KONSTRUKSI MUTAN PROTEIN FOSFATASE ptc2D Saccharomyces cerevisiae DENGAN METODE PENGGANTIAN GEN TARGET DENGAN POLYMERASE CHAIN REACTION (PCR

Directory of Open Access Journals (Sweden)

Hermansyah

2011-05-01

Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

Polymerase chain reaction to search for Herpes viruses in uveitic ...

African Journals Online (AJOL)

Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

Science.gov (United States)

Nasarabadi, Shanavaz [Livermore, CA

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

DEFF Research Database (Denmark)

Pattison, D I; Davies, Michael Jonathan

2001-01-01

, absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

Nuclear fission, chain reaction and criticality

International Nuclear Information System (INIS)

Reuss, Paul

2016-01-01

Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

The role of chain carriers in fusion reaction kinetics

International Nuclear Information System (INIS)

Harms, A.A.; Krenciglowa, E.M.

1980-01-01

The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)

Reverse transcriptase-quantitative polymerase chain reaction (RT ...

African Journals Online (AJOL)

zino

2014-02-05

Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

Polymerase chain reaction versus enzyme-linked immunosorbent ...

African Journals Online (AJOL)

Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.

The application of polymerase chain reaction-denaturing gradient ...

African Journals Online (AJOL)

Jane

2011-05-23

May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

Chain reaction

International Nuclear Information System (INIS)

Balogh, Brian.

1991-01-01

Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids.

Science.gov (United States)

Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M; Qiao, Shanlei; Spencer, Melanie D; Zeisel, Steven H; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

2013-08-01

Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23-25 °C), or 7 days when stored at -20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research.

Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

Science.gov (United States)

Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

2017-07-17

Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

Science.gov (United States)

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

Directory of Open Access Journals (Sweden)

Tuti Susanti Legiastuti

2013-04-01

Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

Energy Technology Data Exchange (ETDEWEB)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

Science.gov (United States)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

2012-03-30

Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Comparison of polymerase chain reaction (PCR) and loop-mediated ...

African Journals Online (AJOL)

Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

Science.gov (United States)

Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

2016-04-01

An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

Determining Annealing Temperatures for Polymerase Chain Reaction

Science.gov (United States)

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.

Science.gov (United States)

Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro

2018-01-01

Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.

Bordetella pertussis diagnosed by polymerase chain reaction

DEFF Research Database (Denmark)

Birkebaek, N H; Heron, I; Skjødt, K

1994-01-01

The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

Competing irreversible cooperative reactions on polymer chains

International Nuclear Information System (INIS)

Evans, J.W.; Hoffman, D.K.; Burgess, D.R.

1984-01-01

We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated

The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

LENUS (Irish Health Repository)

O'Connor, T M

2012-02-03

BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.

Science.gov (United States)

Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen

2015-05-15

Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.

Dependence of ICF reaction dynamics on target structure

International Nuclear Information System (INIS)

Kumar, Kamal; Dutt, Sunil; GulI, Muntazir; Ahmad, Tauseef; Rizvi, I.A.; Ali, Sabir; Agarwal, Avinash; Kumar, R.; Chaubey, A.K.

2016-01-01

The projectile structure is also found responsible for the ICF reaction processes. It is found that projectile having bigger alpha cluster is more unstable towards break up. In this context, a comparative study of 12 C and 16 O ion-beams induced reactions with different targets has been done. The deduced ICF contributions for different systems have been plotted against the target charge of different targets. It is observed that target properties may also be responsible for the interplay between CF and ICF reaction dynamics

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

Science.gov (United States)

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

Science.gov (United States)

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

A Double Polymerase Chain Reaction Method for Detecting African ...

African Journals Online (AJOL)

Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

Science.gov (United States)

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

Science.gov (United States)

Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

2017-11-01

In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

International Nuclear Information System (INIS)

Schowalter, D.B.; Sommer, S.S.

1989-01-01

By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

The Ripple Effect: Citation Chain Reactions of a Nobel Prize

DEFF Research Database (Denmark)

Faber Frandsen, Tove; Nicolaisen, Jeppe

2013-01-01

This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

Evidence of simian retrovirus type D by polymerase chain reaction.

Science.gov (United States)

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

Science.gov (United States)

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

Science.gov (United States)

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Polymerase chain reaction for the detection of Mycobacterium leprae

NARCIS (Netherlands)

Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

1989-01-01

A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

Transformational leadership: a cascading chain reaction.

Science.gov (United States)

Murphy, Lorraine

2005-03-01

Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

International Nuclear Information System (INIS)

East, L.V.

1994-05-01

A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

Science.gov (United States)

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Use of competitive polymerase chain reaction to determine HIV-1 levels in response to antiviral treatments

NARCIS (Netherlands)

Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.

1993-01-01

OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

Science.gov (United States)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

Science.gov (United States)

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Use of polymerase chain reaction for detection of Chlamydia trachomatis

DEFF Research Database (Denmark)

Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

1990-01-01

A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

KAUST Repository

Zhang, Hefeng

2015-05-01

We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

2016-05-06

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

Role of Polymerase Chain Reaction (PCR) in the detection of ...

African Journals Online (AJOL)

Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

Science.gov (United States)

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

A primer on on-demand polymerase chain reaction technology.

Science.gov (United States)

Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

2015-10-01

Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

KAUST Repository

Zhang, Hefeng; Qu, Chengke; He, Junpo

2015-01-01

We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b

Polymerase Chain Reaction (PCR) provides a superior tool for the ...

African Journals Online (AJOL)

Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

Science.gov (United States)

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

International Nuclear Information System (INIS)

Leone, S.R.

1988-03-01

Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

Evaluation of a new HTLV-I/II polymerase chain reaction

NARCIS (Netherlands)

Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.

1997-01-01

AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

NARCIS (Netherlands)

Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.

1996-01-01

A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific

Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials

Science.gov (United States)

Chapman, Peter Henry

Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are

Nuclear targets, recoil ion catchers and reaction chambers

NARCIS (Netherlands)

Dionisio, JS; Vieu, C; Schuck, C; Collatz, R; Meunier, R; Ledu, D; Folger, H; Lafoux, A; Lagrange, JM; Pautrat, M; Waast, B; Phillips, WR; Blunt, D; Durell, JL; Varley, BJ; Dagnall, PG; Dorning, SJ; JONES, MA; Smith, AG; Bacelar, JCS; Rzaca-Urban, T; Amzal, N; Meliani, Z; Vanhorenbeeck, J; Passoja, A; Urban, W

1998-01-01

The main features of nuclear targets, recoil ion catchers and reaction chambers used in nuclear spectroscopic investigations involving in-beam multi-e-gamma spectrometers are discussed. The relative importance of the F-ray background due to the accelerated ion-target and the recoil-ion-target

An electrochemical impedance biosensor for Hg2+ detection based on DNA hydrogel by coupling with DNAzyme-assisted target recycling and hybridization chain reaction.

Science.gov (United States)

Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying

2017-12-15

In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.

Anticancer Drugs Targeting the Mitochondrial Electron Transport Chain

Czech Academy of Sciences Publication Activity Database

Rohlena, Jakub; Dong, L.-F.; Ralph, S.J.; Neužil, Jiří

2011-01-01

Roč. 15, č. 12 (2011), s. 2951-2974 ISSN 1523-0864 R&D Projects: GA AV ČR(CZ) KAN200520703 Institutional research plan: CEZ:AV0Z50520701 Keywords : Targets for anticancer drugs * mitochondrial electron transport chain * mitocans Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.456, year: 2011

Analytic study of the chain dark decomposition reaction of iodides - atomic iodine donors - in the active medium of a pulsed chemical oxygen-iodine laser: 1. Criteria for the development of the branching chain dark decomposition reaction of iodides

International Nuclear Information System (INIS)

Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N

2009-01-01

The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)

Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

NARCIS (Netherlands)

Felice, A. E.; Alshinawi, C.

1996-01-01

The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

International Nuclear Information System (INIS)

Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.

1989-07-01

Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

International Nuclear Information System (INIS)

Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.

1990-01-01

Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

2008-12-01

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

Targets for high-resolution studies with heavy-ion reactions

International Nuclear Information System (INIS)

Erskine, J.R.

1975-01-01

Target problems in heavy ion reaction studies are discussed, including non-uniformity in thickness effects and the inability to fully compensate for reaction-site effects, both problems becoming more serious the heavier the ion. For the non-uniformity effects, the flatness of the target is very critical. Other problems not yet solved are beam-spot heating and the buildup of carbon

Real-time TaqMan polymerase chain reaction to quantify the effects ...

African Journals Online (AJOL)

TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

Trends and advances in food analysis by real-time polymerase chain reaction.

Science.gov (United States)

Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

2016-05-01

Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1991-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1993-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

The effect of composition of mixture on rate of radiation initiation of chain reactions

International Nuclear Information System (INIS)

Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.

1977-01-01

The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered

Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

DEFF Research Database (Denmark)

Kalia, A.; Jalava, T.; Nieminen, P.

1992-01-01

Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

Case Report:False-negative HIV-1 polymerase chain reaction in a ...

African Journals Online (AJOL)

Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

NARCIS (Netherlands)

de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

1993-01-01

The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

NARCIS (Netherlands)

Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

2003-01-01

Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

Development of odd-Z-projectile reactions for transactinide element synthesis

International Nuclear Information System (INIS)

Folden III, Charles Marvin

2004-01-01

The development of new odd-Z-projectile reactions leading to the production of transactinide elements is described. The cross section of the even-Z-projectile 208Pb(64Ni, n)271Ds reaction was measured at two new energies using the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron. In total, seven decay chains attributable to 271Ds were observed. These data, combined with previous results, establish an excitation function for the production of 271Ds. The maximum cross section was 20 +15 -11 pb at a center-of-target energy of 311.5 MeV in the laboratory frame.The data from the 271Ds experiments were used to estimate the optimum beam energy for the new odd-Z-projectile 208Pb(65Cu, n)272-111 reaction using the Fusion by Diffusion theory proposed by Swiatecki, Siwek-Wilczynska, and Wilczynski. A cross section for this reaction was measured for the first time, at a center-of-target energy of 321.1 MeV in the laboratory frame. The excitation energy f or compound nuclei formed at the target center was 13.2 MeV. One decay chain was observed, resulting in a measured cross section of 1.7 +3.9 -1.4 pb. This decay chain is in good agreement with previously published data on the decay of 272-111.The new odd-Z-projectile 208Pb(55Mn, n)262Bh reaction was studied at three different projectile energies, and 33 decay chains of 262Bh were observed. The existence of a previously reported alpha-decaying isomeric state in this nuclide was confirmed. Production of the ground state was preferred at all three beam energies. The maximum cross section was 540 +180 -150 pb at a projectile center-of-target energy of 264.0 MeV. This cross section is much larger than that previously reported for the even-Z-projectile 209Bi(54Cr, n)262Bh reaction, which may be because the 54Cr projectile energies in the latter reaction were too high for optimum production of the 1n product. At the highest projectile energy of 268.0 MeV in the target center, two decay

The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

NARCIS (Netherlands)

de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

2002-01-01

Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

Science.gov (United States)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

DEFF Research Database (Denmark)

Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

2007-01-01

OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.

Science.gov (United States)

Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F

2015-01-01

Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.

Pathogen detection by the polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

1994-05-01

In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

International Nuclear Information System (INIS)

Anghaie, S.; Froelich, P.; Monkhorst, H.J.

1990-01-01

In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur

DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

Directory of Open Access Journals (Sweden)

Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

2011-11-01

Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

A cascade autocatalytic strand displacement amplification and hybridization chain reaction event for label-free and ultrasensitive electrochemical nucleic acid biosensing.

Science.gov (United States)

Chen, Zhiqiang; Liu, Ying; Xin, Chen; Zhao, Jikuan; Liu, Shufeng

2018-04-23

Herein, an autocatalytic strand displacement amplification (ASDA) strategy was proposed for the first time, which was further ingeniously coupled with hybridization chain reaction (HCR) event for the isothermal, label-free and multiple amplification toward nucleic acid detection. During the ASDA module, the target recognition opens the immobilized hairpin probe (IP) and initiates the annealing of the auxiliary DNA strand (AS) with the opened IP for the successive polymerization and nicking reaction in the presence of DNA polymerase and nicking endonuclease. This induces the target recycling and generation of a large amount of intermediate DNA sequences, which can be used as target analogy to execute the autocatalytic strand displacement amplification. Simultaneously, the introduced AS strand can propagate the HCR between two hairpins (H1 and H2) to form a linear DNA concatamer with cytosine (C)-rich loop region, which can facilitate the in-situ synthesis of silver nanoclusters (AgNCs) as electrochemical tags for further amplification toward target responses. With current cascade ASDA and HCR strategy, the detection of target DNA could be achieved with a low detection limit of about 0.16 fM and a good selectivity. The developed biosensor also exhibits the distinct advantages of flexibility and simplicity in probe design and biosensor fabrication, and label-free electrochemical detection, thus opens a promising avenue for the detection of nucleic acid with low abundance in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier B.V. All rights reserved.

A polymerase chain reaction-based methodology to detect gene doping.

Science.gov (United States)

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

The chain re-action

CERN Multimedia

2009-01-01

On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

Science.gov (United States)

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

African Journals Online (AJOL)

Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

Science.gov (United States)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain

International Nuclear Information System (INIS)

Mattes, W.

1977-01-01

1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays

Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

National Research Council Canada - National Science Library

McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

2005-01-01

...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

Chain reaction on de-halogenation of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane induced by irradiation in alcohols

International Nuclear Information System (INIS)

Nakagawa, Seiko

2015-01-01

Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction

Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

International Nuclear Information System (INIS)

Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

2005-01-01

With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

Evaluation of multiplex polymerase chain reaction as an alternative to conventional antibiotic sensitivity test

Directory of Open Access Journals (Sweden)

K. Rathore

2018-04-01

Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.

A SEROLOGIC AND POLYMERASE CHAIN REACTION SURVEY OF EQUINE HERPESVIRUS IN BURCHELL'S ZEBRAS (EQUUS QUAGGA), HARTMANN'S MOUNTAIN ZEBRAS (EQUUS ZEBRA HARTMANNAE), AND THOMSON'S GAZELLES (EUDORCAS THOMSONII) IN A MIXED SPECIES SAVANNAH EXHIBIT.

Science.gov (United States)

Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D

2016-12-01

Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.

Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

Directory of Open Access Journals (Sweden)

Ana Lisa do Vale Gomes

2006-10-01

Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

Radiochemical separations of target-like reaction products from Au-, Pt-, and Th-targets after irradiation with GeV protons

International Nuclear Information System (INIS)

Szweryn, B.; Bruechle, W.; Schausten, B.; Schaedel, M.

1988-08-01

Chemical separation procedures for separations of reaction products after spallation reactions with 2.6 GeV protons and heavy element targets are presented. To determine independent cross sections of individual isotopes the elements Au, Pt, Ir, Os, Re, W, Ta, Hf, (Lu, Yb, Tm, Er), (Gd, Eu, Sm), were separated from gold targets, Pt, Ir, Os, W, Ta, Hf, (Lu, Yb, Tm, Er), (Gd, Eu, Sm) from a platinum target and Au, Tl from a thorium target. (orig.)

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Early detection of typhoid by polymerase chain reaction

International Nuclear Information System (INIS)

Haque, A.; Qureshi, Javed A.; Ahmed, J.

1999-01-01

Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

Chain reaction. History of the atomic bomb

International Nuclear Information System (INIS)

Mania, Hubert

2010-01-01

Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

Polymerase chain reaction methods (PCR in agrobiotechnology

Directory of Open Access Journals (Sweden)

Taški-Ajduković Ksenija

2006-01-01

Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

Science.gov (United States)

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

Science.gov (United States)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

DEFF Research Database (Denmark)

Hougs, L; Barington, T; Madsen, HO

1993-01-01

reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

Science.gov (United States)

Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

2011-03-01

The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

Science.gov (United States)

Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

2018-01-18

Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

International Nuclear Information System (INIS)

Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

1990-01-01

Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Carlos Alberto Scrideli

2001-09-01

Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

An exonuclease-assisted amplification electrochemical aptasensor for Hg(2+) detection based on hybridization chain reaction.

Science.gov (United States)

Bao, Ting; Wen, Wei; Zhang, Xiuhua; Xia, Qinghua; Wang, Shengfu

2015-08-15

In this work, a novel electrochemical aptasensor was developed for Hg(2+) detection based on exonuclease-assisted target recycling and hybridization chain reaction (HCR) dual signal amplification strategy. The presence of Hg(2+) induced the T-rich DNA partly folded into duplex-like structure via the Hg(2+) mediated T-Hg(2+)-T base pairs, which triggered the activity of exonuclease III (Exo III). Exo III selectively digested the double-strand DNA containing multiple T-Hg(2+)-T base pairs from its 3'-end, the released Hg(2+) participated analyte recycle. With each digestion cycle, a digestion product named as help DNA was obtained, which acted as a linkage between the capture DNA and auxiliary DNA. The presence of help DNA and two auxiliary DNA collectively facilitated successful HCR process and formed long double-stranded DNA. [Ru(NH3)6](3+) was used as redox indicator, which electrostatically bound to the double strands and produced an electrochemical signal. Exo III-assisted target recycling and HCR dual amplification significantly improved the sensitivity for Hg(2+) with a detection limit of 0.12 pM (S/N=3). Furthermore, the proposed aptasensor had a promising potential for the application of Hg(2+) detection in real aquatic sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters.

Science.gov (United States)

Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H

2017-06-20

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.

Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

NARCIS (Netherlands)

Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

1999-01-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

Science.gov (United States)

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

OpenAIRE

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-01-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

Directory of Open Access Journals (Sweden)

Norbert Haider

1998-01-01

Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.

Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

Science.gov (United States)

Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

2013-04-01

Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

Artificial Chemical Reporter Targeting Strategy Using Bioorthogonal Click Reaction for Improving Active-Targeting Efficiency of Tumor.

Science.gov (United States)

Yoon, Hong Yeol; Shin, Min Lee; Shim, Man Kyu; Lee, Sangmin; Na, Jin Hee; Koo, Heebeom; Lee, Hyukjin; Kim, Jong-Ho; Lee, Kuen Yong; Kim, Kwangmeyung; Kwon, Ick Chan

2017-05-01

Biological ligands such as aptamer, antibody, glucose, and peptide have been widely used to bind specific surface molecules or receptors in tumor cells or subcellular structures to improve tumor-targeting efficiency of nanoparticles. However, this active-targeting strategy has limitations for tumor targeting due to inter- and intraheterogeneity of tumors. In this study, we demonstrated an alternative active-targeting strategy using metabolic engineering and bioorthogonal click reaction to improve tumor-targeting efficiency of nanoparticles. We observed that azide-containing chemical reporters were successfully generated onto surface glycans of various tumor cells such as lung cancer (A549), brain cancer (U87), and breast cancer (BT-474, MDA-MB231, MCF-7) via metabolic engineering in vitro. In addition, we compared tumor targeting of artificial azide reporter with bicyclononyne (BCN)-conjugated glycol chitosan nanoparticles (BCN-CNPs) and integrin α v β 3 with cyclic RGD-conjugated CNPs (cRGD-CNPs) in vitro and in vivo. Fluorescence intensity of azide-reporter-targeted BCN-CNPs in tumor tissues was 1.6-fold higher and with a more uniform distribution compared to that of cRGD-CNPs. Moreover, even in the isolated heterogeneous U87 cells, BCN-CNPs could bind artificial azide reporters on tumor cells more uniformly (∼92.9%) compared to cRGD-CNPs. Therefore, the artificial azide-reporter-targeting strategy can be utilized for targeting heterogeneous tumor cells via bioorthogonal click reaction and may provide an alternative method of tumor targeting for further investigation in cancer therapy.

Nuclear reactions of medium and heavy target nuclei with high-energy projectiles

International Nuclear Information System (INIS)

Kozma, P.; Damdinsuren, C.

1988-01-01

The cross sections of a number of target fragmentation products formed in nuclear reactions of 3.65 AGeV 12 C-ions and 3.65 GeV protons with 197 Au have been measured. The measurements have been done by direct counting of irradiated targets with Ge(Li) gamma-spectrometers. Comparison between these and other data has been used to test the hypotheses of factorization and limiting fragmentation. The total cross section for residue production in both reactions indicates that target residues are formed mainly in central collisions

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

Science.gov (United States)

Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

2005-01-01

AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

Directory of Open Access Journals (Sweden)

Wen-Pin Chou

2017-02-01

Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

OpenAIRE

Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

1993-01-01

Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

Directory of Open Access Journals (Sweden)

Cobbs Gary

2012-08-01

Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.

Science.gov (United States)

Cobbs, Gary

2012-08-16

Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

Science.gov (United States)

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

Science.gov (United States)

Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

2017-03-15

This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

Reaction of oxygen with the respiratory chain in cells and tissues.

Science.gov (United States)

Chance, B

1965-09-01

This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate

Live-Cell MicroRNA Imaging through MnO2 Nanosheet-Mediated DD-A Hybridization Chain Reaction.

Science.gov (United States)

Ou, Min; Huang, Jin; Yang, Xiaohai; He, Xiaoxiao; Quan, Ke; Yang, Yanjing; Xie, Nuli; Li, Jing; Wang, Kemin

2018-01-18

Innovative techniques to visualize native microRNAs (miRNAs) in live cells can dramatically impact current research on the roles of miRNA in biology and medicine. Here, we report a novel approach for live-cell miRNA imaging using a biodegradable MnO 2 nanosheet-mediated DD-A FRET hybridization chain reaction (HCR). The MnO 2 nanosheets can adsorb DNA hairpin probes and deliver them into live cells. After entering cells, the MnO 2 nanosheets are degraded by cellular GSH. Then, the target miR-21 triggers cascaded assembly of the liberated hairpin probes into long dsDNA polymers, which brings each two FAMs (donor) and one TAMRA (acceptor) into close proximity to generate significantly enhanced DD-A FRET signals, which was discovered and proven by our previous report. We think the developed approach can serve as an excellent intracellular miRNAs detection tool, which promises the potential for biological and disease studies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Critical analysis: use of polymerase chain reaction to diagnose leprosy

Directory of Open Access Journals (Sweden)

Flaviane Granero Maltempe

Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

Theory and applications of the polymerase chain reaction.

Science.gov (United States)

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

Science.gov (United States)

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Honcharova S.Y.

2015-08-01

Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

OpenAIRE

Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

2014-01-01

Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Targeting nanodisks via a single chain variable antibody - Apolipoprotein chimera

International Nuclear Information System (INIS)

Iovannisci, David M.; Beckstead, Jennifer A.; Ryan, Robert O.

2009-01-01

Nanodisks (ND) are nanometer scale complexes of phospholipid and apolipoprotein that have been shown to function as drug delivery vehicles. ND harboring significant quantities of the antifungal agent, amphotericin B, or the bioactive isoprenoid, all trans retinoic acid, have been generated and characterized. As currently formulated, ND possess limited targeting capability. In this study, we constructed a single chain variable antibody (scFv).apolipoprotein chimera and assessed the ability of this fusion protein to form ND and recognize the antigen to which the scFv is directed. Data obtained revealed that α-vimentin scFv.apolipoprotein A-I is functional in ND formation and antigen recognition, opening the door to the use of such chimeras in targeting drug-enriched ND to specific tissues.

Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.

Science.gov (United States)

Toyosaki, Toshiyuki

2018-06-01

To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Markov chain aggregation and its applications to combinatorial reaction networks.

Science.gov (United States)

Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

2014-09-01

We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Polymerase Chain Reaction targeting insertion sequence IS6110 for the diagnosis of pulmonary tuberculosis among Sudanese children and young adults

Directory of Open Access Journals (Sweden)

Ahmed L Osman

2014-01-01

All children participating in the study were subjected to the Mantoux test after obtaining appropriate consent injected by 5 tuberculin units of tuberculin purified protein derivative, and the results were recorded after three days. Specimens were decontaminated and inoculated on Lowenstein–Jensen media according to the modified Petroff's method. Two smears were prepared and stained by Ziehl–Neelsen stain and Auramine fluorescent dye; bacterial DNA was extracted from each specimen by using phenol chloroform method, and then the Polymerase Chain Reaction technique was adopted to detect Insertion Sequence IS6110 gene of MTB in these specimens. This study showed that the positive results for TST, ZN, Auramine, Culture and PCR were 86 (43.7%, 16 (8.1%, 22 (11.2%, 32 (16.2% and 35(17.8%, respectively. The study concluded that the PCR technique is the most sensitive and specific technique for a quick identification of MTB in gastric lavage and sputum from children who are unable to expectorate a good quality sputum sample or who are diagnosed as negative using conventional diagnostic methods.

Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

OpenAIRE

Campbell, J; Lowe, J; Walz, S; Ezzell, J

1993-01-01

We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942

Energy Technology Data Exchange (ETDEWEB)

Eklund, S [International Atomic Energy Agency, Vienna (Austria)

1962-12-02

On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

Science.gov (United States)

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

OpenAIRE

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-01-01

Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

Efficient interruption of infection chains by targeted removal of central holdings in an animal trade network.

Science.gov (United States)

Büttner, Kathrin; Krieter, Joachim; Traulsen, Arne; Traulsen, Imke

2013-01-01

Centrality parameters in animal trade networks typically have right-skewed distributions, implying that these networks are highly resistant against the random removal of holdings, but vulnerable to the targeted removal of the most central holdings. In the present study, we analysed the structural changes of an animal trade network topology based on the targeted removal of holdings using specific centrality parameters in comparison to the random removal of holdings. Three different time periods were analysed: the three-year network, the yearly and the monthly networks. The aim of this study was to identify appropriate measures for the targeted removal, which lead to a rapid fragmentation of the network. Furthermore, the optimal combination of the removal of three holdings regardless of their centrality was identified. The results showed that centrality parameters based on ingoing trade contacts, e.g. in-degree, ingoing infection chain and ingoing closeness, were not suitable for a rapid fragmentation in all three time periods. More efficient was the removal based on parameters considering the outgoing trade contacts. In all networks, a maximum percentage of 7.0% (on average 5.2%) of the holdings had to be removed to reduce the size of the largest component by more than 75%. The smallest difference from the optimal combination for all three time periods was obtained by the removal based on out-degree with on average 1.4% removed holdings, followed by outgoing infection chain and outgoing closeness. The targeted removal using the betweenness centrality differed the most from the optimal combination in comparison to the other parameters which consider the outgoing trade contacts. Due to the pyramidal structure and the directed nature of the pork supply chain the most efficient interruption of the infection chain for all three time periods was obtained by using the targeted removal based on out-degree.

Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

DEFF Research Database (Denmark)

Abdulmawjood, A.; Bulte, M.; Roth, S.

2004-01-01

A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

C. Latha

2017-08-01

Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

Science.gov (United States)

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Implementation of targeted medication adherence interventions within a community chain pharmacy practice: The Pennsylvania Project.

Science.gov (United States)

Bacci, Jennifer L; McGrath, Stephanie Harriman; Pringle, Janice L; Maguire, Michelle A; McGivney, Melissa Somma

2014-01-01

To identify facilitators and barriers to implementing targeted medication adherence interventions in community chain pharmacies, and describe adaptations of the targeted intervention and organizational structure within each individual pharmacy practice. Qualitative study. Central and western Pennsylvania from February to April 2012. Rite Aid pharmacists staffed at the 118 Pennsylvania Project intervention sites. Qualitative analysis of pharmacists' perceptions of facilitators and barriers experienced, targeted intervention and organizational structure adaptations implemented, and training and preparation prior to implementation. A total of 15 key informant interviews were conducted from February to April 2012. Ten pharmacists from "early adopter" practices and five pharmacists from "traditionalist" practices were interviewed. Five themes emerged regarding the implementation of targeted interventions, including all pharmacists' need to understand the relationship of patient care programs to their corporation's vision; providing individualized, continual support and mentoring to pharmacists; anticipating barriers before implementation of patient care programs; encouraging active patient engagement; and establishing best practices regarding implementation of patient care services. This qualitative analysis revealed that there are a series of key steps that can be taken before the execution of targeted interventions that may promote successful implementation of medication therapy management in community chain pharmacies.

Access to a polymerase chain reaction assay method targeting 13 respiratory viruses can reduce antibiotics: a randomised, controlled trial

Directory of Open Access Journals (Sweden)

Lindh Magnus

2011-04-01

Full Text Available Abstract Background Viral respiratory infections are common worldwide and range from completely benign disease to life-threatening illness. Symptoms can be unspecific, and an etiologic diagnosis is rarely established because of a lack of suitable diagnostic tools. Improper use of antibiotics is common in this setting, which is detrimental in light of the development of bacterial resistance. It has been suggested that the use of diagnostic tests could reduce antibiotic prescription rates. The objective of this study was to evaluate whether access to a multiplex polymerase chain reaction (PCR assay panel for etiologic diagnosis of acute respiratory tract infections (ARTIs would have an impact on antibiotic prescription rate in primary care clinical settings. Methods Adult patients with symptoms of ARTI were prospectively included. Nasopharyngeal and throat swabs were analysed by using a multiplex real-time PCR method targeting thirteen viruses and two bacteria. Patients were recruited at 12 outpatient units from October 2006 through April 2009, and samples were collected on the day of inclusion (initial visit and after 10 days (follow-up visit. Patients were randomised in an open-label treatment protocol to receive a rapid or delayed result (on the following day or after eight to twelve days. The primary outcome measure was the antibiotic prescription rate at the initial visit, and the secondary outcome was the total antibiotic prescription rate during the study period. Results A total sample of 447 patients was randomised. Forty-one were excluded, leaving 406 patients for analysis. In the group of patients randomised for a rapid result, 4.5% (9 of 202 of patients received antibiotics at the initial visit, compared to 12.3% (25 of 204 (P = 0.005 of patients in the delayed result group. At follow-up, there was no significant difference between the groups: 13.9% (28 of 202 in the rapid result group and 17.2% (35 of 204 in the delayed result group (P

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

Science.gov (United States)

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

Directory of Open Access Journals (Sweden)

Fábio Takenori Higa

2013-04-01

Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

OpenAIRE

Harmey, Judith H.; Harmey, Matthew A.

1993-01-01

We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

International Nuclear Information System (INIS)

Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

2000-01-01

A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Frequency of Chlamydia trachomatis among male patients with urethritis in northeast of Iran detected by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Kiarash Ghazvini

2012-01-01

Full Text Available Planning for appropriate preventive measures against Chlamydia trachomatis, a common cause of sexually transmitted disease, requires knowledge of prevalence of infection so that interventions can be targeted in a cost-effective manner. This study was performed on 178 male patients presenting with urethritis in the Mashhad province to determine the prevalence of chlamydial infection in Northeast Iran. A cotton swab and first voided urine specimen were collected according to standard procedures. Polymerase chain reaction (PCR tests were used for the detection of C. trachomatis in the specimens collected and the results were analyzed using SPSS program. Results showed that 10.6% of male patients in this group were infected with C. trachomatis. This study provides strong evidence that prevalence of Chlamydia in the Northeast Iran is high and suggests that Chlamydia screening as a routine part of STD investigations is highly necessary in this area.

Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

Science.gov (United States)

Qian, Yong; Wang, Chunyan; Gao, Fenglei

2015-01-15

A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Spread and epidemiology of Clostridium difficile polymerase chain reaction ribotype 027/toxinotype III in The Netherlands

NARCIS (Netherlands)

Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.

2007-01-01

After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and

Highly sensitive antibody-aptamer sensor for vascular endothelial growth factor based on hybridization chain reaction and pH meter/indicator.

Science.gov (United States)

Xu, Huifeng; Kou, Fangxia; Ye, Hongzhi; Wang, Zongwen; Huang, Suixin; Liu, Xianxiang; Zhu, Xi; Lin, Zhenyu; Chen, Guonan

2017-12-01

Vascular endothelial growth factor (VEGF) is a crucial signaling protein for the tumor growth and metastasis, which is also acted as the biomarkers for various diseases. In this research, we fabricate an aptamer-antibody sensor for point-of-care test of VEGF. Firstly, target VEGF is captured by antibody immobilized on the microplate, and then binds with aptamer to form the sandwich structure. Next, with the assist of glucose oxidase (GOx)-functionalized ssDNAs, hybridization chain reaction occurs using the aptamer as the primer. Thus, GOx are greatly gathered on the microplate, which catalyzes the oxidization of glucose, leading to the pH change. As a result, the detect limit at a signal-to-noise was estimated to be 0.5pg/mL of target by pH meter, and 1.6pg/mL of VEGF was able to be distinguished by naked eyes. Meanwhile, this method has been used assay VEGF in the serum with the satisfactory results. Copyright © 2017. Published by Elsevier B.V.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

Science.gov (United States)

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

Science.gov (United States)

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

Study of reactions induced by the halo nucleus 11Li with the active target MAYA

International Nuclear Information System (INIS)

Roger, Th.

2009-09-01

Active targets are perfect tools for the study of nuclear reactions induced by very low intensity radioactive ion beams. They also enable the simultaneous study of direct and compound nuclear reactions. The active target MAYA, built at GANIL, has been used to study the reactions induced by a 4.3*A MeV 11 Li beam at the ISAC2 accelerator TRIUMF (Canada). The angular distributions for the elastic scattering and the one and two neutron transfer reaction have been reconstructed. The elastic scattering angular distribution indicates a strong enhancement of the flux absorption with respect to the neighbouring nuclei. From a coupled channel analysis of the two neutron transfer reaction for different three body models, the information on the structure of the halo of the Borromean nucleus 11 Li have been extracted. Meanwhile, the energy dependence of the elastic scattering reaction has been studied, using the active target MAYA as a thick target. The resulting spectrum shows a resonance around 3 MeV centre of mass. This resonance could be an isobaric analog state of 12 Li, observed in 12 Be. R matrix calculations have been performed in order to extract the parameters (spin and parity) of this state. (author)

Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

DEFF Research Database (Denmark)

Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

2013-01-01

Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

Science.gov (United States)

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

CHAINS-PC, Decay Chain Atomic Densities

International Nuclear Information System (INIS)

1994-01-01

1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain

Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078

NARCIS (Netherlands)

Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.

2008-01-01

Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to

Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

Directory of Open Access Journals (Sweden)

Arbefeville S

2015-09-01

Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

Multifunctional Nanomaterials Utilizing Hybridization Chain Reaction for Molecular Diagnostics and Bioanalytical Applications

Science.gov (United States)

Rana, Md. Muhit

DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates

Nuclear reactions of high energy deuterons with medium mass targets

International Nuclear Information System (INIS)

Numajiri, Masaharu; Miura, Taichi; Oki, Yuichi

1994-01-01

Formation cross sections of product nuclides in the nuclear reactions of medium mass targets by 10 GeV deuterons were measured with a gamma-ray spectroscopy. The measured data were compared with the cross sections of 12 GeV protons. (author)

Polymerase chain reaction: A molecular diagnostic tool in periodontology

Science.gov (United States)

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

Directory of Open Access Journals (Sweden)

Kordo B. A. Saeed

2013-11-01

Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

Neutron measurements from beam-target reactions at the ELISE neutral beam test facility

International Nuclear Information System (INIS)

Xufei, X.; Fan, T.; Nocente, M.; Gorini, G.; Bonomo, F.; Franzen, P.; Fröschle, M.; Grosso, G.; Tardocchi, M.; Grünauer, F.; Pasqualotto, R.

2014-01-01

Measurements of 2.5 MeV neutron emission from beam-target reactions performed at the ELISE neutral beam test facility are presented in this paper. The measurements are used to study the penetration of a deuterium beam in a copper dump, based on the observation of the time evolution of the neutron counting rate from beam-target reactions with a liquid scintillation detector. A calculation based on a local mixing model of deuterium deposition in the target up to a concentration of 20% at saturation is used to evaluate the expected neutron yield for comparison with data. The results are of relevance to understand neutron emission associated to beam penetration in a solid target, with applications to diagnostic systems for the SPIDER and MITICA Neutral Beam Injection prototypes

Determination of the number of radicals in the initial chain reactions by mathematical methods

Directory of Open Access Journals (Sweden)

Pejović Branko B.

2009-01-01

Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

Science.gov (United States)

Madadelahi, M.; Kalan, K.; Shamloo, A.

2018-05-01

Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

Science.gov (United States)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Supply chain reaction

International Nuclear Information System (INIS)

Snieckus, Darius

2000-01-01

'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

Science.gov (United States)

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2015-12-01

Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

Brucella contamination in raw milk by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Mohammad Khalili

2016-10-01

Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

First Nuclear Reaction Experiment with Stored Radioactive 56Ni Beam and Internal Hydrogen and Helium Targets

NARCIS (Netherlands)

Egelhof, P.; Bagchi, Soumya; Csatlós, M.; Dillmann, I.; Dimopoulou, C.; Furuno, T; Geissel, H.; Gernhauser, R.; Kalantar-Nayestanaki, Nasser; Kuilman, M.; Mahjour-Shafiei, M.; Najafi, M.A.; Rigollet, C.; Streicher, B.

2014-01-01

The investigation of light-ion induced direct reactions using stored and cooled radioactive beams, interacting with internal targets of storage rings, can lead to substantial advantages over external target experiments, in particular for direct reaction experiments in inverse kinematics at very low

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

Science.gov (United States)

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

International Nuclear Information System (INIS)

Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian

2012-01-01

Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

International Nuclear Information System (INIS)

Leone, S.R.

1990-01-01

Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

Directory of Open Access Journals (Sweden)

Kieu The Loan Trinh

2016-05-01

Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

Directory of Open Access Journals (Sweden)

Людмила Мар’янівна Іщенко

2016-11-01

Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

DEFF Research Database (Denmark)

Blair, D.; Waycott, M.; Byrne, L.

2006-01-01

This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

LENUS (Irish Health Repository)

Drew, Richard J

2012-03-01

Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

Directory of Open Access Journals (Sweden)

Dominique Rainteau

Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

International Nuclear Information System (INIS)

Sun Jiazhen

2003-01-01

Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Development of the polymerase chain reaction for diagnosis of chancroid.

Science.gov (United States)

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

2010-03-15

With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

International Nuclear Information System (INIS)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

2017-01-01

Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

Energy Technology Data Exchange (ETDEWEB)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn

2017-05-31

Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the

A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

Science.gov (United States)

Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

2017-11-01

Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

Simple model of inhibition of chain-branching combustion processes

Science.gov (United States)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

NARCIS (Netherlands)

Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

Large area isotopic silicon targets for astrophysical reaction rate studies in Si-26

NARCIS (Netherlands)

Greene, JP; Berg, GPA

2005-01-01

For measurements of stellar reaction rates of proton rich nuclei involving resonance levels just above threshold, targets of Si-28 were used in studies of the Si-21(He-4, He-6)Si-26 reaction using the Research Center for Nuclear Physics (RCNP) Ring Cyclotron at Osaka University. Resonance structure

Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction

OpenAIRE

Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.

2016-01-01

This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

NARCIS (Netherlands)

Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

Science.gov (United States)

Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

2016-01-19

This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock.

Science.gov (United States)

Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B

2012-11-01

Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Sefrita Tri Utami

2014-01-01

Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

DEFF Research Database (Denmark)

Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

2015-01-01

BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

Measurements of activation reaction rate distributions on a mercury target bombarded with high-energy protons at AGS

International Nuclear Information System (INIS)

Takada, Hiroshi; Kasugai, Yoshimi; Nakashima, Hiroshi; Ikeda, Yujiro; Jerde, Eric; Glasgow, David

2000-02-01

A neutronics experiment was carried out using a thick mercury target at the Alternating Gradient Synchrotron (AGS) facility of Brookhaven National Laboratory in a framework of the ASTE (AGS Spallation Target Experiment) collaboration. Reaction rate distributions around the target were measured by the activation technique at incident proton energies of 1.6, 12 and 24 GeV. Various activation detectors such as the 115 In(n,n') 115m In, 93 Nb(n,2n) 92m Nb, and 209 Bi(n,xn) reactions with threshold energies ranging from 0.3 to 70.5 MeV were employed to obtain the reaction rate data for estimating spallation source neutron characteristics of the mercury target. It was found from the measured 115 In(n,n') 115m In reaction rate distribution that the number of leakage neutrons becomes maximum at about 11 cm from the top of hemisphere of the mercury target for the 1.6-GeV proton incidence and the peak position moves towards forward direction with increase of the incident proton energy. The similar result was observed in the reaction rate distributions of other activation detectors. The experimental procedures and a full set of experimental data in numerical form are summarized in this report. (author)

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

International Nuclear Information System (INIS)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.

1998-01-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

Energy Technology Data Exchange (ETDEWEB)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences

1998-07-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

Science.gov (United States)

Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

2010-04-01

To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

Study of induced reactions by a secondary beam of 11Be in Be, Ti and Au targets

International Nuclear Information System (INIS)

Dogny, S.

1992-01-01

In the last decade, new phenomena arised from nuclear reaction studies of neutron-rich light nuclei produced by projectile fragmentation. In this work, first we will recall briefly some aspects of these studies, in particular the two-neutron halo for nuclei whose binding energy of the two last neutrons is low. Secondly, we will describe the experiment which aims to study 11 Be reactions on Be, Ti and Be targets. The results of this experiment show the presence of a one-neutron halo, corresponding to a high dissociation cross-section for the three targets. We will show that three mechanisms, Coulomb dissociation for heavy targets, diffraction-and absorption-dissociation for light targets, account satisfactorily for reactions leading to 10 Be

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

Science.gov (United States)

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

Directory of Open Access Journals (Sweden)

Lina Marcela Villa

2013-11-01

Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

LENUS (Irish Health Repository)

Meyler, Kenneth L

2012-12-01

Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies\\/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and\\/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

Science.gov (United States)

Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

2012-12-01

Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.

Use of Hybridization Chain Reaction-Fluorescent In Situ Hybridization To Track Gene Expression by Both Partners during Initiation of Symbiosis.

Science.gov (United States)

Nikolakakis, K; Lehnert, E; McFall-Ngai, M J; Ruby, E G

2015-07-01

The establishment of a productive symbiosis between Euprymna scolopes, the Hawaiian bobtail squid, and its luminous bacterial symbiont, Vibrio fischeri, is mediated by transcriptional changes in both partners. A key challenge to unraveling the steps required to successfully initiate this and many other symbiotic associations is characterization of the timing and location of these changes. We report on the adaptation of hybridization chain reaction-fluorescent in situ hybridization (HCR-FISH) to simultaneously probe the spatiotemporal regulation of targeted genes in both E. scolopes and V. fischeri. This method revealed localized, transcriptionally coregulated epithelial cells within the light organ that responded directly to the presence of bacterial cells while, at the same time, provided a sensitive means to directly show regulated gene expression within the symbiont population. Thus, HCR-FISH provides a new approach for characterizing habitat transition in bacteria and for discovering host tissue responses to colonization. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

Science.gov (United States)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

2017-05-01

All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens

Measurements of activation reaction rate distributions on a mercury target bombarded with high-energy protons at AGS

Energy Technology Data Exchange (ETDEWEB)

Takada, Hiroshi; Kasugai, Yoshimi; Nakashima, Hiroshi; Ikeda, Yujiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Ino, Takashi; Kawai, Masayoshi [High Energy Accelerator Research Organization, Tsukuba, Ibaraki (Japan); Jerde, Eric; Glasgow, David [Oak Ridge National Laboratory, Oak Ridge, TN (United States)

2000-02-01

A neutronics experiment was carried out using a thick mercury target at the Alternating Gradient Synchrotron (AGS) facility of Brookhaven National Laboratory in a framework of the ASTE (AGS Spallation Target Experiment) collaboration. Reaction rate distributions around the target were measured by the activation technique at incident proton energies of 1.6, 12 and 24 GeV. Various activation detectors such as the {sup 115}In(n,n'){sup 115m}In, {sup 93}Nb(n,2n){sup 92m}Nb, and {sup 209}Bi(n,xn) reactions with threshold energies ranging from 0.3 to 70.5 MeV were employed to obtain the reaction rate data for estimating spallation source neutron characteristics of the mercury target. It was found from the measured {sup 115}In(n,n'){sup 115m}In reaction rate distribution that the number of leakage neutrons becomes maximum at about 11 cm from the top of hemisphere of the mercury target for the 1.6-GeV proton incidence and the peak position moves towards forward direction with increase of the incident proton energy. The similar result was observed in the reaction rate distributions of other activation detectors. The experimental procedures and a full set of experimental data in numerical form are summarized in this report. (author)

Advancing the sensitivity of selected reaction monitoring-based targeted quantitative proteomics

Energy Technology Data Exchange (ETDEWEB)

Shi, Tujin; Su, Dian; Liu, Tao; Tang, Keqi; Camp, David G.; Qian, Weijun; Smith, Richard D.

2012-04-01

Selected reaction monitoring (SRM)—also known as multiple reaction monitoring (MRM)—has emerged as a promising high-throughput targeted protein quantification technology for candidate biomarker verification and systems biology applications. A major bottleneck for current SRM technology, however, is insufficient sensitivity for e.g., detecting low-abundance biomarkers likely present at the pg/mL to low ng/mL range in human blood plasma or serum, or extremely low-abundance signaling proteins in the cells or tissues. Herein we review recent advances in methods and technologies, including front-end immunoaffinity depletion, fractionation, selective enrichment of target proteins/peptides or their posttranslational modifications (PTMs), as well as advances in MS instrumentation, which have significantly enhanced the overall sensitivity of SRM assays and enabled the detection of low-abundance proteins at low to sub- ng/mL level in human blood plasma or serum. General perspectives on the potential of achieving sufficient sensitivity for detection of pg/mL level proteins in plasma are also discussed.

Direct Quantification of Methane Emissions Across the Supply Chain: Identification of Mitigation Targets

Science.gov (United States)

Darzi, M.; Johnson, D.; Heltzel, R.; Clark, N.

2017-12-01

Researchers at West Virginia University's Center for Alternative Fuels, Engines, and Emissions have recently participated in a variety of studies targeted at direction quantification of methane emissions from across the natural gas supply chain. These studies included assessing methane emissions from heavy-duty vehicles and their fuel stations, active unconventional well sites - during both development and production, natural gas compression and storage facilities, natural gas engines - both large and small, two- and four-stroke, and low-throughput equipment associated with coal bed methane wells. Engine emissions were sampled using conventional instruments such as Fourier transform infrared spectrometers and heated flame ionization detection analyzers. However, to accurately quantify a wide range of other sources beyond the tailpipe (both leaks and losses), a full flow sampling system was developed, which included an integrated cavity-enhanced absorption spectrometer. Through these direct quantification efforts and analysis major sources of methane emissions were identified. Technological solutions and best practices exist or could be developed to reduce methane emissions by focusing on the "lowest-hanging fruit." For example, engine crankcases from across the supply chain should employ vent mitigation systems to reduce methane and other emissions. An overview of the direct quantification system and various campaign measurements results will be presented along with the identification of other targets for additional mitigation.

A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

Directory of Open Access Journals (Sweden)

Maria Cesarina Abete

2013-04-01

Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

Science.gov (United States)

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Toshiaki Higashi

2012-04-01

Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

Mycobacterium leprae specific genomic target in the promoter region of probable 4-alpha-glucanotransferase (ML1545) gene with potential sensitivity for polymerase chain reaction based diagnosis of leprosy.

Science.gov (United States)

Sundeep Chaitanya, V; Das, Madhusmita; Eisenbach, Tiffany L; Amoako, Angela; Rajan, Lakshmi; Horo, Ilse; Ebenezer, Mannam

2016-06-01

With the absence of an effective diagnostic tool for leprosy, cases with negative bacteriological index and limited clinical manifestations often pose diagnostic challenges. In this study, we investigated the utility of a novel Mycobacterium leprae specific 112-bp DNA sequence in the promoter region of probable 4-alpha-glucanotransferase (pseudogene, ML1545) for polymerase chain reaction (PCR) based diagnosis of leprosy in comparison to that of the RLEP gene. DNA was extracted from slit skin scrapings of 180 newly diagnosed untreated leprosy cases that were classified as per Ridley Jopling classifications and bacteriological index (BI). Primers were designed using Primer Blast 3.0 and PCR was performed with annealing temperatures of 61°C for ML1545 and 58°C for the RLEP gene using conventional gradient PCR. The results indicated a significant increase in PCR positivity of ML1545 when compared to RLEP across the study groups (164/180 [91.11%] were positive for ML1545 whereas 114/180 (63.33%) were positive for RLEP [pleprosy cases with negative BI, 28 (48.28%) were positive for RLEP and 48 (82.76%) were positive for ML1545 (p=.0001, z=3.8). Of the 42 borderline tuberculoid leprosy cases, 23 (54.76%) were positive for RLEP whereas 37 (88.09%) were positive for ML1545 (pleprosy and BI-positive groups. ML1545 can be a potential gene target for PCR-based diagnosis of leprosy especially in cases where clinical manifestations were minimal. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.

OpenAIRE

Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E

1992-01-01

Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

Directory of Open Access Journals (Sweden)

Jennifer A. Scoble

2013-10-01

Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

Science.gov (United States)

Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

2013-01-01

Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

Ultrasensitive electrochemical detection of microRNA-21 combining layered nanostructure of oxidized single-walled carbon nanotubes and nanodiamonds by hybridization chain reaction.

Science.gov (United States)

Liu, Lingzhi; Song, Chao; Zhang, Zhang; Yang, Juan; Zhou, Lili; Zhang, Xing; Xie, Guoming

2015-08-15

Measurement of microRNA (miRNA) levels in body fluids is a crucial tool for the early diagnosis and prognosis of cancers. In this study, we developed an electrochemical assay to detect miRNA-21 by fabricating the electrode with layer-by-layer assembly of oxidized single-walled carbon nanotubes and nanodiamonds. Tetrahedron-structured probes with free-standing probe on the top served as receptors to hybridize with target miRNA directly. The probes were immobilized on the deposited gold nanoparticles through a well-established strong Au-S bond. The electrochemical signal was mainly derived from an ultrasensitive pattern by combining hybridization chain reaction with DNA-functionalized AuNPs, which provided DNAzyme to catalyze H2O2 reduction. Differential pulse voltammetry was applied to record the electrochemical signals, which was increased linearly with the target miRNA-21, and the linear detection range was 10 fM to 1.0 nM. The limit of detection reached 1.95 fM (S/N=3), and the proposed biosensor exhibited good reproducibility and stability, as well as high sensitivity. Hence, this biosensor has a promising potential in clinical application. Copyright © 2015 Elsevier B.V. All rights reserved.

Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

Directory of Open Access Journals (Sweden)

Carla Bertechini Faria

2012-03-01

Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Universal, colorimetric microRNA detection strategy based on target-catalyzed toehold-mediated strand displacement reaction

Science.gov (United States)

Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu

2018-02-01

In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.

Homologous recombination in hybridoma cells: heavy chain chimeric antibody produced by gene targeting.

OpenAIRE

Fell, H P; Yarnold, S; Hellström, I; Hellström, K E; Folger, K R

1989-01-01

We demonstrate that murine myeloma cells can efficiently mediate homologous recombination. The murine myeloma cell line J558L was shown to appropriately recombine two transfected DNA molecules in approximately 30% of cells that received and integrated intact copies of both molecules. This activity was then exploited to direct major reconstructions of an endogenous locus within a hybridoma cell line. Production of antigen-specific chimeric heavy chain was achieved by targeting the human IgG1 h...

Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Gusti Ayu Yuniati Kencana

2013-07-01

Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

Identifying of meat species using polymerase chain reaction (PCR)

International Nuclear Information System (INIS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-01-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

Identifying of meat species using polymerase chain reaction (PCR)

Energy Technology Data Exchange (ETDEWEB)

Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

2013-11-27

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

DEFF Research Database (Denmark)

Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

2005-01-01

Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

Real-time polymerase chain reaction with melting analysis of positive blood culture specimens in bloodstream infections: diagnostic value and turnaround time.

Science.gov (United States)

Angeletti, Silvia; Gherardi, Giovanni; De Florio, Lucia; Avola, Alessandra; Crea, Francesca; Riva, Elisabetta; Vitali, Massimiliano Andrea; Galluzzo, Sara; Dicuonzo, Giordano

2013-01-01

A Real-time polymerase chain reaction (PCR) with melting analysis was devised to target bacterial and fungal genes together with the most prevalent antimicrobial resistance genes in 250 positive blood culture broths. This method allowed the blood culture cultivated pathogens to be classified into clinically relevant groups such as Enterobacteriaceae, oxidase-positive bacilli, oxidase-positive coccobacilli, S. aureus and yeast. Enterococci and streptococci could be distinguished from CoNS only by the Gram stain. Gram-positive bacilli were discriminated from Gram-positive cocci by Gram stain. Furthermore, the most important antimicrobial resistant genes such as mecA, vanA, bla TEM , bla SHV and bla CTX-M could be identified. All results were obtained with a turnaround time of three hours from the moment of blood culture positivity compared to 24-72 hours for phenotypic methods. In conclusion, the proposed approach can allow the clinician to implement proper early management of sepsis patients.

Skin: Major target organ of allergic reactions to small molecular weight compounds

International Nuclear Information System (INIS)

Merk, Hans F.; Baron, Jens M.; Neis, Mark M.; Obrigkeit, Daniela Hoeller; Karlberg, Ann-Therese

2007-01-01

Skin is a major target organ for allergic reactions to small molecular weight compounds. Drug allergic reactions may be life-threatening such as in the case of anaphylactic reactions or bullous drug reactions and occur in about 5% of all hospitalized patients. Allergic contact dermatitis has an enormous influence on the social life of the patient because it is the most frequent reason for occupational skin diseases and the treatment and prevention of this disease cost approximately Euro 3 billion per year in Germany. The different proposed pathophysiological pathways leading to a drug eruption are discussed in this paper. All major enzymes which are involved in the metabolism of xenobiotica were shown to be present in skin. Evidence supporting the role of metabolism in the development of drug allergy and allergic contact dermatitis is demonstrated in the example of sulphonamides and fragrances

Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

DEFF Research Database (Denmark)

Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

2007-01-01

Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases

Directory of Open Access Journals (Sweden)

Sharma J

2010-01-01

Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.

Design and Generation of Humanized Single-chain Fv Derived from Mouse Hybridoma for Potential Targeting Application.

Science.gov (United States)

Khantasup, Kannika; Chantima, Warangkana; Sangma, Chak; Poomputsa, Kanokwan; Dharakul, Tararaj

2015-12-01

Single-chain variable antibody fragments (scFvs) are attractive candidates for targeted immunotherapy in several human diseases. In this study, a concise humanization strategy combined with an optimized production method for humanizing scFvs was successfully employed. Two antibody clones, one directed against the hemagglutinin of H5N1 influenza virus, the other against EpCAM, a cancer biomarker, were used to demonstrate the validity of the method. Heavy chain (VH) and light chain (VL) variable regions of immunoglobulin genes from mouse hybridoma cells were sequenced and subjected to the construction of mouse scFv 3-D structure. Based on in silico modeling, the humanized version of the scFv was designed via complementarity-determining region (CDR) grafting with the retention of mouse framework region (FR) residues identified by primary sequence analysis. Root-mean-square deviation (RMSD) value between mouse and humanized scFv structures was calculated to evaluate the preservation of CDR conformation. Mouse and humanized scFv genes were then constructed and expressed in Escherichia coli. Using this method, we successfully generated humanized scFvs that retained the targeting activity of their respective mouse scFv counterparts. In addition, the humanized scFvs were engineered with a C-terminal cysteine residue (hscFv-C) for site-directed conjugation for use in future targeting applications. The hscFv-C expression was extensively optimized to improve protein production yield. The protocol yielded a 20-fold increase in production of hscFv-Cs in E. coli periplasm. The strategy described in this study may be applicable in the humanization of other antibodies derived from mouse hybridoma.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

Science.gov (United States)

Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

2010-03-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

Science.gov (United States)

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

Determining Li+-Coupled Redox Targeting Reaction Kinetics of Battery Materials with Scanning Electrochemical Microscopy.

Science.gov (United States)

Yan, Ruiting; Ghilane, Jalal; Phuah, Kia Chai; Pham Truong, Thuan Nguyen; Adams, Stefan; Randriamahazaka, Hyacinthe; Wang, Qing

2018-02-01

The redox targeting reaction of Li + -storage materials with redox mediators is the key process in redox flow lithium batteries, a promising technology for next-generation large-scale energy storage. The kinetics of the Li + -coupled heterogeneous charge transfer between the energy storage material and redox mediator dictates the performance of the device, while as a new type of charge transfer process it has been rarely studied. Here, scanning electrochemical microscopy (SECM) was employed for the first time to determine the interfacial charge transfer kinetics of LiFePO 4 /FePO 4 upon delithiation and lithiation by a pair of redox shuttle molecules FcBr 2 + and Fc. The effective rate constant k eff was determined to be around 3.70-6.57 × 10 -3 cm/s for the two-way pseudo-first-order reactions, which feature a linear dependence on the composition of LiFePO 4 , validating the kinetic process of interfacial charge transfer rather than bulk solid diffusion. In addition, in conjunction with chronoamperometry measurement, the SECM study disproves the conventional "shrinking-core" model for the delithiation of LiFePO 4 and presents an intriguing way of probing the phase boundary propagations induced by interfacial redox reactions. This study demonstrates a reliable method for the kinetics of redox targeting reactions, and the results provide useful guidance for the optimization of redox targeting systems for large-scale energy storage.

Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

Directory of Open Access Journals (Sweden)

Anupam Berwal

2017-01-01

Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

DEFF Research Database (Denmark)

Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager

2017-01-01

transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

(p,γ) reaction on thick target as a spectroscopic tool

International Nuclear Information System (INIS)

Paradellis, T.

1985-01-01

When thick even-even targets around mass A-60 are bombarded with low energy protons the (p,γ) reaction excite a large number of resonances in the compound nucleus with a strong initial alignment. The statistical gamma decay of these states to the low lying discrete levels of the compound nucleus introduces some attenuation of the initial alignment. It is shown experimentally that the resulting alignment of the low discrete states is strong enough to permit usefull spectroscopic study of these states, since the resulting attenuation do not depend on the target or the bombarding energy being function of the spin of the level. This type of spectroscopy can be extended also to measure life-time of levels through Doppler-shift

Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

Energy Technology Data Exchange (ETDEWEB)

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

2013-11-01

Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

International Nuclear Information System (INIS)

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

2013-01-01

Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10 6 copies

Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

Science.gov (United States)

Khan, S; Miah, M R; Khatun, S

2015-12-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

Target fragmentation in proton-nucleus and /sup 16/O-nucleus reactions at 60 and 200 GeVnucleon

Energy Technology Data Exchange (ETDEWEB)

Schmidt, H R; Albrecht, R; Awes, T C; Baktash, C; Beckmann, P; Claesson, G; Berger, F; Bock, R; Dragon, L; Ferguson, R L; Franz, A; Garpman, S; Glasow, R; Gustafsson, H A; Gutbrod, H H; Kampert, K H; Kolb, B W; Kristiansson, P; Lee, I Y; Loehner, H; Lund, I; Obenshain, F E; Oskarsson, A; Otterlund, I; Peitzmann, T; Persson, S; Plasil, F; Poskanzer, A M; Purschke, M; Ritter, H G; Santo, R; Siemiarczuk, T; Sorensen, S P; Stenlund, E; Young, G R

1987-01-01

Target remnants with Z<3 from proton-nucleus and /sup 16/O-nulceus reactions at 60 and 200 GeVnucleon were measured in the angular range from 30)degree) to 160)degree) (-1.7<)eta)1.3) employing the Plastic Ball detector. The excitation energy of the target spectator matter in central oxygen-induced collisions is found to be high enough to allow for complete disintegration of the target nucelus into fragments with Z<3. The average longtitudinal momentum transfer per proton to the target in central collisions is considerably higher in the case of /sup 16/O-induced reactions (approx.300 MeVc) than in proton-induced reactions (approx.130 MeVc). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calcualtions at 60 GeVnucleon /sup 16/O)plus)Au but are in disagreement at 200 GeVnucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse moments of target spectators and the entropy produced in the target gfragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeVnucleon. 18 refs., 112 figs

Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Stephen Duffett

2012-01-01

Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

The polymerase chain reaction and its application to clinical plastic surgery.

LENUS (Irish Health Repository)

Rea, S

2012-02-03

Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

Performance of an HF chain-reaction laser with high initiation efficiency

International Nuclear Information System (INIS)

Whittier, J.S.; Kerber, R.L.

1974-01-01

Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)

Interaction of cover and target with xenon gas in the IFE-reaction chamber

International Nuclear Information System (INIS)

Kuteev, Boris V.

2001-11-01

Interaction of a direct drive target and a cover, which is shielding the target against gas particle and heat flows in the reaction chamber of the Inertial Confinement Reactor, is considered. The cover is produced from solid gas -deuterium, neon of xenon. It is shown that at the SOMBRERO parameters the xenon cover with 5.6-mm size significantly reduces the heat flows onto the 4-mm target. The gas drag produces the deceleration of the target much larger than that for the cover due to large mass difference between them. The distance between the target and the cover is about 15 mm at the explosion point, which is sufficient for normal irradiation of the target by laser beams. Protection of the target against the wall radiation is necessary during the flight. Along with creation of reflecting layers over the target surface ablating layers from solid hydrogen or neon seem to be a solution. (author)

Detecting beef meatball contamination with polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hoda A.

2017-10-01

Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

Science.gov (United States)

Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

2018-05-01

Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

Directory of Open Access Journals (Sweden)

Andriani .

2013-08-01

Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

Excitation functions of radionuclides produced by proton induced reactions on gadolinium targets

International Nuclear Information System (INIS)

Challana, M.B.; Comsana, M.N.H.; Moawadb, G.S.; Abou-Zeid, M.A.

2008-01-01

Cross section study for proton induced reaction on natural Gadolinium targets were performed. Excitation functions for the reactions n atGd(p,x) 152m+g , 154m,154g Tb from threshold up to E p = 18 MeV have been measured employing the stacked foil activation technique, and using high resolution HPGe gamma spectrometry. Utilizing the simultaneous measurement of the excitation function of n atCu(p,x) 62 Zn, n atCu(p,x) 63 Zn, and n atCu(p,x) 65 Zn as monitor reactions. The theoretical analysis of the excitation functions has been done employing both ALICE-91 and EMPIRE-II codes. In general, theoretical calculations agree well with the experimental data. A significant contribution of pre-equilibrium component has been observed at these energies

Decisive Markov Chains

OpenAIRE

Abdulla, Parosh Aziz; Henda, Noomene Ben; Mayr, Richard

2007-01-01

We consider qualitative and quantitative verification problems for infinite-state Markov chains. We call a Markov chain decisive w.r.t. a given set of target states F if it almost certainly eventually reaches either F or a state from which F can no longer be reached. While all finite Markov chains are trivially decisive (for every set F), this also holds for many classes of infinite Markov chains. Infinite Markov chains which contain a finite attractor are decisive w.r.t. every set F. In part...

Optimisation of a quantitative polymerase chain reaction-based strategy for the detection and quantification of human herpesvirus 6 DNA in patients undergoing allogeneic haematopoietic stem cell transplantation

Directory of Open Access Journals (Sweden)

Miriam YH Ueda

2015-06-01

Full Text Available Human herpesvirus 6 (HHV-6 may cause severe complications after haematopoietic stem cell transplantation (HSCT. Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.

Quantitative polymerase chain reaction detection of circulating DNA in serum for early diagnosis of mucormycosis in immunocompromised patients.

Science.gov (United States)

Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic

2013-05-01

The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.

Bayesian estimation for quantification by real-time polymerase chain reaction under a branching process model of the DNA molecules amplification process

NARCIS (Netherlands)

Lalam, N.; Jacob, C.

2007-01-01

The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

High-spin nuclear target of 178m2Hf: creation and nuclear reaction studies

International Nuclear Information System (INIS)

Oganessyan, Yu.Ts.; Karamyan, S.A.; Gangrskij, Yu.P.

1993-01-01

A long-lived (31 years) four-quasiparticle isomer 178m 2 Hf(I,K π =16,16 + ) was produced in microweight quantities using the nuclear reaction 176 Yb( 4 He, 2n). Methods of precision chemistry and mass-separation for the purification of the produced Hf material have been developed. Thin targets of isomeric hafnium-178 on carbon backings were prepared and used in experiments on a neutron, proton and deuteron beams. First results on nuclear reactions on a high-spin exotic target were obtained. Experiments on electromagnetic interactions of the isomeric hafnium using methods of the collinear laser spectroscopy as well as of the nuclear orientation of hafnium implanted into a crystalline media were started. 11 refs.; 11 figs.; 2 tabs

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

Target fragmentation in proton-nucleus and 16O-nucleus reactions at 60 and 200 GeV/nucleon

International Nuclear Information System (INIS)

Schmidt, H.R.; Albrecht, R.; Claesson, G.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Sorensen, S.P.; Young, G.R.; Beckmann, P.; Berger, F.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Franz, A.; Kristiansson, P.; Poskanzer, A.M.; Ritter, H.G.; Garpman, S.; Gustafsson, H.A.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.

1988-01-01

Target remnants with Z 16 O-nucleus reactions at 60 and 200 GeV/nucleon were measured in the angular range from 30 0 to 160 0 (-1.7 16 O-induced reactions (≅ 300 MeV/c) than in proton-induced reactions (≅ 130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon 16 O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeV/nucleon. (orig.)

Target fragmentation in proton-nucleus and 16O-nucleus reactions at 60 and 200 GeV/nucleon

International Nuclear Information System (INIS)

Schmidt, H.R.; Albrecht, R.; Claesson, G.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Sorensen, S.P.; Young, G.R.; Beckmann, P.; Berger, F.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Franz, A.; Kristiansson, P.; Poskanzer, A.M.; Ritter, H.G.; Garpman, S.; Gustafsson, H.A.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.

1988-01-01

Target remnants with Z 16 O-nucleus reactions at 60 and 200 GeV/nucleon were measured in the angular range from 30 0 to 160 0 (-1.7 16 O-induced reactions (= 300 MeV/c) than in proton-induced reactions (= 130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon 16 O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeV/nucleon. (orig.)

Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

DEFF Research Database (Denmark)

Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L

2015-01-01

Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

DEFF Research Database (Denmark)

Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

2011-01-01

Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

Directory of Open Access Journals (Sweden)

Xu Q

2015-06-01

Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

Theoretical modeling of yields for proton-induced reactions on natural and enriched molybdenum targets

Energy Technology Data Exchange (ETDEWEB)

Celler, A; Hou, X [University of British Columbia, Vancouver, BC, Canada, (Canada); Benard, F; Ruth, T, E-mail: aceller@physics.ubc.ca, E-mail: xinchi@phas.ubc.ca, E-mail: fbenard@bccrc.ca, E-mail: truth@triumf.ca [BC Cancer Agency, Vancouver, BC (Canada)

2011-09-07

Recent acute shortage of medical radioisotopes prompted investigations into alternative methods of production and the use of a cyclotron and {sup 100}Mo(p,2n){sup 99m}Tc reaction has been considered. In this context, the production yields of {sup 99m}Tc and various other radioactive and stable isotopes which will be created in the process have to be investigated, as these may affect the diagnostic outcome and radiation dosimetry in human studies. Reaction conditions (beam and target characteristics, and irradiation and cooling times) need to be optimized in order to maximize the amount of {sup 99m}Tc and minimize impurities. Although ultimately careful experimental verification of these conditions must be performed, theoretical calculations can provide the initial guidance allowing for extensive investigations at little cost. We report the results of theoretically determined reaction yields for {sup 99m}Tc and other radioactive isotopes created when natural and enriched molybdenum targets are irradiated by protons. The cross-section calculations were performed using a computer program EMPIRE for the proton energy range 6-30 MeV. A computer graphical user interface for automatic calculation of production yields taking into account various reaction channels leading to the same final product has been created. The proposed approach allows us to theoretically estimate the amount of {sup 99m}Tc and its ratio relative to {sup 99g}Tc and other radioisotopes which must be considered reaction contaminants, potentially contributing to additional patient dose in diagnostic studies.

Theoretical modeling of yields for proton-induced reactions on natural and enriched molybdenum targets.

Science.gov (United States)

Celler, A; Hou, X; Bénard, F; Ruth, T

2011-09-07

Recent acute shortage of medical radioisotopes prompted investigations into alternative methods of production and the use of a cyclotron and ¹⁰⁰Mo(p,2n)(99m)Tc reaction has been considered. In this context, the production yields of (99m)Tc and various other radioactive and stable isotopes which will be created in the process have to be investigated, as these may affect the diagnostic outcome and radiation dosimetry in human studies. Reaction conditions (beam and target characteristics, and irradiation and cooling times) need to be optimized in order to maximize the amount of (99m)Tc and minimize impurities. Although ultimately careful experimental verification of these conditions must be performed, theoretical calculations can provide the initial guidance allowing for extensive investigations at little cost. We report the results of theoretically determined reaction yields for (99m)Tc and other radioactive isotopes created when natural and enriched molybdenum targets are irradiated by protons. The cross-section calculations were performed using a computer program EMPIRE for the proton energy range 6-30 MeV. A computer graphical user interface for automatic calculation of production yields taking into account various reaction channels leading to the same final product has been created. The proposed approach allows us to theoretically estimate the amount of (99m)Tc and its ratio relative to (99g)Tc and other radioisotopes which must be considered reaction contaminants, potentially contributing to additional patient dose in diagnostic studies.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

Science.gov (United States)

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

LOCALIZATION OF HUMAN PAPILLOMAVIRUS TYPE-16 DNA USING THE POLYMERASE CHAIN-REACTION IN THE CERVIX UTERI OF WOMEN WITH CERVICAL INTRAEPITHELIAL NEOPLASIA

NARCIS (Netherlands)

Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.

1989-01-01

The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained

Detection and differentiation of Cryptosporidium by real-time polymerase chain reaction in stool samples from patients in Rio de Janeiro, Brazil

Directory of Open Access Journals (Sweden)

Roberta Flávia Ribeiro Rolando

2012-06-01

Full Text Available This study reports the first genetic characterisation of Cryptosporidium isolates in Brazil using real-time polymerase chain reaction (RT-PCR. A total of 1,197 faecal specimens from children and 10 specimens from human immunodeficiency virus-infected patients were collected between 1999-2010 and screened using microscopy. Forty-eight Cryptosporidium oocyst-positive isolates were identified and analysed using a generic TaqMan assay targeting the 18S rRNA to detect Cryptosporidium species and two other TaqMan assays to identify Cryptosporidium hominis and Cryptosporidium parvum. The 18S rRNA assay detected Cryptosporidium species in all 48 of the stool specimens. The C. parvum TaqMan assay correctly identified five/48 stool samples, while 37/48 stool specimens were correctly amplified in the C. hominis TaqMan assay. The results obtained in this study support previous findings showing that C. hominis infections are more prevalent than C. parvum infections in Brazil and they demonstrate that the TaqMan RT-PCR procedure is a simple, fast and valuable tool for the detection and differentiation of Cryptosporidium species.

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur P

2004-01-01

Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

Energy Technology Data Exchange (ETDEWEB)

Mania, Hubert

2010-07-01

Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

Science.gov (United States)

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Devita Kusdianingrum

2014-10-01

Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

Recent progress in the development of a polarized proton target for reactions with radioactive ion beams

International Nuclear Information System (INIS)

Urrego-Blanco, J.P.; Bingham, C.R.; Brandt, B. van den; Galindo-Uribarri, A.; Gomez del Campo, J.; Hautle, P.; Konter, J.A.; Padilla-Rodal, E.; Schmelzbach, P.A.

2007-01-01

Polarization observables in nuclear reactions with stable beams have provided important information concerning structural properties of nuclei and reaction mechanisms and hold great promise in the context of exotic nuclei. We report on the development of a polarized target based on plastic foils of 20-200 μm thickness to be used with radioactive ion beams. The operation of such a target requires a moderately high magnetic field and very low temperatures. The plastic foil is placed inside a chamber attached to the mixing chamber of a 3 He- 4 He dilution refrigerator. Cooling of the foil is achieved via a superfluid film of 4 He that can be supplied through two capillaries. The chamber has two thin, highly uniform silicon nitride windows. An NMR coil is attached to the target to monitor the polarization. Results of a first test to characterize the target system, using the elastic scattering of 38 MeV 12 C by protons in inverse kinematics are presented

Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

DEFF Research Database (Denmark)

Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard

2015-01-01

Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

Science.gov (United States)

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Kinetics of the chain uranium decay

International Nuclear Information System (INIS)

Zel'dovich, Ya.B.; Khariton, Yu.B.

1984-01-01

The development of chain reaction in uranium mass, when passing through the mass critical value, is studied. It is shown that thermal expanson is a powerful regulating factor, making the limit passing quite safe. The case of convergence of two uranium masses of precritical dimensions is considered in particular. The critical mass value is assessed and it is shown that its gradual increase above the critical value results in the reaction vibrational regime with the period inversely proportional to the square root of uranium supply rate. The role of delaying neutrons in the fission chain reaction development is pointed out

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

Science.gov (United States)

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

OpenAIRE

ÖZKUL, Aykut

2002-01-01

In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

Selective binding of carotenoids with a shorter conjugated chain to the LH2 antenna complex and those with a longer conjugated chain to the reaction center from Rubrivivax gelatinosus.

Science.gov (United States)

Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo

2007-06-19

Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.

Target fragmentation in proton-nucleus and16O-nucleus reactions at 60 and 200 GeV/nucleon

Science.gov (United States)

Albrecht, R.; Awes, T. C.; Baktash, C.; Beckmann, P.; Claesson, G.; Berger, F.; Bock, R.; Dragon, L.; Ferguson, R. L.; Franz, A.; Garpman, S.; Glasow, R.; Gustafsson, H. Å.; Gutbrod, H. H.; Kampert, K. H.; Kolb, B. W.; Kristiansson, P.; Lee, I. Y.; Löhner, H.; Lund, I.; Obenshain, F. E.; Oskarsson, A.; Otterlund, I.; Peitzmann, T.; Persson, S.; Plasil, F.; Poskanzer, A. M.; Purschke, M.; Ritter, H. G.; Santo, R.; Schmidt, H. R.; Siemiarczuk, T.; Sorensen, S. P.; Stenlund, E.; Young, G. R.

1988-03-01

Target remnants with ZPlastic Ball detector. The excitation energy of the target spectator matter in central oxygen-induced collisions is found to be high enough to allow for complete disintegration of the target nucleus into fragments with Z<3. The average longitudinal momentum transfer per proton to the target in central collisions is considerably higher in the case of16O-induced reactions (≈300 MeV/c) than in proton-induced reactions (≈130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon16O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1 2 GeV/nucleon.

First Year Report: Nuclear Reaction Measurements with Radioactive Beams and Targets- Progress in Measurements of the 89Zr (n,xnyp) Reaction Cross Sections

International Nuclear Information System (INIS)

Joseph Cerny; Dennis Moltz; Sylvia La; Ed Morse; Larry Ahle; Lee Bernstein; Ken Moody; Kevin Roberts; Margaret Moody; James Powell; Jim O'Neil; Anthony Belian

2004-01-01

OAK-B135 During the underground nuclear tests in Nevada, some of the most important information was obtained by radiochemical analysis of post-test excavations. By adding small samples of refractory and rare earth elements not commonly present in the surrounding soil to the device, a detailed look could be had of the actual event. In order to properly analyze these data, several hundred cross sections are needed at a neutron energy of 14 MeV (a d-t-burn product). Although it has always been assumed that these calculations are correct, insufficient experimental data exist to corroborate this assumption. The purpose of this experiment is to measure two reaction cross sections, namely the 89 Zr (n, 2n) 88 Zr and 89 Zr (n, np) 88 Y reactions. Although the former reaction has been measured in an unpublished report ( A. A. Delucchi and W. Goishi, LANL Report LA-7841-C (1977) pp. 33-36), we intend to reduce the experimental error in this cross section. The latter cross section has not been measured. This case is much simplified because these reaction products have half-lives ∼100 days compared with ∼3 days for the target nuclide. Therefore the assay can be accomplished long after the target nuclei have decayed away

Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

Directory of Open Access Journals (Sweden)

Kosuke Nakamura

2016-06-01

Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

DEFF Research Database (Denmark)

Andresen, K; Gasim, S; Elhassan, A M

1997-01-01

We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

Detection of Mycoplasma pneumoniae by two polymerase chain reactions and role of M. pneumoniae in acute respiratory tract infections in pediatric patients

NARCIS (Netherlands)

Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H

Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI

Analysis of environmental and economic aspects of international pellet supply chains

Energy Technology Data Exchange (ETDEWEB)

Ehrig, Rita

2014-01-17

Biomass plays a key role to achieve the EU's 20-20-20 energy and climate targets. Because of rising European demand and limited domestic resources, the EU relies on worldwide imports. Given this framework, the present thesis explores the influences on wood pellet supply chains considering different environmental policies, price risks and the effect of torrefaction pretreatment. The examinations refer to three real case studies for pellet trade from Australia, Canada, and Russia to Europe. In the first investigation, the efficiency of co-firing imported wood pellets in terms of CO{sub 2} savings and related subsidy schemes is analysed. Scenarios show that co-firing biomass is efficient to contribute to the EU energy targets. Though, policy makers could use these instruments more effective when directing sourcing decision towards options with even less environmental impacts. The second analysis explores the influence of statistically derived price risks on total supply chain economics. It is shown that price risks can effect strong fluctuations in the short term, which seriously affect the profitability of individual trade routes. Securing the supply chain is mainly based on individual producer-buyer agreements, personal branch experiences and fast reactions on the subsidy system. Systematic evaluation of supply chains could contribute to a more reliable market and thus foster investment decisions. In the last investigation, the economic and environmental performance of potential torrefaction-based supply chains is assessed. As a result, torrefaction-based supply chains turn out to be a certain alternative to conventional ones. Though, still huge research efforts and industrial demonstration are required to make torrefied biomass a real alternative on the market.

Analysis of environmental and economic aspects of international pellet supply chains

International Nuclear Information System (INIS)

Ehrig, Rita

2014-01-01

Biomass plays a key role to achieve the EU's 20-20-20 energy and climate targets. Because of rising European demand and limited domestic resources, the EU relies on worldwide imports. Given this framework, the present thesis explores the influences on wood pellet supply chains considering different environmental policies, price risks and the effect of torrefaction pretreatment. The examinations refer to three real case studies for pellet trade from Australia, Canada, and Russia to Europe. In the first investigation, the efficiency of co-firing imported wood pellets in terms of CO 2 savings and related subsidy schemes is analysed. Scenarios show that co-firing biomass is efficient to contribute to the EU energy targets. Though, policy makers could use these instruments more effective when directing sourcing decision towards options with even less environmental impacts. The second analysis explores the influence of statistically derived price risks on total supply chain economics. It is shown that price risks can effect strong fluctuations in the short term, which seriously affect the profitability of individual trade routes. Securing the supply chain is mainly based on individual producer-buyer agreements, personal branch experiences and fast reactions on the subsidy system. Systematic evaluation of supply chains could contribute to a more reliable market and thus foster investment decisions. In the last investigation, the economic and environmental performance of potential torrefaction-based supply chains is assessed. As a result, torrefaction-based supply chains turn out to be a certain alternative to conventional ones. Though, still huge research efforts and industrial demonstration are required to make torrefied biomass a real alternative on the market.

Sleeve reaction chamber system

Science.gov (United States)

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

Directory of Open Access Journals (Sweden)

Mayara C. Lombardi

2014-12-01

Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

lumpGEM: Systematic generation of subnetworks and elementally balanced lumped reactions for the biosynthesis of target metabolites.

Directory of Open Access Journals (Sweden)

Meric Ataman

2017-07-01

Full Text Available In the post-genomic era, Genome-scale metabolic networks (GEMs have emerged as invaluable tools to understand metabolic capabilities of organisms. Different parts of these metabolic networks are defined as subsystems/pathways, which are sets of functional roles to implement a specific biological process or structural complex, such as glycolysis and TCA cycle. Subsystem/pathway definition is also employed to delineate the biosynthetic routes that produce biomass building blocks. In databases, such as MetaCyc and SEED, these representations are composed of linear routes from precursors to target biomass building blocks. However, this approach cannot capture the nested, complex nature of GEMs. Here we implemented an algorithm, lumpGEM, which generates biosynthetic subnetworks composed of reactions that can synthesize a target metabolite from a set of defined core precursor metabolites. lumpGEM captures balanced subnetworks, which account for the fate of all metabolites along the synthesis routes, thus encapsulating reactions from various subsystems/pathways to balance these metabolites in the metabolic network. Moreover, lumpGEM collapses these subnetworks into elementally balanced lumped reactions that specify the cost of all precursor metabolites and cofactors. It also generates alternative subnetworks and lumped reactions for the same metabolite, accounting for the flexibility of organisms. lumpGEM is applicable to any GEM and any target metabolite defined in the network. Lumped reactions generated by lumpGEM can be also used to generate properly balanced reduced core metabolic models.

Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

International Nuclear Information System (INIS)

Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

1990-01-01

The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids

OpenAIRE

Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M.; Qiao, Shanlei; Spencer, Melanie D.; Zeisel, Steven H.; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

2013-01-01

Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reactio...

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Science.gov (United States)

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

Science.gov (United States)

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY

Directory of Open Access Journals (Sweden)

Susan Maphilindawati Noor

2014-10-01

Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.

Tangential breast irradiation with or without internal mammary chain irradiation: results of a randomized trial

International Nuclear Information System (INIS)

Kaija, Holli; Maunu, Pitkaenen

1995-01-01

A prospective randomized study was made of 270 patients with unilateral stage I or II invasive breast cancer treated by segmental resection, axillary dissection and radiation at the University Hospital of Tampere, Finland, between 1989 and 1991. The aim of the study was to determine whether there is any advantage or disadvantage if the internal mammary chains (IMC) are included in the radiation target volume. The medial and lateral two-field technique was used and the target volumes were determined randomly either to include the internal mammary chain (IMC-RT) or not (no-IMC-RT). The prevalence of radiation pneumonitis was 16% and there was no significant difference between the IMC- and no-IMC-groups (18 vs. 14%). Skin reactions were equal in both groups. Lung fibrosis was more common in the IMC-RT group. In conclusion: radiation of internal mammary chain after conservative surgery does not lead to an increase in clinically important skin or pulmonary complications. Whether it prevents recurrences or new primaries of the opposite breast is too early to say because of the short follow-up time

New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction

Energy Technology Data Exchange (ETDEWEB)

Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)

1997-09-01

Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.

Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

Directory of Open Access Journals (Sweden)

Winny Xie

2013-12-01

Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

Integral excitation functions for proton and alpha induced reactions on target elements 22 <= Z <= 28

International Nuclear Information System (INIS)

Brinkmann, G.

1979-01-01

In the framework of a systematic study which is also important for certain cosmological questions a series of integral excitation functions of p- and α-induced nuclear reactions on target elements 22 [de

Cross section of α-induced reactions on iridium isotopes obtained from thick target yield measurement for the astrophysical γ process

Directory of Open Access Journals (Sweden)

T. Szücs

2018-01-01

Full Text Available The stellar reaction rates of radiative α-capture reactions on heavy isotopes are of crucial importance for the γ process network calculations. These rates are usually derived from statistical model calculations, which need to be validated, but the experimental database is very scarce. This paper presents the results of α-induced reaction cross section measurements on iridium isotopes carried out at first close to the astrophysically relevant energy region. Thick target yields of 191Ir(α,γ195Au, 191Ir(α,n194Au, 193Ir(α,n196mAu, 193Ir(α,n196Au reactions have been measured with the activation technique between Eα=13.4 MeV and 17 MeV. For the first time the thick target yield was determined with X-ray counting. This led to a previously unprecedented sensitivity. From the measured thick target yields, reaction cross sections are derived and compared with statistical model calculations. The recently suggested energy-dependent modification of the α+nucleus optical potential gives a good description of the experimental data.

Characterization and development of an active scintillating target for nuclear reaction studies on actinides

Energy Technology Data Exchange (ETDEWEB)

Belier, Gilbert, E-mail: gilbert.belier@cea.fr [CEA, DAM, DIF, DPTA, Centre du Grand Rue, 91297 Arpajon (France); Aupiais, Jean; Varignon, Cyril; Vayre, Sylvain [CEA, DAM, DIF, DPTA, Centre du Grand Rue, 91297 Arpajon (France)

2012-02-01

This article presents the development of a new kind of active actinide target, based on organic liquid scintillators containing the dissolved isotope. Amongst many advantages one can mention the very high detection efficiency, the Pulse Shape Discrimination capability, the fast response allowing high count rates and good time resolution and the ease of fabrication. The response of this target to fission fragments has been studied. The discrimination of alpha, fission and proton recoil events is demonstrated. The alpha decay and fission detection efficiencies are simulated and compared to measurements. Finally the use of such a target in the context of fast neutron induced reactions is discussed.

Characterization and development of an active scintillating target for nuclear reaction studies on actinides

International Nuclear Information System (INIS)

Belier, Gilbert; Aupiais, Jean; Varignon, Cyril; Vayre, Sylvain

2012-01-01

This article presents the development of a new kind of active actinide target, based on organic liquid scintillators containing the dissolved isotope. Amongst many advantages one can mention the very high detection efficiency, the Pulse Shape Discrimination capability, the fast response allowing high count rates and good time resolution and the ease of fabrication. The response of this target to fission fragments has been studied. The discrimination of alpha, fission and proton recoil events is demonstrated. The alpha decay and fission detection efficiencies are simulated and compared to measurements. Finally the use of such a target in the context of fast neutron induced reactions is discussed.

Requirements for design of accelerator, beam transport, and target in a study of thermonuclear reaction cross section

Energy Technology Data Exchange (ETDEWEB)

Itahashi, T; Takahisa, K; Fujiwara, M; Toki, H; Ejiri, H [Osaka Univ., Ibaraki (Japan). Research Center for Nuclear Physics; Ohsumi, H; Komori, M

1997-03-01

A compact accelerator with high current ion source, low energy beam transport elements and windowless gas target was designed to investigate the thermonuclear reaction cross section. The idea of this project focused on the cross section measurement of the fusion reaction data {sup 3}He+{sup 3}He-{sup 4}He+p+p at 25keV. The system will be installed in Otoh Cosmo Observatory (1270m.w.e.) to get rid of the huge cosmic and environmental background. It consists of NANOGUN ECR ion source, focusing elements made of permanent magnets window less {sup 3}He gas target and/or He{sup 3} plasma target and detector telescopes with low noise and low background. Requirements for these were discussed technically and various ideas were proposed. (author)

Cost management in the internal value chain of integrated application of activity-based costing, Kaizen concept and target costing

Directory of Open Access Journals (Sweden)

Pešić-Tomić Vesna

2014-01-01

Full Text Available The objective of this paper is an effort to view the possibilities of integrated use of target costing, activity based costing and Kaizen concept in the internal value chain as the central link of the entire chain. The idea is to stimulate the company management to think about the costs, position they take in the structure of price cost and their influence on forming the sales price since it is very important to produce right product for the consumer, of desired quality and functionality but along with as low production costs as possible. It is therefore needed to construct the right design of a product and provide its production at the shortest possible time along with as low costs as possible which will impact the efficiency of the entire value chain.

The tandem chain extension aldol reaction used for synthesis of ketomethylene tripeptidomimetics targeting hPEPT1

DEFF Research Database (Denmark)

Thorn, Karina; Nielsen, Carsten Uhd; Jakobsen, Palle

2011-01-01

The rationale for targeting the human di-/tripeptide transporter hPEPT1 for oral drug delivery has been well established by several drug and prodrug cases. The aim of this study was to synthesize novel ketomethylene modified tripeptidomimetics and to investigate their binding affinity for hPEPT1....

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

Science.gov (United States)

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Capture reactions at astrophysically relevant energies: extended gas target experiments and GEANT simulations

CERN Document Server

Kölle, V; Braitmayer, S E; Mohr, P J; Wilmes, S; Staudt, G; Hammer, J W; Jäger, M; Knee, H; Kunz, R; Mayer, A

1999-01-01

Several resonances of the capture reaction sup 2 sup 0 Ne(alpha, gamma) sup 2 sup 4 Mg were measured using an extended windowless gas target system. Detailed GEANT simulations were performed to derive the strength and the total width of the resonances from the measured yield curve. The crucial experimental parameters, which are mainly the density profile in the gas target and the efficiency of the gamma-ray detector, were analyzed by a comparison between the measured data and the corresponding simulation calculations. The excellent agreement between the experimental data and the simulations gives detailed insight into these parameters. (author)

Technical Aspects of Cyber Kill Chain

OpenAIRE

Yadav, Tarun; Mallari, Rao Arvind

2016-01-01

Recent trends in targeted cyber-attacks has increased the interest of research in the field of cyber security. Such attacks have massive disruptive effects on rganizations, enterprises and governments. Cyber kill chain is a model to describe cyber-attacks so as to develop incident response and analysis capabilities. Cyber kill chain in simple terms is an attack chain, the path that an intruder takes to penetrate information systems over time to execute an attack on the target. This paper broa...

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

Science.gov (United States)

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

NARCIS (Netherlands)

Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

2002-01-01

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

Pelacakan Virus Bercak Putih pada Udang Vaname (Litopenaeus vannamei di Lombok dengan Real-Time Polymerase Chain Reaction (DETECTION OF WHITE SPOT SYNDROME VIRUS IN LITOPENAEUS VANNAMEI IN LOMBOK ISLAND USING REAL-TIME POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Lulu Arafani

2016-03-01

Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .

Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide

Directory of Open Access Journals (Sweden)

Yuexia Wang

2015-09-01

Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.

Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

Science.gov (United States)

Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

2015-09-01

Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3  CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0  CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur R

2003-01-01

Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

Directory of Open Access Journals (Sweden)

Chan-Young Park

2016-10-01

Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

Science.gov (United States)

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Eduardus Bimo Aksono

2017-06-01

Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

Characterization of 22Ne implanted target by 22Ne(p,γ)23Na resonance reaction

International Nuclear Information System (INIS)

Bisoi, Abhijit; Saha Sarkar, M.; Desai, C.A.; Tribedi, L.C.; Jung, H.S.; Setoodehnia, K.; Lyons, S.; Görres, J.; Stech, Ed; Robertson, D.; Wiescher, M.

2013-01-01

Studies of nuclear reactions relevant to astrophysical scenario, often require measurement of cross section in picobarn to nano-barn range (1 barn = 10 −24 cm 2 ). So we need targets which are isotopically pure and can withstand high beam load over a long time. Even the backings used should contain no or very low concentration of impurities. Implantation technique has been found to be one of the most effective methods to produce such targets

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

Science.gov (United States)

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

Science.gov (United States)

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Study of Reaction Mechanism in the Interaction 86 MeV/A $^{12}$C with Heavy Targets

CERN Multimedia

2002-01-01

Using the thin target-thin catcher techniques and the off-line analysis of the activities induced in the irradiated foils by means of singles and coincidences spectra recorded with Ge(Li) @g-rays and Si X-rays detectors, we will measure: 1) The target fragment mass and charge distribution from the interact 2) 86 MeV/A |1|2C with silver, tin and gold. 3) The target fragment average kinetic energy. 4) The target fragment angular and differential kinetic energy distributions. These measurements should allow us to better understand the heavy ion reaction mechanisms at intermediate energy.

Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

DEFF Research Database (Denmark)

Andresen, K; Gaafar, A; El-Hassan, A M

1996-01-01

We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

Extended methods using thick-targets for nuclear reaction data of radioactive isotopes

Science.gov (United States)

Ebata, Shuichiro; Aikawa, Masayuki; Imai, Shotaro

2017-09-01

The nuclear transmutation is a technology to dispose of radioactive wastes. However, we do not have enough basic data for its developments, such as thick-target yields (TTY) and the interaction cross sections for radioactive material. We suggest two methods to estimate the TTY using inverse kinematics and to obtain the excitation function of the interaction cross sections which is named the thick-target transmission (T3) method. We deduce the energy-dependent conversion relation between the TTYs of the original system and its inverse kinematics, which can be replaced to a constant coefficient in the high energy region. Furthermore we show the usefulness of the T3 method to investigate the excitation function of the 12C + 27Al reaction in the simulation.

Ionic debye screening in dense liquid plasmas observed for Li+p, d reactions with liquid Li target

International Nuclear Information System (INIS)

Kasagi, J.; Yonemura, H.; Toriyabe, Y.; Nakagawa, A.; Sugawara, T.; Wang Tieshan

2009-01-01

Thick target yields of α particles emitted in the 6 Li(d,α) 4 He and 7 Li(p,α) 4 He reactions were measured for Li target in the solid and liquid phase. Observed reaction rates for the liquid Li are always larger than those for the solid. This suggests that the stopping power of hydrogen ion in the liquid Li metal might be smaller than in the solid. Using the empirically obtained stopping power for the liquid Li, we have deduced the screening potentials of the Li+p and Li+d reactions in both phases. The deduced screening potential for the liquid Li is about 500 eV larger than for the solid. This difference is attributed to the effect of liquefied Li + ions. It is concluded that the ionic screening is much stronger than the electronic screening in a low-temperature dense plasmas. (authors)

Ionic Debye Screening in Dense Liquid Plasmas Observed for Li+p,d Reactions with Liquid Li Target

Institute of Scientific and Technical Information of China (English)

J.Kasagi; H.Yonemura; Y.Toriyabe; A.Nakagawa; T.Sugawara; WANG Tie-shan

2009-01-01

Thick target yields of a particles emitted in the ~6Li(d,a)~4 He and ~7Li(p,a)~4 He reactions were measured for Li target in the solid and liquid phase.Observed reaction rates for the liquid Li are always larger than those for the solid.This suggests that the stopping power of hydrogen ion in the liquid Li metal might be smaller than in the solid.Using the empirically obtained stopping power for the liquid Li,we have deduced the screening potentials of the Li+p and Li+d reactions in both phases.The deduced screening potential for the liquid Li is about 500 eV larger than for the solid.This difference is attributed to the effect of liquefied Li~+ ions.It is concluded that the ionic screening is much stronger than the electronic screening in a low-temperature dense plasmas.

Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

OpenAIRE

Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

2014-01-01

Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

International Nuclear Information System (INIS)

Garrison, W.M.

1983-11-01

The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

OpenAIRE

Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.

Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

International Nuclear Information System (INIS)

Wang Sufan; Smith, Sean C.

2006-01-01

The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

Microfabricated sleeve devices for chemical reactions

Science.gov (United States)

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

Directory of Open Access Journals (Sweden)

Zhouli Wang

Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Energy Technology Data Exchange (ETDEWEB)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

2017-10-31

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

International Nuclear Information System (INIS)

Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

2007-01-01

Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

Validation of MC models of spallation reactions in thin and thick targets in the GeV range

International Nuclear Information System (INIS)

Goldenbaum, F.; Filges, D.; Neef, R.D.; Nuenighoff, K.; Paul, N.; Schaal, H.; Sterzenbach, G.; Tietze, A.; Wohlmuther, M.; Galin, J.; Letourneau, A.; Lott, B.; Peghaire, A.; Pienkowski, L.

2001-01-01

In the framework of new projects of intense spallation neutron sources an extensive experimental and theoretical effort is devoted to the precise prediction and optimization of the targets and shielding in terms of reaction cross sections, hadronic interaction lengths and usable neutrons produced in proton induced spallation reactions. Strong constraints on Monte-Carlo high energy transport codes are put by a measurement campaign of the NESSI (neutron scintillator and silicon detector) collaboration. While the predictive power of inter- and intra-nuclear cascade models coupled to evaporation codes and transport systems is excellent as far as neutron production in thick targets is concerned, there are considerable discrepancies not only between experiments and models, but also among the different codes themselves when regarding charged particle production in thin targets. In the current contribution a representative validation will be executed and possible deficiencies within the codes are elaborated. (orig.)

Contribution to the study of reactions induced by a low-energy He3 beam on a C12 target

International Nuclear Information System (INIS)

Schapira, Jean-Paul

1965-01-01

This research thesis reports the study concerning which reaction mode will better describe a nucleus in which the excitation energy is between two extremes. Due to experimental considerations and abilities, this study focuses on light target nuclei and carbon 12. The author describes experimental techniques used for angular distributions (targets, detection system), describes the experimental techniques for activation experiments (experimental set-up, targets, measurement of relative efficient cross section, result analysis, measurement of absolute efficient cross section). The author discusses the experimental results (excitation functions and angular distributions) and the interpretation of elastic scattering results (theoretical background, computation approach, analysis of elastic scattering) and the results of the C 12 (He 3 , α)C 11 reaction [fr

A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

Directory of Open Access Journals (Sweden)

Elisa Morganti

2011-01-01

Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

Science.gov (United States)

Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

2016-08-01

In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

Cross Sections for Neutron-induced Reactions on Actinide Targets Extracted from Surrogate Experiments: A Status Report

International Nuclear Information System (INIS)

Escher, J.E.; Burke, J.T.; Dietrich, F.S.; Lesher, S.R.; Scielzo, N.D.; Thompson, I.J.; Younes, W.

2009-01-01

The Surrogate nuclear reactions method, an indirect approach for determining cross sections for compound-nuclear reactions involving difficult-to-measure targets, is reviewed. Focusing on cross sections for neutron-induced reactions on actinides, we review the successes of past and present applications of the method and assess its uncertainties and limitations. The approximations used in the analyses of most experiments work reasonably well for (n,f) cross sections for neutron energies above 1-2 MeV, but lead to discrepancies for low-energy (n,f) reactions, as well as for (n,γ) applications. Correcting for some of the effects neglected in the approximate analyses leads to improved (n,f) results. We outline steps that will further improve the accuracy and reliability of the Surrogate method and extend its applicability to reactions that cannot be approached with the present implementation of the method.

Cross Sections for Neutron-induced Reactions on Actinide Targets Extracted from Surrogate Experiments: A Status Report

Energy Technology Data Exchange (ETDEWEB)

Escher, J E; Burke, J T; Dietrich, F S; Lesher, S R; Scielzo, N D; Thompson, I J; Younes, W

2009-10-01

The Surrogate nuclear reactions method, an indirect approach for determining cross sections for compound-nuclear reactions involving difficult-to-measure targets, is reviewed. Focusing on cross sections for neutron-induced reactions on actinides, we review the successes of past and present applications of the method and assess its uncertainties and limitations. The approximations used in the analyses of most experiments work reasonably well for (n,f) cross sections for neutron energies above 1-2 MeV, but lead to discrepancies for low-energy (n,f) reactions, as well as for (n,{gamma}) applications. Correcting for some of the effects neglected in the approximate analyses leads to improved (n,f) results. We outline steps that will further improve the accuracy and reliability of the Surrogate method and extend its applicability to reactions that cannot be approached with the present implementation of the method.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

Science.gov (United States)

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

Science.gov (United States)

Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

2003-06-01

Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

The Importance of IgG Avidity and the Polymerase Chain Reaction in Treating Toxoplasmosis during Pregnancy: Current Knowledge

Directory of Open Access Journals (Sweden)

João Bortoletti Filho

2013-01-01

Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.

Silicon-based sleeve devices for chemical reactions

Science.gov (United States)

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Tandem Reaction of Cationic Copolymerization and Concertedly Induced Hetero-Diels-Alder Reaction Preparing Sequence-Regulated Polymers.

Science.gov (United States)

Matsumoto, Suzuka; Kanazawa, Arihiro; Kanaoka, Shokyoku; Aoshima, Sadahito

2017-06-14

A unique tandem reaction of sequence-controlled cationic copolymerization and site-specific hetero-Diels-Alder (DA) reaction is demonstrated. In the controlled cationic copolymerization of furfural and 2-acetoxyethyl vinyl ether (AcOVE), only the furan ring adjacent to the propagating carbocation underwent the hetero-DA reaction with the aldehyde moiety of another furfural molecule. A further and equally important feature of the copolymerization is that the obtained copolymers had unprecedented 2:(1 + 1)-type alternating structures of repeating sequences of two VE and one furfural units in the main chain and one furfural unit in the side chain. The specific DA reaction is attributed to the delocalization of the positive charge to the side furan ring.

Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

Science.gov (United States)

Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

2011-06-07

Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

Directory of Open Access Journals (Sweden)

Gildo Almeida da Silva

Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

Impetigo-like tinea faciei around the nostrils caused by Arthroderma vanbreuseghemii identified using polymerase chain reaction-based sequencing of crusts.

Science.gov (United States)

Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina

2013-01-01

We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.

Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates

Directory of Open Access Journals (Sweden)

Shyamal G

2005-01-01

Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.

Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

Science.gov (United States)

Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

2018-02-01

Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

Exchange reaction between hydrogen and deuterium. I. Importance of surface reactions in the steady-state mechanism

Energy Technology Data Exchange (ETDEWEB)

Marteau, C; Gaillard-Cusin, F; James, H [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures

1978-05-01

Investigation of heterogeneous initiation process of gas phase linear chain reactions is carried out through the study of H/sub 2/-D/sub 2/ exchange reaction. Experimental data under study concern mainly the stationary rate of HD formation and the prestationary proceeding. Steady-state method accounts for the first one of these data; it allows to clearly compare the wall process part to the part played by the homogeneous chain reaction towards HD formation. Activation energy of exchange elementary step between chemisorbed hydrogen (on silica) and gaseous deuterium has been evaluated: Esub(e1)=52+-1 Kcal/mole.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

Science.gov (United States)

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

Science.gov (United States)

Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

2015-04-15

Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

New supersonic gas jet target for low energy nuclear reaction studies

Science.gov (United States)

Favela, F.; Acosta, L.; Andrade, E.; Araujo, V.; Huerta, A.; de Lucio, O. G.; Murillo, G.; Ortiz, M. E.; Policroniades, R.; Santa Rita, P.; Varela, A.; Chávez, E.

2015-12-01

A windowless supersonic gas jet target (SUGAR) has been put in operation recently in Mexico. It is the first target of its kind in the country and the region. New research opportunities become available with this facility through the study of the direct beam-gas interaction: nuclear physics and astrophysics, atomic physics, interaction of radiation with matter and other interdisciplinary applications. A general description of the apparatus and its commissioning is given here. Air, nitrogen and argon jets were produced. Proton and deuteron beams were used to measure key parameters of the system to compare with theoretical estimates. In addition, as a first study case, we present data from the 14N (d ,α )12C reaction, at center of mass energies between 1.9 and 3.0 MeV with an E-Δ E telescope detector at 35°. Excitation functions for several excited states were constructed and an 16O resonance at 22.72 MeV was confirmed.

Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

Science.gov (United States)

Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

2015-02-15

In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products.

Science.gov (United States)

Manduzio, Hélène; Ezan, Eric; Fenaille, François

2010-12-30

We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

Side-chain interactions form late and cooperatively in the binding reaction between disordered peptides and PDZ domains

DEFF Research Database (Denmark)

Haq, S Raza; Chi, Celestine N; Bach, Anders

2012-01-01

Intrinsically disordered proteins are very common and mediate numerous protein-protein and protein-DNA interactions. While it is clear that these interactions are instrumental for the life of the mammalian cell, there is a paucity of data regarding their molecular binding mechanisms. We have here...... used short peptides as a model system for intrinsically disordered proteins. Linear free-energy relationships based on rate and equilibrium constants for the binding of these peptides to ordered target proteins, PDZ domains, demonstrate that native side-chain interactions form mainly after the rate......-limiting barrier for binding, in a cooperative fashion. This finding suggests that these disordered peptides first form a weak encounter complex with non-native interactions. The data do not support the recent notion that the affinities of intrinsically disordered proteins towards their targets are generally...

Reaction dynamics of {sup 34-38}Mg projectile with carbon target using Glauber model

Energy Technology Data Exchange (ETDEWEB)

Shama, Mahesh K., E-mail: maheshphy82@gmail.com [School of Physics and Material Sciences, Thapar University Patiala-147004 (India); Department of Applied Sciences, Chandigarh Engineering College, Landran Mohali-140307 (India); Panda, R. N. [Department of Physics, ITER, Shiksha O Anusandhan University, Bhubaneswar-751030 (India); Sharma, Manoj K. [School of Physics and Material Sciences, Thapar University Patiala-147004 (India); Patra, S. K. [Institute of Physics, Sachivalaya marg Bhubneswar-751005 (India)

2015-08-28

We have studied nuclear reaction cross-sections for {sup 34-38}Mg isotopes as projectile with {sup 12}C target at projectile energy 240AMeV using Glauber model with the conjunction of densities from relativistic mean filed formalism. We found good agreement with the available experimental data. The halo status of {sup 37}Mg is also investigated.

Fission from Fe and Nb reactions with heavy targets at 50--100 MeV/nucleon

International Nuclear Information System (INIS)

Begemann-Blaich, M.; Blaich, T.; Fowler, M.M.; Wilhelmy, J.B.; Britt, H.C.; Fields, D.J.; Hansen, L.F.; Lanier, R.G.; Massoletti, D.J.; Namboodiri, M.N.; Remington, B.A.; Sangster, T.C.; Struble, G.L.; Webb, M.L.; Chan, Y.D.; Dacal, A.; Harmon, A.; Pouliot, J.; Stokstad, R.G.; Kaufman, S.; Videbaek, F.; Fraenkel, Z.

1992-01-01

Cross sections, parallel and perpendicular momentum transfers, charge loss, and velocity systematics are presented for fission following reactions of Fe and Nb projectiles at 50--100 MeV/nucleon on targets of Ta, Au, and Th. Data are compared to simple models for peripheral heavy ion collisions

Radioinitiation of Chain Branched Reactions and its Sensitization; Amorcage sous rayonnement des reactions par ramification en chaine; sensibilisation du processus; Radiatsionnoe initsiirovanie tsennykh razvetvlennykh reaktsij i ego sensibilizatsiya; Radioiniciacion de reacciones en cadena ramificadas y medios para aumentar su sensibilidad

Energy Technology Data Exchange (ETDEWEB)

Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)

1960-07-15

This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

NARCIS (Netherlands)

Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.

2007-01-01

Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

Ionothermal synthesis and crystal structures of metal phosphate chains

NARCIS (Netherlands)

Wragg, D.; Le Ouay, B.; Beale, A.M.; O'Brien, M.G.; Slawin, A.M.Z.; Warren, J.E.; Prior, T.J.; Morris, R.E.

2013-01-01

We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains

Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hamed Rezaeejam

2015-01-01

Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

International Nuclear Information System (INIS)

Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.

2013-01-01

Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

A polymerase chain reaction strategy for the diagnosis of camelpox.

Science.gov (United States)

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

OpenAIRE

Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

2004-01-01

We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

Directory of Open Access Journals (Sweden)

PD Andrade

2013-01-01

Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

Science.gov (United States)

Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

2016-08-24

A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

Directory of Open Access Journals (Sweden)

Bramastha Rosadi

2015-01-01

Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Measurement of thick target neutron yield from the reaction (p+181 Ta) with projectiles in the range of 6-20 MeV

Science.gov (United States)

Paul, Sabyasachi; Sahoo, G. S.; Tripathy, S. P.; Sharma, S. C.; Joshi, D. S.; Bandyopadhyay, T.

2018-02-01

181Ta is a commonly used backing material for many targets in nuclear reaction studies. When the target thickness is less than the range of bombarded projectiles, the interaction via Ta(p,n) reactions in the backing can be a significant source of background. In this study, the neutron spectral yields from the reaction of protons of different energies (between 6 to 20 MeV) with a thick Ta target were determined using CR-39 detectors. The results from this study can be used as a correction factor in such situations. The parameters of registered tracks in CR-39 were analysed using an in-house image analysing program autoTRAK_n and then to derive the associated dose values. The spectral yields obtained experimentally were compared with those obtained from the theoretical calculations. The neutron yield was found to increase with increase in projectile energy mainly due to the opening of reaction channels from (p, n) to (p, 3n).

The reaction {sup 48}Ca+{sup 248}Cm{yields}{sup 296}116{sup *} studied at the GSI-SHIP

Energy Technology Data Exchange (ETDEWEB)

Hofmann, S. [GSI Helmholtzzentrum fuer Schwerionenforschung, Darmstadt (Germany); Goethe-Universitaet Frankfurt, Institut fuer Physik, Frankfurt (Germany); Heinz, S.; Mann, R.; Khuyagbaatar, J.; Ackermann, D.; Barth, W.; Block, M.; Burkhard, H.G.; Comas, V.F.; Dahl, L.; Heredia, J.A.; Kindler, B.; Kojouharov, I.; Lang, R.; Lommel, B.; Muenzenberg, G.; Tinschert, K. [GSI Helmholtzzentrum fuer Schwerionenforschung, Darmstadt (Germany); Maurer, J.; Hessberger, F.P. [GSI Helmholtzzentrum fuer Schwerionenforschung, Darmstadt (Germany); Johannes Gutenberg-Universitaet, Helmholtz-Institut Mainz, Mainz (Germany); Antalic, S.; Saro, S. [Comenius University, Department of Nuclear Physics and Biophysics, Bratislava (Slovakia); Eberhardt, K.; Kratz, J.V.; Runke, J.; Thoerle-Pospiech, P.; Trautmann, N. [Johannes Gutenberg-Universitaet Mainz, Mainz (Germany); Gostic, J.; Henderson, R.A.; Kenneally, J.M.; Moody, K.J.; Nelson, S.L.; Shaughnessy, D.A.; Stoyer, M.A.; Wilk, P.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Leino, M.; Uusitalo, J. [University of Jyvaeskylae, Department of Physics, Jyvaeskylae (Finland); Nishio, K. [Japan Atomic Energy Agency, Tokai, Ibaraki (Japan); Popeko, A.G.; Yeremin, A.V. [Joint Institute for Nuclear Research, Dubna (Russian Federation)

2012-05-15

The synthesis of element 116 in fusion-evaporation reactions of a {sup 48}Ca beam with radioactive {sup 248}Cm targets was studied at the velocity filter SHIP of GSI in Darmstadt. At excitation energies of the compound nuclei of 40.9MeV, four decay chains were measured, which were assigned to the isotope {sup 292}116, and one chain, which was assigned to {sup 293}116. Measured cross-sections of (3.4{sub -1.6}{sup +2.7})pb and (0.9{sub -0.7}{sup +2.1}), respectively, and decay data of the chains agree with data measured previously at the Flerov Laboratory of Nuclear Reactions in Dubna. As a new result, one {alpha}-decay chain was measured, which terminates after four {alpha} decays by spontaneous fission. The {alpha} energies of the second-to-fourth decay are considerably higher than those measured for the {alpha} decays of {sup 289}114, {sup 285}Cn, and {sup 281}Ds and the spontaneous fission half-life is significantly longer than that of {sup 277}Hs measured in previous experiments. A possible assignment is discussed in the frame of excited quasiparticle states of nuclei populated in the decay chain from {sup 293}116. Also other possible assignments were considered and are discussed. At an excitation energy of 45.0MeV no events were observed resulting in a one-event cross-section limit of 1.6 pb. The technical aspects related with the use of radioactive target material at SHIP are described in detail. The experience gained in this experiment will serve as a basis for future experiments aiming to study still heavier elements at the velocity filter SHIP. (orig.)

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

Energy Technology Data Exchange (ETDEWEB)

Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

2011-10-25

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

International Nuclear Information System (INIS)

Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

2011-01-01

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

Directory of Open Access Journals (Sweden)

JANNOTTI-PASSOS Liana Konovaloff

2000-01-01

Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

Science.gov (United States)

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

Science.gov (United States)

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Edina Rodrigues Pires

1997-01-01

Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

Science.gov (United States)

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

Science.gov (United States)

Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

2002-01-01

Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

Solid targets for 99mTc production on medical cyclotrons

International Nuclear Information System (INIS)

Hanemaayer, V.; Buckley, K.R.; Klug, J.; Ruth, T.J.; Schaffer, P.; Zeisler, S.K.; Benard, F.; Kovacs, M.; Leon, C.

2014-01-01

Recent disruptions in the molybdenum-technetium generator supply chain prompted a review of non-reactor based production methods for both 99 Mo and 99m Tc. Small medical cyclotrons (E p ∼ 16-24 MeV) are capable of producing Curie quantities of 99m Tc from isotopically enriched 100 Mo using the 100 Mo(p,2n) 99m Tc reaction. Unlike most other metallic target materials for routine production of medical radioisotopes, molybdenum cannot be deposited by reductive electroplating from aqueous salt solutions. To overcome this issue, we developed a new process for solid molybdenum targets based on the electrophoretic deposition of fine 100 Mo powder onto a tantalum plate, followed by high temperature sintering. The targets obtained were mechanically robust and thermally stable when irradiated with protons at high power density. (author)

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

Science.gov (United States)

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

Science.gov (United States)

Helmig, Sarah; Gothelf, Kurt Vesterager

2017-10-23

Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Open-chain poly(organophosphazenes). Synthesis and properties

International Nuclear Information System (INIS)

Vinogradova, Svetlana V; Tur, Dzidra R; Vasnev, Valery A

1998-01-01

Various methods for the synthesis of open-chain poly(organophosphazenes) are considered. The mechanism of polymerisation of hexachlorocyclotriphosphazene and the basic principles of formation of poly(organophosphazene) macromolecules by polymeranalogous reactions of poly(dichloro-phosphazene) with various nucleophilic reagents are analysed from a new viewpoint. The potential of this synthetic method for targeted design of poly(organophosphazenes) of various structures is shown. The possibility of synthesising poly(organophosphazenes) by polymerisation of cyclophosphazenes is also discussed. The problem of unit non-uniformity of poly(organophosphazenes) and its influence on the properties of these polymers are considered. The properties of poly(organophosphazenes) are considered in detail and it is shown that these polymers possess unusual valuable properties, which provide opportunities for their successful practical application. The bibliography includes 276 references.

Polymerase chain reaction as a tool for developing stress protein probes

Energy Technology Data Exchange (ETDEWEB)

Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

1994-08-01

Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

Science.gov (United States)

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Sub-barrier quasifission in heavy element formation reactions with deformed actinide target nuclei

Science.gov (United States)

Hinde, D. J.; Jeung, D. Y.; Prasad, E.; Wakhle, A.; Dasgupta, M.; Evers, M.; Luong, D. H.; du Rietz, R.; Simenel, C.; Simpson, E. C.; Williams, E.

2018-02-01

Background: The formation of superheavy elements (SHEs) by fusion of two massive nuclei is severely inhibited by the competing quasifission process. Low excitation energies favor SHE survival against fusion-fission competition. In "cold" fusion with spherical target nuclei near 208Pb, SHE yields are largest at beam energies significantly below the average capture barrier. In "hot" fusion with statically deformed actinide nuclei, this is not the case. Here the elongated deformation-aligned configurations in sub-barrier capture reactions inhibits fusion (formation of a compact compound nucleus), instead favoring rapid reseparation through quasifission. Purpose: To determine the probabilities of fast and slow quasifission in reactions with prolate statically deformed actinide nuclei, through measurement and quantitative analysis of the dependence of quasifission characteristics at beam energies spanning the average capture barrier energy. Methods: The Australian National University Heavy Ion Accelerator Facility and CUBE fission spectrometer have been used to measure fission and quasifission mass and angle distributions for reactions with projectiles from C to S, bombarding Th and U target nuclei. Results: Mass-asymmetric quasifission occurring on a fast time scale, associated with collisions with the tips of the prolate actinide nuclei, shows a rapid increase in probability with increasing projectile charge, the transition being centered around projectile atomic number ZP=14 . For mass-symmetric fission events, deviations of angular anisotropies from expectations for fusion fission, indicating a component of slower quasifission, suggest a similar transition, but centered around ZP˜8 . Conclusions: Collisions with the tips of statically deformed prolate actinide nuclei show evidence for two distinct quasifission processes of different time scales. Their probabilities both increase rapidly with the projectile charge. The probability of fusion can be severely

Chain-growth cycloaddition polymerization via a catalytic alkyne [2 + 2 + 2] cyclotrimerization reaction and its application to one-shot spontaneous block copolymerization.

Science.gov (United States)

Sugiyama, Yu-ki; Kato, Rei; Sakurada, Tetsuya; Okamoto, Sentaro

2011-06-29

A cobalt-catalyzed alkyne [2 + 2 + 2] cycloaddition reaction has been applied to polymerizations yielding linear polymers via selective cross-cyclotrimerization of yne-diyne monomers, which occurs in a chain-growth manner. Additionally, through control of the alkyne reactivity of the two monomers, this method was efficiently applied to the spontaneous block copolymerization of their mixture. Here we present the proposed mechanism of the catalyst transfer process of this cycloaddition polymerization.

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Rapid and Direct VHH and Target Identification by Staphylococcal Surface Display Libraries

Directory of Open Access Journals (Sweden)

Marco Cavallari

2017-07-01

Full Text Available Unbiased and simultaneous identification of a specific antibody and its target antigen has been difficult without prior knowledge of at least one interaction partner. Immunization with complex mixtures of antigens such as whole organisms and tissue extracts including tumoral ones evokes a highly diverse immune response. During such a response, antibodies are generated against a variety of epitopes in the mixture. Here, we propose a surface display design that is suited to simultaneously identify camelid single domain antibodies and their targets. Immune libraries of single-domain antigen recognition fragments from camelid heavy chain-only antibodies (VHH were attached to the peptidoglycan of Gram-positive Staphylococcus aureus employing its endogenous housekeeping sortase enzyme. The sortase transpeptidation reaction covalently attached the VHH to the bacterial peptidoglycan. The reversible nature of the reaction allowed the recovery of the VHH from the bacterial surface and the use of the VHH in downstream applications. These staphylococcal surface display libraries were used to rapidly identify VHH as well as their targets by immunoprecipitation (IP. Our novel bacterial surface display platform was stable under harsh screening conditions, allowed fast target identification, and readily permitted the recovery of the displayed VHH for downstream analysis.

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

Science.gov (United States)

Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

2015-01-01

In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

Electrochemical detection of C-reactive protein using Copper nanoparticles and hybridization chain reaction amplifying signal.

Science.gov (United States)

Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong

2017-12-15

In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.

Spectroscopy of element 115 decay chains.

Science.gov (United States)

Rudolph, D; Forsberg, U; Golubev, P; Sarmiento, L G; Yakushev, A; Andersson, L-L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Gregorich, K E; Gross, C J; Heßberger, F P; Herzberg, R-D; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Schädel, M; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

2013-09-13

A high-resolution α, x-ray, and γ-ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum für Schwerionenforschung. Thirty correlated α-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z=115. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z>112. Comprehensive Monte Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

Potential testing of reprocessing procedures by real-time polymerase chain reaction: A multicenter study of colonoscopy devices.

Science.gov (United States)

Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo

2018-02-01

Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

CONCERNING CHAIN GROWTH SPECIFIC REACTION RATE AS A PART OF THE PROCESS OF METHYL METHACRYLATE MASS RADICAL POLYMERIZATION

Directory of Open Access Journals (Sweden)

A. A. Sultanova

2017-02-01

Full Text Available It is the chain growth specific reaction rate that was determined for the process of methyl methacrylate mass radical polymerization within the temperature range of 40–900 С in quasi-steady approximation by means of Monte Carlo method. The theoretical model of radical polymerization was developed taking the gel effect into account. Computer software was developed that enables to imitate radical polymerization process taking gel effect into account within the minimum run time. The programme was tested on asymptotic examples as well as was applied for methyl methacrylate mass radical polymerization. The programme makes it possible to calculate monomer conversion, molecular mass variation, molecular-mass distribution, etc.

Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

Science.gov (United States)

Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

2017-09-27

Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

Science.gov (United States)

Ha, Y; Fessehaie, A; Ling, K S; Wechter, W P; Keinath, A P; Walcott, R R

2009-06-01

To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae.

Spallation reactions and energy deposition in heavy target materials comparison of measurements and MC-calculations

International Nuclear Information System (INIS)

Filges, D.; Enke, M.; Galin, J.

2001-01-01

A renascence of interest for energetic proton induced production of neutrons originates recently by the inception of new projects for target stations of intense spallation neutron sources (like the planned European Spallation Source ESS), accelerator-driven nuclear reactors, nuclear waste transmutation and also the application for radioactive beams. Here we verify the predictive power of transport codes currently on the market by confronting observables and quantities of interest with an exhaustive matrix of benchmark data essentially coming from two experiments being performed at the Cooler Synchrotron COSY at Juelich. Program packages like HERMES, LCS or MCNPX master the prevision of reaction cross sections, hadronic interaction lengths, averaged neutron multiplicities and neutron multiplicity distributions in thick and thin(!) targets for a wide spectrum of incident proton energies, geometrical shapes and materials of the target. While also the observables related to the energy deposition in thick targets are in a good agreement with the model predictions, the production cross section measurements however for light charged particles on thin targets point out that problems exist within these models. (author)

Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

Directory of Open Access Journals (Sweden)

Elisabetta Di Giannatale

2010-03-01

Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

Directory of Open Access Journals (Sweden)

Lei Zhang

2014-01-01

Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

Directory of Open Access Journals (Sweden)

Shyamala G

2008-01-01

Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Production and decay of the heaviest odd-Z nuclei in the 249Bk + 48Ca reaction

International Nuclear Information System (INIS)

Oganessian, Yu Ts; Abdullin, F Sh; Dmitriev, S N; Itkis, M G; Polyakov, A N; Alexander, C; Binder, J; Boll, R A; Ezold, J; Felker, K; Grzywacz, R K; Miernik, K; Roberto, J B; Gostic, J M; Henderson, R A; Moody, K J; Hamilton, J H; Ramayya, A V; Miller, D; Ryabinin, M A

2015-01-01

The reaction of 249 Bk with 48 Ca has been investigated with an aim of synthesizing and studying the decay properties of isotopes of the new element 117. The experiments were performed at five projectile energies (in two runs, in 2009-2010 and 2012) and with a total beam dose of 48 Ca ions of about 9x10 19 The experiments yielded data on a-decay characteristics and excitation functions of the produced nuclei that establish these to be 293 117 and 294 117 – the products of the 4n- and 3n-evaporation channels, respectively. In total, we have observed 20 decay chains of Z=117 nuclides. The cross sections were measured to be 1.1 pb for the 3n and 2.4 pb for the 4n-reaction channel. The new 289 115 events, populated by α decay of 117, demonstrate the same decay properties as those observed for 115 produced in the 243 Am( 48 Ca,2n) reaction thus providing cross-bombardment evidence. In addition, a single decay of 294 118 was observed from the reaction with 249 Cf – a result of the in-growth of 249 Cf in the 249 Bk target. The observed decay chain of 294 118 is in good agreement with decay properties obtained in 2002-2005 in the experiments with the reaction 249 Cf( 48 Ca,3n) 294 118. The energies and half-lives of the odd-Z isotopes observed in the 117 decay chains together with the results obtained for lower-Z superheavy nuclei demonstrate enhancement of nuclear stability with increasing neutron number towards the predicted new magic number N=184

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

Science.gov (United States)

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

Science.gov (United States)

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Real-Time Polymerase Chain Reaction Detection of Trichomonas vaginalis from vaginal swabs: Validation of a Diagnostic Method and Preliminary Epidemiological Application

Directory of Open Access Journals (Sweden)

Carlo Mengoli

2009-06-01

Full Text Available Background Trichomonas vaginalis is the most common nonviral sexually trasmitted diseases (STDs agent. For females, the diagnostic gold standard is the culture of vaginal swab, which is labour-exacting.The direct microscopic examination of vaginal secretions is the most used approach, but its sensitivity depends on the skill of the observer. Objectives We evaluated an original real-time TaqMan-based Polymerase Chain Reaction (PCR technique.The scope of the study was to confirm the effectiveness of the molecular approach in a clinical context and to explore its relevance to an epidemiological investigation. Study Design a ß-tubulin gene was chosen as target sequence.The assay was designed to exploit the quantitative potential of the TaqMan procedure.The population sample was 583 adult females presenting at the Service from January 2005 to December 2005.Three vaginal swabs were collected from each patient, one for wet mount microscopy, one for broth culture, and one for the molecular assay. Results The prevalence was 3.3% (culture, 3.1% (microscopy, 3.8% (PCR.An excess risk was detected in the immigrant population (risk ratio by PCR = 28. Conclusions The molecular approach was the most accurate way to detect the protozoon.The real-time PCR is convenient in a busy laboratory, provided the necessary equipment is available, and it is suitable for epidemiological investigation.

Enzyme-linked immunosorbent assay and polymerase chain reaction performance using Mexican and Guatemalan discrete typing unit I strains of Trypanosoma cruzi.

Science.gov (United States)

Ballinas-Verdugo, Martha; Reyes, Pedro Antonio; Mejia-Dominguez, Ana; López, Ruth; Matta, Vivian; Monteón, Victor M

2011-12-01

Thirteen Trypanosoma cruzi isolates from different geographic regions of Mexico and Guatemala belonging to discrete typing unit (DTU) I and a reference CL-Brener (DTU VI) strain were used to perform enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). A panel of 57 Mexican serum samples of patients with chronic chagasic cardiopathy and asymptomatic infected subjects (blood bank donors) were used in this study. DNA from the above 14 T. cruzi strains were extracted and analyzed by PCR using different sets of primers designed from minicircle and satellite T. cruzi DNA. The chronic chagasic cardiopathy serum samples were easily recognized with ELISA regardless of the source of antigenic extract used, even with the CL-Brener TcVI, but positive serum samples from blood bank donors in some cases were not recognized by some Mexican antigenic extracts. On the other hand, PCR showed an excellent performance despite the set of primers used, since all Mexican and Guatemalan T. cruzi strains were correctly amplified. In general terms, Mexican, Guatemalan, and CL-Brener T. cruzi strains are equally good sources of antigen when using the ELISA test to detect Mexican serum samples. However, there are some strains with poor performance. The DTU I strains are easily detected using either kinetoplast or satellite DNA target designed from DTU VI strains.

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

Science.gov (United States)

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

Science.gov (United States)

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

Investigating the nature of palladium chain-walking in the enantioselective redox-relay Heck reaction of alkenyl alcohols.

Science.gov (United States)

Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S

2014-12-19

The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.

Synthesis of the AB ring system of clifednamide utilizing Claisen rearrangement and Diels-Alder reaction as key steps.

Science.gov (United States)

Loke, Inga; Bentzinger, Guillaume; Holz, Julia; Raja, Aruna; Bhasin, Aman; Sasse, Florenz; Köhn, Andreas; Schobert, Rainer; Laschat, Sabine

2016-01-21

In order to construct the functionalized AB ring system of clifednamide, member of the class of macrocyclic tetramic acid lactams, a synthesis was developed which utilized an Ireland-Claisen rearrangement and an intramolecular Diels-Alder reaction. Starting from di-O-isopropylidene-d-mannitol the allyl carboxylate precursor for the sigmatropic rearrangement was prepared. This rearrangement proceeded diastereoselectively only in the presence of an allyl silyl ether instead of the parent enone in the side chain, as suggested by deuteration experiments. A subsequent Diels-Alder reaction yielded the target ethyl hexahydro-1H-indene-carboxylate with high diastereoselectivity. Quantum-chemical investigations of this intramolecular Diels-Alder reaction support the proposed configuration of the final product.

Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

Science.gov (United States)

Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

2015-03-01

Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

Science.gov (United States)

Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

2016-06-01

We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes.

Science.gov (United States)

Silvar, C; Díaz, J; Merino, F

2005-12-01

ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

Science.gov (United States)

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Samira Mohammadi

2017-01-01

Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.