The application of polymerase chain reaction-denaturing gradient ...

African Journals Online (AJOL)

Jane

2011-05-23

May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

Chain reaction

International Nuclear Information System (INIS)

Balogh, Brian.

1991-01-01

Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

Science.gov (United States)

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

Directory of Open Access Journals (Sweden)

Tuti Susanti Legiastuti

2013-04-01

Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

2012-03-30

Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

Comparison of polymerase chain reaction (PCR) and loop-mediated ...

African Journals Online (AJOL)

Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

Determining Annealing Temperatures for Polymerase Chain Reaction

Science.gov (United States)

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction.

Science.gov (United States)

Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro

2018-01-01

Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.

Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

Science.gov (United States)

Qian, Yong; Wang, Chunyan; Gao, Fenglei

2015-01-15

A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Bordetella pertussis diagnosed by polymerase chain reaction

DEFF Research Database (Denmark)

Birkebaek, N H; Heron, I; Skjødt, K

1994-01-01

The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

Competing irreversible cooperative reactions on polymer chains

International Nuclear Information System (INIS)

Evans, J.W.; Hoffman, D.K.; Burgess, D.R.

1984-01-01

We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated

The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

LENUS (Irish Health Repository)

O'Connor, T M

2012-02-03

BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

Science.gov (United States)

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

A Double Polymerase Chain Reaction Method for Detecting African ...

African Journals Online (AJOL)

Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

The Ripple Effect: Citation Chain Reactions of a Nobel Prize

DEFF Research Database (Denmark)

Faber Frandsen, Tove; Nicolaisen, Jeppe

2013-01-01

This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

International Nuclear Information System (INIS)

Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie

2009-01-01

Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

Polymerase chain reaction for the detection of Mycobacterium leprae

NARCIS (Netherlands)

Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

1989-01-01

A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

Transformational leadership: a cascading chain reaction.

Science.gov (United States)

Murphy, Lorraine

2005-03-01

Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

International Nuclear Information System (INIS)

East, L.V.

1994-05-01

A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

Science.gov (United States)

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Use of competitive polymerase chain reaction to determine HIV-1 levels in response to antiviral treatments

NARCIS (Netherlands)

Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.

1993-01-01

OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

Science.gov (United States)

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Use of polymerase chain reaction for detection of Chlamydia trachomatis

DEFF Research Database (Denmark)

Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

1990-01-01

A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

KAUST Repository

Zhang, Hefeng

2015-05-01

We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

2016-05-06

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

Role of Polymerase Chain Reaction (PCR) in the detection of ...

African Journals Online (AJOL)

Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

The Production of Biodiesel and Bio-kerosene from Coconut Oil Using Microwave Assisted Reaction

Science.gov (United States)

SAIFUDDIN, N.; SITI FAZLILI, A.; KUMARAN, P.; PEI-JUA, N.; PRIATHASHINI, P.

2016-03-01

Biofuels including biodiesel, an alternative fuel, is renewable, environmentally friendly, non-toxic and low emissions. The raw material used in this work was coconut oil, which contained saturated fatty acids about 90% with high percentage of medium chain (C8-C12), especially lauric acid and myristic acid. The purpose of this research was to study the effect of power and NaOH catalyst in transesterification assisted by microwave for production of biofuels (biodiesel and bio-kerosene) derived from coconut oil. The reaction was performed with oil and methanol using mole ratio of 1:6, catalyst concentration of 0.6% with microwave power at 100W, 180W, 300W, 450W, 600W, and 850W. The reaction time was set at of 3, 5, 7, 10 and 15 min. The results showed that microwave could accelerate the transesterification process to produce biodiesel and bio-kerosene using NaOH catalyst. The highest yield of biodiesel was 97.17 %, or 99.05 % conversion at 5 min and 100W microwave power. Meanwhile, the bio-kerosene obtained was 65% after distillation.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

Science.gov (United States)

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Light-assisted, templated self-assembly of gold nanoparticle chains.

Science.gov (United States)

Jaquay, Eric; Martínez, Luis Javier; Huang, Ningfeng; Mejia, Camilo A; Sarkar, Debarghya; Povinelli, Michelle L

2014-09-10

We experimentally demonstrate the technique of light-assisted, templated self-assembly (LATS) to trap and assemble 200 nm diameter gold nanoparticles. We excite a guided-resonance mode of a photonic-crystal slab with 1.55 μm laser light to create an array of optical traps. Unlike our previous demonstration of LATS with polystyrene particles, we find that the interparticle interactions play a significant role in the resulting particle patterns. Despite a two-dimensionally periodic intensity profile in the slab, the particles form one-dimensional chains whose orientations can be controlled by the incident polarization of the light. The formation of chains can be understood in terms of a competition between the gradient force due to the excitation of the mode in the slab and optical binding between particles.

Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

KAUST Repository

Zhang, Hefeng; Qu, Chengke; He, Junpo

2015-01-01

We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b

Polymerase Chain Reaction (PCR) provides a superior tool for the ...

African Journals Online (AJOL)

Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

Science.gov (United States)

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

International Nuclear Information System (INIS)

Leone, S.R.

1988-03-01

Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

Evaluation of a new HTLV-I/II polymerase chain reaction

NARCIS (Netherlands)

Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.

1997-01-01

AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

Assistive technologies along supply chains in health care and in the social services sector.

Science.gov (United States)

Mayer, Peter; Hauer, Katharina; Schloffer, Evelyn; Leyrer, Barbara

2015-01-01

Health care systems in Austria and Slovenia are currently facing challenges due to scarce resources and demographic change which can be seen especially along the supply chains. The main objective of this paper is to present an option to improve the use of assistive technologies. An extensive literature research for the theoretic part as well as a qualitative survey for the empiric part focusing on short-term care were carried out. Results show that there is a lack of information and training on assistive technologies. As a consequence, their full potential cannot be exploited. Therefore a guideline for nursing consultations was developed. To conclude, both the literature research and the qualitative survey show that assistive technologies have high potentials to improve the supply chains in the health care and social services sector, but there is a lot of information and training on them needed.

Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials

Science.gov (United States)

Chapman, Peter Henry

Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are

Analytic study of the chain dark decomposition reaction of iodides - atomic iodine donors - in the active medium of a pulsed chemical oxygen-iodine laser: 1. Criteria for the development of the branching chain dark decomposition reaction of iodides

International Nuclear Information System (INIS)

Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N

2009-01-01

The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)

Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

NARCIS (Netherlands)

Felice, A. E.; Alshinawi, C.

1996-01-01

The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

Computer aided design, analysis and experimental investigation of membrane assisted batch reaction-separation systems

DEFF Research Database (Denmark)

Mitkowski, Piotr Tomasz; Buchaly, Carsten; Kreis, Peter

2009-01-01

Membrane assisted batch reaction operation offers an interesting option for equilibrium limited reaction systems in chemical and biochemical manufacturing by selective removal of one of the products and thereby increasing the product yield. The design of such hybrid systems need to take into acco......Membrane assisted batch reaction operation offers an interesting option for equilibrium limited reaction systems in chemical and biochemical manufacturing by selective removal of one of the products and thereby increasing the product yield. The design of such hybrid systems need to take...... into account the performance of each constituent element and the optimisation of the design must take into consideration their interdependency. In this paper use of a membrane, to assist in the synthesis of propyl-propionate is investigated through the use of a hybrid process design framework, which consists...... and separation functionalities and to design/analyse the hybrid scheme. The generated hybrid scheme has been validated through experiments involving an esterification reaction....

Real-time TaqMan polymerase chain reaction to quantify the effects ...

African Journals Online (AJOL)

TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1991-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

DEFF Research Database (Denmark)

Østergaard, Lars; Traulsen, J; Birkelund, Svend

1993-01-01

the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

The effect of composition of mixture on rate of radiation initiation of chain reactions

International Nuclear Information System (INIS)

Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.

1977-01-01

The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered

Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

DEFF Research Database (Denmark)

Kalia, A.; Jalava, T.; Nieminen, P.

1992-01-01

Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

Case Report:False-negative HIV-1 polymerase chain reaction in a ...

African Journals Online (AJOL)

Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

NARCIS (Netherlands)

de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

1993-01-01

The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

NARCIS (Netherlands)

Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

2003-01-01

Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

Directory of Open Access Journals (Sweden)

V.K. Jain

2010-02-01

Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

Understanding recovery in children following traffic-related injuries: exploring acute traumatic stress reactions, child coping, and coping assistance.

Science.gov (United States)

Marsac, Meghan L; Donlon, Katharine A; Hildenbrand, Aimee K; Winston, Flaura K; Kassam-Adams, Nancy

2014-04-01

Millions of children incur potentially traumatic physical injuries every year. Most children recover well from their injury but many go on to develop persistent traumatic stress reactions. This study aimed to describe children's coping and coping assistance (i.e., the ways in which parents and peers help children cope) strategies and to explore the association between coping and acute stress reactions following an injury. Children (N = 243) rated their acute traumatic stress reactions within one month of injury and reported on coping and coping assistance six months later. Parents completed a measure of coping assistance at the six-month assessment. Children used an average of five to six coping strategies (out of 10), with wishful thinking, social support, and distraction endorsed most frequently. Child coping was associated with parent and peer coping assistance strategies. Significant acute stress reactions were related to subsequent child use of coping strategies (distraction, social withdrawal, problem-solving, blaming others) and to child report of parent use of distraction (as a coping assistance strategy). Findings suggest that children's acute stress reactions may influence their selection of coping and coping assistance strategies. To best inform interventions, research is needed to examine change in coping behaviors and coping assistance over time, including potential bidirectional relationships between trauma reactions and coping.

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.

Science.gov (United States)

Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F

2015-01-01

Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.

Pathogen detection by the polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

1994-05-01

In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

International Nuclear Information System (INIS)

Anghaie, S.; Froelich, P.; Monkhorst, H.J.

1990-01-01

In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur

Microwave-Assisted Organic Synthesis and Transformations using Benign Reaction Media

Science.gov (United States)

The nonclassical heating technique using microwaves, termed as 'Bunsen burner of the 21st century, is rapidly becoming popular and is dramatically reducing the reaction times. The significant outcomes of microwave (MW)-assisted green chemistry endeavors are summarized that have r...

Real time monitoring of accelerated chemical reactions by ultrasonication-assisted spray ionization mass spectrometry.

Science.gov (United States)

Lin, Shu-Hsuan; Lo, Ta-Ju; Kuo, Fang-Yin; Chen, Yu-Chie

2014-01-01

Ultrasonication has been used to accelerate chemical reactions. It would be ideal if ultrasonication-assisted chemical reactions could be monitored by suitable detection tools such as mass spectrometry in real time. It would be helpful to clarify reaction intermediates/products and to have a better understanding of reaction mechanism. In this work, we developed a system for ultrasonication-assisted spray ionization mass spectrometry (UASI-MS) with an ~1.7 MHz ultrasonic transducer to monitor chemical reactions in real time. We demonstrated that simply depositing a sample solution on the MHz-based ultrasonic transducer, which was placed in front of the orifice of a mass spectrometer, the analyte signals can be readily detected by the mass spectrometer. Singly and multiply charged ions from small and large molecules, respectively, can be observed in the UASI mass spectra. Furthermore, the ultrasonic transducer used in the UASI setup accelerates the chemical reactions while being monitored via UASI-MS. The feasibility of using this approach for real-time acceleration/monitoring of chemical reactions was demonstrated. The reactions of Girard T reagent and hydroxylamine with steroids were used as the model reactions. Upon the deposition of reactant solutions on the ultrasonic transducer, the intermediate/product ions are readily generated and instantaneously monitored using MS within 1 s. Additionally, we also showed the possibility of using this reactive UASI-MS approach to assist the confirmation of trace steroids from complex urine samples by monitoring the generation of the product ions. Copyright © 2014 John Wiley & Sons, Ltd.

The chain re-action

CERN Multimedia

2009-01-01

On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

Science.gov (United States)

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

African Journals Online (AJOL)

Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

New Flame-Retardant Poly(ester-imide)s Containing Phosphine Oxide Moieties in the Main Chain: Synthesis and Properties

OpenAIRE

FAGHIHI, Khalil

2014-01-01

Six new flame-retardant poly(ester-imide)s (9a-f) with high inherent viscosity and containing phosphine oxide moieties in the main chain were synthesized from the polycondensation reaction of N,N-(3,3-diphenylphenyl phosphine oxide) bistrimellitimide diacid chloride (7) with 6 aromatic diols (8a-f) by 2 different methods:--solution and microwave-assisted polycondensation. The results showed that compared to solution polycondensation, the microwave-assisted polycondensation reaction us...

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

Science.gov (United States)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain

International Nuclear Information System (INIS)

Mattes, W.

1977-01-01

1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays

Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

National Research Council Canada - National Science Library

McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

2005-01-01

...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

Microwave-Assisted Synthesis of Nanoporous Aluminum-Based Coordination Polymers as Catalysts for Selective Sulfoxidation Reaction

Directory of Open Access Journals (Sweden)

Madhan Vinu

2017-10-01

Full Text Available A series of aluminum-based coordination polymers or metal–organic frameworks (Al–MOFs, i.e., DUT-4, DUT-5, MIL-53, NH2-MIL-53, and MIL-100, have been facile prepared by microwave (MW-assisted reactions and used as catalysts for selective sulfoxidation reactions. The MW-assisted synthesis drastically reduced the reaction time from few days to hours. The prepared MOFs have smaller and uniform particle sizes and better yield compared to conventional hydrothermal method. Furthermore, the Al–MOFs have been successfully demonstrated as catalysts in oxidation reaction of methyl phenyl sulfide with H2O2 as oxidant, even under mild conditions, with more than 95% conversion.

Chain reaction on de-halogenation of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane induced by irradiation in alcohols

International Nuclear Information System (INIS)

Nakagawa, Seiko

2015-01-01

Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction

Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

International Nuclear Information System (INIS)

Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

2005-01-01

With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

Enzyme-free electrochemical detection of microRNA-21 using immobilized hairpin probes and a target-triggered hybridization chain reaction amplification strategy

International Nuclear Information System (INIS)

Liu, Hongying; Bei, Xiaoqiong; Xia, Qiuting; Fu, Yan; Zhang, Shi; Liu, Maochuan; Fan, Kai; Zhang, Mingzhen; Yang, Yong

2016-01-01

We describe a sensitive enzyme-free bioassay for the determination of microRNA-21. It is based on a combination of target-triggered hybridization chain reaction, tagging with CdTe quantum dots (QDs), and anodic stripping voltammetry. Firstly, a thiolated capture hairpin probe SH-HP1 was immobilized on the surface of a gold electrode. HP1 unfolds in the presence of microRNA-21. If hairpin probe 2 (HP2) is present, a HP1-HP2 complex will be formed which possesses an exposed stem of HP2, and microRNA is released in parallel. The released microRNA-21 triggers a hybridization chain reaction and this leads to form an exposed DNA segment of HP2 and cycle use microRNA-21. With the aid of assistant DNA A1 and A2, the exposed DNA segment of HP2 progressed to a long double strand. The strand is rich in CdTe QDs with the help of QDs-A1. Then, the attached QDs were dissolved with HNO 3 to give dissolved Cd(II) ions. Finally, the corresponding electrochemical current response of Cd(II) is monitored by anodic stripping voltammetry and used to quantify the concentration of microRNA-21. More microRNA-21 participated in this reaction increases the number of CdTe QDs, which results in increased electrochemical current. Thus, an ultrasensitive detection of microRNA-21 is accomplished by anodic stripping voltammetry. This gene assay displays a detection limit as low as 33 aM. It can discriminate between complementary DNA sequence and single-base mismatched DNA, indicating its high specificity. (author)

Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

DEFF Research Database (Denmark)

Pattison, D I; Davies, Michael Jonathan

2001-01-01

, absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

Comparison of TiO2 photocatalysis, electrochemically assisted Fenton reaction and direct electrochemistry for simulation of phase I metabolism reactions of drugs

NARCIS (Netherlands)

Ruokolainen, Miina; Gül, Turan; Permentier, Hjalmar; Sikanen, Tiina; Kostiainen, Risto; Kotiaho, Tapio

2016-01-01

The feasibility of titanium dioxide (TiO2) photocatalysis, electrochemically assisted Fenton reaction (EC-Fenton) and direct electrochemical oxidation (EC) for simulation of phase I metabolism of drugs was studied by comparing the reaction products of buspirone, promazine, testosterone and

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

Early detection of typhoid by polymerase chain reaction

International Nuclear Information System (INIS)

Haque, A.; Qureshi, Javed A.; Ahmed, J.

1999-01-01

Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

Chain reaction. History of the atomic bomb

International Nuclear Information System (INIS)

Mania, Hubert

2010-01-01

Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

Polymerase chain reaction methods (PCR in agrobiotechnology

Directory of Open Access Journals (Sweden)

Taški-Ajduković Ksenija

2006-01-01

Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

Science.gov (United States)

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

Science.gov (United States)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

DEFF Research Database (Denmark)

Hougs, L; Barington, T; Madsen, HO

1993-01-01

reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

Science.gov (United States)

Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

2017-07-17

Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

Science.gov (United States)

Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

2011-03-01

The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

Fast and versatile microwave-assisted intramolecular Heck reaction in peptide macrocyclization using microwave energy.

Science.gov (United States)

Byk, Gerardo; Cohen-Ohana, Mirit; Raichman, Daniel

2006-01-01

We have revisited the intramolecular Heck reaction and investigated the microwave-assisted macrocyclization on preformed peptides using a model series of ring-varying peptides acryloyl-Gly-[Gly](n)-Phe(4-I)NHR; n = 0-4. The method was applied to both solution and solid supported cyclizations. We demonstrate that the intramolecular Heck reaction can be performed in peptides both in solution and solid support using a modified domestic microwave within 1 to 30 minutes in DMF under reflux with moderate yields ranging from 15 to 25% for a scale between 2-45 mg of linear precursors. The approach was applied to the synthesis of a constrained biologically relevant peptidomimetic bearing an Arg-Gly-Asp (RGD) sequence. These results make the microwave-assisted Heck reaction an attractive renovated approach for peptidomimetics. Copyright 2006 Wiley Periodicals, Inc.

Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

International Nuclear Information System (INIS)

Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

1990-01-01

Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Carlos Alberto Scrideli

2001-09-01

Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

International Nuclear Information System (INIS)

Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

2013-01-01

Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

Vortex-assisted liquid-liquid microextraction for the rapid screening of short-chain chlorinated paraffins in water.

Science.gov (United States)

Chang, Chia-Yu; Chung, Wu-Hsun; Ding, Wang-Hsien

2016-01-01

The rapid screening of trace levels of short-chain chlorinated paraffins in various aqueous samples was performed by a simple and reliable procedure based on vortex-assisted liquid-liquid microextraction combined with gas chromatography and electron capture negative ionization mass spectrometry. The optimal vortex-assisted liquid-liquid microextraction conditions for 20 mL water sample were as follows: extractant 400 μL of dichloromethane; vortex extraction time of 1 min at 2500 × g; centrifugation of 3 min at 5000 × g; and no ionic strength adjustment. Under the optimum conditions, the limit of quantitation was 0.05 μg/L. Precision, as indicated by relative standard deviations, was less than 9% for both intra- and inter-day analysis. Accuracy, expressed as the mean extraction recovery, was above 91%. The vortex-assisted liquid-liquid microextraction with gas chromatography and electron capture negative ionization mass spectrometry method was successfully applied to quantitatively extract short-chain chlorinated paraffins from samples of river water and the effluent of a wastewater treatment plant, and the concentrations ranged from 0.8 to 1.6 μg/L. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

NARCIS (Netherlands)

Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

1999-01-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

OpenAIRE

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-01-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

Directory of Open Access Journals (Sweden)

Norbert Haider

1998-01-01

Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.

Kinetics of subdiffusion-assisted reactions: non-Markovian stochastic Liouville equation approach

International Nuclear Information System (INIS)

Shushin, A I

2005-01-01

Anomalous specific features of the kinetics of subdiffusion-assisted bimolecular reactions (time-dependence, dependence on parameters of systems, etc) are analysed in detail with the use of the non-Markovian stochastic Liouville equation (SLE), which has been recently derived within the continuous-time random-walk (CTRW) approach. In the CTRW approach, subdiffusive motion of particles is modelled by jumps whose onset probability distribution function is of a long-tailed form. The non-Markovian SLE allows for rigorous describing of some peculiarities of these reactions; for example, very slow long-time behaviour of the kinetics, non-analytical dependence of the reaction rate on the reactivity of particles, strong manifestation of fluctuation kinetics showing itself in very slowly decreasing behaviour of the kinetics at very long times, etc

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

Science.gov (United States)

Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

2005-01-01

AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

Directory of Open Access Journals (Sweden)

Wen-Pin Chou

2017-02-01

Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

OpenAIRE

Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

1993-01-01

Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

Magnetic field assisted Fenton reactions for the enhanced degradation of methyl blue

Institute of Scientific and Technical Information of China (English)

Xiao Long Hao; Lu Yi Zou; Guang Sheng Zhang; Yi Bo Zhang

2009-01-01

Magnetic field was tentatively introduced into Fenton reactions system for the degradation and discoloration of methyl blue as the represent of organic chemical dye, which was a bio-refractory organic pollutant in industry wastewater. It was found that under optimal Fenton reaction conditions, with the assistant of magnetic field in Fenton reactions, the degradation rate of methyl blue, the decomposition rate of H2O2 and the conversion rate of Fe2+ were accelerated, the extent of them would be improved by the increase of magnetic field intensity. Meanwhile, the mineralization of methyl blue (CODcr) was improved by over 10% with magnetic fiold.

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

Science.gov (United States)

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

Science.gov (United States)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Reaction of oxygen with the respiratory chain in cells and tissues.

Science.gov (United States)

Chance, B

1965-09-01

This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate

Typing of Ochrobactrum anthropi clinical isolates using automated repetitive extragenic palindromic-polymerase chain reaction DNA fingerprinting and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry.

Science.gov (United States)

Quirino, Angela; Pulcrano, Giovanna; Rametti, Linda; Puccio, Rossana; Marascio, Nadia; Catania, Maria Rosaria; Matera, Giovanni; Liberto, Maria Carla; Focà, Alfredo

2014-03-22

Ochrobactrum anthropi (O. anthropi), is a non-fermenting gram-negative bacillus usually found in the environment. Nevertheless, during the past decade it has been identified as pathogenic to immunocompromised patients. In this study, we assessed the usefulness of the automated repetitive extragenic palindromic-polymerase chain reaction (rep-PCR-based DiversiLab™ system, bioMèrieux, France) and of matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF MS) for typing of twentythree O. anthropi clinical isolates that we found over a four-months period (from April 2011 to August 2011) in bacteriemic patients admitted in the same operative unit of our hospital. Pulsed-field gel electrophoresis (PFGE), commonly accepted as the gold standard technique for typing, was also used. Analysis was carried out using the Pearson correlation coefficient to determine the distance matrice and the unweighted pair group method with arithmetic mean (UPGMA) to generate dendogram. Rep-PCR analysis identified four different patterns: three that clustered together with 97% or more pattern similarity, and one whose members showed < 95% pattern similarity. Interestingly, strains isolated later (from 11/06/2011 to 24/08/2011) displayed a pattern with 99% similarity. MALDI-TOF MS evaluation clustered the twentythree strains of O. anthropi into a single group containing four distinct subgroups, each comprising the majority of strains clustering below 5 distance levels, indicating a high similarity between the isolates. Our results indicate that these isolates are clonally-related and the methods used afforded a valuable contribution to the epidemiology, prevention and control of the infections caused by this pathogen.

Label-assisted mass spectrometry for the acceleration of reaction discovery and optimization

Science.gov (United States)

Cabrera-Pardo, Jaime R.; Chai, David I.; Liu, Song; Mrksich, Milan; Kozmin, Sergey A.

2013-05-01

The identification of new reactions expands our knowledge of chemical reactivity and enables new synthetic applications. Accelerating the pace of this discovery process remains challenging. We describe a highly effective and simple platform for screening a large number of potential chemical reactions in order to discover and optimize previously unknown catalytic transformations, thereby revealing new chemical reactivity. Our strategy is based on labelling one of the reactants with a polyaromatic chemical tag, which selectively undergoes a photoionization/desorption process upon laser irradiation, without the assistance of an external matrix, and enables rapid mass spectrometric detection of any products originating from such labelled reactants in complex reaction mixtures without any chromatographic separation. This method was successfully used for high-throughput discovery and subsequent optimization of two previously unknown benzannulation reactions.

Liquid-assisted grinding and ion pairing regulates percentage conversion and diastereoselectivity of the Wittig reaction under mechanochemical conditions.

Science.gov (United States)

Denlinger, Kendra Leahy; Ortiz-Trankina, Lianna; Carr, Preston; Benson, Kingsley; Waddell, Daniel C; Mack, James

2018-01-01

Mechanochemistry is maturing as a discipline and continuing to grow, so it is important to continue understanding the rules governing the system. In a mechanochemical reaction, the reactants are added into a vessel along with one or more grinding balls and the vessel is shaken at high speeds to facilitate a chemical reaction. The dielectric constant of the solvent used in liquid-assisted grinding (LAG) and properly chosen counter-ion pairing increases the percentage conversion of stilbenes in a mechanochemical Wittig reaction. Utilizing stepwise addition/evaporation of ethanol in liquid-assisted grinding also allows for the tuning of the diastereoselectivity in the Wittig reaction.

Theory and applications of the polymerase chain reaction.

Science.gov (United States)

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Honcharova S.Y.

2015-08-01

Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

Microwave-Assisted Synthesis of 5-Phenyl-2-Hydroxyacetophenone Derivatives by a Green Suzuki Coupling Reaction

Science.gov (United States)

Soares, Pedro; Fernandes, Carlos; Chavarria, Daniel; Borges, Fernanda

2015-01-01

In recent years, the use of boron-containing reagents in palladium-assisted C-C coupling reactions (the Suzuki reaction) has gained prominence due to the vast array of reagents commercially available. Consequently, the generation of carbon-carbon bonds, namely of functionalized biphenyl systems, is at present considered the backbone of organic…

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

OpenAIRE

Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

2014-01-01

Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

Science.gov (United States)

Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

2015-06-01

Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of medium-chain triacylglycerols on Maillard reaction in bread baking.

Science.gov (United States)

Toyosaki, Toshiyuki

2018-06-01

To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Markov chain aggregation and its applications to combinatorial reaction networks.

Science.gov (United States)

Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

2014-09-01

We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

OpenAIRE

Campbell, J; Lowe, J; Walz, S; Ezzell, J

1993-01-01

We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942

Energy Technology Data Exchange (ETDEWEB)

Eklund, S [International Atomic Energy Agency, Vienna (Austria)

1962-12-02

On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

OpenAIRE

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-01-01

Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

Energy Technology Data Exchange (ETDEWEB)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

Science.gov (United States)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

DEFF Research Database (Denmark)

Abdulmawjood, A.; Bulte, M.; Roth, S.

2004-01-01

A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

Science.gov (United States)

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

OpenAIRE

Harmey, Judith H.; Harmey, Matthew A.

1993-01-01

We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

International Nuclear Information System (INIS)

Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

2000-01-01

A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Decolourization of methyl orange using iron- immobilize MKSF in UV assisted Fenton-like reaction

Science.gov (United States)

Abdullah, N. H.; Zubir, N. A.; Hassan, H.

2017-09-01

In this work, montmorillonite KSF clay was used to immobilize iron species as a potential heterogeneous UV assisted Fenton-like reaction. Iron-immobilized MKSF (Fe-MKSF) was synthesized via hydrothermal method in an autoclave. Fe-MKSF was tested on methyl orange (MO) removal by adsorption (5%) and hydrogen peroxide (H2O2) activation (63%) and these prominent margins proved Fe-MKSF performance was attributed by UV assisted Fenton-like reaction. Fe-MKSF show superior performance with 63% color removal within 180 mins reaction in comparison to iron oxide and pristine MKSF. The Fe-MKSF increased in the surface area from 91.1 to 101.9 m2/g and pore volume from 0.13 to 0.45 cm3/g compared to pristine MKSF. The SEM images of Fe-MKSF show iron aggregates indicating successful immobilizing process and the elemental weight percent of iron which increase from 6.12% to 55.38% in Fe-MKSF. These findings prove Fe-MKSF as a promising alternative catalyst in dye contaminated wastewater treatment.

Spread and epidemiology of Clostridium difficile polymerase chain reaction ribotype 027/toxinotype III in The Netherlands

NARCIS (Netherlands)

Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.

2007-01-01

After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and

A Review of the Wood Pellet Value Chain, Modern Value/Supply Chain Management Approaches, and Value/Supply Chain Models

OpenAIRE

Hughes, Natalie M.; Shahi, Chander; Pulkki, Reino

2014-01-01

We reviewed 153 peer-reviewed sources to provide identification of modern supply chain management techniques and exploration of supply chain modeling, to offer decision support to managers. Ultimately, the review is intended to assist member-companies of supply chains, mainly producers, improve their current management approaches, by directing them to studies that may be suitable for direct application to their supply chains and value chains for improved efficiency and profitability. We found...

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

Directory of Open Access Journals (Sweden)

Šošo Vladislava M.

2014-01-01

Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

Science.gov (United States)

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

DEFF Research Database (Denmark)

Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

2013-01-01

Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

Science.gov (United States)

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

CHAINS-PC, Decay Chain Atomic Densities

International Nuclear Information System (INIS)

1994-01-01

1 - Description of program or function: CHAINS computes the atom density of members of a single radioactive decay chain. The linearity of the Bateman equations allows tracing of interconnecting chains by manually accumulating results from separate calculations of single chains. Re-entrant loops can be treated as extensions of a single chain. Losses from the chain are also tallied. 2 - Method of solution: The Bateman equations are solved analytically using double-precision arithmetic. Poles are avoided by small alterations of the loss terms. Multigroup fluxes, cross sections, and self-shielding factors entered as input are used to compute the effective specific reaction rates. The atom densities are computed at any specified times. 3 - Restrictions on the complexity of the problem: Maxima of 100 energy groups, 100 time values, 50 members in a chain

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078

NARCIS (Netherlands)

Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.

2008-01-01

Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to

Polymerase chain reaction: A molecular diagnostic tool in periodontology

Science.gov (United States)

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

Directory of Open Access Journals (Sweden)

Kordo B. A. Saeed

2013-11-01

Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

Determination of the number of radicals in the initial chain reactions by mathematical methods

Directory of Open Access Journals (Sweden)

Pejović Branko B.

2009-01-01

Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

Science.gov (United States)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Microwave-assisted intramolecular dehydrogenative Diels-Alder reactions for the synthesis of functionalized naphthalenes/solvatochromic dyes.

Science.gov (United States)

Kocsis, Laura S; Benedetti, Erica; Brummond, Kay M

2013-04-01

Functionalized naphthalenes have applications in a variety of research fields ranging from the synthesis of natural or biologically active molecules to the preparation of new organic dyes. Although numerous strategies have been reported to access naphthalene scaffolds, many procedures still present limitations in terms of incorporating functionality, which in turn narrows the range of available substrates. The development of versatile methods for direct access to substituted naphthalenes is therefore highly desirable. The Diels-Alder (DA) cycloaddition reaction is a powerful and attractive method for the formation of saturated and unsaturated ring systems from readily available starting materials. A new microwave-assisted intramolecular dehydrogenative DA reaction of styrenyl derivatives described herein generates a variety of functionalized cyclopenta[b]naphthalenes that could not be prepared using existing synthetic methods. When compared to conventional heating, microwave irradiation accelerates reaction rates, enhances yields, and limits the formation of undesired byproducts. The utility of this protocol is further demonstrated by the conversion of a DA cycloadduct into a novel solvatochromic fluorescent dye via a Buchwald-Hartwig palladium-catalyzed cross-coupling reaction. Fluorescence spectroscopy, as an informative and sensitive analytical technique, plays a key role in research fields including environmental science, medicine, pharmacology, and cellular biology. Access to a variety of new organic fluorophores provided by the microwave-assisted dehydrogenative DA reaction allows for further advancement in these fields.

Supply chain reaction

International Nuclear Information System (INIS)

Snieckus, Darius

2000-01-01

'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2015-12-01

Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

Science.gov (United States)

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

International Nuclear Information System (INIS)

Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian

2012-01-01

Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Mohammad Rubayet Hasan

2014-01-01

Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

Reaction time for processing visual stimulus in a computer-assisted rehabilitation environment.

Science.gov (United States)

Sanchez, Yerly; Pinzon, David; Zheng, Bin

2017-10-01

To examine the reaction time when human subjects process information presented in the visual channel under both a direct vision and a virtual rehabilitation environment when walking was performed. Visual stimulus included eight math problems displayed on the peripheral vision to seven healthy human subjects in a virtual rehabilitation training (computer-assisted rehabilitation environment (CAREN)) and a direct vision environment. Subjects were required to verbally report the results of these math calculations in a short period of time. Reaction time measured by Tobii Eye tracker and calculation accuracy were recorded and compared between the direct vision and virtual rehabilitation environment. Performance outcomes measured for both groups included reaction time, reading time, answering time and the verbal answer score. A significant difference between the groups was only found for the reaction time (p = .004). Participants had more difficulty recognizing the first equation of the virtual environment. Participants reaction time was faster in the direct vision environment. This reaction time delay should be kept in mind when designing skill training scenarios in virtual environments. This was a pilot project to a series of studies assessing cognition ability of stroke patients who are undertaking a rehabilitation program with a virtual training environment. Implications for rehabilitation Eye tracking is a reliable tool that can be employed in rehabilitation virtual environments. Reaction time changes between direct vision and virtual environment.

Multiscale Reaction-Diffusion Algorithms: PDE-Assisted Brownian Dynamics

KAUST Repository

Franz, Benjamin

2013-06-19

Two algorithms that combine Brownian dynami cs (BD) simulations with mean-field partial differential equations (PDEs) are presented. This PDE-assisted Brownian dynamics (PBD) methodology provides exact particle tracking data in parts of the domain, whilst making use of a mean-field reaction-diffusion PDE description elsewhere. The first PBD algorithm couples BD simulations with PDEs by randomly creating new particles close to the interface, which partitions the domain, and by reincorporating particles into the continuum PDE-description when they cross the interface. The second PBD algorithm introduces an overlap region, where both descriptions exist in parallel. It is shown that the overlap region is required to accurately compute variances using PBD simulations. Advantages of both PBD approaches are discussed and illustrative numerical examples are presented. © 2013 Society for Industrial and Applied Mathematics.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

Energy Technology Data Exchange (ETDEWEB)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe [Key Laboratory for Green Chemical Technology of Ministry of Education, R& D Center for Petrochemical Technology, Tianjin University, Tianjin 300072 (China); Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China); Wen, Guobin [Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China); Zhang, Minhua, E-mail: mhzhang@tju.edu.cn [Key Laboratory for Green Chemical Technology of Ministry of Education, R& D Center for Petrochemical Technology, Tianjin University, Tianjin 300072 (China); Collaborative Innovation Center of Chemical Science and Engineering (Tianjin), Tianjin 300072 (China)

2017-08-01

Highlights: • Calculations based on the first-principle density functional theory were carried out to study ethanol formation from syngas on Cu-Co surfaces. • The most controversial reactions in ethanol formation from syngas were researched: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions (CHx + HCO → CHxCHO (x = 1–3))). • Four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) were built to investigate the synergy of the Cu and Co components. • The PDOS of 4d orbitals and d-band center analysis of surface Cu and Co atoms of all surfaces were studied to reveal correlation between electronic property and catalytic performance. - Abstract: Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CH{sub x} + HCO → CH{sub x}CHO (x = 1–3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between

Efficient and 'green' microwave-assisted synthesis of haloalkylphosphonates via the Michaelis-Arbuzov reaction

Czech Academy of Sciences Publication Activity Database

Jansa, Petr; Holý, Antonín; Dračínský, Martin; Baszczyňski, Ondřej; Česnek, Michal; Janeba, Zlatko

2011-01-01

Roč. 13, č. 4 (2011), s. 882-888 ISSN 1463-9262 R&D Projects: GA AV ČR KJB400550903; GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : microwave-assisted synthesis * haloalkylphosphonates * Michaelis-Arbuzov reaction Subject RIV: CC - Organic Chemistry Impact factor: 6.320, year: 2011

Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

International Nuclear Information System (INIS)

Leone, S.R.

1990-01-01

Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

Directory of Open Access Journals (Sweden)

Людмила Мар’янівна Іщенко

2016-11-01

Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

Highly sensitive antibody-aptamer sensor for vascular endothelial growth factor based on hybridization chain reaction and pH meter/indicator.

Science.gov (United States)

Xu, Huifeng; Kou, Fangxia; Ye, Hongzhi; Wang, Zongwen; Huang, Suixin; Liu, Xianxiang; Zhu, Xi; Lin, Zhenyu; Chen, Guonan

2017-12-01

Vascular endothelial growth factor (VEGF) is a crucial signaling protein for the tumor growth and metastasis, which is also acted as the biomarkers for various diseases. In this research, we fabricate an aptamer-antibody sensor for point-of-care test of VEGF. Firstly, target VEGF is captured by antibody immobilized on the microplate, and then binds with aptamer to form the sandwich structure. Next, with the assist of glucose oxidase (GOx)-functionalized ssDNAs, hybridization chain reaction occurs using the aptamer as the primer. Thus, GOx are greatly gathered on the microplate, which catalyzes the oxidization of glucose, leading to the pH change. As a result, the detect limit at a signal-to-noise was estimated to be 0.5pg/mL of target by pH meter, and 1.6pg/mL of VEGF was able to be distinguished by naked eyes. Meanwhile, this method has been used assay VEGF in the serum with the satisfactory results. Copyright © 2017. Published by Elsevier B.V.

Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

DEFF Research Database (Denmark)

Blair, D.; Waycott, M.; Byrne, L.

2006-01-01

This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

LENUS (Irish Health Repository)

Drew, Richard J

2012-03-01

Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

Reaction-assisted diffusion bonding of TiAl alloy to steel

Energy Technology Data Exchange (ETDEWEB)

Simões, S., E-mail: ssimoes@fe.up.pt [CEMUC, Department of Metallurgical and Materials Engineering, University of Porto, R. Dr. Roberto Frias, 4200-465 Porto (Portugal); Viana, F. [CEMUC, Department of Metallurgical and Materials Engineering, University of Porto, R. Dr. Roberto Frias, 4200-465 Porto (Portugal); Ramos, A.S.; Vieira, M.T. [CEMUC, Department of Mechanical Engineering, University of Coimbra, R. Luís Reis Santos, 3030-788 Coimbra (Portugal); Vieira, M.F. [CEMUC, Department of Metallurgical and Materials Engineering, University of Porto, R. Dr. Roberto Frias, 4200-465 Porto (Portugal)

2016-03-01

The dissimilar joining of TiAl to AISI 310 stainless steel by a reaction-assisted diffusion bonding process, using Ni/Al nanolayers as an interlayer, was investigated in the present work. The Ni and Al alternated nanolayers were deposited by d.c. magnetron sputtering onto the base materials, with a bilayer thickness of 14 nm. Joining experiments were performed at 800 °C for 60 min with compressive stress of 25 and 50 MPa. The effectiveness of the interlayer on the bonding process was assessed by microstructural characterization of the interface and by mechanical tests. Diffusion bonded joints were characterized by scanning electron microscopy (SEM), electron backscatter diffraction (EBSD), transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM), scanning transmission electron microscopy (STEM) and analyzed by energy dispersive X-ray spectroscopy (EDS) in SEM and TEM and Fast Fourier Transform (FFT). The thickness of the interface region, together with its microstructural and mechanical characteristics, is affected by the use of Ni/Al multilayers; which promote joints with lower hardness values, closer to the values of the base materials, and exhibit higher shear strength. - Highlights: • Dissimilar joining by a reaction-assisted diffusion bonding were studied. • Ni/Al nanolayers allows join TiAl to steel in less demanding processing conditions. • The microstructural and mechanical characterization of the joints were investigated. • The fracture occurring in the TiAl base material attests to the sound joining. • Shear strength value decreases for joints with base materials without nanolayers.

The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

International Nuclear Information System (INIS)

Sun Jiazhen

2003-01-01

Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Development of the polymerase chain reaction for diagnosis of chancroid.

Science.gov (United States)

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)

2010-03-15

With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

International Nuclear Information System (INIS)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

2017-01-01

Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

Energy Technology Data Exchange (ETDEWEB)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn

2017-05-31

Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the

Simple model of inhibition of chain-branching combustion processes

Science.gov (United States)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

NARCIS (Netherlands)

Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

An electrochemical impedance biosensor for Hg2+ detection based on DNA hydrogel by coupling with DNAzyme-assisted target recycling and hybridization chain reaction.

Science.gov (United States)

Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying

2017-12-15

In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction

OpenAIRE

Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.

2016-01-01

This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

NARCIS (Netherlands)

Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

Science.gov (United States)

Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

2016-01-19

This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

International Nuclear Information System (INIS)

Schowalter, D.B.; Sommer, S.S.

1989-01-01

By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Sefrita Tri Utami

2014-01-01

Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

DEFF Research Database (Denmark)

Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

2015-01-01

BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

International Nuclear Information System (INIS)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.

1998-01-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

Energy Technology Data Exchange (ETDEWEB)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences

1998-07-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

Science.gov (United States)

Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

2010-04-01

To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

Integrated supply chain risk management

Directory of Open Access Journals (Sweden)

Riaan Bredell

2007-11-01

Full Text Available Integrated supply chain risk management (ISCRM has become indispensable to the theory and practice of supply chain management. The economic and political realities of the modern world require not only a different approach to supply chain management, but also bold steps to secure supply chain performance and sustainable wealth creation. Integrated supply chain risk management provides supply chain organisations with a level of insight into their supply chains yet to be achieved. If correctly applied, this process may optimise management decision-making and assist in the protection and enhancement of shareholder value.

Green synthesis of tetrahydrobenzo[b]Pyrans by microwave assisted multi-component one-pot reactions in PEG-400.

Science.gov (United States)

Feng, Chun; Wang, Qiuyan; Lu, Cuifen; Yang, Guichun; Chen, Zuxing

2012-01-01

Polyethylene glycol is found to be a nontoxic and recyclable reaction medium for the microwave-assisted, multi-component one-pot reactions of aromatic aldehydes with ethyl-2-cyanoacetate and 1,3-cyclohexanedione or 5,5- dimethyl-1,3-cyclohexanedione in the presence of piperidine. This environmentally friendly microwave protocol offers ease of operation and enables recyclability of reaction medium and synthesis of a variety of substituted tetrahydrobenzo[b]pyran derivatives. It is an efficient, promising, and green synthetic strategy to construct tetrahydrobenzo[b]pyran skeleton.

Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

Science.gov (United States)

Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

2017-05-01

All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens

Enhanced photocatalytic degradation of methylene blue by ZnO-reduced graphene oxide composite synthesized via microwave-assisted reaction

Energy Technology Data Exchange (ETDEWEB)

Lv Tian [Engineering Research Center for Nanophotonics and Advanced Instrument, Ministry of Education, Department of Physics, East China Normal University, Shanghai, 200062 (China); Pan Likun, E-mail: lkpan@phy.ecnu.edu.cn [Engineering Research Center for Nanophotonics and Advanced Instrument, Ministry of Education, Department of Physics, East China Normal University, Shanghai, 200062 (China); Liu Xinjuan; Lu Ting; Zhu Guang; Sun Zhuo [Engineering Research Center for Nanophotonics and Advanced Instrument, Ministry of Education, Department of Physics, East China Normal University, Shanghai, 200062 (China)

2011-10-13

Highlights: > ZnO-reduced graphene oxide composite is synthesized via microwave assisted reaction. > The method allows a facile, safe and rapid reaction in aqueous media. > A high dye degradation efficiency is achieved under UV light irradiation. - Abstract: A quick and facile microwave-assisted reaction is used to synthesize ZnO-reduced graphene oxide (RGO) hybrid composites by reducing graphite oxide dispersion with zinc nitrate using a microwave synthesis system. Their photocatalytic performance in degradation of methylene blue is investigated and the results show that the RGO plays an important role in the enhancement of photocatalytic performance and the ZnO-RGO composite with 1.1 wt. % RGO achieves a maximum degradation efficiency of 88% in a neutral solution under UV light irradiation for 260 min as compared with pure ZnO (68%) due to the increased light absorption, the reduced charge recombination with the introduction of RGO.

Supply Chain Management In Construction Revealed

OpenAIRE

Dr. Ghaith Al-Werikat

2017-01-01

The construction supply chain plays a major role in the construction market competition. Construction supply chain management assists enterprises by helping to improve competitiveness increase profits and have more control over the different factors and variables within the project. This paper discusses the construction supply chain characteristics challenges and problems supply chains encounter and the benefits of an integrated supply chain in the construction sector.

Halalan Toyyiban Supply Chain The New Insights in Sustainable Supply Chain Management

OpenAIRE

Omar, Emi Normalina; Jaafar, Harlina Suzana; Osman, Muhamad Rahimi; Nasruddin, Faisol

2013-01-01

Purpose: In today’s highly competitive world scenario, in order for logistics and supply chain firms to be successful, resilient and sustainable, halalan-toyyiban supply chain could be the new insight in assisting the firm. Hence, the purpose of this study is to provide a practical definition for developing an effective supply chain through halalan toyyiban processes and comparing the similarities and differences of the halal term. Design/methodology/approach: The analysis is develo...

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

Science.gov (United States)

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Toshiaki Higashi

2012-04-01

Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

Evidence of simian retrovirus type D by polymerase chain reaction.

Science.gov (United States)

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Energy Considerations for Plasma-Assisted N-Fixation Reactions

Directory of Open Access Journals (Sweden)

Aikaterini Anastasopoulou

2014-09-01

Full Text Available In a time of increasing concerns about the immense energy consumption and poor environmental performance of contemporary processes in the chemical industry, there is great need to develop novel sustainable technologies that enhance energy efficiency. There is abundant chemical literature on process innovations (laboratory-scale around the plasma reactor itself, which, naturally, is the essential part to be intensified to achieve a satisfactory process. In essence, a plasma process needs attention beyond reaction engineering towards the process integration side and also with strong electrical engineering focus. In this mini-review, we have detailed our future focus on the process and energy intensification of plasma-based N-fixation. Three focal points are mainly stressed throughout the review: (I the integration of renewable energy; (II the power supply system of plasma reactors and (III process design of industrial plasma-assisted nitrogen fixation. These different enabling strategies will be set in a holistic and synergetic picture so as to improve process performance.

Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.

OpenAIRE

Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E

1992-01-01

Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

Directory of Open Access Journals (Sweden)

Jennifer A. Scoble

2013-10-01

Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

Science.gov (United States)

Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

2013-01-01

Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

Supply Chain Management In Construction Revealed

Directory of Open Access Journals (Sweden)

Dr. Ghaith Al-Werikat

2017-03-01

Full Text Available The construction supply chain plays a major role in the construction market competition. Construction supply chain management assists enterprises by helping to improve competitiveness increase profits and have more control over the different factors and variables within the project. This paper discusses the construction supply chain characteristics challenges and problems supply chains encounter and the benefits of an integrated supply chain in the construction sector.

Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

Directory of Open Access Journals (Sweden)

Carla Bertechini Faria

2012-03-01

Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

Transactions at a Northeastern Supermarket Chain: Differences by Supplemental Nutrition Assistance Program Use.

Science.gov (United States)

Franckle, Rebecca L; Moran, Alyssa; Hou, Tao; Blue, Dan; Greene, Julie; Thorndike, Anne N; Polacsek, Michele; Rimm, Eric B

2017-10-01

Although one in seven Americans receives Supplemental Nutrition Assistance Program (SNAP) benefits, little is known about how these benefits for food are spent because individual-level sales data are not publicly available. The purpose of this study is to compare transactions made with and without SNAP benefits at a large regional supermarket chain. Sales data were obtained from a large supermarket chain in the Northeastern U.S. for a period of 2 years (April 2012-April 2014). Multivariate multiple regression models were used to quantify relative differences in dollars spent on 31 predefined SNAP-eligible food categories. Analyses were completed in 2016. Transactions with SNAP benefit use included higher spending on less healthful food categories, including sugar-sweetened beverages ($1.08), red meat ($1.55), and convenience foods ($1.34), and lower spending on more healthful food categories, such as fruits (-$1.51), vegetables (-$1.35), and poultry (-$1.25) compared to transactions without SNAP benefit use. These findings provide objective data to compare purchases made with and without SNAP benefits. Next steps should be to test proposed SNAP modifications to determine whether they would have the intended effect of promoting healthier purchasing patterns among SNAP beneficiaries. Copyright © 2017 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

A Review of the Wood Pellet Value Chain, Modern Value/Supply Chain Management Approaches, and Value/Supply Chain Models

Directory of Open Access Journals (Sweden)

Natalie M. Hughes

2014-01-01

Full Text Available We reviewed 153 peer-reviewed sources to provide identification of modern supply chain management techniques and exploration of supply chain modeling, to offer decision support to managers. Ultimately, the review is intended to assist member-companies of supply chains, mainly producers, improve their current management approaches, by directing them to studies that may be suitable for direct application to their supply chains and value chains for improved efficiency and profitability. We found that information on supply chain management and modeling techniques in general is available. However, few Canadian-based published studies exist regarding a demand-driven modeling approach to value/supply chain management for wood pellet production. Only three papers were found specifically on wood pellet value chain analysis. We propose that more studies should be carried out on the value chain of wood pellet manufacturing, as well as demand-driven management and modeling approaches with improved demand forecasting methods.

Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Gusti Ayu Yuniati Kencana

2013-07-01

Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

Identifying of meat species using polymerase chain reaction (PCR)

International Nuclear Information System (INIS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-01-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

Identifying of meat species using polymerase chain reaction (PCR)

Energy Technology Data Exchange (ETDEWEB)

Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

2013-11-27

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

A primer on on-demand polymerase chain reaction technology.

Science.gov (United States)

Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

2015-10-01

Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

DEFF Research Database (Denmark)

Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

2005-01-01

Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

Quantum-memory-assisted entropic uncertainty relation in a Heisenberg XYZ chain with an inhomogeneous magnetic field

Science.gov (United States)

Wang, Dong; Huang, Aijun; Ming, Fei; Sun, Wenyang; Lu, Heping; Liu, Chengcheng; Ye, Liu

2017-06-01

The uncertainty principle provides a nontrivial bound to expose the precision for the outcome of the measurement on a pair of incompatible observables in a quantum system. Therefore, it is of essential importance for quantum precision measurement in the area of quantum information processing. Herein, we investigate quantum-memory-assisted entropic uncertainty relation (QMA-EUR) in a two-qubit Heisenberg \\boldsymbol{X}\\boldsymbol{Y}\\boldsymbol{Z} spin chain. Specifically, we observe the dynamics of QMA-EUR in a realistic model there are two correlated sites linked by a thermal entanglement in the spin chain with an inhomogeneous magnetic field. It turns out that the temperature, the external inhomogeneous magnetic field and the field inhomogeneity can lift the uncertainty of the measurement due to the reduction of the thermal entanglement, and explicitly higher temperature, stronger magnetic field or larger inhomogeneity of the field can result in inflation of the uncertainty. Besides, it is found that there exists distinct dynamical behaviors of the uncertainty for ferromagnetism \\boldsymbol{}≤ft(\\boldsymbol{J}\\boldsymbol{0}\\right) chains. Moreover, we also verify that the measuring uncertainty is dramatically anti-correlated with the purity of the bipartite spin system, the greater purity can result in the reduction of the measuring uncertainty, vice versa. Therefore, our observations might provide a better understanding of the dynamics of the entropic uncertainty in the Heisenberg spin chain, and thus shed light on quantum precision measurement in the framework of versatile systems, particularly solid states.

Sonic and microwaves assisted redox reactions of the hydrolysates of protein for the preparation of rechargeable battery

International Nuclear Information System (INIS)

Hussain, Z.; Khatak, K.; Sardar, A.

2016-01-01

Long recharging time is one of the serious limitations of batteries. One of the best solutions for quick redox reactions via the use of microwave and sound-assisted reversible redox reaction is presented in this work. A wireless charged prototype battery based on the redox reactions of hydrolyzed waste protein was designed. The effect of experimental conditions like time of charging, nature of media and strength of the acid on the voltage of this prototype battery was investigated. The experimental data was explained on the basis of the previous work on protein peptides and amino acids by various workers. (author)

Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

DEFF Research Database (Denmark)

Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

2007-01-01

Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases

Directory of Open Access Journals (Sweden)

Sharma J

2010-01-01

Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

Science.gov (United States)

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

Science.gov (United States)

Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

2010-03-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

Science.gov (United States)

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

Science.gov (United States)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

α 'agostic' assistance in Ziegler-Natta polymerization of olefins. Deuterium isotopic perturbation of stereochemistry indicating coordination of an α C-H bond in chain propagation

International Nuclear Information System (INIS)

Piers, W.E.; Bercaw, J.E.

1990-01-01

The well-defined, homogeneous Ziegler-Natta olefin polymerization systems that have been reported recently provide an unprecedented opportunity to investigate the mechanism of this important process. While a consensus appears to be developing that in all these systems the active catalysts are the 14-electron, d 0 (or d 0 f n ) metallocene alkyls, Cp 2 MR (M = lanthanide or group 3 transition metal) or [Cp 2 MR] + (M = group 4 transition metal), the mechanism for chain propagation and the geometry of the transition state for olefin insertion into the metal-carbon bond have not yet been unequivocally established. In a cleverly conceived experiment, Grubbs et al. probed for an α agostic interaction in the transition state for olefin insertion. Racemic 1-d 1 -5-hexenylchlorotitanocene was prepared and found to undergo AlCl 2 (CH 2 CH 3 )-induced cyclization to a mixture of cis- and trans-2-d 1 -cyclopentylmethyl stereoisomers. Any α agostic assistance in the insertion step is expected to favor the trans product (vide infra). Hydrolysis and 2 H NMR analysis of the resultant mixture of deuteriomethylcyclopentanes revealed a 1.00 ± 0.05 ratio of trans:cis products, arguing against an α agostic assisted insertion in their system, however. The scandium hydride, {(η 5 -C 5 Me 4 ) 2 SiMe 2 }Sc(PMe 3 )H ('OpSc(PMe 3 )H'), cleanly catalyzes the hydrocyclization of 1,5-hexadiene to methylcyclopentane. The authors have adapted this catalytic hydrocyclization reaction along the lines of the Grubbs experiment to probe for α agostic assistance with the scandium system

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

Modeling impurity-assisted chain creation in noble-metal break junctions

International Nuclear Information System (INIS)

Di Napoli, S; Thiess, A; Blügel, S; Mokrousov, Y

2012-01-01

In this work we present the generalization of the model for chain formation in break junctions, introduced by Thiess et al (2008 Nano Lett. 8 2144), to zigzag transition-metal chains with s and p impurities. We apply this extended model to study the producibility trends for noble-metal chains with impurities, often present in break junction experiments, namely, Cu, Ag and Au chains with H, C, O and N adatoms. Providing the material-specific parameters for our model from systematic full-potential linearized augmented plane-wave first-principles calculations, we find that the presence of such impurities crucially affects the binding properties of the noble-metal chains. We reveal that both the impurity-induced bond strengthening and the formation of zigzag bonds can lead to a significantly enhanced probability for chain formation in break junctions. (paper)

Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

Directory of Open Access Journals (Sweden)

Anupam Berwal

2017-01-01

Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

DEFF Research Database (Denmark)

Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager

2017-01-01

transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Stephen Duffett

2012-01-01

Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

The polymerase chain reaction and its application to clinical plastic surgery.

LENUS (Irish Health Repository)

Rea, S

2012-02-03

Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

Performance of an HF chain-reaction laser with high initiation efficiency

International Nuclear Information System (INIS)

Whittier, J.S.; Kerber, R.L.

1974-01-01

Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)

Detecting beef meatball contamination with polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hoda A.

2017-10-01

Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

Science.gov (United States)

Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

2018-05-01

Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

Directory of Open Access Journals (Sweden)

Andriani .

2013-08-01

Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

Tracing pathogens in the food chain

NARCIS (Netherlands)

Brul, S.; Fratamico, P.M.; McMeekin, T.A.

2010-01-01

Successful methods for the detection and investigation of outbreaks of foodborne disease are essential for ensuring consumer safety. Increased understanding of the transmission of pathogens in food chains will also assist efforts to safeguard public health. Tracing pathogens in the food chain

Bayesian estimation for quantification by real-time polymerase chain reaction under a branching process model of the DNA molecules amplification process

NARCIS (Netherlands)

Lalam, N.; Jacob, C.

2007-01-01

The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

Comparison of TiO2 photocatalysis, electrochemically assisted Fenton reaction and direct electrochemistry for simulation of phase I metabolism reactions of drugs.

Science.gov (United States)

Ruokolainen, Miina; Gul, Turan; Permentier, Hjalmar; Sikanen, Tiina; Kostiainen, Risto; Kotiaho, Tapio

2016-02-15

The feasibility of titanium dioxide (TiO2) photocatalysis, electrochemically assisted Fenton reaction (EC-Fenton) and direct electrochemical oxidation (EC) for simulation of phase I metabolism of drugs was studied by comparing the reaction products of buspirone, promazine, testosterone and 7-ethoxycoumarin with phase I metabolites of the same compounds produced in vitro by human liver microsomes (HLM). Reaction products were analysed by UHPLC-MS. TiO2 photocatalysis simulated the in vitro phase I metabolism in HLM more comprehensively than did EC-Fenton or EC. Even though TiO2 photocatalysis, EC-Fenton and EC do not allow comprehensive prediction of phase I metabolism, all three methods produce several important metabolites without the need for demanding purification steps to remove the biological matrix. Importantly, TiO2 photocatalysis produces aliphatic and aromatic hydroxylation products where direct EC fails. Furthermore, TiO2 photocatalysis is an extremely rapid, simple and inexpensive way to generate oxidation products in a clean matrix and the reaction can be simply initiated and quenched by switching the UV lamp on/off. Copyright © 2015 Elsevier B.V. All rights reserved.

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

Science.gov (United States)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.

Science.gov (United States)

Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen

2015-05-15

Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of solvation shells and cluster size on the reaction of aluminum clusters with water

Directory of Open Access Journals (Sweden)

Weiwei Mou

2011-12-01

Full Text Available Reaction of aluminum clusters, Aln (n = 16, 17 and 18, with liquid water is investigated using quantum molecular dynamics simulations, which show rapid production of hydrogen molecules assisted by proton transfer along a chain of hydrogen bonds (H-bonds between water molecules, i.e. Grotthuss mechanism. The simulation results provide answers to two unsolved questions: (1 What is the role of a solvation shell formed by non-reacting H-bonds surrounding the H-bond chain; and (2 whether the high size-selectivity observed in gas-phase Aln-water reaction persists in liquid phase? First, the solvation shell is found to play a crucial role in facilitating proton transfer and hence H2 production. Namely, it greatly modifies the energy barrier, generally to much lower values (< 0.1 eV. Second, we find that H2 production by Aln in liquid water does not depend strongly on the cluster size, in contrast to the existence of magic numbers in gas-phase reaction. This paper elucidates atomistic mechanisms underlying these observations.

Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

DEFF Research Database (Denmark)

Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L

2015-01-01

Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

DEFF Research Database (Denmark)

Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

2011-01-01

Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

LOCALIZATION OF HUMAN PAPILLOMAVIRUS TYPE-16 DNA USING THE POLYMERASE CHAIN-REACTION IN THE CERVIX UTERI OF WOMEN WITH CERVICAL INTRAEPITHELIAL NEOPLASIA

NARCIS (Netherlands)

Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.

1989-01-01

The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained

Designing driver assistance systems with crossmodal signals: multisensory integration rules for saccadic reaction times apply.

Directory of Open Access Journals (Sweden)

Rike Steenken

Full Text Available Modern driver assistance systems make increasing use of auditory and tactile signals in order to reduce the driver's visual information load. This entails potential crossmodal interaction effects that need to be taken into account in designing an optimal system. Here we show that saccadic reaction times to visual targets (cockpit or outside mirror, presented in a driving simulator environment and accompanied by auditory or tactile accessories, follow some well-known spatiotemporal rules of multisensory integration, usually found under confined laboratory conditions. Auditory nontargets speed up reaction time by about 80 ms. The effect tends to be maximal when the nontarget is presented 50 ms before the target and when target and nontarget are spatially coincident. The effect of a tactile nontarget (vibrating steering wheel was less pronounced and not spatially specific. It is shown that the average reaction times are well-described by the stochastic "time window of integration" model for multisensory integration developed by the authors. This two-stage model postulates that crossmodal interaction occurs only if the peripheral processes from the different sensory modalities terminate within a fixed temporal interval, and that the amount of crossmodal interaction manifests itself in an increase or decrease of second stage processing time. A qualitative test is consistent with the model prediction that the probability of interaction, but not the amount of crossmodal interaction, depends on target-nontarget onset asynchrony. A quantitative model fit yields estimates of individual participants' parameters, including the size of the time window. Some consequences for the design of driver assistance systems are discussed.

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur P

2004-01-01

Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

Energy Technology Data Exchange (ETDEWEB)

Mania, Hubert

2010-07-01

Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

Science.gov (United States)

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Pulsed laser-assisted focused electron-beam-induced etching of titanium with XeF2: enhanced reaction rate and precursor transport.

Science.gov (United States)

Noh, J H; Fowlkes, J D; Timilsina, R; Stanford, M G; Lewis, B B; Rack, P D

2015-02-25

In order to enhance the etch rate of electron-beam-induced etching, we introduce a laser-assisted focused electron-beam-induced etching (LA-FEBIE) process which is a versatile, direct write nanofabrication method that allows nanoscale patterning and editing. The results demonstrate that the titanium electron stimulated etch rate via the XeF2 precursor can be enhanced up to a factor of 6 times with an intermittent pulsed laser assist. The evolution of the etching process is correlated to in situ stage current measurements and scanning electron micrographs as a function of time. The increased etch rate is attributed to photothermally enhanced Ti-F reaction and TiF4 desorption and in some regimes enhanced XeF2 surface diffusion to the reaction zone.

Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

DEFF Research Database (Denmark)

Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard

2015-01-01

Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

Science.gov (United States)

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Kinetics of the chain uranium decay

International Nuclear Information System (INIS)

Zel'dovich, Ya.B.; Khariton, Yu.B.

1984-01-01

The development of chain reaction in uranium mass, when passing through the mass critical value, is studied. It is shown that thermal expanson is a powerful regulating factor, making the limit passing quite safe. The case of convergence of two uranium masses of precritical dimensions is considered in particular. The critical mass value is assessed and it is shown that its gradual increase above the critical value results in the reaction vibrational regime with the period inversely proportional to the square root of uranium supply rate. The role of delaying neutrons in the fission chain reaction development is pointed out

Molecular Wring Resonances in Chain Molecules

DEFF Research Database (Denmark)

Bohr, Henrik; Brunak, Søren; Bohr, Jakob

1997-01-01

It is shown that the eigenfrequency of collective twist excitations in chain molecules can be in the megahertz and gigahertz range. Accordingly, resonance states can be obtained at specific frequencies, and phenomena that involve structural properties can take place. Chain molecules can alter the...... their conformation and their ability to function, and a breaking of the chain can result. It is suggested that this phenomenon forms the basis for effects caused by the interaction of microwaves and biomolecules, e.g. microwave assisted hydrolysis of chain molecules....

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

Science.gov (United States)

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

OpenAIRE

ÖZKUL, Aykut

2002-01-01

In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

Pyridine group assisted addition of diazo-compounds to imines in the 3-CC reaction of 2-aminopyridines, aldehydes, and diazo-compounds.

Science.gov (United States)

Gulevich, Anton V; Helan, Victoria; Wink, Donald J; Gevorgyan, Vladimir

2013-02-15

A novel three-component coupling (3-CC) reaction of 2-aminoazines, aromatic aldehydes, and diazo-compounds producing polyfunctional β-amino-α-diazo-compounds has been developed. The reaction features an unprecedented heterocycle-assisted addition of a diazo-compound to an imine. The obtained diazoesters were efficiently converted into valuable heterocycles as well as β-amino acid derivatives.

Selective binding of carotenoids with a shorter conjugated chain to the LH2 antenna complex and those with a longer conjugated chain to the reaction center from Rubrivivax gelatinosus.

Science.gov (United States)

Kakitani, Yoshinori; Fujii, Ritsuko; Hayakawa, Yoshihiro; Kurahashi, Masahiro; Koyama, Yasushi; Harada, Jiro; Shimada, Keizo

2007-06-19

Rubrivivax gelatinosus having both the spheroidene and spirilloxanthin biosynthetic pathways produces carotenoids (Cars) with a variety of conjugated chains, which consist of different numbers of conjugated double bonds (n), including the C=C (m) and C=O (o) bonds. When grown under anaerobic conditions, the wild type produces Cars for which n = m = 9-13, whereas under semiaerobic conditions, it additionally produces Cars for which n = m + o = 10 + 1, 13 + 1, and 13 + 2. On the other hand, a mutant, in which the latter pathway is genetically blocked, produces only Cars for which n = 9 and 10 under anaerobic conditions and n = 9, 10, and 10 + 1 under semianaerobic conditions. Those Cars that were extracted from the LH2 complex (LH2) and the reaction center (RC), isolated from the wild-type and the mutant Rvi. gelatinosus, were analyzed by HPLC, and their structures were determined by mass spectrometry and 1H NMR spectroscopy. The selective binding of Cars to those pigment-protein complexes has been characterized as follows. (1) Cars with a shorter conjugated chain are selectively bound to LH2 whereas Cars with a longer conjugated chain to the RC. (2) Shorter chain Cars with a hydroxyl group are bound to LH2 almost exclusively. This rule holds either in the absence or in the presence of the keto group. The natural selection of shorter chain Cars by LH2 and longer chain Cars by the RC is discussed, on the basis of the results now available, in relation to the light-harvesting and photoprotective functions of Cars.

Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

Directory of Open Access Journals (Sweden)

Kosuke Nakamura

2016-06-01

Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

DEFF Research Database (Denmark)

Andresen, K; Gasim, S; Elhassan, A M

1997-01-01

We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

Detection of Mycoplasma pneumoniae by two polymerase chain reactions and role of M. pneumoniae in acute respiratory tract infections in pediatric patients

NARCIS (Netherlands)

Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H

Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI

Sleeve reaction chamber system

Science.gov (United States)

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

Directory of Open Access Journals (Sweden)

Mayara C. Lombardi

2014-12-01

Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

International Nuclear Information System (INIS)

Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

1990-01-01

The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

Pyridine Group-Assisted Addition of Diazo-Compounds to Imines in the 3-CC Reaction of 2-Aminopyridines, Aldehydes, and Diazo-Compounds

Science.gov (United States)

Gulevich, Anton V.; Helan, Victoria; Wink, Donald J.

2013-01-01

A novel three-component (3-CC) coupling reaction of 2-aminoazines, aromatic aldehydes and diazo-compounds producing polyfunctional β-amino-α-diazo-compounds has been developed. The reaction features an unprecedented heterocycle-assisted addition of a diazo-compound to an imine. The obtained diazoesters were efficiently converted into valuable heterocycles, as well as to β-amino acid derivatives. PMID:23373731

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Science.gov (United States)

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

Science.gov (United States)

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY

Directory of Open Access Journals (Sweden)

Susan Maphilindawati Noor

2014-10-01

Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.

New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction

Energy Technology Data Exchange (ETDEWEB)

Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)

1997-09-01

Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.

Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

Science.gov (United States)

Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

2016-04-01

An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

Science.gov (United States)

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

Directory of Open Access Journals (Sweden)

Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

2011-11-01

Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

Science.gov (United States)

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

NARCIS (Netherlands)

Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

2002-01-01

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

Nano-organocatalyst: magnetically retrievable ferrite-anchored glutathione for microwave-assisted Paal–Knorr reaction, aza-Michael addition, and pyrazole synthesis

KAUST Repository

Polshettiwar, Vivek; Varma, Rajender S.

2010-01-01

Postsynthetic Surface modification of magnetic nanoparticles by glutathione imparts desirable chemical functionality and enables the generation of catalytic sites on the surfaces of ensuing organocatalysts. In this article, we discuss the developments, unique activity, and high selectivity of nano-organocatalysts for microwave-assisted Paal-Knorr reaction, aza-Michael addition, and pyrazole synthesis. Their insoluble character Coupled with paramagnetic nature enables easy separation of these nano-catalysts from the reaction mixture using external magnet, which eliminates the requirement of catalyst filtration. Published by Elsevier Ltd.

Analytical definition of fission chain reaction parameters for cylindrical uranium bar and energy release evaluations for HIF hybrid targets

International Nuclear Information System (INIS)

Imshennik, V.S.

2006-01-01

Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru

Pelacakan Virus Bercak Putih pada Udang Vaname (Litopenaeus vannamei di Lombok dengan Real-Time Polymerase Chain Reaction (DETECTION OF WHITE SPOT SYNDROME VIRUS IN LITOPENAEUS VANNAMEI IN LOMBOK ISLAND USING REAL-TIME POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Lulu Arafani

2016-03-01

Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .

Chemical synthesis of magnetic Fe-B and Fe-Co-B particles and chains

International Nuclear Information System (INIS)

Fulmer, P.; Kim, J.; Manthiram, A.; Sanchez, J.M.

1999-04-01

With an objective to develop magnetic materials with high saturation magnetization for the Magnetically Assisted Chemical Separation (MACS) process the chemical synthesis of Fe-B and Fe-Co-B alloys by reducing iron and cobalt chloride solutions with potassium borohydride has been investigated systematically. The influence of the concentration of the reactants, applied magnetic field, reaction atmosphere, and method of mixing the reactants on the microstructure, particle size, composition and magnetic properties has been studied. Both M-B (M = Fe and Co) particles and elongated chains composed of nanometer size M-B particles have been obtained depending on the reaction conditions. The Fe-B samples exhibit saturation magnetization of M S of 120--190 emu/g, remanent magnetization M r of 10--22 emu/g, and coercive field H c of 400--900 Oe. A high M S value of 190 emu/g, which is close to the theoretical value of 218 emu/g for pure Fe, has been achieved particularly for samples with well-defined chain structures. Increasing the Co content in the Fe-Co-B alloys increases the boron content and thereby decreases the crystallinity and M S values although marginal increase in H c (1,250 Oe) and M r (36 emu/g) values could be made in some Fe-Co-B compositions. The chain structure with high M S may be attractive for other magnetic separation processes as well

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur R

2003-01-01

Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

Directory of Open Access Journals (Sweden)

Chan-Young Park

2016-10-01

Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

Science.gov (United States)

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Eduardus Bimo Aksono

2017-06-01

Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

Science.gov (United States)

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

Science.gov (United States)

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

DEFF Research Database (Denmark)

Andresen, K; Gaafar, A; El-Hassan, A M

1996-01-01

We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

OpenAIRE

Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

2014-01-01

Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

International Nuclear Information System (INIS)

Garrison, W.M.

1983-11-01

The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

Near-infrared responsive PbS-sensitized photovoltaic photodetectors fabricated by the spin-assisted successive ionic layer adsorption and reaction method

International Nuclear Information System (INIS)

Im, Sang Hyuk; Kim, Hi-jung; Seok, Sang Il

2011-01-01

A PbS-sensitized photovoltaic photodetector responsive to near-infrared (NIR) light was fabricated by depositing monolayered PbS nanoparticles on a mesoporous TiO 2 (mp-TiO 2 ) film via the spin-assisted successive ionic layer adsorption and reaction (SILAR) method. By adjusting the size and morphology of the PbS nanoparticles through repeated spin-assisted SILAR cycles, the PbS-sensitized photovoltaic photodetector achieved an external quantum efficiency of 9.3% at 1140 nm wavelength and could process signals up to 1 kHz.

A SEROLOGIC AND POLYMERASE CHAIN REACTION SURVEY OF EQUINE HERPESVIRUS IN BURCHELL'S ZEBRAS (EQUUS QUAGGA), HARTMANN'S MOUNTAIN ZEBRAS (EQUUS ZEBRA HARTMANNAE), AND THOMSON'S GAZELLES (EUDORCAS THOMSONII) IN A MIXED SPECIES SAVANNAH EXHIBIT.

Science.gov (United States)

Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D

2016-12-01

Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

OpenAIRE

Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.

Catalytic cracking of crude bio-oil from glycerol-assisted liquefaction of swine manure

International Nuclear Information System (INIS)

Cheng, Dan; Wang, Lijun; Shahbazi, Abolghasem; Xiu, Shuangning; Zhang, Bo

2014-01-01

Highlights: • Bio-oil from glycerol-assisted liquefaction of swine manure was cracked over zeolite. • 30-Min cracking on 5% catalyst at 400 °C yielded 46.1% bio-oil with 62.5% recovered energy. • 30-Min cracking on 5% catalyst at 400 °C removed 55.74% oxygen in the crude bio-oil. • The heating value and viscosity of the upgraded bio-oil were 41.4 MJ/kg and 3.6 cP. • Long chain acid methyl esters were cracked into alkanes, alkenes and short chain esters. - Abstract: The crude bio-oil produced from the glycerol-assisted liquefaction of swine manure which had large amount of long chain esters, was upgraded by thermal cracking over a modified zeolite catalyst. The effects of thermal cracking temperature (350–425 °C), reaction time (15–60 min) and catalyst loading (0–10 wt%) on the yield and quality of the upgraded oil were analyzed. The yield of upgraded bio-oil decreased with the increase of reaction temperature, reaction time and catalyst loading, but the viscosity, heating value and composition of the upgraded bio-oil became more desirable. Taking into the consideration both the yield and quality of the upgraded bio-oil, the optimal thermal cracking could be achieved over 5 wt% catalyst at 400 °C for 30 min. Under this condition, the yield of upgraded bio-oil was 46.14 wt% of the crude bio-oil, and 62.5% of the energy stored in the crude bio-oil was recovered. The oxygen content of the upgraded bio-oil was 15.04%, which was less than half of the original value of 33.98%. The viscosity of the upgraded bio-oil was 3.6 cP, compared with 188.9 cP for the crude bio-oil. The heating value of the upgraded bio-oil was 41.4 MJ/kg, compared with 30.54 MJ/kg for the crude bio-oil. Both the viscosity and heating value of the upgraded bio-oil were comparable to those of commercial diesel. The GC–MS analysis showed that the catalytic upgrading resulted in the increased cracking of long-chain acid methyl esters (such as hexadecanoic acid methyl ester

Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

International Nuclear Information System (INIS)

Wang Sufan; Smith, Sean C.

2006-01-01

The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

Microfabricated sleeve devices for chemical reactions

Science.gov (United States)

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

Directory of Open Access Journals (Sweden)

Zhouli Wang

Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Energy Technology Data Exchange (ETDEWEB)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

2017-10-31

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

International Nuclear Information System (INIS)

Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

2007-01-01

Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

Comparison of postoperative pain and inflammation reaction in dogs undergoing preventive laparoscopic-assisted and incisional gastropexy

OpenAIRE

HARAGUCHI, Tomoya; KIMURA, Shiho; ITOH, Harumichi; NISHIKAWA, Shimpei; HIYAMA, Masato; TANI, Kenji; ISERI, Toshie; ITOH, Yoshiki; NAKAICHI, Munekazu; TAURA, Yasuho; ITAMOTO, Kazuhito

2017-01-01

This study compared the effects of postoperative pain and inflammation reaction after preventive laparoscopic-assisted gastropexy (LAG) and incisional gastropexy (IG) in 10 clinically normal Beagles. Surgical time, incision length, visual analog scale (VAS) score, University of Melbourne Pain Scale (UMPS) score, and plasma C-reactive protein (CRP), plasma cortisol (COR), and serum interleukin-6 (IL-6) levels were evaluated. The VAS and UMPS scores and COR and IL-6 levels were recorded at 0.5,...

A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

Directory of Open Access Journals (Sweden)

Elisa Morganti

2011-01-01

Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

Science.gov (United States)

Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

2016-08-01

In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

Science.gov (United States)

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Performance analysis of Supply Chain Management with Supply Chain Operation reference model

Science.gov (United States)

Hasibuan, Abdurrozzaq; Arfah, Mahrani; Parinduri, Luthfi; Hernawati, Tri; Suliawati; Harahap, Bonar; Rahmah Sibuea, Siti; Krianto Sulaiman, Oris; purwadi, Adi

2018-04-01

This research was conducted at PT. Shamrock Manufacturing Corpora, the company is required to think creatively to implement competition strategy by producing goods/services that are more qualified, cheaper. Therefore, it is necessary to measure the performance of Supply Chain Management in order to improve the competitiveness. Therefore, the company is required to optimize its production output to meet the export quality standard. This research begins with the creation of initial dimensions based on Supply Chain Management process, ie Plan, Source, Make, Delivery, and Return with hierarchy based on Supply Chain Reference Operation that is Reliability, Responsiveness, Agility, Cost, and Asset. Key Performance Indicator identification becomes a benchmark in performance measurement whereas Snorm De Boer normalization serves to equalize Key Performance Indicator value. Analiytical Hierarchy Process is done to assist in determining priority criteria. Measurement of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora produces SC. Responsiveness (0.649) has higher weight (priority) than other alternatives. The result of performance analysis using Supply Chain Reference Operation model of Supply Chain Management performance at PT. Shamrock Manufacturing Corpora looks good because its monitoring system between 50-100 is good.

ARCHITECTURAL CONCEPTS FOR VALUE CHAINS

OpenAIRE

A.C. Janse van Rensburg

2012-01-01

ENGLISH ABSTRACT:The Porter Value Chain has been widely adopted by the business community as a mechanism to understand and comprehend complexity in business environments, with the ultimate goal of structuring the business to maximize its competitive advantage. Implementing the Value Chain is not easy: a number of organizations can testify to their failure to derive any benefits at all from this concept. To overcome this problem, an approach is presented to assist the organization in ...

Near-infrared responsive PbS-sensitized photovoltaic photodetectors fabricated by the spin-assisted successive ionic layer adsorption and reaction method

Energy Technology Data Exchange (ETDEWEB)

Im, Sang Hyuk; Kim, Hi-jung; Seok, Sang Il, E-mail: seoksi@krict.re.kr [KRICT-EPFL Global Research Laboratory, Advanced Materials Division, Korea Research Institute of Chemical Technology, 19 Sinseongno, Yuseong, Daejeon 305-600 (Korea, Republic of)

2011-09-30

A PbS-sensitized photovoltaic photodetector responsive to near-infrared (NIR) light was fabricated by depositing monolayered PbS nanoparticles on a mesoporous TiO{sub 2} (mp-TiO{sub 2}) film via the spin-assisted successive ionic layer adsorption and reaction (SILAR) method. By adjusting the size and morphology of the PbS nanoparticles through repeated spin-assisted SILAR cycles, the PbS-sensitized photovoltaic photodetector achieved an external quantum efficiency of 9.3% at 1140 nm wavelength and could process signals up to 1 kHz.

Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

Science.gov (United States)

Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

2003-06-01

Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

The Importance of IgG Avidity and the Polymerase Chain Reaction in Treating Toxoplasmosis during Pregnancy: Current Knowledge

Directory of Open Access Journals (Sweden)

João Bortoletti Filho

2013-01-01

Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.

Silicon-based sleeve devices for chemical reactions

Science.gov (United States)

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

Science.gov (United States)

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

Tandem Reaction of Cationic Copolymerization and Concertedly Induced Hetero-Diels-Alder Reaction Preparing Sequence-Regulated Polymers.

Science.gov (United States)

Matsumoto, Suzuka; Kanazawa, Arihiro; Kanaoka, Shokyoku; Aoshima, Sadahito

2017-06-14

A unique tandem reaction of sequence-controlled cationic copolymerization and site-specific hetero-Diels-Alder (DA) reaction is demonstrated. In the controlled cationic copolymerization of furfural and 2-acetoxyethyl vinyl ether (AcOVE), only the furan ring adjacent to the propagating carbocation underwent the hetero-DA reaction with the aldehyde moiety of another furfural molecule. A further and equally important feature of the copolymerization is that the obtained copolymers had unprecedented 2:(1 + 1)-type alternating structures of repeating sequences of two VE and one furfural units in the main chain and one furfural unit in the side chain. The specific DA reaction is attributed to the delocalization of the positive charge to the side furan ring.

Computer-assisted mechanistic evaluation of organic reactions

Energy Technology Data Exchange (ETDEWEB)

Gushurst, A.J.

1988-01-01

CAMEO, an interactive computer program which predicts the products of organic reactions given starting materials and conditions, has been refined and extended in the area of base-catalyzed and nucleophilic processes. The present capabilities of the program are outlined including brief discussion on the major segments in CAMEO: graphics, perception, and reaction evaluation. The implementation of general algorithms for predicting the acidities of a vast number of organic compounds to within 2 pK{sub a} units in dimethylsulfoxide and water are then described, followed by a presentation of the reactivity rules used by the program to evaluate nucleophilc reactions. Finally, a treatment of sulfur and phosphorus ylides, iminophosphoranes, and P=X-activated anions is given illuminating the various competitions available for these reagents, such as between proton transfer and addition, 1,2- and 1,4-addition, and the Peterson, Wittig, and Horner-Emmons olefination reactions.

Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

Science.gov (United States)

Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

2011-06-07

Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

Directory of Open Access Journals (Sweden)

Gildo Almeida da Silva

Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

Impetigo-like tinea faciei around the nostrils caused by Arthroderma vanbreuseghemii identified using polymerase chain reaction-based sequencing of crusts.

Science.gov (United States)

Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina

2013-01-01

We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.

Exchange reaction between hydrogen and deuterium. I. Importance of surface reactions in the steady-state mechanism

Energy Technology Data Exchange (ETDEWEB)

Marteau, C; Gaillard-Cusin, F; James, H [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures

1978-05-01

Investigation of heterogeneous initiation process of gas phase linear chain reactions is carried out through the study of H/sub 2/-D/sub 2/ exchange reaction. Experimental data under study concern mainly the stationary rate of HD formation and the prestationary proceeding. Steady-state method accounts for the first one of these data; it allows to clearly compare the wall process part to the part played by the homogeneous chain reaction towards HD formation. Activation energy of exchange elementary step between chemisorbed hydrogen (on silica) and gaseous deuterium has been evaluated: Esub(e1)=52+-1 Kcal/mole.

Charge Exchange Reaction in Dopant-Assisted Atmospheric Pressure Chemical Ionization and Atmospheric Pressure Photoionization.

Science.gov (United States)

Vaikkinen, Anu; Kauppila, Tiina J; Kostiainen, Risto

2016-08-01

The efficiencies of charge exchange reaction in dopant-assisted atmospheric pressure chemical ionization (DA-APCI) and dopant-assisted atmospheric pressure photoionization (DA-APPI) mass spectrometry (MS) were compared by flow injection analysis. Fourteen individual compounds and a commercial mixture of 16 polycyclic aromatic hydrocarbons were chosen as model analytes to cover a wide range of polarities, gas-phase ionization energies, and proton affinities. Chlorobenzene was used as the dopant, and methanol/water (80/20) as the solvent. In both techniques, analytes formed the same ions (radical cations, protonated molecules, and/or fragments). However, in DA-APCI, the relative efficiency of charge exchange versus proton transfer was lower than in DA-APPI. This is suggested to be because in DA-APCI both dopant and solvent clusters can be ionized, and the formed reagent ions can react with the analytes via competing charge exchange and proton transfer reactions. In DA-APPI, on the other hand, the main reagents are dopant-derived radical cations, which favor ionization of analytes via charge exchange. The efficiency of charge exchange in both DA-APPI and DA-APCI was shown to depend heavily on the solvent flow rate, with best efficiency seen at lowest flow rates studied (0.05 and 0.1 mL/min). Both DA-APCI and DA-APPI showed the radical cation of chlorobenzene at 0.05-0.1 mL/min flow rate, but at increasing flow rate, the abundance of chlorobenzene M(+.) decreased and reagent ion populations deriving from different gas-phase chemistry were recorded. The formation of these reagent ions explains the decreasing ionization efficiency and the differences in charge exchange between the techniques. Graphical Abstract ᅟ.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

Science.gov (United States)

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

Radioinitiation of Chain Branched Reactions and its Sensitization; Amorcage sous rayonnement des reactions par ramification en chaine; sensibilisation du processus; Radiatsionnoe initsiirovanie tsennykh razvetvlennykh reaktsij i ego sensibilizatsiya; Radioiniciacion de reacciones en cadena ramificadas y medios para aumentar su sensibilidad

Energy Technology Data Exchange (ETDEWEB)

Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)

1960-07-15

This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

NARCIS (Netherlands)

Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.

2007-01-01

Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

Ionothermal synthesis and crystal structures of metal phosphate chains

NARCIS (Netherlands)

Wragg, D.; Le Ouay, B.; Beale, A.M.; O'Brien, M.G.; Slawin, A.M.Z.; Warren, J.E.; Prior, T.J.; Morris, R.E.

2013-01-01

We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

Science.gov (United States)

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

DEFF Research Database (Denmark)

Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

2007-01-01

OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

A polymerase chain reaction strategy for the diagnosis of camelpox.

Science.gov (United States)

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

OpenAIRE

Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

2004-01-01

We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

Directory of Open Access Journals (Sweden)

PD Andrade

2013-01-01

Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

Science.gov (United States)

Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

2016-08-24

A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

Directory of Open Access Journals (Sweden)

Bramastha Rosadi

2015-01-01

Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

NARCIS (Netherlands)

Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.

1996-01-01

A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific

Reaction time for trimolecular reactions in compartment-based reaction-diffusion models

Science.gov (United States)

Li, Fei; Chen, Minghan; Erban, Radek; Cao, Yang

2018-05-01

Trimolecular reaction models are investigated in the compartment-based (lattice-based) framework for stochastic reaction-diffusion modeling. The formulae for the first collision time and the mean reaction time are derived for the case where three molecules are present in the solution under periodic boundary conditions. For the case of reflecting boundary conditions, similar formulae are obtained using a computer-assisted approach. The accuracy of these formulae is further verified through comparison with numerical results. The presented derivation is based on the first passage time analysis of Montroll [J. Math. Phys. 10, 753 (1969)]. Montroll's results for two-dimensional lattice-based random walks are adapted and applied to compartment-based models of trimolecular reactions, which are studied in one-dimensional or pseudo one-dimensional domains.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

Energy Technology Data Exchange (ETDEWEB)

Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

2011-10-25

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

International Nuclear Information System (INIS)

Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

2011-01-01

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

Directory of Open Access Journals (Sweden)

JANNOTTI-PASSOS Liana Konovaloff

2000-01-01

Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

Science.gov (United States)

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

The composite supply chain efficiency model: A case study of the Sishen-Saldanha supply chain

Directory of Open Access Journals (Sweden)

Leila L. Goedhals-Gerber

2016-01-01

Full Text Available As South Africa strives to be a major force in global markets, it is essential that South African supply chains achieve and maintain a competitive advantage. One approach to achieving this is to ensure that South African supply chains maximise their levels of efficiency. Consequently, the efficiency levels of South Africa’s supply chains must be evaluated. The objective of this article is to propose a model that can assist South African industries in becoming internationally competitive by providing them with a tool for evaluating their levels of efficiency both as individual firms and as a component in an overall supply chain. The Composite Supply Chain Efficiency Model (CSCEM was developed to measure supply chain efficiency across supply chains using variables identified as problem areas experienced by South African supply chains. The CSCEM is tested in this article using the Sishen-Saldanda iron ore supply chain as a case study. The results indicate that all three links or nodes along the Sishen-Saldanha iron ore supply chain performed well. The average efficiency of the rail leg was 97.34%, while the average efficiency of the mine and the port were 97% and 95.44%, respectively. The results also show that the CSCEM can be used by South African firms to measure their levels of supply chain efficiency. This article concludes with the benefits of the CSCEM.

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

Science.gov (United States)

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Duplex-assisted carotid artery stenting without administration of contrast medium for patients with chronic kidney disease or allergic reaction.

Science.gov (United States)

Mizowaki, Takashi; Fujita, Atsushi; Imahori, Taichiro; Uyama, Atsushi; Inoue, Satoshi; Kohta, Masaaki; Hamaguchi, Hirotoshi; Sasayama, Takashi; Hosoda, Kohkichi; Kohmura, Eiji

2016-07-01

We aimed to investigate the safety and feasibility of duplex-assisted carotid artery stenting (CAS) without administration of contrast medium for the prevention of adverse reactions. Fifteen patients (9 % of all CASs) with severe carotid stenosis (≥70 %) associated with chronic kidney disease (CKD) (stage ≥3) or allergy to contrast medium underwent duplex-assisted CAS without administration of contrast medium over 4 years. The procedural success rate and perioperative complication rates were compared between the duplex-assisted CAS (n = 15) and conventional CAS (n = 153) groups. The technical success rate was 100 % in both groups. Combined stroke or death rates during the post-procedural period did not differ significantly between the duplex-assisted CAS group (0/15, 0 %) and conventional CAS group (4/153, 2.6 %). None of the 14 patients with CKD in the duplex-assisted CAS group experienced further deterioration of renal function. The mean surface radiation dose of participants in the duplex-assisted CAS group (n = 13, 312 ± 131 mGy) was significantly lower than that of the conventional CAS group (n = 31, 1036 ± 571 mGy) (p duplex-assisted CAS group (156 ± 39.7 min) and the conventional CAS group (156 ± 37.4 min). Duplex-assisted CAS without administration of contrast medium could be an alternative option in selected patients deemed to be at high risk for renal failure from nephrotoxic contrast medium or who have an allergy to contrast medium.

Development of a multiple-marker polymerase chain reaction assay for detection of metastatic melanoma in lymph node aspirates of dogs.

Science.gov (United States)

Catchpole, Brian; Gould, Sara M; Kellett-Gregory, Lindsay M; Dobson, Jane M

2003-05-01

To develop a reverse transcriptase-polymerase chain reaction (RT-PCR) assay to detect canine melanoma-associated antigens (MAAs) and to use this technique to screen aspirates of lymph nodes (LNs) for evidence of metastatic spread of oral malignant melanoma. 7 dogs with oral malignant melanoma and 4 dogs with multicentric lymphosarcoma. We prepared cDNA from melanoma tumor biopsies and fine-needle aspirates obtained from submandibular LNs of dogs with oral malignant melanoma or multicentric lymphosarcoma. The RT-PCR assay was performed by use of tyrosinase, Melan-A, gp100, tyrosinase-related protein 2 (TRP-2), or melanoma antigen-encoding gene B (MAGE-B)-specific primers. We detected MAGE-B mRNA in canine testicular tissue but not in melanoma biopsy specimens. Tyrosinase, Melan-A, gp100, and TRP-2 mRNAs were detected in tumor biopsy specimens and in 2 of 5 LN aspirates from dogs with melanoma, suggesting metastatic spread in those 2 dogs. We did not detect MAAs in LN aspirates obtained from dogs with multicentric lymphosarcoma. Sequencing of canine Melan-A and gp100 PCR products confirmed the specificity of the assay for these genes. Clinical staging of dogs with oral malignant melanoma is useful to assist in designing appropriate treatments. However, results of histologic examination of LN biopsy specimens can be inconclusive and, in humans, can underestimate the number of patients with metastatic disease. Molecular staging of melanomas in dogs can be achieved by screening LN aspirates for MAA mRNA, and this can be performed in combination with cytologic examination to aid in detection of metastatic disease.

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Edina Rodrigues Pires

1997-01-01

Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

CATALYST-FREE REACTIONS UNDER SOLVENT-FEE CONDITIONS: MICROWAVE-ASSISTED SYNTHESIS OF HETEROCYCLIC HYDRAZONES BELOW THE MELTING POINT OF NEAT REACTANTS: JOURNAL ARTICLE

Science.gov (United States)

NRMRL-CIN-1437 Jeselnik, M., Varma*, R.S., Polanc, S., and Kocevar, M. Catalyst-free Reactions under Solvent-fee Conditions: Microwave-assisted Synthesis of Heterocyclic Hydrazones below the Melting Point of Neat Reactants. Published in: Chemical Communications 18:1716-1717 (200...

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

Science.gov (United States)

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

Science.gov (United States)

Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

2002-01-01

Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

Establishment of a nanoparticle-assisted RT-PCR assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus.

Science.gov (United States)

Zhu, Yu; Wang, Gui-Hua; Cui, Yu-Dong; Cui, Shang-Jin

2016-09-01

Porcine epidemic diarrhea virus (PEDV) can cause serious disease and even death in neonatal piglets, resulting in serious damage to the swine industry worldwide. Open reading frame 3 (ORF3) is the only accessory gene in the PEDV genome. Previous studies have indicated that PEDV vaccine strains have a partial deletion in ORF3. In this study, a nanoparticle-assisted polymerase chain reaction (nanoparticle-assisted RT-PCR) assay targeting the ORF3 of PEDV was developed to distinguish PEDV field strains from attenuated strains by using a specific pair of primers. The PCR products of field strains and attenuated strains were 264 bp and 215 bp in length, respectively. The sensitivity and specificity of this assay were also assessed. The nanoparticle-assisted RT-PCR assay was 10-100 times more sensitive than the conventional RT-PCR assay, with no cross-reactions when amplifying porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (RV), and porcine transmissible gastroenteritis virus (TGEV). The nanoparticle-assisted RT-PCR assay we describe here can be used to distinguish field strains from vaccine strains of PEDV, and it shows promise for reducing economic loss due to PEDV infection.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

Science.gov (United States)

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

Science.gov (United States)

Helmig, Sarah; Gothelf, Kurt Vesterager

2017-10-23

Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Polymerase chain reaction as a tool for developing stress protein probes

Energy Technology Data Exchange (ETDEWEB)

Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

1994-08-01

Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

Kinetics and Thermodynamics of Ultrasound-Assisted Depolymerization of κ-Carrageenan

Directory of Open Access Journals (Sweden)

Ratnawati Ratnawati

2016-03-01

Full Text Available The ultrasound-assisted depolymerization of κ-carrageenan has been studied at various temperatures and times. The κ-carrageenan with initial molecular weight of 545 kDa was dispersed in water to form a 5 g/L solution, which was then depolymerized in an ultrasound device at various temperatures and times. The viscosity of the solution was measured using Brookfield viscometer, which was then used to find the number-average molecular weight by Mark-Houwink equation. To obtain the kinetics of κ-carrageenan depolymerization, the number-average molecular weight data was treated using midpoint-chain scission kinetics model. The pre-exponential factor and activation energies for the reaction are 2.683×10-7 mol g-1 min-1 and 6.43 kJ mol-1, respectively. The limiting molecular weight varies from 160 kDa to 240 kDa, and it is linearly correlated to temperature. The results are compared to the result of thermal depolymerization by calculating the half life. It is revealed that ultrasound assisted depolymerization of κ-carrageenan is faster than thermal depolymerization at temperatures below 72.2°C. Compared to thermal depolymerization, the ultrasound-assisted process has lower values of Ea, ΔG‡, ΔH‡, and ΔS‡, which can be attributed to the ultrasonically induced breakage of non-covalent bonds in κ-carrageenan molecules. Copyright © 2016 BCREC GROUP. All rights reserved Received: 10th November 2015; Revised: 18th January 2016; Accepted: 19th January 2016 How to Cite: Ratnawati, R., Prasetyaningrum, A., Wardhani, D.H. (2016. Kinetics and Thermodynamics of Ultrasound-Assisted Depolymerization of κ-Carrageenan. Bulletin of Chemical Reaction Engineering & Catalysis, 11(1: 48-58. (doi:10.9767/bcrec.11.1.415.48-58 Permalink/DOI: http://dx.doi.org/10.9767/bcrec.11.1.415.48-58

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

Science.gov (United States)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

Preparation and tribological behavior of Cu-nanoparticle polyelectrolyte multilayers obtained by spin-assisted layer-by-layer assembly

International Nuclear Information System (INIS)

Yang Guangbin; Geng Zhengang; Ma Hongxia; Wu Zhishen; Zhang Pingyu

2009-01-01

Polyelectrolyte multilayers (PEMs) fabricated by spin-assisted layer-by-layer assembly technique were used as nanoreactors for in-situ synthesis Cu nanoparticles. Chemical reaction within the PEMs was initiated by a reaction cycle in which Cu 2+ was absorbed into the polymer-coated substrate and then reduced in NaBH 4 solutions. Repeating the above process resulted in an increase in density of the nanoparticles and further growth in the dimension of the particles initially formed. So, different Cu-nanoparticle polyelectrolyte multilayers were formed in the process. The friction and wear properties of Cu-nanoparticle PEMs formed by different reaction cycles were investigated on a microtribometer against a stainless steel ball. The PEMs reinforced with Cu nanoparticles, prepared under the best preparation conditions, possess good tribological behavior, because of the weakened adhesion between the PEMs and the substrate and decreased mobility of the polymeric chains in the presence of excessive Cu nanoparticles generated at larger reaction cycles

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

Science.gov (United States)

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

Overcoming SMEs Financing and Supply Chain Obstacles by Introducing Supply Chain Finance

Directory of Open Access Journals (Sweden)

Abbasi Waseem Ahmed

2018-05-01

Full Text Available Keeping in view the importance of small and medium enterprises (SMEs for the growth of a nation, we must also keep an eye on the challenges faced by those SMEs. There are various kinds of financing and supply chain options available for SMEs but they still face lot of hindrances. This paper would help us to understand why SMEs are important for the development of any country and how could we help the SMEs from facing challenges related to financing and supply chain. This study further highlights the key financing issues faced by SMEs and also focuses on major supply chain challenges confronted by the SMEs. This study put emphasis on the concept of supply chain finance (SCF and that how SCF could help SMEs to overcome those challenges. In addition, this paper also points out the benefits and prospects of SMEs. Even though the concept of SCF is still in developing phase but it has shown significant assistance to SMEs in order to grow further.

Microwave-Assisted Synthesis of Phenothiazine and Quinoline Derivatives

Science.gov (United States)

Găină, Luiza; Cristea, Castelia; Moldovan, Claudia; Porumb, Dan; Surducan, Emanoil; Deleanu, Călin; Mahamoud, Abdalah; Barbe, Jacques; Silberg, Ioan A.

2007-01-01

Application of a dynamic microwave power system in the chemical synthesis of some phenothiazine and quinoline derivatives is described. Heterocyclic ring formation, aromatic nucleophilic substitution and heterocyclic aldehydes/ketones condensation reactions were performed on solid support, or under solvent free reaction conditions. The microwave-assisted Duff formylation of phenothiazine was achieved. Comparison of microwave-assisted synthesis with the conventional synthetic methods demonstrates advantages related to shorter reaction times and in some cases better reaction yields.

Critical analysis: use of polymerase chain reaction to diagnose leprosy

Directory of Open Access Journals (Sweden)

Flaviane Granero Maltempe

Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Materials and Mechanisms of Photo-Assisted Chemical Reactions under Light and Dark Conditions: Can Day-Night Photocatalysis Be Achieved?

Science.gov (United States)

Sakar, M; Nguyen, Chinh-Chien; Vu, Manh-Hiep; Do, Trong-On

2018-03-09

The photoassisted catalytic reaction, conventionally known as photocatalysis, is expanding into the field of energy and environmental applications. It is widely known that the discovery of TiO 2 -assisted photochemical reactions has led to several unique applications, such as degradation of pollutants in water and air, hydrogen production through water splitting, fuel conversion, cancer treatment, antibacterial activity, self-cleaning glasses, and concrete. These multifaceted applications of this phenomenon can be enriched and expanded further if this process is equipped with more tools and functions. The term "photoassisted" catalytic reactions clearly emphasizes that photons are required to activate the catalyst; this can be transcended even into the dark if electrons are stored in the material for the later use to continue the catalytic reactions in the absence of light. This can be achieved by equipping the photocatalyst with an electron-storage material to overcome current limitations in photoassisted catalytic reactions. In this context, this article sheds lights on the materials and mechanisms of photocatalytic reactions under light and dark conditions. The manifestation of such systems could be an unparalleled technology in the near future that could influence all spheres of the catalytic sciences. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Chain-growth cycloaddition polymerization via a catalytic alkyne [2 + 2 + 2] cyclotrimerization reaction and its application to one-shot spontaneous block copolymerization.

Science.gov (United States)

Sugiyama, Yu-ki; Kato, Rei; Sakurada, Tetsuya; Okamoto, Sentaro

2011-06-29

A cobalt-catalyzed alkyne [2 + 2 + 2] cycloaddition reaction has been applied to polymerizations yielding linear polymers via selective cross-cyclotrimerization of yne-diyne monomers, which occurs in a chain-growth manner. Additionally, through control of the alkyne reactivity of the two monomers, this method was efficiently applied to the spontaneous block copolymerization of their mixture. Here we present the proposed mechanism of the catalyst transfer process of this cycloaddition polymerization.

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

Microwave assisted esterification of free fatty acid over a heterogeneous catalyst for biodiesel production

International Nuclear Information System (INIS)

Liu, Wei; Yin, Ping; Liu, Xiguang; Chen, Wen; Chen, Hou; Liu, Chunping; Qu, Rongjun; Xu, Qiang

2013-01-01

Highlights: • Microwave assisted esterification of stearic acid with ethanol was catalyzed by D418. • D418 exhibited remarkable catalytic performance for ethyl stearate formation. • It proved possible to prepare biodiesel rapidly and with good conversions by microwave heating. • The relative catalytic kinetics study has been conducted and modeled. - Abstract: Biodiesel fuel is gaining significant attention in recent years because of its environmental benefits and the growing interest in finding new resources and alternatives for conventional fuels. Biodiesel production from waste cooking oil with high free fatty acids usually requires esterification step to produce fatty acid methyl/ethyl ester. In the present work, the heterogeneous catalyst aminophosphonic acid resin D418 has been successfully utilized in the energy-efficient microwave-assisted esterification reaction of fatty acid ethyl ester (FAEE) from free fatty acid (FFA) stearic acid with short-chain alcohol ethanol. Under the reaction conditions of 9 wt% D418 and 11: 1 M ratio of ethanol to stearic acid at 353 K and atmospheric pressure, more than 90% conversion of the esterification was achieved in 7 h by microwave heating, while it took about 12 h by conventional heating. Moreover, the kinetics of this esterification reaction has been studied, and the relevant values of activation energy and pre-exponential factor were obtained

Electrochemical detection of C-reactive protein using Copper nanoparticles and hybridization chain reaction amplifying signal.

Science.gov (United States)

Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong

2017-12-15

In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.

Spectroscopy of element 115 decay chains.

Science.gov (United States)

Rudolph, D; Forsberg, U; Golubev, P; Sarmiento, L G; Yakushev, A; Andersson, L-L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Gregorich, K E; Gross, C J; Heßberger, F P; Herzberg, R-D; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Schädel, M; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N

2013-09-13

A high-resolution α, x-ray, and γ-ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum für Schwerionenforschung. Thirty correlated α-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z=115. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z>112. Comprehensive Monte Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

CONCERNING CHAIN GROWTH SPECIFIC REACTION RATE AS A PART OF THE PROCESS OF METHYL METHACRYLATE MASS RADICAL POLYMERIZATION

Directory of Open Access Journals (Sweden)

A. A. Sultanova

2017-02-01

Full Text Available It is the chain growth specific reaction rate that was determined for the process of methyl methacrylate mass radical polymerization within the temperature range of 40–900 С in quasi-steady approximation by means of Monte Carlo method. The theoretical model of radical polymerization was developed taking the gel effect into account. Computer software was developed that enables to imitate radical polymerization process taking gel effect into account within the minimum run time. The programme was tested on asymptotic examples as well as was applied for methyl methacrylate mass radical polymerization. The programme makes it possible to calculate monomer conversion, molecular mass variation, molecular-mass distribution, etc.

Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

Science.gov (United States)

Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

2017-09-27

Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

Trends and advances in food analysis by real-time polymerase chain reaction.

Science.gov (United States)

Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

2016-05-01

Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

Directory of Open Access Journals (Sweden)

Elisabetta Di Giannatale

2010-03-01

Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

Directory of Open Access Journals (Sweden)

Lei Zhang

2014-01-01

Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

Supply chain management in Forest products industry-case study for S?dra Cell Company

Institute of Scientific and Technical Information of China (English)

YAO; PAN

2016-01-01

The supply chain plays an increasing significant role in current global business operation process.It is not just considered as a crucial factor for leading the company to achieve their strategic goals,but also assisting firm’s to enhance the competitiveness in its own industry.This report choses the Swedish forest company-S?dra Cell as a case company to analysis its supply chain management advantages and disadvantages. It also states the role of supply chain management theory in assisting organization to achieve its strategic goal and marketing strategies.

Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

Directory of Open Access Journals (Sweden)

Shyamala G

2008-01-01

Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

Integrating the Department of Defense Supply Chain

Science.gov (United States)

2012-01-01

Defense for Logistics and Materiel Readiness, DoD Supply Chain Materiel Management Procedures , DoD Manual 4140.01, Volumes 1 through 11, draft as of March...this is summarized in R. Glenn Richey, Jr., Anthony S. Roath, Judith M. Whipple , and Stanley E. Fawcett, “Exploring a Governance Theory of Supply...of this report, DoD Supply Chain Materiel Management Procedures (Assistant Secretary of Defense for Logis- tics and Materiel Readiness, DoD Manual

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Will blockchain technology revolutionize excipient supply chain management?

OpenAIRE

Shireesh Apte; Nikolai Petrovsky

2016-01-01

Blockchain technology provides a major advance for excipient supply chains, assisting in the delivery of unadulterated, source, process and transit verifiable excipients (or APIs and drug products), but does not alleviate the necessity for quality audits. The adoption of blockchain technology should make the process faster and make the transactional record more robust and reliable, however other rate-limiting steps of the excipient supply chain including transit ...

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

Science.gov (United States)

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

Science.gov (United States)

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Opportunities and realities of supply chain integration

DEFF Research Database (Denmark)

van Donk, Dirk Pieter; Akkerman, Renzo; van der Vaart, Taco

2008-01-01

Purpose: The purpose of the paper is to investigate the limitations and barriers for supply chain integration that food manufacturers experience and to highlight their planning and scheduling problems. Possible ways to cope with these are offered. Methodology: The paper is theoretical/conceptual ......Purpose: The purpose of the paper is to investigate the limitations and barriers for supply chain integration that food manufacturers experience and to highlight their planning and scheduling problems. Possible ways to cope with these are offered. Methodology: The paper is theoretical...... of solutions that might assist production managers in better understanding their situation and thinking about improvements. Originality/Value of the paper: The paper introduces buyer focus, shared resources and the limitations of supply chain integration into the field of food supply chains....

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

Science.gov (United States)

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

Science.gov (United States)

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

Investigating the nature of palladium chain-walking in the enantioselective redox-relay Heck reaction of alkenyl alcohols.

Science.gov (United States)

Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S

2014-12-19

The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.

Sustainability of Hydrogen Supply Chain. Part II: Prioritizing and Classifying the Sustainability of Hydrogen Supply Chains based on the Combination of Extension Theory and AHP

DEFF Research Database (Denmark)

Ren, Jingzheng; Manzardo, Alessandro; Toniolo, Sara

2013-01-01

The purpose of this study is to develop a method for prioritizing and classifying the sustainability of hydrogen supply chains and assist decision-making for the stakeholders/decision-makers. Multiple criteria for sustainability assessment of hydrogen supply chains are considered and multiple...... decision-makers are allowed to participate in the decision-making using linguistic terms. In this study, extension theory and analytic hierarchy process are combined to rate the sustainability of hydrogen supply chains. The sustainability of hydrogen supply chains could be identified according...

A polymerase chain reaction-based methodology to detect gene doping.

Science.gov (United States)

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

Science.gov (United States)

Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

2016-06-01

We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes.

Science.gov (United States)

Silvar, C; Díaz, J; Merino, F

2005-12-01

ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

Science.gov (United States)

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Samira Mohammadi

2017-01-01

Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Computer-assisted design for scaling up systems based on DNA reaction networks.

Science.gov (United States)

Aubert, Nathanaël; Mosca, Clément; Fujii, Teruo; Hagiya, Masami; Rondelez, Yannick

2014-04-06

In the past few years, there have been many exciting advances in the field of molecular programming, reaching a point where implementation of non-trivial systems, such as neural networks or switchable bistable networks, is a reality. Such systems require nonlinearity, be it through signal amplification, digitalization or the generation of autonomous dynamics such as oscillations. The biochemistry of DNA systems provides such mechanisms, but assembling them in a constructive manner is still a difficult and sometimes counterintuitive process. Moreover, realistic prediction of the actual evolution of concentrations over time requires a number of side reactions, such as leaks, cross-talks or competitive interactions, to be taken into account. In this case, the design of a system targeting a given function takes much trial and error before the correct architecture can be found. To speed up this process, we have created DNA Artificial Circuits Computer-Assisted Design (DACCAD), a computer-assisted design software that supports the construction of systems for the DNA toolbox. DACCAD is ultimately aimed to design actual in vitro implementations, which is made possible by building on the experimental knowledge available on the DNA toolbox. We illustrate its effectiveness by designing various systems, from Montagne et al.'s Oligator or Padirac et al.'s bistable system to new and complex networks, including a two-bit counter or a frequency divider as well as an example of very large system encoding the game Mastermind. In the process, we highlight a variety of behaviours, such as enzymatic saturation and load effect, which would be hard to handle or even predict with a simpler model. We also show that those mechanisms, while generally seen as detrimental, can be used in a positive way, as functional part of a design. Additionally, the number of parameters included in these simulations can be large, especially in the case of complex systems. For this reason, we included the

Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

Science.gov (United States)

Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

2002-12-01

The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

TaqMan real-time polymerase chain reaction for detection of Ophidiomyces ophiodiicola, the fungus associated with snake fungal disease.

Science.gov (United States)

Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S

2015-04-15

Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.

A Bullet-Block Experiment that Explains the Chain Fountain

Science.gov (United States)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Hydroxyl-radical-induced oxidation of cyclic dipeptides: Reactions of free peptide radicals and their peroxyl radicals

International Nuclear Information System (INIS)

Mieden, O.J.

1989-01-01

In the course of this study investigations were carried out into the reactions of hydroxyl radicals and hydrogen atoms with cyclic dipeptides as well as the subsequent reactions of peptide radicals and their peroxyl radicals in aqueous solution. The radiolysis products formed in the absence and presence of oxygen or transient metal complexes were characterized and determined on a quantitative basis. The linking of information from product analyses to the kinetic data for transient species obtained by time-resolving UV/VIS and conductivity measurements (pulse radiolysis) as well as computer-assisted simulations of individual events during the reaction permitted an evaluation of the mechanisms underlying the various processes and an identification of interim products with short life-times, which did or did not belong to the group of radicals. Through the characterization of key reactions of radicals and peroxyl radicals of this substance class a major advance has been made towards a better understanding of the role of radicals in the peptide compound and the mechanisms involved in indirect radiation effects on long-chain peptides and proteins. (orig.) [de

Reaction-transport simulations of non-oxidative methane conversion with continuous hydrogen removal: Homogeneous-heterogeneous methane reaction pathways

International Nuclear Information System (INIS)

Li, Lin; Borry, Richard W.; Iglesia, Enrique

2000-01-01

Detailed kinetic-transport models were used to explore thermodynamic and kinetic barriers in the non-oxidative conversion of CH4 via homogeneous and homogeneous-heterogeneous pathways and the effects of continuous hydrogen removal and of catalytic sites on attainable yields of useful C2-C10 products. The homogeneous kinetic model combines separately developed models for low-conversion pyrolysis and for chain growth to form large aromatics and carbon. The H2 formed in the reaction decreases CH4 pyrolysis rates and equilibrium conversions and it favors the formation of lighter products. The removal of H2 along tubular reactors with permeable walls increases reaction rates and equilibrium CH4 conversions. C2-C10 yields reach values greater than 90 percent at intermediate values of dimensionless transport rates (delta=1-10), defined as the ratio hydrogen transport and methane conversion rates. Homogeneous reactions require impractical residence times, even with H2 removal, because of slow initiation and chain transfer rates. The introduction of heterogeneous chain initiation pathways using surface sites that form methyl radicals eliminates the induction period without influencing the homogeneous product distribution. Methane conversion, however, occurs predominately in the chain transfer regime, within which individual transfer steps and the formation of C2 intermediates become limited by thermodynamic constraints. Catalytic sites alone cannot overcome these constraints. Catalytic membrane reactors with continuous H2 removal remove these thermodynamic obstacles and decrease the required residence time. Reaction rates become limited by homogeneous reactions of C2 products to form C6+ aromatics. Higher delta values lead to subsequent conversion of the desired C2-C10 products to larger polynuclear aromatics. We conclude that catalytic methane pyrolysis at the low temperatures required for restricted chain growth and the elimination of thermodynamics constraints via

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

Science.gov (United States)

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1991-01-01

A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

Science.gov (United States)

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

Science.gov (United States)

Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

2018-01-18

Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

Directory of Open Access Journals (Sweden)

Nikhil Moorchung

2011-01-01

Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

Science.gov (United States)

Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

2012-07-28

To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

Microwave-Assisted Synthesis of Phenothiazine and Qinoline Derivatives

Directory of Open Access Journals (Sweden)

Ioan A. Silberg

2007-02-01

Full Text Available Application of a dynamic microwave power system in the chemical synthesis ofsome phenothiazine and quinoline derivatives is described. Heterocyclic ring formation,aromatic nucleophilic substitution and heterocyclic aldehydes/ketones condensationreactions were performed on solid support, or under solvent free reaction conditions. Themicrowave-assisted Duff formylation of phenothiazine was achieved. Comparison ofmicrowave-assisted synthesis with the conventional synthetic methods demonstratesadvantages related to shorter reaction times and in some cases better reaction yields.

Brucella contamination in raw milk by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Mohammad Khalili

2016-10-01

Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

Science.gov (United States)

Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

2017-05-01

The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

Multi-template polymerase chain reaction.

Science.gov (United States)

Kalle, Elena; Kubista, Mikael; Rensing, Christopher

2014-12-01

PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

Exchange reaction between hydrogen and deuterium. II - Proposal for an heterogeneous initiation mechanism of gaseous phase reactions

Energy Technology Data Exchange (ETDEWEB)

Marteau, Chantal; Gaillard-Cusin, Francoise; James, Henri [Centre National de la Recherche Scientifique, 45 - Orleans-la-Source (France). Centre de Recherches sur la Chimie de Combustion et des Hautes Temperatures

1978-05-01

Investigation of experimental data related to evolution period exhibited by H/sub 2/-D/sub 2/ exchange process requires to take into account the variation against time of every atomic species -adsorbed or not- implied in the reaction mechanism. The formation of first chain carriers involves: - chemisorption of either gaseous reactant on the surface active centres (..sigma..), e.g.: ..sigma.. + 1/2 H/sub 2/ reversible ..sigma..H; - consecutive generation of atomic species through hetero-homogeneous transfer between chemisorbed species (..sigma..H) and gaseous molecules: ..sigma..H+H/sub 2/..--> sigma..+H/sub 2/+H/sup 0/, ..sigma..H+D/sub 2/..--> sigma..+HD+D/sup 0/. Therefore, it can be shown that the heterogeneous initiation process of a gas phase reaction identifies to a chain linear mechanism. Such an heterogeneous sequence conditions the further proceeding of the homogeneous chain reaction; both evolutions being kinematically connected. Rate constant of hydrogen adsorption on silica glass: ksub(a1) approximately 10/sup 14/ exp(-47/RT)Isup(0,5).molesup(-0,5).S/sup -1/ has been evaluated.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

Science.gov (United States)

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

Science.gov (United States)

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

Directory of Open Access Journals (Sweden)

Ching Giap Tan

2014-09-01

Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

Directory of Open Access Journals (Sweden)

Daniela Camargos Costa

2014-02-01

Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

Chain radiation-chemical oxidation of aromatic amines in polyvinylchloride films

International Nuclear Information System (INIS)

Kolninov, O.V.; Lisovskaya, I.A.; Milinchuk, V.K.

1983-01-01

Radiation-chemical oxidation of tetramethyldiaminediphenylmethane in polyvinylchloride (PVC) and polystyrene (PS) films was investigated in the presence of CBr 4 at 300 K. Radiation yields (G) of 70 and 1 were obtained for an oxidized amine form (Am + ) in PVC and PS, resp. High yields of Am + in PVC matrix indicate the chain character of an oxidation reaction. Triplet states, which form exciplexes with CBr 4 were established to participate in oxidation reactions. The kinetic scheme suggested for the chain radiation oxidation of Am takes into account energy transfer, formation and degradation of the excited states of molecules resulting in the initiation and propagation of the chain on the account of active particles. (author)

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction.

Science.gov (United States)

Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza

2016-01-01

This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Ionothermal synthesis and crystal structures of metal phosphate chains

International Nuclear Information System (INIS)

Wragg, David S.; Le Ouay, Benjamin; Beale, Andrew M.; O'Brien, Matthew G.; Slawin, Alexandra M.Z.; Warren, John E.; Prior, Timothy J.; Morris, Russell E.

2010-01-01

We have prepared isostructural aluminium and gallium phosphate chains by ionothermal reactions in 1-ethyl-3-methylimidazolium bromide and 1-ethylpyridinium bromide under a variety of conditions. The chains can be prepared as pure phases or along with three dimensional framework phases. The chains are favoured at shorter heating times and the crystallinity can be improved by addition of transition metal acetates and amines which are not included in the final structure. The chain can be prepared with or without the presence of hydrofluoric acid. - Graphical abstract: Chain structures prepared from ionic liquid solvents under a wide variety of synthesis conditions.

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

Directory of Open Access Journals (Sweden)

Dominique Rainteau

Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

Spectroscopy of element 115 decay chains

Energy Technology Data Exchange (ETDEWEB)

Rudolph, Dirk [Lund University, Sweden; Forsberg, U. [Lund University, Sweden; Golubev, P. [Lund University, Sweden; Sarmiento, L. G. [Lund University, Sweden; Yakushev, A. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Andersson, L.-L. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Di Nitto, A. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Duehllmann, Ch. E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Gates, J. M. [Lawrence Berkeley National Laboratory (LBNL); Gregorich, K. E. [Lawrence Berkeley National Laboratory (LBNL); Gross, Carl J [ORNL; Hessberger, F. P. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Herzberg, R.-D [University of Liverpool; Khuyagbaatar, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Kratz, J. V. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Rykaczewski, Krzysztof Piotr [ORNL; Schaedel, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Aberg, S. [Lund University, Sweden; Ackermann, D. [GSI-Hemholtzzentrum fur Schwerionenforschung, Darmstadt, Germany; Block, M. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Brand, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Carlsson, B. G. [Lund University, Sweden; Cox, D. [University of Liverpool; Derkx, X. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Eberhardt, K. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Even, J. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Fahlander, C. [Lund University, Sweden; Gerl, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Jaeger, E. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kindler, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Krier, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kojouharov, I. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Kurz, N. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Lommel, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Mistry, A. [University of Liverpool; Mokry, C. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Nitsche, H. [Lawrence Berkeley National Laboratory (LBNL); Omtvedt, J. P. [Paul Scherrer Institut, Villigen, Switzerland; Papadakis, P. [University of Liverpool; Ragnarsson, I. [Lund University, Sweden; Runke, J. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schaffner, H. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Schausten, B. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Thoerle-Pospiech, P. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Torres, T. [Gesellschaft fur Schwerionenforschung (GSI), Germany; Traut, T. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Trautmann, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany; Tuerler, A. [Paul Scherrer Institut, Villigen, Switzerland; Ward, A. [University of Liverpool; Ward, D. E. [Lund University, Sweden; Wiehl, N. [Johannes Gutenberg-Universitaet Mainz, Mainz, Germany

2013-01-01

A high-resolution a, X-ray and -ray coincidence spectroscopy experiment was conducted at the GSI Helmholtzzentrum fu r Schwerionenforschung. Thirty correlated a-decay chains were detected following the fusion-evaporation reaction 48Ca + 243Am. The observations are consistent with previous assignments of similar decay chains to originate from element Z = 115. The data includes first candidates of fingerprinting the decay step Mt --> Bh with characteristic X rays. For the first time, precise spectroscopy allows the derivation of excitation schemes of isotopes along the decay chains starting with elements Z > 112. Comprehensive Monte-Carlo simulations accompany the data analysis. Nuclear structure models provide a first level interpretation.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

1992-01-01

We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Cesare Bonacina

2010-01-01

Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

Microwave-assisted transformations and synthesis of polymer nanocomposites and nanomaterials

Science.gov (United States)

The use of emerging MW-assisted chemistry techniques in conjunction with greener reaction media is dramatically reducing chemical waste and reaction times in several organic transformations and material synthesis. This account summarizes our own experience in developing MW-assist...

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

Science.gov (United States)

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Multi-template polymerase chain reaction

Directory of Open Access Journals (Sweden)

Elena Kalle

2014-12-01

Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

Science.gov (United States)

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

Science.gov (United States)

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

Energy Technology Data Exchange (ETDEWEB)

Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan

2016-11-15

Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

International Nuclear Information System (INIS)

Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan

2016-01-01

Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

Simultaneous detection of hepatitis B virus genotypes and mutations associated with resistance to lamivudine, adefovir, and telbivudine by the polymerase chain reaction-ligase detection reaction

Directory of Open Access Journals (Sweden)

Yong-Zhong Wang

Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

Science.gov (United States)

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

Science.gov (United States)

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Lai-yu Kwok

Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

Science.gov (United States)

Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

2018-01-10

Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

International Nuclear Information System (INIS)

Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

2007-01-01

Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

Science.gov (United States)

Po, F; Le Dimna, M; Le Potier, M F

2011-12-01

Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

Directory of Open Access Journals (Sweden)

Milić Nenad

2010-01-01

Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

Science.gov (United States)

Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

2018-03-15

To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (pClostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

Abazar Pournajaf

Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues

Directory of Open Access Journals (Sweden)

Mini P Singh

2017-01-01

Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.

Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

Directory of Open Access Journals (Sweden)

Jobin Thomas

2014-11-01

Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Live-Cell MicroRNA Imaging through MnO2 Nanosheet-Mediated DD-A Hybridization Chain Reaction.

Science.gov (United States)

Ou, Min; Huang, Jin; Yang, Xiaohai; He, Xiaoxiao; Quan, Ke; Yang, Yanjing; Xie, Nuli; Li, Jing; Wang, Kemin

2018-01-18

Innovative techniques to visualize native microRNAs (miRNAs) in live cells can dramatically impact current research on the roles of miRNA in biology and medicine. Here, we report a novel approach for live-cell miRNA imaging using a biodegradable MnO 2 nanosheet-mediated DD-A FRET hybridization chain reaction (HCR). The MnO 2 nanosheets can adsorb DNA hairpin probes and deliver them into live cells. After entering cells, the MnO 2 nanosheets are degraded by cellular GSH. Then, the target miR-21 triggers cascaded assembly of the liberated hairpin probes into long dsDNA polymers, which brings each two FAMs (donor) and one TAMRA (acceptor) into close proximity to generate significantly enhanced DD-A FRET signals, which was discovered and proven by our previous report. We think the developed approach can serve as an excellent intracellular miRNAs detection tool, which promises the potential for biological and disease studies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

International Nuclear Information System (INIS)

Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.

2014-01-01

Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

DEFF Research Database (Denmark)

Guil-Luna, S.; Stenvang, Jan; Brünner, Nils

2014-01-01

and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

Science.gov (United States)

Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

2016-11-01

Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

Selected spectroscopic results on element 115 decay chains

International Nuclear Information System (INIS)

Rudolph, D.; Forsberg, U.; Golubev, P.; Sarmiento, L.G.; Yakushev, A.; Andersson, L.L.; Di Nitto, A.; Duellmann, Ch.E.; Gates, J.M.; Gregorich, K.E.

2015-01-01

Thirty correlated α-decay chains were observed in an experiment studying the fusion-evaporation reaction 48 Ca + 243 Am at the GSI Helmholtzzentrum fuer Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision. (author)

Reaction of Hydrogen Sulfide with Oxygen in the Presence ofSulfite

Energy Technology Data Exchange (ETDEWEB)

Weres, Oleh; Tsao, Leon

1983-01-01

Commonly, abatement of hydrogen sulfide emissions from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One Mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. The authors studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDT are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use.

Reaction of hydrogen sulfide with oxygen in the presence of sulfite

Energy Technology Data Exchange (ETDEWEB)

Weres, O.; Tsao, L.

1983-01-14

Commonly, abatement of hydrogen sulfide emission from a geothermal powerplant requires that hydrogen sulfide dissolved in the cooling water be eliminated by chemical reaction. Oxidation by atmospheric oxygen is the preferred reaction, but requires a suitable catalyst. Nickel is the most potent and thereby cheapest catalyst for this purpose. One mg/L nickel in the cooling water would allow 99% removal of hydrogen sulfide to be attained. A major drawback of catalytic air oxidation is that colloidal sulfur is a major reaction product; this causes rapid sludge accumulation and deposition of sulfur scale. We studied the kinetics and product distribution of the reaction of hydrogen sulfide with oxygen, catalyzed by nickel. Adding sodium sulfite to the solution completely suppresses formation of colloidal sulfur by converting it to thiosulfate. The oxidation reaction is an autocatalytic, free radical chain reaction. A rate expression for this reaction and a detailed reaction mechanism were developed. Nickel catalyzes the chain initiation step, and polysulfidoradical ions propagate the chains. Several complexes of iron and cobalt were also studied. Iron citrate and iron N-hydroxyEDTA are the most effective iron based catalysts. Uncomplexed cobalt is as effective as nickel, but forms a precipitate of cobalt oxysulfide and is too expensive for practical use. 33 figures, 9 tables.

RADIOCHEMICAL YIELDS OF GRAFT POLYMERIZATION REACTIONS OF CELLULOSE

Energy Technology Data Exchange (ETDEWEB)

Arthur, Jr, J C; Blouin, F A

1963-12-15

The preparation of radioinduced graft polymers of cotton cellulose, while retaining the fibrous nature and high molecular weight of the cellulose, depended primarily on the radiochemical yields of cellulose reactions and of graft polymerization reactions. Yields of the initial major molecular changes in cellulosic polymer indicated that, in the case of scission of the molecule and carboxyl group formation, chain reactions were not initiated by radiation; however, in the case of carbonyl group formation chain reactions were initiated but quickly terminated. Generally, experimental procedures, used in graft polymerization reactions, were: simultaneous irradiation reactions, that is, application of monomers or solutions of monomers to cellulose or chemically modified celluloses, then irradiation; and post-irradiation reactions, that is, irradiation of cellulose or chemically modified celluloses, then after removal from the field of radiation, contacting the irradiated cellulose with monomer. Some of the most important factors influencing the radiochemical yields of graft polymerization reactions, of styrene and acrylonitrile onto cellulose were: concentration of monomer in treating solution; solvent; ratio of monomer solution to cellulose; prior chemical modification of cellulose; and absence of oxygen, particularly in post-irradiation reactions. Experimental data are presented, and the direct and indirect effects of Co/sup 60/ gamma radiation on these reactions are discussed. (auth)

Machine assisted reaction optimization: A self-optimizing reactor system for continuous-flow photochemical reactions

KAUST Repository

Poscharny, K.; Fabry, D.C.; Heddrich, S.; Sugiono, E.; Liauw, M.A.; Rueping, Magnus

2018-01-01

A methodology for the synthesis of oxetanes from benzophenone and furan derivatives is presented. UV-light irradiation in batch and flow systems allowed the [2 + 2] cycloaddition reaction to proceed and a broad range of oxetanes could be synthesized in manual and automated fashion. The identification of high-yielding reaction parameters was achieved through a new self-optimizing photoreactor system.

Machine assisted reaction optimization: A self-optimizing reactor system for continuous-flow photochemical reactions

KAUST Repository

Poscharny, K.

2018-04-07

A methodology for the synthesis of oxetanes from benzophenone and furan derivatives is presented. UV-light irradiation in batch and flow systems allowed the [2 + 2] cycloaddition reaction to proceed and a broad range of oxetanes could be synthesized in manual and automated fashion. The identification of high-yielding reaction parameters was achieved through a new self-optimizing photoreactor system.

Biodiesel production from triolein and short chain alcohols through biocatalysis.

Science.gov (United States)

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

Science.gov (United States)

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Natália Malaguti

2015-01-01

Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

Science.gov (United States)

Madadelahi, M.; Kalan, K.; Shamloo, A.

2018-05-01

Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

Chemical reactions directed Peptide self-assembly.

Science.gov (United States)

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

Directory of Open Access Journals (Sweden)

Tiana Milanda

2014-12-01

Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

Science.gov (United States)

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins

International Nuclear Information System (INIS)

Garrison, W.M.

1985-01-01

The purpose of this review is to bring together and to correlate the wide variety of experimental studies that provide information on the reaction products and reaction mechanisms involved in the radiolysis of peptides, polypeptides and proteins (including chromosomal proteins) in both aqueous and solid-state systems. The comparative radiation chemistry of these systems is developed in terms of specific reactions of the peptide main-chain and the aliphatic, aromatic-unsaturated and sulfur-containing side-chains. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis and ESR spectroscopy is included. 147 refs

Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins

Energy Technology Data Exchange (ETDEWEB)

Garrison, W.M.

1985-01-01

The purpose of this review is to bring together and to correlate the wide variety of experimental studies that provide information on the reaction products and reaction mechanisms involved in the radiolysis of peptides, polypeptides and proteins (including chromosomal proteins) in both aqueous and solid-state systems. The comparative radiation chemistry of these systems is developed in terms of specific reactions of the peptide main-chain and the aliphatic, aromatic-unsaturated and sulfur-containing side-chains. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis and ESR spectroscopy is included. 147 refs.

On the mechanism of photocatalytic reactions with eosin Y

Directory of Open Access Journals (Sweden)

Michal Majek

2014-04-01

Full Text Available A combined spectroscopic, synthetic, and apparative study has allowed a more detailed mechanistic rationalization of several recently reported eosin Y-catalyzed aromatic substitutions at arenediazonium salts. The operation of rapid acid–base equilibria, direct photolysis pathways, and radical chain reactions has been discussed on the basis of pH, solvent polarity, lamp type, absorption properties, and quantum yields. Determination of the latter proved to be an especially valuable tool for the distinction between radical chain and photocatalytic reactions.

Process characteristics for microwave assisted hydrothermal carbonization of cellulose.

Science.gov (United States)

Zhang, Junting; An, Ying; Borrion, Aiduan; He, Wenzhi; Wang, Nan; Chen, Yirong; Li, Guangming

2018-07-01

The process characteristics of microwave assisted hydrothermal carbonization of cellulose was investigated and a first order kinetics model based on carbon concentration was developed. Chemical properties analysis showed that comparing to conventional hydrothermal carbonization, hydrochar with comparable energy properties can be obtained with 5-10 times decrease in reaction time with assistance of microwave heating. Results from kinetics study was in great agreement with experimental analysis, that they both illustrated the predominant mechanism of the reaction depend on variations in the reaction rates of two co-existent pathways. Particularly, the pyrolysis-like intramolecular dehydration reaction was proved to be the predominant mechanism for hydrochar generation under high temperatures. Finally, the enhancement effects of microwave heating were reflected under both soluble and solid pathways in this research, suggesting microwave-assisted hydrothermal carbonization as a more attracting method for carbon-enriched hydrochar recovery. Copyright © 2018 Elsevier Ltd. All rights reserved.

Synthesis and characterization of hafnium carbide microcrystal chains with a carbon-rich shell via CVD

International Nuclear Information System (INIS)

Tian, Song; Li, Hejun; Zhang, Yulei; Liu, Sen; Fu, Yangxi; Li, Yixian; Qiang, Xinfa

2013-01-01

Graphical abstract: Novel HfC microcrystal chains have been synthesized via a catalyst-assisted chemical vapor deposition process. SEM results show the chains have a periodically changing diameter and a nanoscale sharpening tip. Analysis of TEM/SAED/EELS/EDX data shows the single-crystal chains grow along a [0 0 1] direction and consist of a HfC core and a thin carbon-rich shell with embedded HfC nanocrystallites surrounding the core. This work achieves the controllable preparation of nanoscale HfC sharpening tips for application as a point electron emission source and facilitates the application of HfC ultrafast laser-triggered tips in attosecond science. Highlights: •HfC microcrystal chains were synthesized by a catalyst-assisted CVD. •The chains grow along a [0 0 1] direction and have a periodically changing diameter. •Single-crystal HfC core is sheathed by a thin carbon-rich shell. •A growth mechanism model is proposed to explain the growth of microcrystal chians. •This work achieves the controllable preparation of nanoscale HfC sharpening tips. -- Abstract: Novel hafnium carbide (HfC) microcrystal chains, with a periodically changing diameter and a nanoscale sharpening tip at the chain end, have been synthesized via a catalyst-assisted chemical vapor deposition (CVD) process. The as-synthesized chains with many octahedral microcrystals have diameters of between several hundreds of nm and 6 μm and lengths of ∼500 μm. TEM diffraction studies show that the chains are single-crystalline HfC and preferentially grow along a [0 0 1] crystal orientation. TEM/EELS/EDX analysis proves the chains are composed of a HfC core and a thin (several tens of nm to 100 nm) carbon-rich shell with the embedded HfC nanocrystallites (typically below 10 nm) surrounding the core. The growth mechanism model for the chains based on the vapor–liquid–solid process, the vapor–solid process, and the HfC crystal growth characteristics is discussed

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

Science.gov (United States)

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Personal Information Security Assistant

NARCIS (Netherlands)

Kegel, Roeland Hendrik,Pieter

The human element is often found to be the weakest link in the information security chain. The Personal Information Security Assistant project aims to address this by improving the privacy and security awareness of end-users and by aligning the user's personal IT environment to the user's security

Greening Supply Chains: Impact on Cost and Design

NARCIS (Netherlands)

I. Mallidis (Ioannis); D. Vlachos (Dimitrios); R. Dekker (Rommert)

2010-01-01

textabstractThe consideration of environmental issues has emerged as a topic of critical importance for today’s globalized supply chains. The purpose of this paper is to develop a strategic-tactical decision-support methodology to assist managers in evaluating the impact of environmental issues,

Ultrasound-assisted self-metathesis reactions of monounsaturated fatty acids

Directory of Open Access Journals (Sweden)

Elmkaddem Mohammed Kamal

2016-09-01

Full Text Available An efficient protocol for the self-metathesis of oleic acid, using ruthenium catalysts is described. The self-metathesis reaction under ultrasonic activation allows the conversion of monoenic fatty acids such as oleic acid, elaidic acid and erucic acid into diacids and olefins with very short reaction times in the presence of Grubbs ruthenium catalysts. These yields and selectivity towards the desired products are influenced by the nature of solvents. This study demonstrated that metathesis reaction carried out in DCM or 1-butanol showed promising results, since it produced a variety of products, like n-alkenes and diacids with good yields (45–75% and high selectivities (75–95%.

The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia