
Javaid, Nadeem; Jafri, Mohsin Raza; Khan, Zahoor Ali; Alrajeh, Nabil; Imran, Muhammad; Vasilakos, Athanasios
2015-02-04
Appropriate network design is very significant for Underwater Wireless Sensor Networks (UWSNs). Application-oriented UWSNs are planned to achieve certain objectives. Therefore, there is always a demand for efficient data routing schemes, which can fulfill certain requirements of application-oriented UWSNs. These networks can be of any shape, i.e., rectangular, cylindrical or square. In this paper, we propose chain-based routing schemes for application-oriented cylindrical networks and also formulate mathematical models to find a global optimum path for data transmission. In the first scheme, we devise four interconnected chains of sensor nodes to perform data communication. In the second scheme, we propose routing scheme in which two chains of sensor nodes are interconnected, whereas in third scheme single-chain based routing is done in cylindrical networks. After finding local optimum paths in separate chains, we find global optimum paths through their interconnection. Moreover, we develop a computational model for the analysis of end-to-end delay. We compare the performance of the above three proposed schemes with that of Power Efficient Gathering System in Sensor Information Systems (PEGASIS) and Congestion adjusted PEGASIS (C-PEGASIS). Simulation results show that our proposed 4-chain based scheme performs better than the other selected schemes in terms of network lifetime, end-to-end delay, path loss, transmission loss, and packet sending rate.
Chain-Based Communication in Cylindrical Underwater Wireless Sensor Networks
Directory of Open Access Journals (Sweden)
Nadeem Javaid
2015-02-01
Full Text Available Appropriate network design is very significant for Underwater Wireless Sensor Networks (UWSNs. Application-oriented UWSNs are planned to achieve certain objectives. Therefore, there is always a demand for efficient data routing schemes, which can fulfill certain requirements of application-oriented UWSNs. These networks can be of any shape, i.e., rectangular, cylindrical or square. In this paper, we propose chain-based routing schemes for application-oriented cylindrical networks and also formulate mathematical models to find a global optimum path for data transmission. In the first scheme, we devise four interconnected chains of sensor nodes to perform data communication. In the second scheme, we propose routing scheme in which two chains of sensor nodes are interconnected, whereas in third scheme single-chain based routing is done in cylindrical networks. After finding local optimum paths in separate chains, we find global optimum paths through their interconnection. Moreover, we develop a computational model for the analysis of end-to-end delay. We compare the performance of the above three proposed schemes with that of Power Efficient Gathering System in Sensor Information Systems (PEGASIS and Congestion adjusted PEGASIS (C-PEGASIS. Simulation results show that our proposed 4-chain based scheme performs better than the other selected schemes in terms of network lifetime, end-to-end delay, path loss, transmission loss, and packet sending rate.
Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.
2015-07-01
Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.
Chemical reactions directed Peptide self-assembly.
Rasale, Dnyaneshwar B; Das, Apurba K
2015-05-13
Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.
Directory of Open Access Journals (Sweden)
Ina Schoon
2017-12-01
Full Text Available Bio-based unsaturated polyester resins derived from itaconic acid can be an alternative to established resins of this type in the field of radical-curing resins. However, one of the challenges of these polyester itaconates is the somewhat more elaborate synthetic process, especially under polycondensation conditions used on an industrial scale. The α,β-unsaturated double bond of the itaconic acid is prone to side reactions that can lead to the gelation of the polyester resin under standard conditions. This is especially true when bio-based diols such as 1,3-propanediol or 1,4-butanediol are used to obtain resins that are 100% derived from renewable resources. It was observed in earlier studies that high amounts of these aliphatic diols in the polyester lead to low conversion and gelation of the resins. In this work, a catalytic study using different diols was performed in order to elucidate the reasons for this behavior. It was shown that the choice of catalyst has a crucial influence on the side reactions occurring during the polycondensation reactions. In addition, the side reactions taking place were identified and suppressed. These results will allow for the synthesis of polyester itaconates on a larger scale, setting the stage for their industrial application.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Tran, Hong Hanh; Trinh, Kieu The Loan; Lee, Nae Yoon
2013-10-01
In this study, we fabricate a monolithic poly(methylmethacrylate) (PMMA) microdevice on which solid phase-based DNA preparation and flow-through polymerase chain reaction (PCR) units were functionally integrated for one-step sample preparation and amplification operated by pressure. Chelex resin, which is used as a solid support for DNA preparation, can capture denatured proteins but releases DNA, and the purified DNA can then be used as a template in a subsequent amplification process. Using the PMMA microdevices, DNA was successfully purified from both Escherichia coli and human hair sample, and the plasmid vector inserted in E. coli and the D1S80 locus in human genomic DNA were successfully amplified from on-chip purified E. coli and human hair samples. Furthermore, the integration potential of the proposed sample preparation and flow-through PCR units was successfully demonstrate on a monolithic PMMA microdevice with a seamless flow, which could pave the way for a pressure-driven, simple one-step sample preparation and amplification with greatly decreased manufacture cost and enhanced device disposability. Copyright © 2013 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager
2017-01-01
transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...
Internet-enabled collaborative agent-based supply chains
Shen, Weiming; Kremer, Rob; Norrie, Douglas H.
2000-12-01
This paper presents some results of our recent research work related to the development of a new Collaborative Agent System Architecture (CASA) and an Infrastructure for Collaborative Agent Systems (ICAS). Initially being proposed as a general architecture for Internet based collaborative agent systems (particularly complex industrial collaborative agent systems), the proposed architecture is very suitable for managing the Internet enabled complex supply chain for a large manufacturing enterprise. The general collaborative agent system architecture with the basic communication and cooperation services, domain independent components, prototypes and mechanisms are described. Benefits of implementing Internet enabled supply chains with the proposed infrastructure are discussed. A case study on Internet enabled supply chain management is presented.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-05-01
Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Directory of Open Access Journals (Sweden)
Miriam Ribas Zambenedetti
Full Text Available BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV, hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+ plasmid, generating pET47b(+-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Optimization of Consignment-Store-Based Supply Chain with Black Hole Algorithm
Directory of Open Access Journals (Sweden)
Ágota Bányai
2017-01-01
Full Text Available The globalization of economy and market led to increased networking in the field of manufacturing and services. These manufacturing and service processes including supply chain became more and more complex. The supply chain includes in many cases consignment stores. The design and operation of these complex supply chain processes can be described as NP-hard optimization problems. These problems can be solved using sophisticated models and methods based on metaheuristic algorithms. This research proposes an integrated supply model based on consignment stores. After a careful literature review, this paper introduces a mathematical model to formulate the problem of consignment-store-based supply chain optimization. The integrated model includes facility location and assignment problems to be solved. Next, an enhanced black hole algorithm dealing with multiobjective supply chain model is presented. The sensitivity analysis of the heuristic black hole optimization method is also described to check the efficiency of new operators to increase the convergence of the algorithm. Numerical results with different datasets demonstrate how the proposed model supports the efficiency, flexibility, and reliability of the consignment-store-based supply chain.
Tomizawa, Minoru; Shinozaki, Fuminobu; Motoyoshi, Yasufumi; Sugiyama, Takao; Yamamoto, Shigenori; Ishige, Naoki
2016-01-01
The compound 3-bromopyruvate (3BP) is an analogue of pyruvate, which is the final product of glycolysis that enters the citric acid cycle. The present study aimed to investigate the suppressive effects of 3BP on the proliferation and motility of hepatocellular carcinoma (HCC) cells. HLF and PLC/PRF/5 cells were cultured with 3BP and subjected to an MTS assay. Apoptosis was analyzed by hematoxylin and eosin staining. Cell motility was analyzed using a scratch assay. Real-time quantitative polymerase chain reaction (PCR) was performed to determine the expression levels of cyclin D1 and matrix metalloproteinase (MMP)9. Proliferation of both cell lines was significantly suppressed by 3BP at 100 µM (P<0.05). The expression level of cyclin D1 was decreased after 3BP treatment at 100 µM in both cell lines (P<0.05). Pyknotic nuclei were observed in the cells cultured with 3BP at 100 µM. These results revealed that 3BP suppressed cell proliferation, decreased the expression of cyclin D1, and induced apoptosis in HCC cells. 3BP significantly suppressed motility in both cell lines (P<0.05). The expression level of MMP9 was significantly decreased (P<0.05). 3BP suppressed the proliferation and motility of HCC cells by decreasing the expression of cyclin D1 and MMP9.
Design of Test Wrapper Scan Chain Based on Differential Evolution
Directory of Open Access Journals (Sweden)
Aijun Zhu
2013-08-01
Full Text Available Integrated Circuit has entered the era of design of the IP-based SoC (System on Chip, which makes the IP core reuse become a key issue. SoC test wrapper design for scan chain is a NP Hard problem, we propose an algorithm based on Differential Evolution (DE to design wrapper scan chain. Through group’s mutation, crossover and selection operations, the design of test wrapper scan chain is achieved. Experimental verification is carried out according to the international standard benchmark ITC’02. The results show that the algorithm can obtain shorter longest wrapper scan chains, compared with other algorithms.
Electronic shift register memory based on molecular electron-transfer reactions
Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.
1989-01-01
The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.
Wubetu, Gizachew Yismaw; Utsunomiya, Tohru; Ishikawa, Daichi; Ikemoto, Tetsuya; Yamada, Shinichiro; Morine, Yuji; Iwahashi, Shuichi; Saito, Yu; Arakawa, Yusuke; Imura, Satoru; Arimochi, Hideki; Shimada, Mitsuo
2014-09-01
Branched chain amino acid (BCAA) dietary supplementation inhibits activation of the insulin-like growth factor (IGF)/IGF-I receptor (IGF-IR) axis in diabetic animal models. However, the in vitro effect of BCAA on human cancer cell lines under hyper-insulinemic conditions remains unclear. Colon (HCT-116) and hepatic (HepG2) tumor cells were treated with varying concentrations of BCAA with or without fluorouracil (5-FU). The effect of BCAA on insulin-initiated proliferation was determined. Gene and protein expression was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively. BCAA supplementation had no significant effect on cell proliferation and did not show significant synergistic or antagonistic effects with 5-FU. However, BCAA significantly decreased insulin-initiated proliferation of human colon and hepatic cancer cell lines in vitro. BCAA supplementation caused a marked decrease in activated IGF-IR expression and significantly enhanced both mRNA and protein expression of LC3-II and BECN1 (BECLIN-1). BCAA could be a useful chemopreventive modality for cancer in hyperinsulinemic conditions. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Aging and repeated thought suppression success.
Directory of Open Access Journals (Sweden)
Ann E Lambert
Full Text Available Intrusive thoughts and attempts to suppress them are common, but while suppression may be effective in the short-term, it can increase thought recurrence in the long-term. Because intentional suppression involves controlled processing, and many aspects of controlled processing decline with age, age differences in thought suppression outcomes may emerge, especially over repeated thought suppression attempts as cognitive resources are expended. Using multilevel modeling, we examined age differences in reactions to thought suppression attempts across four thought suppression sequences in 40 older and 42 younger adults. As expected, age differences were more prevalent during suppression than during free monitoring periods, with younger adults indicating longer, more frequent thought recurrences and greater suppression difficulty. Further, younger adults' thought suppression outcomes changed over time, while trajectories for older adults' were relatively stable. Results are discussed in terms of older adults' reduced thought recurrence, which was potentially afforded by age-related changes in reactive control and distractibility.
Performance of an HF chain-reaction laser with high initiation efficiency
International Nuclear Information System (INIS)
Whittier, J.S.; Kerber, R.L.
1974-01-01
Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Giovannelli, D; Abballe, F
2005-08-26
A method has been developed which allows simultaneous determination of three linear alkyl trimethylammonium salts. Dodecyltrimethylammonium chloride, tetradecyltrimethylammonium bromide and hexadecyltrimethylammonium chloride are widely used as main active ingredients of lysing reagents for blood cell analyzers which perform white blood cells differential determination into two or more sub-populations by impedance analysis. The ion-pair on styrene-divinyl benzene chromatographic phase looks like a suitable, reliable and long term stable tool for separation of such quaternary compounds. The detection based on suppressed conductivity was chosen because of the lack of significance chromophores. A micromembrane suppressor device compatible with high solvent concentration (up to 80%) was used in order to minimize the conductivity background before the detection. In the present work we show how the chemical post column derivatization makes the alkyl chain detectable also by UV direct detection at 210 nm.
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-12-01
Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Luan, Yan; Deqin, Yang
2017-08-01
Objective To explore the impact of nicotine on proliferation and osteogenic capability of periodontal ligament stem cells (PDLSCs), and the role of Toll-like receptor 4 (TLR4) in nicotine, suppressing the osteogenic capability of PDLSCs. Methods PDLSCs were cultured in vitro, and the flow cytometer was used to identify the surface antigen markers of PDLSCs. WST-1 was used to detect the proliferation ability of PDLSCs, which were stimulated by different concentrations of nicotine. Alizarin red staining was used to observe the formation of mineralized nodules after PDLSCs stimulation with different concentrations of nicotine. Real-time polymerase chain reaction (RT-PCR) and Western blot were used to detect the change in osteogenic potential of PDLSCs stimulated by nicotine, after TAK-242, and with the inhibitor of TLR4. Results PDLSCs expressed mesenchymal stem cell-associated markers CD90 and CD105. When the concentration of nicotine was 10⁻⁴ mol·L⁻¹, the PDLSC proliferation could be suppressed after 3 d compared with the control group (Pnicotine suppressed the PDLSCs (PNicotine suppresses the proliferation and osteogenic capability of PDLSCs, which may be regulated by TLR4.
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.
Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen
2015-05-15
Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Boissière-Michot Florence
2009-04-01
Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
International Nuclear Information System (INIS)
Adare, A.; Bickley, A. A.; Ellinghaus, F.; Glenn, A.; Kinney, E.; Kiriluk, K.; Linden Levy, L. A.; Nagle, J. L.; Rosen, C. A.; Seele, J.; Wysocki, M.; Afanasiev, S.; Isupov, A.; Litvinenko, A.; Malakhov, A.; Peresedov, V.; Rukoyatkin, P.; Zolin, L.; Aidala, C.; Datta, A.
2011-01-01
Pair correlations between large transverse momentum neutral pion triggers (p T =4--7 GeV/c) and charged hadron partners (p T =3--7 GeV/c) in central (0%-20%) and midcentral (20%-60%) Au+Au collisions at √(s NN )=200 GeV are presented as a function of trigger orientation with respect to the reaction plane. The particles are at larger momentum than where jet shape modifications have been observed, and the correlations are sensitive to the energy loss of partons traveling through hot dense matter. An out-of-plane trigger particle produces only 26±20% of the away-side pairs that are observed opposite of an in-plane trigger particle for midcentral (20%-60%) collisions. In contrast, near-side jet fragments are consistent with no suppression or dependence on trigger orientation with respect to the reaction plane. These observations are qualitatively consistent with a picture of little near-side parton energy loss either due to surface bias or fluctuations and increased away-side parton energy loss due to a long path through the medium. The away-side suppression as a function of reaction-plane angle is shown to be sensitive to both the energy loss mechanism and the space-time evolution of heavy-ion collisions.
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
He, Jianghua
2014-11-25
A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
How does methylation suppress the electron-induced decomposition of 1-methyl-nitroimidazoles?
Kossoski, F.; Varella, M. T. do N.
2017-10-01
The efficient decomposition of nitroimidazoles (NIs) by low energy electrons is believed to underlie their radiosensitizing properties. Recent dissociative electron attachment (DEA) measurements showed that methylation at the N1 site unexpectedly suppresses the electron-induced reactions in 4(5)-NI. We report theoretical results that provide a clear interpretation of that astounding finding. Around 1.5 eV, DEA reactions into several fragments are initiated by a π* resonance, not considered in previous studies. The autoionization lifetime of this anion state, which limits the predissociation dynamics, is considerably shorter in the methylated species, thereby suppressing the DEA signals. On the other hand, the lifetime of the π* resonance located around 3 eV is less affected by methylation, which explains why DEA is still observed at these energies. Our results demonstrate how even a simple methylation can significantly modify the probabilities for DEA reactions, which may be significant for NI-based cancer therapy.
HLA-DP related suppression of mixed lymphocyte reaction with alloactivated lymphocytes
DEFF Research Database (Denmark)
Ødum, Niels; Hofmann, B; Jakobsen, B K
1986-01-01
We studied the influence of HLA class I and class II antigens on the suppression of the MLR induced by primed lymphocytes (PLs) alloactivated in vitro. The suppression of 14 different PLs of 83 MLRs was analyzed. The PLs were primed against (i) HLA-DP (SB) (ii) HLA-DR/DQ or (iii) both HLA-DP and ...
HLA-DP related suppression of mixed lymphocyte reaction with alloactivated lymphocytes
DEFF Research Database (Denmark)
Ødum, Niels; Hofmann, B; Jakobsen, B K
1986-01-01
We studied the influence of HLA class I and class II antigens on the suppression of the MLR induced by primed lymphocytes (PLs) alloactivated in vitro. The suppression of 14 different PLs of 83 MLRs was analyzed. The PLs were primed against (i) HLA-DP (SB) (ii) HLA-DR/DQ or (iii) both HLA-DP and DR...
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-09-01
Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms
Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe
Energy Technology Data Exchange (ETDEWEB)
Mania, Hubert
2010-07-01
Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Aquino-Andrade, Alejandra; Martínez-Leyva, Gabriel; Mérida-Vieyra, Jocelin; Saltigeral, Patricia; Lara, Antonino; Domínguez, Wendy; García de la Puente, Silvestre; De Colsa, Agustín
2017-09-01
To evaluate the usefulness of real-time polymerase chain reaction (RT-PCR) as a diagnostic method for the detection of Bordetella pertussis in hospitalized patients aged pertussis detection and symptoms in household contacts of patients diagnosed with pertussis were studied. A total of 286 patients were included; of these, 67.1% had B pertussis and 4.5% had Bordetella spp. Complications occurred in 20% of patients, and the mortality rate was 6.7%. Of 434 contacts studied, 111 were mothers of study infants, representing the most frequently B pertussis-infected group and the main symptomatic contact. The use of RT-PCR permits improved detection and diagnosis of pertussis and a better understanding of the epidemiology of sources of infection. The complications and mortality rate of pertussis continue to be high. Household contacts are confirmed as a frequent source of infection of B pertussis in young children. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
Xu, Huifeng; Kou, Fangxia; Ye, Hongzhi; Wang, Zongwen; Huang, Suixin; Liu, Xianxiang; Zhu, Xi; Lin, Zhenyu; Chen, Guonan
2017-12-01
Vascular endothelial growth factor (VEGF) is a crucial signaling protein for the tumor growth and metastasis, which is also acted as the biomarkers for various diseases. In this research, we fabricate an aptamer-antibody sensor for point-of-care test of VEGF. Firstly, target VEGF is captured by antibody immobilized on the microplate, and then binds with aptamer to form the sandwich structure. Next, with the assist of glucose oxidase (GOx)-functionalized ssDNAs, hybridization chain reaction occurs using the aptamer as the primer. Thus, GOx are greatly gathered on the microplate, which catalyzes the oxidization of glucose, leading to the pH change. As a result, the detect limit at a signal-to-noise was estimated to be 0.5pg/mL of target by pH meter, and 1.6pg/mL of VEGF was able to be distinguished by naked eyes. Meanwhile, this method has been used assay VEGF in the serum with the satisfactory results. Copyright © 2017. Published by Elsevier B.V.
Amino Acid Based Synthesis of Chiral Long Chain Diamines and Tetramines
Directory of Open Access Journals (Sweden)
George Kokotos
2002-10-01
Full Text Available A method for the synthesis of long chain diamines and tetramines starting from natural α-amino acids is reported. Diamines and tetramines were prepared through the Wittig olefination reaction of N-protected amino aldehydes obtained from phenylalanine and lysine. A 1,2,17,18-tetramine was synthesized using (2S-1-azido-2-[bis(tert-butoxycarbonyl-amino]-5-oxopentane as key-intermediate compound.
Kinetics of the chain uranium decay
International Nuclear Information System (INIS)
Zel'dovich, Ya.B.; Khariton, Yu.B.
1984-01-01
The development of chain reaction in uranium mass, when passing through the mass critical value, is studied. It is shown that thermal expanson is a powerful regulating factor, making the limit passing quite safe. The case of convergence of two uranium masses of precritical dimensions is considered in particular. The critical mass value is assessed and it is shown that its gradual increase above the critical value results in the reaction vibrational regime with the period inversely proportional to the square root of uranium supply rate. The role of delaying neutrons in the fission chain reaction development is pointed out
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Automated generation of burnup chain for reactor analysis applications
International Nuclear Information System (INIS)
Tran, Viet-Phu; Tran, Hoai-Nam; Yamamoto, Akio; Endo, Tomohiro
2017-01-01
This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO_2 and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.
Automated generation of burnup chain for reactor analysis applications
Energy Technology Data Exchange (ETDEWEB)
Tran, Viet-Phu [VINATOM, Hanoi (Viet Nam). Inst. for Nuclear Science and Technology; Tran, Hoai-Nam [Duy Tan Univ., Da Nang (Viet Nam). Inst. of Research and Development; Yamamoto, Akio; Endo, Tomohiro [Nagoya Univ., Nagoya-shi (Japan). Dept. of Materials, Physics and Energy Engineering
2017-05-15
This paper presents the development of an automated generation of burnup chain for reactor analysis applications. Algorithms are proposed to reevaluate decay modes, branching ratios and effective fission product (FP) cumulative yields of a given list of important FPs taking into account intermediate reactions. A new burnup chain is generated using the updated data sources taken from the JENDL FP decay data file 2011 and Fission yields data file 2011. The new burnup chain is output according to the format for the SRAC code system. Verification has been performed to evaluate the accuracy of the new burnup chain. The results show that the new burnup chain reproduces well the results of a reference one with 193 fission products used in SRAC. Burnup calculations using the new burnup chain have also been performed based on UO{sub 2} and MOX fuel pin cells and compared with a reference chain th2cm6fp193bp6T.
Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo
2007-06-19
Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.
International Nuclear Information System (INIS)
Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet
2004-01-01
The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)
Ion energy recovery experiment based on magnetic electro suppression
International Nuclear Information System (INIS)
Kim, J.; Stirling, W.L.; Dagenhart, W.K.; Barber, G.C.; Ponte, N.S.
1980-05-01
A proof-of-principle experiment on direct recovery of residual hydrogen ions based on a magnetic electron suppression scheme is described. Ions extracted from a source plasma a few kilovolts above the ground potential (approx. 20 A) are accelerated to 40 keV by a negative potential maintained on a neutralizer gas cell. As the residual ions exit the gas cell, they are deflected from the neutral beam by a magnetic field that also suppresses gas cell electrons and then recovered on a ground-potential surface. Under optimum conditions, a recovery efficiency (the ratio of the net recovered current to the available full-energy ion current) of 80% +- 20% has been obtained. Magnetic suppression of the beam plasma electrons was rather easily achieved; however, handling the fractional-energy ions originating from molecular species (H 2 + and H 3 + ) proved to be extremely important to recovery efficiency
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Increasing Supply-Chain Visibility with Rule-Based RFID Data Analysis
DEFF Research Database (Denmark)
Ilic, A.; Andersen, Thomas; Michahelles, F.
2009-01-01
RFID technology tracks the flow of physical items and goods in supply chains to help users detect inefficiencies, such as shipment delays, theft, or inventory problems. An inevitable consequence, however, is that it generates huge numbers of events. To exploit these large amounts of data, the Sup......RFID technology tracks the flow of physical items and goods in supply chains to help users detect inefficiencies, such as shipment delays, theft, or inventory problems. An inevitable consequence, however, is that it generates huge numbers of events. To exploit these large amounts of data......, the Supply Chain Visualizer increases supply-chain visibility by analyzing RFID data, using a mix of automated analysis techniques and human effort. The tool's core concepts include rule-based analysis techniques and a map-based representation interface. With these features, it lets users visualize...
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
MRP-based negotiation in collaborative supply chains
Directory of Open Access Journals (Sweden)
Bernard Grabot
2013-07-01
Full Text Available Although collaboration between parteners is now considered as a mean to increase the performance of the supply chains, most of them are still managed in a directive way through cascades of classical MRP/MRP2 systems, in which the constraints of the suppliers, especially the smallest ones, are poorly taken into account. We suggest in this article to assess the interest of the integration into collaborative processes of some practices based on MRP, identified after a study in aeronautical supply chains. Within these processes, classical parameters of MRP would be negotiated instead of being imposed by the large companies.
Directory of Open Access Journals (Sweden)
Lina Marcela Villa
2013-11-01
Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.
Alessandro, Pancrazzi; Paola, Guglielmelli; Vanessa, Ponziani; Gaetano, Bergamaschi; Alberto, Bosi; Giovanni, Barosi; Alessandro M, Vannucchi
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves we...
Improved olefinic fat suppression in skeletal muscle DTI using a magnitude-based dixon method.
Burakiewicz, Jedrzej; Hooijmans, Melissa T; Webb, Andrew G; Verschuuren, Jan J G M; Niks, Erik H; Kan, Hermien E
2018-01-01
To develop a method of suppressing the multi-resonance fat signal in diffusion-weighted imaging of skeletal muscle. This is particularly important when imaging patients with muscular dystrophies, a group of diseases which cause gradual replacement of muscle tissue by fat. The signal from the olefinic fat peak at 5.3 ppm can significantly confound diffusion-tensor imaging measurements. Dixon olefinic fat suppression (DOFS), a magnitude-based chemical-shift-based method of suppressing the olefinic peak, is proposed. It is verified in vivo by performing diffusion tensor imaging (DTI)-based quantification in the lower leg of seven healthy volunteers, and compared to two previously described fat-suppression techniques in regions with and without fat contamination. In the region without fat contamination, DOFS produces similar results to existing techniques, whereas in muscle contaminated by subcutaneous fat signal moved due to the chemical shift artefact, it consistently showed significantly higher (P = 0.018) mean diffusivity (MD). Because fat presence lowers MD, this suggests improved fat suppression. DOFS offers superior fat suppression and enhances quantitative measurements in the muscle in the presence of fat. DOFS is an alternative to spectral olefinic fat suppression. Magn Reson Med 79:152-159, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals
Directory of Open Access Journals (Sweden)
Mayara C. Lombardi
2014-12-01
Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.
Directory of Open Access Journals (Sweden)
Milena Alicja Stachelska
2017-01-01
Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.
75 FR 29307 - Web Based Supply Chain Management Commodity Offer Form, Paperwork Collection Notice
2010-05-25
... Based Supply Chain Management Commodity Offer Form, Paperwork Collection Notice AGENCY: Agricultural... collection request is required for the implementation of a new system named Web Based Supply Chain Management...-2782. Mail: David Tuckwiller, Project Manager, Web Based Supply Chain Management System, Agricultural...
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Subwavelength dielectric nanorod chains for energy transfer in the visible range.
Li, Dongdong; Zhang, Jingjing; Yan, Changchun; Xu, Zhengji; Zhang, Dao Hua
2017-10-15
We report a new type of energy transfer device, formed by a dielectric nanorod array embedded in a silver slab. Such dielectric chain structures allow surface plasmon wave guiding with large propagation length and highly suppressed crosstalk between adjacent transmission channels. The simulation results show that our proposed design can be used to enhance the energy transfer along the waveguide-like dielectric nanorod chains via coupled plasmons, where the energy spreading is effectively suppressed, and superior imaging properties in terms of resolution and energy transfer distance can be achieved.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
Electronic structures and band gaps of chains and sheets based on phenylacetylene units
International Nuclear Information System (INIS)
Kondo, Masakazu; Nozaki, Daijiro; Tachibana, Masamitsu; Yumura, Takashi; Yoshizawa, Kazunari
2005-01-01
We investigate the electronic structures of polymers composed of π-conjugated phenylacetylene (PA) units, m-PA-based and p-PA-based wires, at the extended Hueckel level of theory. It is demonstrated that these conjugated systems should have a variety of electric conductance. All of the one-dimensional (1D) chains and the two-dimensional (2D) sheet based on the m-PA unit are insulators with large band gaps of 2.56 eV because there is no effective orbital interaction with neighboring chains. On the other hand, p-PA-based 1D chains have relatively small band gaps that decrease with an increase in chain width (1.17-1.74 eV) and are semiconductive. The p-PA-based sheet called 'graphyne', a 2D-limit of the p-PA-based 1D chains, shows a small band gap of 0.89 eV. The variety of band electronic structures is discussed in terms of frontier crystal orbitals
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
Modeling of China's cassava-based bioethanol supply chain operation and coordination
International Nuclear Information System (INIS)
Ye, Fei; Li, Yina; Lin, Qiang; Zhan, Yuanzhu
2017-01-01
As a useful alternative to petroleum-based fuel, biofuels are playing an increasingly important role due to their economic, environmental, and social benefits. Cassava is viewed as an important and highly attractive nonedible feedstock for the production of biofuels. In this paper, a game-theoretic approach is proposed to explore decision behavior within a cassava-based bioethanol supply chain under the condition of yield uncertainty. In addition, a production cost sharing contract is proposed to overcome the double marginalization effect due to competition between supply chain players. With data from China's cassava-based bioethanol industry, the paper analyzes the effects of the farmer's capacity, risk aversion, yield uncertainty, the conversion ratio, the bioethanol's market price and ethanol plant's operation cost on optimal decisions within the supply chain and its overall performance. In addition, the effectiveness of the proposed production cost sharing contract is tested, and the results show that it can enhance the supply of cassava, increase the utility of the whole supply chain and reduce the level of greenhouse gas (GHG) emissions. The implications are set out for policy makers regarding how to promote the development of the biofuel industry, to guarantee the supply of feedstock, to reduce GHG emissions and to promote rural development. - Highlights: • Decision behavior within the cassava-based bioethanol supply chain is modeled. • Yield uncertainty and farmers' capacity and risk aversion are considered. • A production cost sharing contract is proposed to coordinate the supply chain. • The cassava supply, the utility and reduction on GHG emissions are increased. • Policy implications regarding how to promote biofuel supply chains are set out.
Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios
2015-10-15
Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A
2017-01-01
Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.
Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha
2017-09-19
The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.
Experimental Study of Serpentinization Reactions
Cohen, B. A.; Brearley, A. J.; Ganguly, J.; Liermann, H.-P.; Keil, K.
2004-01-01
Current carbonaceous chondrite parent-body thermal models [1-3] produce scenarios that are inconsistent with constraints on aqueous alteration conditions based on meteorite mineralogical evidence, such as phase stability relationships within the meteorite matrix minerals [4] and isotope equilibration arguments [5, 6]. This discrepancy arises principally because of the thermal runaway effect produced by silicate hydration reactions (here loosely called serpentinization, as the principal products are serpentine minerals), which are so exothermic as to produce more than enough heat to melt more ice and provide a self-sustaining chain reaction. One possible way to dissipate the heat of reaction is to use a very small parent body [e.g., 2] or possibly a rubble pile model. Another possibility is to release this heat more slowly, which depends on the alteration reaction path and kinetics.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
New levels in 168Er: Use of a Compton-suppressed Ge array with the (n,γ) reaction
International Nuclear Information System (INIS)
Gill, R.L.; Casten, R.F.; Phillips, W.R.; Varley, B.J.; Lister, C.J.; Durell, J.L.; Shannon, J.A.; Warner, D.D.
1996-01-01
For the first time an (n,γ) reaction has been extensively studied using a large array of Compton-suppressed Ge detectors (the TESSA array). The nucleus 168 Er was studied and the data show substantial improvement, in both quantity and quality, over previous coincidence data. Even though 168 Er is perhaps the best studied deformed nucleus, over 250 new coincidence relations and a number of new levels in 168 Er were disclosed, demonstrating the usefulness of this approach. Nuclear physics applications relate to the extension of nearly complete spectroscopy to higher excitation energies and to the study of statistical and chaotic features of the decay of low spin compound nuclear levels. copyright 1996 The American Physical Society
A Probabilistic Short-Term Water Demand Forecasting Model Based on the Markov Chain
Directory of Open Access Journals (Sweden)
Francesca Gagliardi
2017-07-01
Full Text Available This paper proposes a short-term water demand forecasting method based on the use of the Markov chain. This method provides estimates of future demands by calculating probabilities that the future demand value will fall within pre-assigned intervals covering the expected total variability. More specifically, two models based on homogeneous and non-homogeneous Markov chains were developed and presented. These models, together with two benchmark models (based on artificial neural network and naïve methods, were applied to three real-life case studies for the purpose of forecasting the respective water demands from 1 to 24 h ahead. The results obtained show that the model based on a homogeneous Markov chain provides more accurate short-term forecasts than the one based on a non-homogeneous Markov chain, which is in line with the artificial neural network model. Both Markov chain models enable probabilistic information regarding the stochastic demand forecast to be easily obtained.
Zhou, Yu; Pearson, John E; Auerbach, Anthony
2005-12-01
We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.
Chaos suppression based on adaptive observer for a P-class of chaotic systems
International Nuclear Information System (INIS)
Rodriguez, Angel; Leon, Jesus de; Femat, Ricardo
2007-01-01
A feedback approach is presented to suppress chaos in a P-class of chaotic system. The approach is based on an adaptive observer; which provides estimated values of both the unmeasured states and the uncertain model parameters. A continuous-time feedback law is taken as suppressing force. The feedback law attains chaos suppression as the observer provides estimated values close to the actual state/parameter values along time. The proposed scheme is robust in the sense that suppression is achieved despite only some states are measured and uncertainties in parameters are compensated. Results are corroborated experimentally by implementation in chaotic circuits
Chaos suppression based on adaptive observer for a P-class of chaotic systems
Energy Technology Data Exchange (ETDEWEB)
Rodriguez, Angel [Universidad Autonoma de Nuevo Leon, Facultad de Ingenieria Mecanica y Electrica, Av. Pedro de Alba s/n Cd. Universitaria, CP 66450 San Nicolas de los Garza, NL (Mexico); Leon, Jesus de [Universidad Autonoma de Nuevo Leon, Facultad de Ingenieria Mecanica y Electrica, Av. Pedro de Alba s/n Cd. Universitaria, CP 66450 San Nicolas de los Garza, NL (Mexico); Femat, Ricardo [Division de Matematicas Aplicadas y Sistemas Computacionales, IPICyT, Camino a la Presa San Jose 2055 Col. Lomas 4a. Secc. CP 78216 San Luis Potosi, SLP (Mexico)]. E-mail: rfemat@ipicyt.edu.mx
2007-05-15
A feedback approach is presented to suppress chaos in a P-class of chaotic system. The approach is based on an adaptive observer; which provides estimated values of both the unmeasured states and the uncertain model parameters. A continuous-time feedback law is taken as suppressing force. The feedback law attains chaos suppression as the observer provides estimated values close to the actual state/parameter values along time. The proposed scheme is robust in the sense that suppression is achieved despite only some states are measured and uncertainties in parameters are compensated. Results are corroborated experimentally by implementation in chaotic circuits.
A straightforward approach towards combined α-amino and α-hydroxy acids based on Passerini reactions
Directory of Open Access Journals (Sweden)
Ameer F. Zahoor
2011-09-01
Full Text Available Complex amino acids with an α-acyloxycarbonyl functionality in the side chain are easily available through epoxide opening by chelated enolates and subsequent oxidation/Passerini reaction. This protocol works with both, aldehyde and ketone intermediates, as long as the ketones are activated by electron-withdrawing groups. In principle Ugi reactions are also possible, allowing the generation of diamino acid derivatives.
Directory of Open Access Journals (Sweden)
Angela Wang
2016-12-01
Full Text Available Procyanidins are a family of plant metabolites that have been suggested to mitigate osteoarthritis pathogenesis in mice. However, the underlying mechanism is largely unknown. This study aimed to determine whether procyanidins mitigate traumatic injury-induced osteoarthritis (OA disease progression, and whether procyanidins exert a chondroprotective effect by, at least in part, suppressing vascular endothelial growth factor signaling. Procyanidins (extracts from pine bark, orally administered to mice subjected to surgery for destabilization of the medial meniscus, significantly slowed OA disease progression. Real-time polymerase chain reaction revealed that procyanidin treatment reduced expression of vascular endothelial growth factor and effectors in OA pathogenesis that are regulated by vascular endothelial growth factor. Procyanidin-suppressed vascular endothelial growth factor expression was correlated with reduced phosphorylation of vascular endothelial growth factor receptor 2 in human OA primary chondrocytes. Moreover, components of procyanidins, procyanidin B2 and procyanidin B3 exerted effects similar to those of total procyanidins in mitigating the OA-related gene expression profile in the primary culture of human OA chondrocytes in the presence of vascular endothelial growth factor. Together, these findings suggest procyanidins mitigate OA pathogenesis, which is mediated, at least in part, by suppressing vascular endothelial growth factor signaling.
International Nuclear Information System (INIS)
Takatsuji, Yoshiyuki; Wakabayashi, Ryo; Sakakura, Tatsuya; Haruyama, Tetsuya
2015-01-01
The molecular affinities of biomolecules have found applications in the areas of clinical diagnostics, drug discovery, as well as allied fields of study. An affinity sensor is a unique in situ assay tool, which is valuable and convenient in practical situations. In this study, we designed a photo-excitable molecular interface with an affinity domain and fabricated with a “swingable” straight-chain affinity molecule immobilized on a semi-conductor electrode (SCE). The straight-chain affinity molecule possessed a photo-excitable dye at one end and was bound to the SCE surface at the other by the EC tag method, which was developed previously. A straight-chain molecule is too long to transfer electrons from the photo-excited dye to the conduction band of the SCE. However, the straight-chain molecule was designed with a “swing” structure, which made the transfer of electrons possible. The central region of the chain molecule has an affinity to the activated estrogen receptor (ER). When the activated ER bound to the affinity region, the molecular lost its swingable function, the electron transfer from the photo-excited dye to the SCE was consequently suppressed. Based on the unique swingable molecular interface, the affinity sensor can be used to determine the in situ concentration of endocrine disrupter ESTROGEN (17β-estradiol) at concentrations ranging from 2 to 10 nM with very good reproducibility. The superior assay reproducibility is responsible for the success of the EC tag method, which is a quantitative method for immobilizing molecules on SCE.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
An Agent-based Simulation of a QoS-oriented Supply Chain
Gumzej, Roman; Rosi, Bojan
2017-01-01
With adaptive customer-orientation the efficiency of supply chain management is improved substantially. By the introduction of service quality-based decision-making into supply chain management the quality of service (QoS) within supply chains is expected to improve autonomously and continuously up- and downstream. In the paper the main characteristics of quality of service oriented supply chain management are outlined. The quality of service criterion, introduced into the adaptive supply cha...
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy
2004-01-01
In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement
Directory of Open Access Journals (Sweden)
Vladimir Agabekov
2012-01-01
Full Text Available The effect of diisocyanate chain extender (CE on the mechanical, rheological, and relaxation properties, as well as on molecular weight and crystallizability, of starting poly(ethylene terephthalate (PET and its composites containing carbon nanomaterials (CNM such as carbon nanotubes (CNTs and commercial carbon (CC has been studied. The composites were compounded in molten PET using twin-screw extruder (screw diameter 35 mm; L/D=40. To improve the distribution of CNM in the polymeric matrix (before introduction into the melt, they were blended with PET powder and subjected to an ultrasonic treatment in methylene chloride. The salient features of the materials structure were estimated based on DSC and relaxation spectrometry (dynamic mechanical analysis data. It has been found that CNM additives partly suppress the PET-chain extension reactions which take place during interaction between macromolecular end groups and CE. Besides, both CNT and CC favour crystallizability of the modified PET owing to nucleation of the crystallization process. The influence of CNT appears to be more effective than that of CC. Enhancements in true mechanical strength and deformability of PET/CE/CNM composites, as against PET/CE materials, were found to be most clearly exhibited by the CNT-containing composites.
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
International Nuclear Information System (INIS)
Imshennik, V.S.
2006-01-01
Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru
Directory of Open Access Journals (Sweden)
Lulu Arafani
2016-03-01
Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .
Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.
Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne
2017-06-01
To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.
Mechanisms of RhoGDI2 Mediated Lung Cancer Epithelial-Mesenchymal Transition Suppression
Directory of Open Access Journals (Sweden)
Huiyan Niu
2014-11-01
Full Text Available Background: The aim of this study was to evaluate the function of RhoGDI2 in lung cancer epithelial-mesenchymal transition (EMT process and to illustrate the underlying mechanisms that will lead to improvement of lung cancer treatment. Methods: The RhoGDI2 knock-down and overexpressing A549 cell lines were first constructed. The influence of RhoGDI2 on cytoskeleton in A549 cells was studied using two approaches: G-LISA-based Rac1 activity measurement and immunostaining-based F-actin distribution. The expression levels of key EMT genes were analyzed using real time quantitative polymerase chain reaction (RT-qPCR, western blot and immunostaining in untreated and RhoGDI2 knock-down or overexpressing A549 cells in both in vivo and in vitro experimental settings. Results: Our study showed that the activity of Rac1, a key gene that is crucial for the initiation and metastasis of human lung adenocarcinoma, causing the redistribution of F-actin with partial loss of cell-cell adhesions and stress fibers, was significantly suppressed by RhoGDI2. RhoGDI2 promoted the expression of EMT marker gene E-cadherin and repressed EMT promoting genes Slug, Snail, α-SMA in both A549 cells and lung and liver organs derived from the mouse models. Knocking-down RhoGDI2 induced abnormal morphology for lung organs. Conclusion: These findings indicate that RhoGDI2 repressed the activity of Rac1 and may be involved in the rearrangement of cytoskeleton in lung cancer cells. RhoGDI2 suppresses the metastasis of lung cancer mediated through EMT by regulating the expression of key genes such as E-cadherin, Slug, Snail and α-SMA in both in vivo and in vitro models.
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Additional chain-branching pathways in the low-temperature oxidation of branched alkanes
Wang, Zhandong
2015-12-31
Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS). Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C8H14O4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C8H16O5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C8H16O5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O2 addition, intramolecular isomerization, and OH release; C8H14O4 species are proposed to result from subsequent reactions of C8H16O5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth\\'s troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. The results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances. © 2015 The Combustion Institute.
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.
Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi
2012-01-01
Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.
Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L
2009-10-01
Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.
Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi
2017-11-01
Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Thakur, Kiran; Tomar, Sudhir Kumar; Brahma, Biswajit; De, Sachinandan
2016-03-09
Riboflavin has an important role in various cellular metabolic activities through its participation in oxidation-reduction reactions. In this study, as many as 60 lactobacilli were screened for the presence or absence of riboflavin biosynthesis genes and riboflavin production. Of these, only 14 strains were able to grow in a commercial riboflavin-free medium. We observed that the presence of riboflavin biosynthesis genes is strain-specific across different species of lactobacilli. The microbiological assay was found to be appreciably reproducible, sensitive, rapid, and inexpensive and, hence, can be employed for screening the riboflavin-producing strains. The study thus represents a convenient and efficient method for selection of novel riboflavin producers. These riboflavin(+) strains thus identified and characterized could be explored as potent candidates for the development of a wide range of dairy- and cereal-based foods for the delivery of in situ riboflavin to consumers.
Directory of Open Access Journals (Sweden)
Caldeira Roberta Lima
1998-01-01
Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.
Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua
2016-07-15
Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Alignment of global supply networks based on strategic groups of supply chains
Directory of Open Access Journals (Sweden)
Nikos G. Moraitakis
2017-09-01
Full Text Available Background: From a supply chain perspective, often big differences exist between global raw material suppliers’ approaches to supply their respective local markets. The progressing complexity of large centrally managed global supply networks and their often-unknown upstream ramifications increase the likelihood of undetected bottlenecks and inefficiencies. It is therefore necessary to develop an approach to strategically master the upstream complexity of such networks from a holistic supply chain perspective in order to align regional competitive priorities and supply chain structures. The objective of this research is hence to develop an approach for the supply-chain-based alignment of complex global supply networks. Method: We review existing literature from the fields of supply chain and network management, strategic sourcing, and strategic management. Based on the literature review and theoretical and practical considerations we deduce a conceptual approach to consider upstream supply chain structures in supply network alignment initiatives. Results: On the basis of these considerations and current empirical literature we transfer strategic group theory to the supply network management context. The proposed approach introduces strategic groups of supply chains as a segmentation criterion for complex global supply networks which enables the network-wide alignment of competitive priorities. Conclusion: Supply-chain-based segmentation of global supply network structures can effectively reduce the complexity, firms face when aiming to strategically align their supply chains on a holistic level. The results of this research are applicable for certain types of global supply networks and can be used for network alignment and strategy development. The approach can furthermore generate insights useable for negotiation support with suppliers.
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Suria, Ateeq J.; Yalamarthy, Ananth Saran; Heuser, Thomas A.; Bruefach, Alexandra; Chapin, Caitlin A.; So, Hongyun; Senesky, Debbie G.
2017-06-01
In this paper, we describe the use of 50 nm atomic layer deposited (ALD) Al2O3 to suppress the interfacial reaction and inter-diffusion between the gate metal and semiconductor interface, to extend the operation limit up to 600 °C in air. Suppression of diffusion is verified through Auger electron spectroscopy (AES) depth profiling and X-ray diffraction (XRD) and is further supported with electrical characterization. An ALD Al2O3 thin film (10 nm and 50 nm), which functions as a dielectric layer, was inserted between the gate metal (Ni/Au) and heterostructure-based semiconductor material (AlGaN/GaN) to form a metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). This extended the 50 nm ALD Al2O3 MIS-HEMT (50-MIS) current-voltage (Ids-Vds) and gate leakage (Ig,leakage) characteristics up to 600 °C. Both, the 10 nm ALD Al2O3 MIS-HEMT (10-MIS) and HEMT, failed above 350 °C, as evidenced by a sudden increase of approximately 50 times and 5.3 × 106 times in Ig,leakage, respectively. AES on the HEMT revealed the formation of a Ni-Au alloy and Ni present in the active region. Additionally, XRD showed existence of metal gallides in the HEMT. The 50-MIS enables the operation of AlGaN/GaN based electronics in oxidizing high-temperature environments, by suppressing interfacial reaction and inter-diffusion of the gate metal with the semiconductor.
Smeets, N.M.B.; Meda, U.S.; Heuts, J.P.A.; Keurentjes, J.T.F.; Herk, van A.M.; Meuldijk, J.
2007-01-01
For the application of catalytic chain transfer in (mini)emulsion polymerization, catalyst partitioning and deactivation are key parameters that govern the actual catalyst concentration at the locus of polymerization and consequently the final molecular weight distribution. A global model, based on
International Nuclear Information System (INIS)
Garrison, W.M.
1983-11-01
The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included
Identification of formaldehyde-responsive genes by suppression subtractive hybridization
International Nuclear Information System (INIS)
Lee, Min-Ho; Kim, Young-Ae; Na, Tae-Young; Kim, Sung-Hye; Shin, Young Kee; Lee, Byung-Hoon; Shin, Ho-Sang; Lee, Mi-Ock
2008-01-01
Formaldehyde is frequently used in indoor household and occupational environments. Inhalation of formaldehyde invokes an inflammatory response, including a variety of allergic signs and symptoms. Therefore, formaldehyde has been considered as the most prevalent cause of sick building syndrome, which has become a major social problem, especially in developing urban areas. Further formaldehyde is classified as a genotoxicant in the respiratory tract of rats and humans. To better understand the molecular mechanisms involved in formaldehyde intoxication, we sought differentially regulated genes by formaldehyde exposure to Hs 680.Tr human trachea cells, using polymerase chain reaction (PCR)-based suppression subtractive hybridization. We identified 27 different formaldehyde-inducible genes, including those coding for the major histocompatibility complex, class IA, calcyclin, glutathione S-transferase pi, mouse double minute 2 (MDM2), platelet-derived growth factor receptor alpha, and which are known to be associated with cell proliferation and differentiation, immunity and inflammation, and detoxification. Induction of these genes by formaldehyde treatment was confirmed by reverse transcription PCR and western blot analysis. Further, the expression of calcyclin, glutathione S-transferase pi, PDGFRA and MDM2 were significantly induced in the tracheal epithelium of Sprague Dawley rats after formaldehyde inhalation. Our results suggest that the elevated levels of these genes may be associated with the formaldehyde-induced toxicity, and that they deserve evaluation as potential biomarkers for formaldehyde intoxication
International Nuclear Information System (INIS)
Pielichowska, Kinga; Nowak, Michał; Szatkowski, Piotr; Macherzyńska, Beata
2016-01-01
Highlights: • Polyurethane/graphene composites with solid–solid phase transition were obtained. • PEG incorporated as a soft segment acts as PCM with high heat of phase transition. • The influence of chain extender on PU PCMs properties was investigated. • Graphene introduction caused an increase in thermal stability and conductivity. - Abstract: In this paper polyurethane-based phase change materials (PCMs) modified with graphene for thermal energy storage were obtained in situ using a one-step bulk polymerization method. Polyurethanes (PUs) have been synthesized with 1,4-butanediol as a chain extender or without a chain extender. FTIR-ATR, DSC, TGA, SEM, OM and ultrasonic techniques were used for characterization of the obtained composites containing up to 4 wt.% of graphene. FTIR-ATR analysis confirmed PU structure and proved that there was no chemical reaction between polyurethane and graphene. The highest heat of phase transition and crystallinity were found for PU system synthesized without the chain extender and modified with 1.0 wt.% of graphene. Microscopic observation results indicated spherulite structures typical for poly(ethylene glycol) (PEG) which was used to form soft segments, with regions of lamellar crystal bundles radiating from the center of a spherulite. Thermal cycling tests were done by 50 and 100 heating/cooling cyclings in air and nitrogen atmosphere for verification of the thermal reliability and chemical stability – it has been found the heat of phase transition was generally not diminished. Importantly, the thermal conductivity of the PCMs was improved after modification with graphene. Generally, PUPEG without chain extender exhibited higher heat of phase transition, higher thermal stability and better thermal reliability.
Immune-suppressive activity of punicalagin via inhibition of NFAT activation
International Nuclear Information System (INIS)
Lee, Sang-Ik; Kim, Byoung-Soo; Kim, Kyoung-Shin; Lee, Samkeun; Shin, Kwang-Soo; Lim, Jong-Soon
2008-01-01
Since T cell activation is central to the development of autoimmune diseases, we screened a natural product library comprising 1400 samples of medicinal herbal extracts, to identify compounds that suppress T cell activity. Punicalagin (PCG) isolated from the fruit of Punica granatum was identified as a potent immune suppressant, based on its inhibitory action on the activation of the nuclear factor of activated T cells (NFAT). PCG downregulated the mRNA and soluble protein expression of interleukin-2 from anti-CD3/anti-CD28-stimulated murine splenic CD4+ T cells and suppressed mixed leukocytes reaction (MLR) without exhibiting cytotoxicity to the cells. In vivo, the PCG treatment inhibited phorbol 12-myristate 13-acetate (PMA)-induced chronic ear edema in mice and decreased CD3+ T cell infiltration of the inflamed tissue. These results suggest that PCG could be a potential candidate for the therapeutics of various immune pathologies
Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D
2016-12-01
Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H
2017-06-20
We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.
Time-based analysis of the apheresis platelet supply chain in England.
Wilding, R; Cotton, S; Dobbin, J; Chapman, J; Yates, N
2011-10-01
During 2009/2010 loss of platelets within NHS Blood and Transplant (NHSBT) due to time expiry was 9.3%. Hospitals remain reluctant to hold stocks of platelets due to the poor shelf life at issue. The purpose of this study was to identify areas for time compression in the apheresis platelet supply chain to extend the shelf life available for hospitals and reduce wastage in NHSBT. This was done within the context of NHSBT reconfiguring their supply chain and moving towards a consolidated and centralised approach. Time based process mapping was applied to identify value and non-value adding time in two manufacturing models. A large amount of the non-value adding time in the apheresis platelet supply chain is due to transportation and waiting for the next process in the manufacturing process to take place. Time based process mapping provides an effective 'lens' for supply chain professionals to identify opportunities for improvement in the platelet supply chain. © 2011 The Author(s). Vox Sanguinis © 2011 International Society of Blood Transfusion.
Zhu, Shuzhe; Li, Zhan-Wei; Zhao, Hanying
2015-04-14
Patchy particles are a type of colloidal particles with one or more well-defined patches on the surfaces. The patchy particles with multiple compositions and functionalities have found wide applications from the fundamental studies to practical uses. In this research patchy micelles with thiol groups in the patches were prepared based on coassembly of free block copolymer chains and block copolymer brushes on silica particles. Thiol-terminated and cyanoisopropyl-capped polystyrene-block-poly(N-isopropylacrylamide) block copolymers (PS-b-PNIPAM-SH and PS-b-PNIPAM-CIP) were synthesized by reversible addition-fragmentation chain transfer polymerization and chemical modifications. Pyridyl disulfide-functionalized silica particles (SiO2-SS-Py) were prepared by four-step surface chemical reactions. PS-b-PNIPAM brushes on silica particles were prepared by thiol-disulfide exchange reaction between PS-b-PNIPAM-SH and SiO2-SS-Py. Surface micelles on silica particles were prepared by coassembly of PS-b-PNIPAM-CIP and block copolymer brushes. Upon cleavage of the surface micelles from silica particles, patchy micelles with thiol groups in the patches were obtained. Dynamic light scattering, transmission electron microscopy, and zeta-potential measurements demonstrate the preparation of patchy micelles. Gold nanoparticles can be anchored onto the patchy micelles through S-Au bonds, and asymmetric hybrid structures are formed. The thiol groups can be oxidized to disulfides, which results in directional assembly of the patchy micelles. The self-assembly behavior of the patchy micelles was studied experimentally and by computer simulation.
Challenges for bio-based products in sustainable value chains
Cardon, L.; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.
2011-01-01
This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
Olsvik, B; Olsen, I; Tenover, F C
1995-04-01
The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Greenberg, Jonathan; Shapero, Benjamin G; Mischoulon, David; Lazar, Sara W
2017-04-01
An impaired ability to suppress currently irrelevant mental-sets is a key cognitive deficit in depression. Mindfulness-based cognitive therapy (MBCT) was specifically designed to help depressed individuals avoid getting caught in such irrelevant mental-sets. In the current study, a group assigned to MBCT plus treatment-as-usual (n = 22) exhibited significantly lower depression scores and greater improvements in irrelevant mental-set suppression compared to a wait-list plus treatment-as-usual (n = 18) group. Improvements in mental-set-suppression were associated with improvements in depression scores. Results provide the first evidence that MBCT can improve suppression of irrelevant mental-sets and that such improvements are associated with depressive alleviation.
Directory of Open Access Journals (Sweden)
Vanessa Suin
2014-01-01
Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes
Giovannitti, Alexander
2018-04-24
We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.
The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes
Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David; Donahue, Mary J.; Bryant, Daniel; Barth, Katrina J.; Makdah, Beatrice E.; Savva, Achilleas; Moia, Davide; Zetek, Matyá š; Barnes, Piers R.F.; Reid, Obadiah G.; Inal, Sahika; Rumbles, Garry; Malliaras, George G.; Nelson, Jenny; Rivnay, Jonathan; McCulloch, Iain
2018-01-01
We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
GPK heading machines with noise suppression means. [USSR
Energy Technology Data Exchange (ETDEWEB)
Geshlin, L.A.; Anenberg, G.I.
1981-11-01
Chain conveyor is the main noise pollution source of the GPK heading machine. When the conveyor forms a straight line its noise level ranges from 100 to 106 dB and when bent at a 30 degree angle the noise level is from 102 to 107 dB. The mean noise level in the two positions is 103 and 105 dB respectively. The Donetsk Research Scientific Institute for Occupational Hygiene has developed a system for noise suppression using rubber elements which are particularly efficient when the conveyor is bent. Rubber elements also reduce mechanical vibrations of the chain. Design of the modernized conveyors is shown in three schemes. Operational tests show that use of rubber suppresses noise by 5 to 10 dB, and on the average by 8 dB. Noise level measured at the operator's working place amounts to 89 dB. The noise pollution control measures developed by the Institute are economical and do not exceed 1% of the conveyor price.
Zr alkoxide chain effect on the sol-gel synthesis of lithium metazirconate
International Nuclear Information System (INIS)
Pfeiffer, Heriberto; Bosch, Pedro; Bulbulian, Silvia
2003-01-01
Lithium metazirconate (Li 2 ZrO 3 ) was synthesized by the sol-gel method, using four different Zr alkoxides: zirconium ethoxide, zirconium iso-propoxide, zirconium propoxide and zirconium butoxide. The syntheses were made under two different catalytic regimes, acid and basic. The resulting powders were mixtures of Li 2 ZrO 3 and ZrO 2 . The best yield of Li 2 ZrO 3 (100%) was obtained when the sol-gel reaction was developed with lithium methoxide and zirconium ethoxide under acid catalysis regime. This study establishes that, for base-catalyzed reactions the ZrO 2 formation decreases when the alkyl-chain increases in the alkoxides. By contrast, for acid-catalyzed reactions the ZrO 2 formation increases as the alkyl-chain increases. Finally, when Zr propoxide and Zr iso-propoxide were used, the Li 2 ZrO 3 amounts were different due to steric effects
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Matsumoto, Suzuka; Kanazawa, Arihiro; Kanaoka, Shokyoku; Aoshima, Sadahito
2017-06-14
A unique tandem reaction of sequence-controlled cationic copolymerization and site-specific hetero-Diels-Alder (DA) reaction is demonstrated. In the controlled cationic copolymerization of furfural and 2-acetoxyethyl vinyl ether (AcOVE), only the furan ring adjacent to the propagating carbocation underwent the hetero-DA reaction with the aldehyde moiety of another furfural molecule. A further and equally important feature of the copolymerization is that the obtained copolymers had unprecedented 2:(1 + 1)-type alternating structures of repeating sequences of two VE and one furfural units in the main chain and one furfural unit in the side chain. The specific DA reaction is attributed to the delocalization of the positive charge to the side furan ring.
A Formal Model of Trust Chain based on Multi-level Security Policy
Kong Xiangying
2013-01-01
Trust chain is the core technology of trusted computing. A formal model of trust chain based on finite state automata theory is proposed. We use communicating sequential processes to describe the system state transition in trust chain and by combining with multi-level security strategy give the definition of trust system and trust decision theorem of trust chain transfer which is proved meantime. Finally, a prototype system is given to show the efficiency of the model.
Sustainable supply chains : a research-based textbook on operations and strategy
Bouchery, Y.; Corbett, C.J.; Fransoo, J.C.; Tan, T.
2017-01-01
This book is primarily intended to serve as a research-based textbook on sustainable supply chains for graduate programs in Business, Management, Industrial Engineering, and Industrial Ecology, but it should also be of interest for researchers in the broader sustainable supply chain space, whether
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
Energy Technology Data Exchange (ETDEWEB)
Marteau, C; Gaillard-Cusin, F; James, H [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures
1978-05-01
Investigation of heterogeneous initiation process of gas phase linear chain reactions is carried out through the study of H/sub 2/-D/sub 2/ exchange reaction. Experimental data under study concern mainly the stationary rate of HD formation and the prestationary proceeding. Steady-state method accounts for the first one of these data; it allows to clearly compare the wall process part to the part played by the homogeneous chain reaction towards HD formation. Activation energy of exchange elementary step between chemisorbed hydrogen (on silica) and gaseous deuterium has been evaluated: Esub(e1)=52+-1 Kcal/mole.
Grazer-induced chain lenght plasticity reduces grazing risk in a marine diatom
DEFF Research Database (Denmark)
Bergkvist, Johanna; Thor, Peter; Jakobsen, Hans Henrik
2012-01-01
. marinoi was exposed to chemical cues from caged A. tonsa without physical contact with the responding cells. The reductions in chain length significantly reduced copepod grazing; grazing rates on chains (four cells or more) were several times higher compared to that of single cells. This suggests...... that chain length plasticity is a means for S. marinoi to reduce copepod grazing. In contrast, chain length was not suppressed in cultures exposed to the microzooplankton grazer Gyrodinium dominans. Size-selective predation may have played a key role in the evolution of chain formation and chain length...... plasticity in diatoms...
Wali, Mohebullah; Nakamura, Yukinori; Wakui, Shinji
In this study, a positioning stage is considered, which is actuated by four pneumatic cylinders and vertically supported by four coil-type spring isolators. Previously, we realized the base plate jerk feedback (BPJFB) to be analogues to a Master-Slave system which can synchronize the motion of the stage as a Slave to the motion of the base plate as a Master. However, in the case of real positioning, the stage had slightly self oscillation with higher frequency due to the higher gains set to the outer feedback loop controller besides its oscillation due to the natural vibration of the base plate. The self oscillation of stage was misunderstood to be the natural vibration of base plate due to the reaction force. However, according to the experimental results, the BPJFB scheme was able to control both of the mentioned vibrations. Suppression of the self vibration of stage is an interesting phenomenon, which should be experimentally investigated. Therefore, the current study focuses on the suppression of the self vibration of stage by using the BPJFB scheme. The experimental results show that besides operating as a Master-Slave synchronizing system, the PBJFB scheme is able to increase the damping ratio and stiffness of stage against its self vibration. This newly recognized phenomenon contributes to further increase the proportional gain of the outer feedback loop controller. As a result, the positioning speed and stability can be improved.
Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?
Directory of Open Access Journals (Sweden)
Yoo Jin Lee
2016-11-01
Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.
Institute of Scientific and Technical Information of China (English)
YAO Zhiyuan(姚志远); ZHENG Heyi(郑和义); CAO Jingjiang(曹经江)
2002-01-01
Objective: To study the prevalence of Trichomonas vaginalis(TV) infection in Chinese male patients with nongonococcalurethritis (NGU), to evaluate the sensitivity and specificity ofurine-based and urethral swab polymerase chain reaction(PCR) detection, to set up a method for non-invasive detectionof male TV infection. Method: One hundred and five male NGU patients wereselected from a Beijing STD clinic. Two urethral swabs wereobtained from each patient, one for the InPouch TV culturesystem and the other for PCR. In addition, one first void urinespecimen was collected for PCR detection. Culture wasconsidered the "gold standard". The sensitivity, specificity,positive predictive value (PPV) and negative predictive value(NPV) of the two PCR detections were compared to cultureresults. Results: The prevalence of urine-based PCR and urethralswab PCR detection was 3.81% (4/105) and 4.76% (5/105)respectively. Compared to culture, the sensitivity, specificity,PPV and NPV were 80%, 100%, 100% and 99% for urine-based PCR and 80%, 99%, 80% and 99% for urethral swabPCR.Conclusion: TV is one of the etiological agents in male NGU,with a 4.76% prevalence of infection in our study. The urine-based PCR detection has higher sensitivity and specificity andprovides a noninvasive method more feasible in practice.
Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R
2001-01-01
A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.
Waste Biomass Based Energy Supply Chain Network Design
Directory of Open Access Journals (Sweden)
Hatice Güneş Yıldız
2018-06-01
Full Text Available Reducing dependence on fossil fuels, alleviating environmental impacts and ensuring sustainable economic growth are among the most promising aspects of utilizing renewable energy resources. Biomass is a major renewable energy resource that has the potential for creating sustainable energy systems that are critical in terms of social welfare. Utilization of biomass for bioenergy production is an efficient alternative for meeting rising energy demands, reducing greenhouse gas emissions and thus alleviating climate change. A supply chain for such an energy source is crucial for assisting deliverance of a competitive end product to end-user markets. Considering the existing constraints, a mixed integer linear programming (MILP model for waste biomass based supply chain was proposed in this study for economic performance optimization. Performance of the proposed modelling approach was demonstrated with a real life application study realized in İstanbul. Moreover, sensitivity analyses were conducted which would serve as a foresight for efficient management of the supply chain as a whole
Energy Technology Data Exchange (ETDEWEB)
Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)
1960-07-15
This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Ionothermal synthesis and crystal structures of metal phosphate chains
Wragg, D.; Le Ouay, B.; Beale, A.M.; O'Brien, M.G.; Slawin, A.M.Z.; Warren, J.E.; Prior, T.J.; Morris, R.E.
2013-01-01
We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains
Efficient Synthesis of Single-Chain Polymer Nanoparticles via Amide Formation
Directory of Open Access Journals (Sweden)
Ana Sanchez-Sanchez
2015-01-01
Full Text Available Single-chain technology (SCT allows the transformation of individual polymer chains to folded/collapsed unimolecular soft nanoparticles. In this work we contribute to the enlargement of the SCT toolbox by demonstrating the efficient synthesis of single-chain polymer nanoparticles (SCNPs via intrachain amide formation. In particular, we exploit cross-linking between active methylene groups and isocyanate moieties as powerful “click” chemistry driving force for SCNP construction. By employing poly(methyl methacrylate- (PMMA- based copolymers bearing β-ketoester units distributed randomly along the copolymer chains and bifunctional isocyanate cross-linkers, SCNPs were successfully synthesized at r.t. under appropriate reaction conditions. Characterization of the resulting SCNPs was carried out by means of a combination of techniques including size exclusion chromatography (SEC, infrared (IR spectroscopy, proton nuclear magnetic resonance (1H NMR spectroscopy, dynamic light scattering (DLS, and elemental analysis (EA.
2013-05-01
... Request: Web-Based Supply Chain Management Commodity Offer Forms AGENCY: Farm Service Agency and Commodity..., and yearly bases. Special invitations, however, are issued throughout the month. Web-Based Supply Chain Management (WBSCM) allows respondents to submit information electronically. DATES: Comments on...
Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves
2008-05-15
Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N
2015-02-03
The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.
The governance of cloud based Supply Chain Collaborations
Chandra, Dissa Riandaso; van Hillegersberg, Jos
2015-01-01
Despite of the promising benefits of cloud computing in enabling efficient, sustainable and agile Supply Chain Collaborations (SCCs), this service does not eliminate governance challenges in SCCs. Cloud based SCCs may flounder without a proper understanding of how to govern inter-organizational
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
Suppression of soft nuclear bremsstrahlung in proton-nucleus collisions
International Nuclear Information System (INIS)
Goethem, M.J. van; Bacelar, J.C.S.; Hoefman, M.; Huisman, H.; Kalantar-Nayestanaki, N.; Loehner, H.; Messchendorp, J.G.; Ostendorf, R.W.; Schadmand, S.; Siemssen, R.H.; Turrisi, R.; Volkerts, M.; Wilschut, H.W.; Aphecetche, L.; Delagrange, H.; D'Enterria, D.; Martinez, G.; Schutz, Y.; Diaz, J.; Holzmann, R.
2002-01-01
Photon energy spectra up to the kinematic limit have been measured in 190 MeV proton reactions with light and heavy nuclei to investigate the influence of the multiple-scattering process on the photon production. Relative to the predictions of models based on a quasifree production mechanism, a strong suppression of bremsstrahlung is observed in the low-energy region of the photon spectrum. We attribute this effect to the interference of photon amplitudes due to multiple scattering of nucleons in the nuclear medium
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa
2017-11-01
The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.
Isocyanide based multi component reactions in combinatorial chemistry.
Dömling, A.
1998-01-01
Although usually regarded as a recent development, the combinatorial approach to the synthesis of libraries of new drug candidates was first described as early as 1961 using the isocyanide-based one-pot multicomponent Ugi reaction. Isocyanide-based multi component reactions (MCR's) markedly differ
Fine-tuning of mast cell activation by FceRIbeta chain
Directory of Open Access Journals (Sweden)
Chisei eRa
2012-05-01
Full Text Available Mast cells play the key role in allergic reaction and disorders, being activated by the high affinity receptor for IgE, FceRI. There are two types of FceRI expressed on the cell surface of human mast cells, abg2 type and ag2 type (without b chain, while in mouse mast cells only the tetrameric abg2 type is expressed. In the lesion of allergic inflammation such as atopic conjunctivitis and atopic dermatitis, mast cells increase in number and exclusively express the abg2 type FceRI, in contrast in healthy conjunctiva and skin most mast cells express the ag2 type. The human and mouse FceRI genes contain seven exons and in the human gene we found a repressor element locates in the forth intron. Through the repressor element HDACs are recruited to the FceRIb gene by MZF-1/FHL3/NFY complex and repress b transcription by deacetylation of histones in the presence of GM-CSF. It has been long recognized that the function of the b chain ITAM is a signal amplifier, but we have recently revealed bidirectional (positive and negative functions of the b chain ITAM in the regulation of the mast cell activation and effector functions. Namely, the b chain enhances the mast cell activation signal triggered with low intensity stimulation such as lower dose antigen than threshold while it suppresses the signal of high intensity stimulation. Employing mouse model of CHS induced by oxazolone, we have revealed that IgE-mediated mast cell activation is required for CHS and that the b chain is crucially involved in this model. On the other hand diverse immune receptors including TLRs, SCF receptor and GPCRs are known to mediate signals which modulate FceRI・adenosine receptors, one of GPCRs, trigger synergistic degranulation response in mast cells even when the FceRI stimulation is of ‘lower intensity’ than the threshold. We have recently elucidated, in this synergistic degranulation response, b chain ITAM plays positive role, possibly reflecting in vivo allergic
Energy Technology Data Exchange (ETDEWEB)
Zhang, N.
1999-02-12
Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
Li, C.; Zhou, X.; Tang, D.; Zhu, Z.
2018-04-01
Resolution and sidelobe are mutual restrict for SAR image. Usually sidelobe suppression is based on resolution reduction. This paper provide a method for resolution enchancement using sidelobe opposition speciality of hanning window and SAR image. The method can keep high resolution on the condition of sidelobe suppression. Compare to traditional method, this method can enchance 50 % resolution when sidelobe is -30dB.
NFC-Based Traceability in the Food Chain
Directory of Open Access Journals (Sweden)
Danny Pigini
2017-10-01
Full Text Available In recent years, many events related to food and public health, such as bovine spongiform encephalopathy (BSE, commonly known as mad cow disease, dioxin, bird flu and swine flu, brought the issue of food security to the center of international attention. Many countries established strict rules to ensure the food traceability “from farm to fork” to meet the demand of consumer safety and to ensure public health. Consequently, the concepts of controlled supply chain, brand of quality and traceability of food products have had a strong evolution. Companies in the food production sector must evolve and change their organizational and management chain to satisfy increasingly stringent government rules and to respond to the requirements of the market. From this point of view, NFC (Near Field Communication has all the requirements to become the main technology for traceability in the various food sectors. This paper proposes a solution to gather information throughout the entire food supply chain and bring it directly to the consumer. The architecture consists of a complex identification system based on NFC tags, which cumulates data during all phases of the production process. The aim of this work is to keep track of the information generated during food processing, not only for traceability purposes, but also for enhancing and optimizing production. The data generated by the traceability system are collected in a cloud database through apps on Android smartphones. The information is accessible by the consumers through a public Android application. The pork supply chain has been used as an application example of the proposed methodology.
Regulation of cutaneous allergic reaction by odorant inhalation.
Hosoi, J; Tsuchiya, T
2000-03-01
Olfactory stimuli modulate emotional conditions and the whole body immune system. Effects of odorant inhalation on cutaneous immune reaction were examined. Contact hypersensitivity to 2,4, 6-trinitrochlorobenzene was elicited in C57BL/6 mice. The reaction was suppressed at both the induction and elicitation phases by exposure to an odorant, citralva. Topical application of citralva or lyral/lilial did not affect the reaction. The suppressive effect of citralva was more potent than that of another odorant, lyral/lilial. Citralva decreased the number of epidermal Langerhans cells, whereas lyral/lilial had a weak effect. Citralva but not lyral/lilial induced plasma corticosterone. Glucocorticoid receptor antagonist abrogated the suppressive effect of citralva on contact hypersensitivity. Serum interleukin-12 was downregulated by exposure to citralva or lyral/lilial. These data demonstrate that olfactory stimuli regulate the cutaneous immune system.
International Nuclear Information System (INIS)
Ogawa, Shingo; Asahara, Ryohei; Minoura, Yuya; Hosoi, Takuji; Shimura, Takayoshi; Watanabe, Heiji; Sako, Hideki; Kawasaki, Naohiko; Yamada, Ichiko; Miyamoto, Takashi
2015-01-01
The thermal diffusion of germanium and oxygen atoms in HfO 2 /GeO 2 /Ge gate stacks was comprehensively evaluated by x-ray photoelectron spectroscopy and secondary ion mass spectrometry combined with an isotopic labeling technique. It was found that 18 O-tracers composing the GeO 2 underlayers diffuse within the HfO 2 overlayers based on Fick's law with the low activation energy of about 0.5 eV. Although out-diffusion of the germanium atoms through HfO 2 also proceeded at the low temperatures of around 200 °C, the diffusing germanium atoms preferentially segregated on the HfO 2 surfaces, and the reaction was further enhanced at high temperatures with the assistance of GeO desorption. A technique to insert atomically thin AlO x interlayers between the HfO 2 and GeO 2 layers was proven to effectively suppress both of these independent germanium and oxygen intermixing reactions in the gate stacks
A uranium-based UO_2"+-Mn"2"+ single-chain magnet assembled trough cation-cation interactions
International Nuclear Information System (INIS)
Mougel, Victor; Chatelain, Lucile; Hermle, Johannes; Pecaut, Jacques; Mazzanti, Marinella; Caciuffo, Roberto; Colineau, Eric; Tuna, Floriana; Magnani, Nicola; Geyer, Arnaud de
2014-01-01
Single-chain magnets (SCMs) are materials composed of magnetically isolated one-dimensional (1D) units exhibiting slow relaxation of magnetization. The occurrence of SCM behavior requires the fulfillment of stringent conditions for exchange and anisotropy interactions. Herein, we report the synthesis, the structure, and the magnetic characterization of the first actinide-containing SCM. The 5f-3d heterometallic 1D chains [{[UO_2(salen)(py)][M(py)_4](NO_3)}]_n, (M=Cd (1) and M=Mn (2); py=pyridine) are assembled trough cation-cation interaction from the reaction of the uranyl(V) complex [UO_2(salen)py][Cp"*_2Co] (Cp"*=pentamethylcyclopentadienyl) with Cd(NO_3)_2 or Mn(NO_3)_2 in pyridine. The infinite UMn chain displays a high relaxation barrier of 134±0.8 K (93±0.5 cm"-"1), probably as a result of strong intra-chain magnetic interactions combined with the high Ising anisotropy of the uranyl(V) dioxo group. It also exhibits an open magnetic hysteresis loop at T<6 K, with an impressive coercive field of 3.4 T at 2 K.
Research on the Optimization of Agricultural Supply Chain Based on Internet of Things
Zhang , Guangsheng
2013-01-01
International audience; Technology of IOT which used in agricultural supply chain can help to improve operational efficiency and reduce supply chain costs. This paper analyzes the basic structure of agricultural supply chain, current status of the research, and summarizes major obstacles of the development process. The paper also describes application of IOT principle, as well as agricultural supply chain optimization approach based on internet of things, including agricultural production, pr...
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
Accumulation of long-chain bases in yeast promotes their conversion to a long-chain base vinyl ether
Martínez-Montañés, Fernando; Lone, Museer A.; Hsu, Fong-Fu; Schneiter3, Roger
2017-01-01
Long-chain bases (LCBs) are the precursors to ceramide and sphingolipids in eukaryotic cells. They are formed by the action of serine palmitoyl-CoA transferase (SPT), a complex of integral membrane proteins located in the endoplasmic reticulum. SPT activity is negatively regulated by Orm proteins to prevent the toxic overaccumulation of LCBs. Here we show that overaccumulation of LCBs in yeast results in their conversion to a hitherto undescribed LCB derivative, an LCB vinyl ether. The ...
Trust-Based Information Risk Management in a Supply Chain Network
Yanjun Zuo; Wen-Chen Hu
2009-01-01
Information risk management is crucial for an organization operating in an increasingly integrated and intensively communicated environment to mitigate risks and ensure core business functions. Given the open and dynamic nature of a supply chain network, information risk management is challenging and various factors must be considered. This article introduces a trust-based approach to facilitate supply chain participants to perform effective risk management. The major components of the propos...
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Cluster chain based energy efficient routing protocol for moblie WSN
Directory of Open Access Journals (Sweden)
WU Ziyu
2016-04-01
Full Text Available With the ubiquitous smart devices acting as mobile sensor nodes in the wireless sensor networks(WSNs to sense and transmit physical information,routing protocols should be designed to accommodate the mobility issues,in addition to conventional considerations on energy efficiency.However,due to frequent topology change,traditional routing schemes cannot perform well.Moreover,existence of mobile nodes poses new challenges on energy dissipation and packet loss.In this paper,a novel routing scheme called cluster chain based routing protocol(CCBRP is proposed,which employs a combination of cluster and chain structure to accomplish data collection and transmission and thereafter selects qualified cluster heads as chain leaders to transmit data to the sink.Furthermore,node mobility is handled based on periodical membership update of mobile nodes.Simulation results demonstrate that CCBRP has a good performance in terms of network lifetime and packet delivery,also strikes a better balance between successful packet reception and energy consumption.
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Directory of Open Access Journals (Sweden)
W. Ali
2017-06-01
Full Text Available The aim of this study was to evaluate the economic impact of the disease by using milk production records and to determine the serotypes circulating in the region during 2015. Sampling was done from different outbreaks initially on the basis of clinical signs and later reverse transcriptase-polymerase chain reaction (RT-PCR was employed for the conformation of FMDV genome. Out of total 88 samples, 73 were found positive which were then serotyped into type O (n=44, Asia1 (n=18 and A (n=06. The economic impact was analyzed by recording milk loss at four affected farms. Their average milk yield was observed 9.2 liters before the onset of disease that decreased dramatically after the disease. Milk loss of 225 and 195 liters was recorded for buffalo and cattle respectively, during 70 days of the study period.
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying
2017-12-15
In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.
Fusion enhancement/suppression and irreversibility in reactions induced by weakly bound nuclei
International Nuclear Information System (INIS)
Gomes, P.R.S.; Lubian, J.; Canto, L.F.; Chamon, L.C.; Crema, E.; Hussein, M.S.
2011-01-01
We show that halo effects enhance fusion cross sections of weakly bound systems, comparing with the situation when there is no-halo. We introduce dimensionless fusion functions and energy variable quantity to investigate systematical trends in the fusion cross sections of weakly bound nuclei at near-barrier energies. We observe very clearly complete fusion suppression at energies above the barrier due to dynamic effects of the breakup on fusion. We explain this suppression in terms of the repulsive polarization potential produced by the breakup. (author)
Self-testing protocols based on the chained Bell inequalities
International Nuclear Information System (INIS)
Šupić, I; Augusiak, R; Salavrakos, A; Acín, A
2016-01-01
Self-testing is a device-independent technique based on non-local correlations whose aim is to certify the effective uniqueness of the quantum state and measurements needed to produce these correlations. It is known that the maximal violation of some Bell inequalities suffices for this purpose. However, most of the existing self-testing protocols for two devices exploit the well-known Clauser–Horne–Shimony–Holt Bell inequality or modifications of it, and always with two measurements per party. Here, we generalize the previous results by demonstrating that one can construct self-testing protocols based on the chained Bell inequalities, defined for two devices implementing an arbitrary number of two-output measurements. On the one hand, this proves that the quantum state and measurements leading to the maximal violation of the chained Bell inequality are unique. On the other hand, in the limit of a large number of measurements, our approach allows one to self-test the entire plane of measurements spanned by the Pauli matrices X and Z. Our results also imply that the chained Bell inequalities can be used to certify two bits of perfect randomness. (paper)
Mechanism of chain formation in nanofluid based MR fluids
International Nuclear Information System (INIS)
Patel, Rajesh
2011-01-01
Mechanism of structure formation in bidispersed colloids is important for its physical and optical properties. It is microscopically observed that the mechanism of chain formation in magnetic nanofluid based magnetorheological (MR) fluid is quite different from that in the conventional MR fluid. Under the application of magnetic field the magnetic nanoparticles are filled inside the structural microcavities formed due to the association of large magnetic particles, and some of the magnetic nanoparticles are attached at the end of the chains formed by the large particles. The dipolar energy of the large particles in a magnetic nanofluid matrix becomes effective magnetic permeability (μ eff ) times smaller than that of the neutral medium. Inclusion of magnetic nanoparticles (∼10 nm) with large magnetic particles (∼3-5 μm) restricts the aggregation of large particles, which causes the field induced phase separation in MR fluids. Hence, nanofluid based MR fluids are more stable than conventional MR fluids, which subsequently increase their application potentiality. - Research highlights: → In bidispersed magnetic colloids nanoparticles are attached at the end of the chains formed by the large particles. → Inclusion of magnetic nanoparticles (∼10 nm) with large magnetic particles (∼3-5 m) restricts the aggregation of large particles. → Nanofluid based MR fluids are more stable than conventional MR fluids.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng
The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Xu Q
2015-06-01
Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.